Rozměr: px
Začít zobrazení ze stránky:



1 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství - genetika člověka - řídí se obecně platnými genetickými zákony - metody - dědičnost nelze zkoumat pokusným křížením (hybridizací) - hlavně vyšetřovací / pozorovací metody - sledování fenotypu - vyšetřování karyotypu - prenatální diagnostika - výzkum - genealogický (výzkum rodokmenů) - populační (vzorek populace) - gemelilogický (zkoumá dědičnost jednovaječných dvojčat) - tyto metody lze doplnit vyřešením mikroskopického obrazu chromozomů (zkoumáním karyotypu) - 23 x 2 chromozomů - více než lokusů - dědičné dispozice k chorobám - choroby podmíněné genotypem - malý vliv prostředí (někteří činitelé prostředí se však mohou podílet na rozvoji choroby (patogeneze)) - monogenní dědičnost projevení choroby - dědičné choroby - způsobené odchylkami genotypu - vyvolány mutacemi - choroby podmíněné genotypem a prostředím (dispozice) - k jejímu vzniku je třeba působení (expozice) určitého činitele prostředí - specifický (např. určitá složka potravy, látka v prostředí, sluneční záření apod.) - chorobu vyvolá spolupůsobení obou složek - polygenní dědičnost dispozice k chorobě - dispoziční choroby - alergie, neurózy, vysoký krevní tlak, - dědičné vývojové vady - během nitroděložního vývoje - zpravidla postižení jedince na celý život - řadu z nich dovede odstranit moderní plastická chirurgie (např. rozštěp patra) - eufenický zásah - upraví fenotyp - neodstraní mutací poškozený genotyp zvýšení životaschopnosti postižených jedinců zvýšení četnosti přenosu nežádoucí alely do dalších generací -autozomální

2 - galaktosemie- neschopnost vytvořit enzym pro rozklad galaktózy v mléce - hromadí se v orgánech poškození - genetická informace jediné alely se promítá do celé řady chorobných znaků (pleiotropní účinek) - vzniku lze předejít absolutním vyloučením mléka a mléčných výrobků ze stravy - fenylketonurie - chybí enzym pro přeměnu fenylalaninu v tyrosin poškození mozku (děděno recesivně) - coeliakie - nesnášenlivost lepku (pšeničná bílkovina) - albinismus - chybí enzym pro tvorbu barviva (pigmentu) (recesivně) - chudokrevnost - málo hemoglobinu (recesivně) - srůsty prstů - rozštěpy patra a rtu - heterozomální - hemofilie - nesráží se krev, mutace na chrom. X (recesivně) - daltonismus - nerozeznání zelené a červené, mutace na chromozom X - nedědičné vývojové vady - heterozomální - Klinefelterův syndrom - sterilní, infantilní muž s intersexuálními znaky - Turnerův syndrom - sterilní infantilní žena - důsledek chybného oddělování chromozomů (nondisjunkce) při meióze - nadžena - XXX - možnost otěhotnění, menstruace - debilita - nadmuž - XYY - agresivita, asociálnost, nízká inteligence - autozomální - Downův syndrom - trisomie 21. chromozomového páru - jedinec - opožděný duševní vývoj - snížená inteligence - některé charakteristické tělesné znaky - Pataův syndrom - trisomie 13. chromozomového páru - hl. - pomalý psychický vývoj, rozštěp patra - Edwardsův syndrom- trisomie 18. chromozomového páru

3 - hl. - zpomalený psychický vývoj - syndrom kočičího křiku - monosomie 5. chromozomového páru - delece raménka homologního chromozomu - genetické poradenství - rozpoznání dědičné choroby nebo dispozice - léčení chorob - výskyt v rodině - rodiče se nemohou nutit (rozhodnutí je na nich), proto se pouze doporučují případné možnosti (nemít děti, interrupce, sterilizace, apod.) - lékař - nutnost seznámení se s prostředím v rodině - genealogický výzkum - vyšetření karyotypu - míra narušení plodu ( interrupce) - odběr plodové vody - odběr krve - cíle - genetická prevence - předcházet dědičnému zatížení populace - eugenika B. Mutace a její typy, modifikace, příklad z genetiky člověka - genetická proměnlivost - počet alel se nemění, vytvářejí se jejich nové kombinace - faktory podmiňující proměnlivost genotypů - segregace - rekombinace - spojování párových alel při oplození - mutace - mutace - procesy při kterých se mění počet alel, nebo vznikají alely nové - podle rozsahu zásahu - genové - zasahují a mění jednotlivé geny, jejich podstata je molekulární - mohou být způsobeny - ztrátou jednoho páru nukleotidů (B) - zařazením nadpočetného páru nukleotidů (C) - záměnou fyziologického nukleotidu nefyziologickým (D) změna kodonu chyba v proteosyntéze

4 - nová alela je recesivní vůči standartní asi v poměru 1:100 - dominantní mutace jsou vzácné a dovolují organismu vykonávat nové funkce - chromozomové - mění strukturu chromozomu - předpoklad - chromozom se zlomí na jednom, nebo více místech - deficience (ztráta koncové části chromozomu) - delece (ztráta vnitřní části chromozomu) - duplikace (zdvojení části chromozomu) - inverze (převrácení úseku chromozomu) - translokace (přemístění částí chromozomu na chromozom jiný) - fragmentace (rozpad chromozomu na více částí) - mohou být (narozdíl od genových) překážkou normálního průběhu meiozy a gamety jimi postižené jsou sterilní nebo vytvářejí neživotaschopné zygoty (u člověka se odhaduje asi 6% takto postižených gamet) - genomové - mění počet chromozomů v buňce - polyplodie - znásobení jednoduché sady chromozomů - 3n - triploidie - 4n - tetraploidie - dosti častá (u rostlin) - protože polyploidní jádro obsahuje celistvé násobky haploidní sady chromozomů, může být polyplodie přenášena i do dalších generací - aneuploidie - zvýšen nebo snížen počet určitých chromozomů - 2n+1 - trisomie - 2n 1 - monosomie - vždy příčinou vážných poruch ve zdraví, vede k poruchám meiozy a tím i k poruchám plodnosti - podle způsobu vzniku - spontánní - vznik nahodile z příčin jež nelze s určitostí vysvětlit - velmi nízký výskyt (četnost těchto mutací se odhaduje na 10 5 až pro jeden gen za jednu generaci) - indukované - vyvolány působením mutagenních činitelů

5 - mutageny - fyzikální -všechny typy ionizujících záření (γ, UV, rentgenové)- chemické = chemomutageny - známy již tisíce látek jak organického, tak anoganického původu (aromatické chlorované deriváty, alkaloidy, kationty těžkých kovů, peroxidy, ) - chemické látky by měly být před hromadnou výrobou biologicky testovány - jejich koncentraci zvyšují průmyslové exhaláty, výfukové plyny, odpadní produkty atomových elektráren, - závěr - většina mutací své nositele poškozuje, část mutací je v daném prostředí bez významu - nepatrná část mutací je pro nositele výhodná v daném prostředí - zdroj dědičné proměnlivosti - jeden ze základních předpokladů evoluce

Mutační změny genotypu

Mutační změny genotypu Mutační změny genotypu - změny genotypu: segregace, kombinace + MUTACE - náhodné změny Mutace - genové - spontánní - chromozómové - indukované (uměle vyvolané) - genomové A) Genové mutace - změna (ztráta)



http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace

Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace Mutace Klasifikace mutací Z hlediska lokalizace mutací v genotypu Genové mutace Chromozomální mutace Genomové mutace Vznik genových mutací Tranzice pyrim. za pyrim. C na T T na C purin za purin A na G



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


Vrozené vývojové vady. David Hepnar

Vrozené vývojové vady. David Hepnar Vrozené vývojové vady David Hepnar Vrozené vývojové vady (VVV) jsou defekty orgánů, ke kterým došlo během prenatálního vývoje plodu a jsou přítomny při narození jedince. Postihují v různém rozsahu okolo





Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.cz Mutace Mutace - náhodná změna v genomu organismu - spontánní



http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


Dědičnost kvantitativních znaků. Proměnlivost a dědivost. Mutace

Dědičnost kvantitativních znaků. Proměnlivost a dědivost. Mutace Přehled GMH Seminář z biologie Genetika 3 Dědičnost kvantitativních znaků Kvantitativní znaky mají kontinuální proměnlivost a jsou polygenní. Za velikost znaku je většinou zodpovědný systém několika genů


VY_32_INOVACE_11.18 1/6 Genetika Genetika

VY_32_INOVACE_11.18 1/6 Genetika Genetika 1/6 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


GENETIKA ČLOVĚKA. Monogenní znaky člověka krevní skupiny autozomální dominance, kodominance levorukost autozomální, recesivní

GENETIKA ČLOVĚKA. Monogenní znaky člověka krevní skupiny autozomální dominance, kodominance levorukost autozomální, recesivní GENETIKA ČLOVĚKA Pro dědičnost člověka platí stejné zákonitosti jako pro ostatní organizmy, odlišné jsou jen metody studia: - nelze provádět experimenty - nelze provádět selekci - dlouhá generační doba


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


MUTACE mutageny: typy mutací:

MUTACE mutageny: typy mutací: MUTACE charakteristika: náhodné změny v genotypu organismu oproti normálu jsou poměrně vzácné z hlediska klinické genetiky, jsou to právě mutace, které způsobují genetické choroby nebo nádorové bujení


Zvláš. áštnosti studia genetiky člověka: nelze z etických důvodd experimenty a selekci. ství potomků. ším m prostřed (sociáln ůže sledovat maximáln

Zvláš. áštnosti studia genetiky člověka: nelze z etických důvodd experimenty a selekci. ství potomků. ším m prostřed (sociáln ůže sledovat maximáln Genetika člověka Zvláš áštnosti studia genetiky člověka: Na člověku nelze z etických důvodd vodů provádět experimenty a selekci. Člověk k mám většinou za život velmi malé množstv ství potomků. Fenotyp


Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár

Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár schopen spontánní koncepce, ale žena není schopna donosit


Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením


Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti





Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém


Typy chromosomů. A telocentrický B akrocentrický C submetacentrický D metacentrický. Člověk nemá typ telocentrický!

Typy chromosomů. A telocentrický B akrocentrický C submetacentrický D metacentrický. Člověk nemá typ telocentrický! Karyologie Typy chromosomů A telocentrický B akrocentrický C submetacentrický D metacentrický Člověk nemá typ telocentrický! Chromosom chromosom telomera jádro centomera telomera buňka histony dvoušroubovice


genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace



CZ.1.07/1.5.00/ Projekt: Příjemce: Digitální učební materiály ve škole, registrační číslo projektu CZ.1.07/1.5.00/34.0527 Střední zdravotnická škola a Vyšší odborná škola zdravotnická, Husova 3, 371 60 České Budějovice


Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA Cytogenetika telomera chromosom jádro centomera telomera buňka histony páry bazí dvoušroubovice DNA Typy chromosomů Karyotyp člověka 46 chromosomů 22 párů autosomů (1-22 od největšího po nejmenší) 1 pár


Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k


Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním


Prenatální diagnostika v roce 2008 předběžné výsledky

Prenatální diagnostika v roce 2008 předběžné výsledky Prenatální diagnostika v roce 28 předběžné výsledky V. Gregor 1, A. Šípek 1, 2 1 Oddělení lékařské genetiky, Fakultní Thomayerova nemocnice, Praha 2 3.Lékařská fakulta Univerzity Karlovy, Praha Pracovní



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


Chromosomové změny. Informace pro pacienty a rodiny

Chromosomové změny. Informace pro pacienty a rodiny 12 Databáze pracovišť poskytujících molekulárně genetická vyšetření velmi častých genetických onemocnění v České republice (CZDDNAL) www.uhkt.cz/nrl/db Chromosomové změny Unique - Britská svépomocná skupina


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


Molekulární genetika: Základní stavební jednotkou nukleových kyselin jsou nukleotidy, které jsou tvořeny

Molekulární genetika: Základní stavební jednotkou nukleových kyselin jsou nukleotidy, které jsou tvořeny Otázka: Molekulární genetika, genetika buněk Předmět: Biologie Přidal(a): jeti52 Molekulární genetika: Do roku 1953 nebylo přesně známa podstata genetické informace, genů, dědičnosti,.. V roce 1953 Watson


-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě Otázka: Genetika I Předmět: Biologie Přidal(a): Paris -věda, která se zabývá dědičností a proměnlivostí -zakladatelem je Johan Gregor Mendel (1822 1884), který se narodil v Hynčicích na Moravě 1. MOLEKULÁRNÍ


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI


Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.


Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho


Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto


Příčiny a projevy abnormálního vývoje

Příčiny a projevy abnormálního vývoje Příčiny a projevy abnormálního vývoje Ústav histologie a embryologie 1. LF UK v Praze MUDr. Filip Wagner Předmět: Obecná histologie a obecná embryologie (B02241) 1 Vrozené vývojové vady vývojové poruchy


Předmět: Biologie Školní rok: 2009/10 Třída: 1.L. Referát na téma: Dědičnost Genetika ( DNA)

Předmět: Biologie Školní rok: 2009/10 Třída: 1.L. Referát na téma: Dědičnost Genetika ( DNA) Object 12 34 Vyučující: Mgr.Ludvík Kašpar Jméno:Chromec Marek Datum:13.12.2009 Referát na téma: Dědičnost Genetika ( DNA) Něco z historie : Alfons Bertillon, velký francouzský detektiv vyšetřil v roce



CHROMOZOMÁLNÍ ABERACE CHROMOZOMÁLNÍ ABERACE Chromosomální aberace numerické (změny v počtu chromosomů) polyploidie - změna v počtu celých chromosomových sad triploidie tetraploidie aneuploidie - změna v počtu jednotlivých chromosomů


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):


Genetika populací a. Gentika populací. Autogamická populace

Genetika populací a. Gentika populací. Autogamická populace Genetika populací a člověka Mgr. Aleš RUDA Gentika populací Populace = všichni jedinci téhož druhu, kteří obývají vdaném čase stejné území GENOFOND soubor alel v gametách všech členů populace GENETIKA


- karyotyp: 47, XX, +18 nebo 47, XY, +18 = trizomie chromozomu 18 (po Downově syndromu druhou nejčatější trizomii)

- karyotyp: 47, XX, +18 nebo 47, XY, +18 = trizomie chromozomu 18 (po Downově syndromu druhou nejčatější trizomii) Edwardsův syndrom Edwardsův syndrom - karyotyp: 47, XX, +18 nebo 47, XY, +18 = trizomie chromozomu 18 (po Downově syndromu druhou nejčatější trizomii) - Prevalence v populaci: u narozených dětí cca 1:6500-1:8000,


- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci


Význam genetického vyšetření u pacientů s mentální retardací

Význam genetického vyšetření u pacientů s mentální retardací Význam genetického vyšetření u pacientů s mentální retardací Šantavá, A., Hyjánek, J., Čapková, P., Adamová, K., Vrtěl, R. Ústav lékařské genetiky a fetální medicíny FN a LF UP Olomouc Mentální retardace



EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence


Doporučený postup č. 3. Genetické laboratorní vyšetření v reprodukční genetice

Doporučený postup č. 3. Genetické laboratorní vyšetření v reprodukční genetice Účinnost k 1. 12. 2014 Doporučený postup č. 3 Genetické laboratorní vyšetření v reprodukční genetice Stav změn: 1. vydání Základním předpokladem genetického laboratorního vyšetření v reprodukční genetice


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;



TERATOGENEZA ONTOGENEZA TERATOGENEZA ONTOGENEZA Vrozené vývojové vady (VVV) Jsou defekty orgánů, ke kterým došlo během prenatálního vývoje plodu a jsou přítomny při narození jedince. Postihují v různém rozsahu okolo 3-5 % novorozenců.


Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi


Genetické příčiny sterility a infertility v ambulantní gynekologické praxi. Šantavý J., Čapková P., Šantavá A., Kolářová J., Adamová K., Vrtěl R.

Genetické příčiny sterility a infertility v ambulantní gynekologické praxi. Šantavý J., Čapková P., Šantavá A., Kolářová J., Adamová K., Vrtěl R. Genetické příčiny sterility a infertility v ambulantní gynekologické praxi Šantavý J., Čapková P., Šantavá A., Kolářová J., Adamová K., Vrtěl R. Infertilita Definice: Neschopnost otěhotnět v průběhu jednoho


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA


GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem



BUNĚČNÁ TRANSFORMACE A NÁDOROVÉ BUŇKY BUNĚČNÁ TRANSFORMACE A NÁDOROVÉ BUŇKY 1 VÝZNAM BUNĚČNÉ TRANSFORMACE V MEDICÍNĚ Příklad: Buněčná transformace: postupná kumulace genetických změn Nádorové onemocnění: kolorektální karcinom 2 3 BUNĚČNÁ TRANSFORMACE


GENETIKA. zkoumá dědičnost a proměnlivost organismů

GENETIKA. zkoumá dědičnost a proměnlivost organismů GENETIKA zkoumá dědičnost a proměnlivost organismů Dědičnost: schopnost organismů uchovávat informace o své struktuře a funkčních schopnostech a předávat je svým potomkům Proměnlivost (variabilita) je


Downův syndrom. Renata Gaillyová OLG FN Brno

Downův syndrom. Renata Gaillyová OLG FN Brno Downův syndrom Renata Gaillyová OLG FN Brno Zastoupení genetických chorob a vývojových vad podle etiologie 0,6 %-0,7% populace má vrozenou chromosomovou aberaci incidence vážných monogenně podmíněných


Nemoc a její příčiny

Nemoc a její příčiny Nemoc a její příčiny Definice zdraví a nemoc zdraví stav úplné tělesné, duševní a sociální pohody s harmonickým průběhem vitálních procesů nemoc porucha zdraví poškození určitého počtu bb. (bb. reagují



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová



CYTOGENETIKA MUTACE A JEJICH KLINICKÉ DOPADY CYTOGENETIKA MUTACE A JEJICH KLINICKÉ DOPADY CHROMOZOMY A PORUCHY 100% všech známých znaků (chorob) vztah ke genetické výbavě jedince Chromozomální vady - v současné době přes 200 známých syndromů Frekvence


Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol 20.5.2015 Popis klinických příznaků, možnosti léčby Muži: střední až těžká mentální


Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Chromozomová teorie dědičnosti KBI / GENE Mgr. Zbyněk Houdek Proč octomilka a T.H. Morgan? Drosophila melanogaster ideální objekt pro genetický výzkum : Rychlý reprodukční cyklus a snadný chov v laboratorních


Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010


Genetika člověka. Základním cílem genetiky člověka je studium genetické variability, kterou lze rozdělit na patologickou a nepatologickou.

Genetika člověka. Základním cílem genetiky člověka je studium genetické variability, kterou lze rozdělit na patologickou a nepatologickou. Genetika člověka Jednou z možností členění genetiky je její třídění podle druhu studovaných organismů (genetika virů, bakterií, rostlin, zvířat, člověka atd.). Genetiku člověka jsme se rozhodli zařadit


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto


Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické


Pohled genetika na racionální vyšetřování v preventivní kardiologii

Pohled genetika na racionální vyšetřování v preventivní kardiologii Pohled genetika na racionální vyšetřování v preventivní kardiologii Tomáš Freiberger Genetická laboratoř, Centrum kardiovaskulární a transplantační chirurgie Brno, ČR Osnova Genetické faktory vzniku KV


Neinvazivní testování 2 roky v klinické praxi. Jaroslav Loucký, Darina Kostelníková, Michal Zemánek, Eva Loucká, Milan Kovalčík

Neinvazivní testování 2 roky v klinické praxi. Jaroslav Loucký, Darina Kostelníková, Michal Zemánek, Eva Loucká, Milan Kovalčík Neinvazivní testování 2 roky v klinické praxi. Jaroslav Loucký, Darina Kostelníková, Michal Zemánek, Eva Loucká, Milan Kovalčík Odkud pocházejí zdroje informací využívané ve screeningu? U těhotenství s


Chromozomální aberace nalezené u párů s poruchou reprodukce v letech

Chromozomální aberace nalezené u párů s poruchou reprodukce v letech Chromozomální aberace nalezené u párů s poruchou reprodukce v letech 2000-2005 Jak přistupovat k nálezům minoritních gonozomálních mozaik? Šantavá A., Adamová, K.,Čapková P., Hyjánek J. Ústav lékařské


Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika


Karyologie. Typy chromosomů. Chromosom. Karyotyp člověka. Chromosomy. Koncové části lineárních chromosomů - telomery

Karyologie. Typy chromosomů. Chromosom. Karyotyp člověka. Chromosomy. Koncové části lineárních chromosomů - telomery Karyologie Typy chromosomů A telocentrický B akrocentrický C submetacentrický D metacentrický Člověk nemá typ telocentrický! Chromosom Koncové části lineárních chromosomů - telomery telomera chromosom


Rozštěpy rtu a patra Vrozená vývojová vada, kterou dnes již nemusíte (na první pohled) vidět Pohled genetika. Renata Gaillyová, OLG FN Brno

Rozštěpy rtu a patra Vrozená vývojová vada, kterou dnes již nemusíte (na první pohled) vidět Pohled genetika. Renata Gaillyová, OLG FN Brno Rozštěpy rtu a patra Vrozená vývojová vada, kterou dnes již nemusíte (na první pohled) vidět Pohled genetika Renata Gaillyová, OLG FN Brno Lékařská genetika Interdisciplinární spolupráce Preventivní medicína



ší šířen CYTOGENETIKA CYTOGENETIKA V této kapitole se budeme zabývat genetickým álem lokalizovaným v buněčném jádře v útvarech zvaných chromosomy. Morfologie chromosomů se dynamicky mění během buněčného děl; v interfázi jsou


Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje



CYTOGENETIKA MUTACE A JEJICH KLINICKÉ DOPADY CYTOGENETIKA MUTACE A JEJICH KLINICKÉ DOPADY Emil Rudolf rudolf@lfhk.cuni.cz 1879 Arnold publikuje zprávu o lidských chromozomech v mitóze 1956 Tjio a Levan určují počet lidských chromosomů (46) a vyvíjejí


Proč jsme podobní rodičům? A jak k tomu vlastně může dojít?

Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Základy genetiky Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Johann Gregor Mendel (1822 1884) O jeho životě byl mnich, zakladatel genetiky a opat augustiniánského kláštera v Brně studium


1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická


GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných
