Alelov specifická PCR

Rozměr: px
Začít zobrazení ze stránky:

Download "Alelov specifická PCR"

Transkript

1 Pímá analýza muací jedné známé muace (SNP polymorfismy) MOLEKULÁRNÍ DIAGNOSTIKA PÍMOU ANALÝZOU Marin Beránek Pednáka pro magisry a UK PCR RLP viz pedelý seminá ARMS (ASA) Real-ime PCR viz aké pednáka dr Libry Hybridizace na pevném podklad druhá polovina pednáky Primer exension Sekvenování zde vinou konfirmaní meoda Základní sloení PCR smsi Alelov specifická PCR DNA polymeráza marice /emplá/ - ssdna primery - oligonukleoidy pufr opimalizace chem. podmínek reakce hoenaé iony pro innos polymerázy dntps datp, dgtp, dctp, dttp (2 -deoxyrifosfá) adiiva efekivia PCR voda negaivní konrola 1. zkum. 2. zkum. 5 normální genoyp WT 5 bodová muace Urí známé ypy bodových muací Není nezbyná píomnos palindromu primery pln komplemenární k populaní sekvenci genu amplifikují wild-ype alelu primery s mismachy umoují amplifikaci muanních alel V obou zkumavkách je sejná délka PCR produk M Rizikové fakory pro vznik a rozvoj rombofilních sav Vyeované rombofilní muace Defici AT Defici proeinu C Defici proeinu S V Leiden G20210 II Dysfibrinogenemie Defici plasminogenu Vyí Hcy Vk + rod. anamnéza Imobilizace Chirurgické operace Malignia Hormon. anikoncepce Obezia Anifosfolipidový sy Gen Muac e Dsledek Ddinos Projev V G1691A Arg 506 Gln AD APC resisence Leiden II G20210A zmna UTR AD prorombin MTHR C677T Ala 222 Val AR homocysein Geneický podklad + vlivy prosedí rombus 1

2 Sruná charakerisika PCR-RLP a ASA Pímá analýza (poeba DNA paciena, nikoliv rodinných písluník a posieného) Sandardní PCR amplifikace Nuná elekroforéza Doba analýzy: 2-3 dny Náklady: K Poe pacien v sérii: 5-10 Vyeení známé muace hydrolyickou (= hydrolyzaní) sondou Lze PCR a deekci produk zauomaizova? K rozliení obou alel (w a M) hydrolyickými (Taqman) sondami se pouívá meoda alelické diskriminace jen1 hydrolyická sonda nasedající na dané vlákno kadá sonda 2 znaky (jen 1 z nich schopná fluorescence) 2 reakní smsi (jako ASA), v kadé 1 sonda komplemenární k w i mu. sekvence oba ypy sond pokrývají oblas muace (jako primery u ASA) snímání fluorescence pouze pi polymeraci (pi pení sond) rozliení alel vzájemnou diskriminací (sou o ezce) ve 2 zkumavkách (sejný fluorofor) nebo v 1 zk. (rozdílné fluorofory) w M nm nm Zái Quencher zháe (energie odchází formou epla) Pi TaqMAN deekci se rosoucí fluorescence snímá po elongaci ANNEALING 1-5 base ROCHE Vyeení známé muace párem hybridizaních sond 525 nm 640 (705) nm Donor záení Akcepor záení Dv RET sondy nasedající sn za sebou na vlákno Ob sondy jsou designované zpravidla pro w alelu Jen jedna z nich pokrývá míso muace Kadá sonda vlasní znaku (ob schopné fluorescence) Snímání fluorescence pouze pi annealingu Rozliení alel pomocí eploy ání hybridizaních sond 2

3 Sruná charakerisika real-ime PCR Poeba DNA paciena, nikoliv rodiny PCR amplifikace se sondami (i inerkalaními lákami) Bez elekroforézy Doba analýzy: 1 den Náklady: K Poe pacien v sérii: Izolace DNA PCR amplifikace Meoda primer exension Syneická reakce (asymerická amplifikace se znaenými ddntps) Muaci dopedu známe Separace produk na HPCE (kapilárním sekvenáoru) ddatp JOE (550 nm) ddctp AM (520 nm) ddgtp- TAMRA (585 nm) ddttp ROX (620 nm) A C G T Meoda primer exension Analýza omezeného pou známých bodových muací (jedna i nkolik) w/w ddt A ddt M/w ddt/c A ddt G ddc M/M ddc G ddc Trombofilní muace (V, II, MTHR) Hemochromaosa (HE) Defek v genu pro alfa-1-anirypsin (A1AT) Defek v genu pro apolipoproein B (apob) Genoypizace genu apoe armakogeneika (izoenzymy P450) enylkeonurie (PAH) Srpkoviá anémie (bea globin) Hemoglobinopaie (HbS, HbC,) Duchennova muskulární dysrofie One-ube muliplex PCR (píklad DMD) M 750 bp 426 bp - exon bp - exon bp - exon bp - exon bp - exon bp 300 bp 200 bp 100 bp 50 bp Velké delece podmiují pes 60% pípad DMD 3

4 Muliplex Ligaion-dependen Probe Amplificaion (MLPA) Muliplex Ligaion-dependen Probe Amplificaion (MLPA) Muliplex Ligaion-dependen Probe Amplificaion (MLPA) Hybridizace - Souhern bloing DNA fragmen se sekvencí genu Hybridizaní sonda pro gen se znakou nylon agarózový gel DNA fragmeny Do bloing 1. ixace vyeované DNA do membrány v ss form 2. Hybridizace sondy komplemenární ke genu (s normální nebo muanní sekvencí) 3. Vizualizace signálu sondy Sekvence sondy Ani GGT (12) Ani GTT (12) Ani GAT (12) Vzorek: Al-Mulla. J Pahol, 185, 1998,

5 Reverzní bloing 1. ixace mnoha neoznaených sond ke genu do membrány 2. Amplifikace DNA a znaení (primeru) 2. Hybridizace vyeované ss DNA k sondám 3. Vizualizace signálu primeru DNA vzorek. 1 anigat anigtt anigct aniagt anicgt Sonda: Podklady pro nanesení sond Nylonová membrána (desíky a sovky sond) Plasy (sovky) Sklo (isíce a soisíce) Kemík (soisíce a milióny) Microarray Píprava spo pro navázání sondy mikropipeováním Sruná charakerisika hybridizaních meod Poeba DNA paciena, nikoliv rodiny PCR se znaeným primerem nebo DNA znaení po PCR Není nuná elekroforéza Doba analýzy: 2-3 dny Náklady: K / 1 spo Poe spo v sérii: nad 20 5

6 Analýza velkého pou známých muací i mikrodelecí v genu (cca nad 20) Cysická fibrosa Duchennova/Beckerova svalová dysrofie Williamsv-Beurenv syndrom 6

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční

Více

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION VYUŽITÍ AUTOMATICKÉHO SEKVENOVÁNÍ DNA PRO DETEKCI POLYMORFISMŮ KANDIDÁTNÍCH GENŮ U PRASAT Vykoukalová Z., Knoll A.,

Více

Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní

Více

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Přehled Molekulárně-biologický úvod, DNA struktura, replikace, DNA polymerasa Princip procesu PCR Optimalizace PCR Typy PCR Aplikace

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Analýza transkriptomu Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s moderními metodami komplexní

Více

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby

Více

Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 5. Metody molekulární biologie II DNA footprinting hledání interakcí DNA s proteiny Polymerázová řetězová reakce (Polymerase chain reaction PCR) Malé

Více

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,

Více

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE

GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE POHLED Z LABORATOŘE Petra Hedvičákov ková ÚBLG FN Motol Odd. lékal kařské molekulárn rní genetiky MZO 00064203 23.-24.5.2008

Více

Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.:

Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.: Yi TPMT Diagnostická souprava Návod k použití Výrobce: YBUX s.r.o. Haasova 27 Brno 616 00 Česká republika IČ 63487951 tel.: +420 541 423 710 e-mail: ybux@ybux.eu Název: Yi TPMT Popis: Diagnostická souprava

Více

Laboratorní přístrojová technika

Laboratorní přístrojová technika Laboratorní přístrojová technika Co najdeme v laboratoři? Přístroje pro obecné použití centrifugy, třepačky, pipety, biohazard boxy Trocha teorie o DNA a PCR Analytické přístroje a příprava vzorků elektroforézy

Více

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Modifikace PCR, sekvenování Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Multiplex PCR Reakční směs obsahuje ne jeden, ale několik párů primerů rozpoznávajících různé cílové sekvence

Více

Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 4. Metody molekulární biologie I Izolace DNA a RNA Specifické postupy pro baktérie, kvasinky, rostlinné a živočišné tkáně U RNA nutno zabránit kontaminaci

Více

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Komponenty nukleových kyselin Nukleotid DNA deoxyguanosid monofosfát (dgmp) Koncept párování bazí je striktně konzervativní Cytosine

Více

Duchenneova/Beckerova svalová dystrofie a Parent Project

Duchenneova/Beckerova svalová dystrofie a Parent Project Duchenneova/Beckerova svalová dystrofie a Parent Project Oddělení lékařské genetiky FN Brno Renata Gaillyová Vzácné nemoci V EU se nemoc považuje za vzácnou, jestliže postihuje méně než 5 osob z každých

Více

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou

Více

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace

Více

Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

KVANTIFIKACE ZMĚN GENOVÉ EXPRESE

KVANTIFIKACE ZMĚN GENOVÉ EXPRESE KVANTIFIKACE ZMĚN GENOVÉ EXPRESE Northern bloty pracné a zdlouhavé Genové čipy nákladné; http://www.molbio.upol.cz/ Semikvantitativní RT-PCR qpcr nepřesné metodiky real-time PCR vysoké dynamické rozpětí

Více

Molekulární genetika

Molekulární genetika Molekulární genetika Genetické inženýrství Technologie rekombinantní DNA Vektor Genomová DNA Štěpení RE Rozštěpení stejnou RE, lepivé konce Ligace Transformace Bakteriální chromozóm Rekombinantní vektor

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné

Více

Genotypování markerů užitkovosti a zdraví u skotu

Genotypování markerů užitkovosti a zdraví u skotu Mezinárodní odborný seminář Využití chovatelských dat onemocnění skotu pro management stád, šlechtění a pro racionální užívání antimikrobik. Genotypování markerů užitkovosti a zdraví u skotu Jitka Kyseľová

Více

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková Diagnostika retrovirů Lentiviry - HIV Vladislava Růžičková VI. Třída RNA-viry se zpětnou transkriptázou RT Čeleď: Retroviridae (hostitelé: Obratlovci) Rody: Alpharetrovirus Betaretrovirus Gammaretrovirus

Více

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction)

Více

Principy a využit. ití qpcr. KBC/BAM Pokročil. rní biologie

Principy a využit. ití qpcr. KBC/BAM Pokročil. rní biologie Principy a využit ití qpcr KBC/BAM Pokročil ilé biochemické a biotechnologické metody Mgr. Mária M Šmehilová, Ph.D. UP PŘF CRH Oddělen lení molekulárn rní biologie Úvod do PCR PCR - 1984 Kary Mullis (Nobelova

Více

J09 Průkaz nukleové kyseliny

J09 Průkaz nukleové kyseliny J09 Průkaz nukleové kyseliny VLLM0421c (jaro 2016) Osnova využití a metody průkazu NK PCR a její modifikace proces prokazování specifické sekvence NK 2/55 Přímé vs. nepřímé metody přímé hledáme mikroba,

Více

Polymorfizmy detekované. polymorfizmů (Single Nucleotide

Polymorfizmy detekované. polymorfizmů (Single Nucleotide Polymorfizmy detekované speciálními metodami s vysokou rozlišovací schopností Stanovení jednonukleotidových polymorfizmů (Single Nucleotide Polymorphisms - SNPs) Příklad jednonukleotidových polymorfizmů

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

Hybridizace nukleových kyselin

Hybridizace nukleových kyselin Hybridizace nukleových kyselin Tvorba dvouřetězcových hybridů za dvou jednořetězcových a komplementárních molekul Založena na schopnosti denaturace a renaturace DNA. Denaturace DNA oddělení komplementárních

Více

UNIVERZITA KARLOVA V PRAZE Přírodovědecká fakulta. Studijní program: Biologie. Katedra antropologie a genetiky člověka.

UNIVERZITA KARLOVA V PRAZE Přírodovědecká fakulta. Studijní program: Biologie. Katedra antropologie a genetiky člověka. UNIVERZITA KARLOVA V PRAZE Přírodovědecká fakulta Studijní program: Biologie Katedra antropologie a genetiky člověka Lenka Dvořáková Využití metod PCR ve forenzní genetické analýze Use of PCR in forensic

Více

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky.

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální

Více

ř ý ý é š ř ř é ř Ž ď č č č é ů é š é é ř é ř Č č é ů é ú ž č é Ž ř ý é ř ó ý é ž č š úč č é ů ů č é ů ř Ž é ř é ř ž ř č é ů é č č ý ů š č é ů ř Ž é ř č ů é ž ř š č č ů ř ž é Ž š č ů č ů ř ý é č é ů ž

Více

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů

Více

Srovnání citlivosti kvantitativní PCR repetitivních oblastí AF a B1 pro detekci Toxoplasma gondii

Srovnání citlivosti kvantitativní PCR repetitivních oblastí AF a B1 pro detekci Toxoplasma gondii Srovnání citlivosti kvantitativní PCR repetitivních oblastí AF146527 a B1 pro detekci Toxoplasma gondii M. Bartková, E. Kriegová, D. Novotný, M. Petřek, P. Schneiderová Oddělení klinické biochemie a imunogenetiky

Více

BioArray Molecular. Graham Smallridge, Immucor Prague November 2013

BioArray Molecular. Graham Smallridge, Immucor Prague November 2013 BioArray Molecular Immunohaematology Graham Smallridge, Immucor Prague November 2013 1 BioArray Solutions BioArray Solutions Ltd. Bylo založeno ve městě Warren, New Jersey, (USA) v roce 1997 skupinou vědeckých

Více

č ý ž ř č č š č ž č úč úř š č úč Č ř č š ň ů č ř š ý ř Ž č Ž Ž č Ž úř ř č č Ž ď ř ý č ý č š ř ý ř š ó č ý ř č ý Ž Ž ď č ř č Ž Ž č ý č ř č Ž ř č ů ž š ů ř Ž š ý ň ů ů ř š ž š ý ř ý ř ž č č Ž ř ýš ř č č

Více

Pokročilé biofyzikální metody v experimentální biologii

Pokročilé biofyzikální metody v experimentální biologii Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 1/1 Proč biofyzikální metody? Biofyzikální metody využívají fyzikální principy ke studiu biologických systémů Poskytují kvantitativní

Více

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14 OBSAH DNA polymerázy pro PCR a pufry.................. 3 Taq DNA polymeráza 4 Taq DNA polymeráza Unis 5 TaqPurple DNA polymeráza 6 Taq DNA polymeráza 1.1 7 Combi Taq DNA polymeráza 8 LA DNA Polymerases

Více

Verze: 1.2 Datum poslední revize: 24.9.2014. Nastavení real-time PCR cykleru. Light Cycler 480 Instrument. (Roche) generi biotech

Verze: 1.2 Datum poslední revize: 24.9.2014. Nastavení real-time PCR cykleru. Light Cycler 480 Instrument. (Roche) generi biotech Verze: 1.2 Datum poslední revize: 24.9.2014 Nastavení real-time PCR cykleru Light Cycler 480 Instrument (Roche) generi biotech OBSAH 1. Nastavení teplotního profilu...3 1.1. Nastavení nového teplotního

Více

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009 Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková Parent projekt Praha 19.2.2009 Diagnostika MD její vývoj 1981-1986: zdokonalování diferenciální diagnostiky

Více

PŘÍLOHA č. 2 Vstupní formulář / V-13 / 7.07.07 /4_05 SMLOUVY O POSKYTOVÁNÍ A ÚHRADĚ ZDRAVOTNÍ PÉČE PRACOVIŠTĚ ZDRAVOTNICKÉHO TÝMU

PŘÍLOHA č. 2 Vstupní formulář / V-13 / 7.07.07 /4_05 SMLOUVY O POSKYTOVÁNÍ A ÚHRADĚ ZDRAVOTNÍ PÉČE PRACOVIŠTĚ ZDRAVOTNICKÉHO TÝMU IČO 2 8 5 7 4 9 0 7 IČZ smluvního ZZ 9 1 9 9 7 9 0 0 Číslo smlouvy 9 T 9 1 K 0 0 1 Název IČO SPADIA LAB, a.s. PŘÍLOHA č. 2 Vstupní formulář / V-13 / 7.07.07 /4_05 SMLOUVY O POSKYTOVÁNÍ A ÚHRADĚ ZDRAVOTNÍ

Více

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. IV. Interkalační barviva a sondy

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. IV. Interkalační barviva a sondy ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR IV. Interkalační barviva a sondy Fluorofor (F) Fluorofor většinou heterocyklická nebo polyaromatická sloučenina, při přechodu z excitovného do základního stavu fluoreskuje

Více

Sekvenování příští generace (Next Generation Sequencing, NGS)

Sekvenování příští generace (Next Generation Sequencing, NGS) Sekvenování příští generace (Next Generation Sequencing, NGS) Přednáška 6, 2013/14 Ivo Papoušek Next generation sequencing poptávka po nízkonákladovém sekvenování vyvolala tlak na vývoj high-throughput

Více

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR)

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek

Více

5. MĚŘENÍ FÁZOVÉHO ROZDÍLU, MĚŘENÍ PROUDU A NAPĚTÍ

5. MĚŘENÍ FÁZOVÉHO ROZDÍLU, MĚŘENÍ PROUDU A NAPĚTÍ 5. MĚŘEÍ FÁZOVÉHO ROZDÍLU, MĚŘEÍ PROUDU A APĚÍ měření fázového rozdílu osciloskopem a číačem, další možnosi měření ϕ (přehled) měření proudu a napěí: ealony, referenční a kalibrační zdroje (včeně principu

Více

Detekce Leidenské mutace

Detekce Leidenské mutace Detekce Leidenské mutace MOLEKULÁRNÍ BIOLOGIE 3. Restrikční štěpení, elektroforéza + interpretace výsledků Restrikční endonukleasy(restriktasy) bakteriální enzymy štěpící cizorodou dsdna na kratší úseky

Více

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc.

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc. Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské praxi doc. RNDr. Ivan Mazura, CSc. Historie forenzní genetiky 1985-1986 Alec Jeffreys a satelitní DNA 1980 Ray

Více

Genetické markery - princip a využití

Genetické markery - princip a využití Genetika a šlechtění lesních dřevin Genetické markery - princip a využití Doc. Ing. RNDr. Eva Palátová, PhD. Ing. R. Longauer, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován

Více

Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2 http://www.paternityexperts.com/basicgenetics.html

Více

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

Havarijní plán PřF UP

Havarijní plán PřF UP Havarijní plán PřF UP v němž se nakládá s geneticky modifikovanými organismy (GMO), zpracovaný podle 20, odst. 4 zákona č. 78/2004 Sb. pro pracoviště kateder Buněčné biologie a genetiky a Oddělení molekulární

Více

cobas 4800 CT/NG Test

cobas 4800 CT/NG Test cobas 4800 CT/NG Test PRO ÚČELY DIAGNOSTIKY IN VITRO. cobas 4800 System Sample Preparation Kit c4800 SMPL PREP 960 Tests P/N: 05235804190 240 Tests P/N: 05235782190 cobas 4800 CT/NG Amplification/Detection

Více

Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin

Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin Část Molekulární biologie a imunologie 6. Základy dědičnosti Mendelovská dědičnost (autozomálně recesivní, autozomálně dominantní a X-vázaný přenos mutací). Nemendelovská dědičnost (uniparentální disomie,

Více

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Biotechnologický kurz Biotechnologický kurz II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně Zemědělská

Více

nastavení real-time PCR cykleru Rotor Gene 3000

nastavení real-time PCR cykleru Rotor Gene 3000 Verze: 1.4 Datum poslední revize: 25. 3. 2015 nastavení real-time PCR cykleru Rotor Gene 3000 (Corbett Research) generi biotech OBSAH: 1. Nastavení teplotního profilu a spuštění cykleru... 3 2. Zadání

Více

Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika

Více

Genetický screening predispozice k celiakii

Genetický screening predispozice k celiakii VETERINÁRN RNÍ A FARMACEUTICKÁ UNIVERZITA BRNO Farmaceutická fakulta Ústav humánn nní farmakologie a toxikologie Genetický screening predispozice k celiakii RNDr. Ladislava Bartošov ová,ph.d. 1, PharmDr.

Více

Biotechnologický kurz. III. letní škola metod molekulární biologie nukleových kyselin a genomiky

Biotechnologický kurz. III. letní škola metod molekulární biologie nukleových kyselin a genomiky Biotechnologický kurz Biotechnologický kurz III. letní škola metod molekulární biologie nukleových kyselin a genomiky 18. - 22. 6. 2012 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně

Více

P ehled výsledk z Referen ní laborato e

P ehled výsledk z Referen ní laborato e P ehled výsledk z Referen ní laborato e 1,3 Hajdúch M, 1,3 Trojanec R, 2,3 Kolá Z, 1,3 Bouchalová K, 2,3 Sedláková E. 1 Laborato experimentální medicíny p i D tské klinice LF UP a FN Olomouc 2 Laborato

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o.

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o. Genetické markery ve šlechtění skotu pro masnou produkci Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Genetické markery Polymorfní místa v DNA, které vykazují asociaci na sledované znaky Příčinné

Více

KATALOG. Chlamydia trachomatis,neisseria gonorrhoeae, Treponema pallidum, Mycoplasma genitalium,

KATALOG. Chlamydia trachomatis,neisseria gonorrhoeae, Treponema pallidum, Mycoplasma genitalium, CHARAKTERISTIKA SPOLEČNOSTI Institute of Applied Biotechnologies a.s. (IAB) je biotechnologická společnost působící v oblasti výzkumu a vývoje technologií, metodik a postupů molekulární biologie s cílem

Více

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA Cytogenetika telomera chromosom jádro centomera telomera buňka histony páry bazí dvoušroubovice DNA Typy chromosomů Karyotyp člověka 46 chromosomů 22 párů autosomů (1-22 od největšího po nejmenší) 1 pár

Více

Mikročipy v mikrobiologii

Mikročipy v mikrobiologii Mikročipy v mikrobiologii doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 Obsah přednášky 1) Charakteristika biočipů, DNA microarrays a DNA chip 2) Výroba čipů, charakteristika

Více

Molekulární diagnostika pletencové svalové dystrofie typu 2A

Molekulární diagnostika pletencové svalové dystrofie typu 2A Molekulární diagnostika pletencové svalové dystrofie typu 2A Lenka Fajkusová Centrum molekulární biologie a genové terapie Fakultní nemocnice Brno Pletencové svalové dystrofie (Limb Girdle Muscular Dystrophy

Více

š É É É É Ř Ý ň ě š š Ž č č č š ě č Ď ě ě ě š č ň ě ěžč ĎŽ ň ě š ě Ž ě š ěň Š ě Ď č ě Ů č ě ÚŽ ě š ě ě Ž ň Ž č Ž ě ě ě ě ž š ě ň Ů Ž č Ž ě š ň Ó č ň š ě ěň č Ž Ž š ě ě ě ě ň ě Ž č š ě š Ů č š š ě ě ň š

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi

Více

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Mgr. Klára Vilimovská Dědečková, Ph.D. Synlab genetics s.r.o. Molekulární

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ

VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ Lucie Vištejnová 2, Jan Hodek 1, Patrik Sekerka 2, Jaroslava Ovesná 1, Kateřina Demnerová 2 1. Výzkumný ústav rostlinné výroby, Drnovská 507,

Více

Č Ú Í Á Ú Í Ú Ú Í Á Ě Č Ě Á Á Í Á Í Í Á Í Ý Í Í Á Í ž Í š š ž ť ž ž Í š š š ž š š Ý Č Í Á ú ý ó Č Č ž Í ř ř ž ž ř ř Č ř ý ž ř ž ř ž ý Í ú ů ý ř ř ú ř š š š š ř ž ž ř ý ý ř ý Č ý ž ý š Í ý ý ř Ú š š ž ť

Více

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)

Více

5. Sekvenování, přečtení genetické informace, éra genomiky.

5. Sekvenování, přečtení genetické informace, éra genomiky. 5. Sekvenování, přečtení genetické informace, éra genomiky. Minulá přednáška nastínila zrod molekulární biologie a představila některé možnosti, jak pracovat s DNA - jak ji analyzovat na základě velikosti

Více

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob PGD preimplantační genetická diagnostika zahrnuje soubor technik, které se používají pro zjištění

Více

Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka

Více

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Zavedení PCR v roce 1983 (Kary B. Mullis) Nobelova cena 1993 Metodika

Více

MEZILABORATORNÍ POROVNÁNÍ stanovení hla znaků asociovaných s chorobami 2016 II. KOLO ALELY VÁZANÉ S CELIAKIÍ

MEZILABORATORNÍ POROVNÁNÍ stanovení hla znaků asociovaných s chorobami 2016 II. KOLO ALELY VÁZANÉ S CELIAKIÍ stanovení hla znaků asociovaných s chorobami 6 II. KOLO Organizátor: Národní referenční laboratoř pro DNA diagnostiku Adresa: U Nemocnice, 8 Praha Zodpovědná osoba: Ing. Milena Vraná e-mail: milena.vrana@uhkt.cz

Více

NÁVOD K POUŽITÍ PRO HER2 DNA QUANTIFICATION KIT

NÁVOD K POUŽITÍ PRO HER2 DNA QUANTIFICATION KIT IČ: 80 DIČ: CZ80 sales@intellmed.eu NÁVOD K POUŽITÍ PRO HER DNA QUANTIFICATION KIT IČ: 80 DIČ: CZ80 sales@intellmed.eu OBSAH Návod k použití pro HER DNA QUANTIFICATION KIT.... Úvod.... Označení.... Rozsah

Více

Vícefunkční chemické a biochemické mikrosystémy Strana 1. Mikrofluidní bioaplikace

Vícefunkční chemické a biochemické mikrosystémy Strana 1. Mikrofluidní bioaplikace Vícefunkční chemické a biochemické mikrosystémy Strana 1 Mikrofluidní bioaplikace Vícefunkční chemické a biochemické mikrosystémy Strana 2 Mikrofluidní aplikace pro bioanalýzu Transport, dávkování, promíchávání

Více

IZOLACE, SEPARACE A DETEKCE PROTEINŮ I. Vlasta Němcová, Michael Jelínek, Jan Šrámek

IZOLACE, SEPARACE A DETEKCE PROTEINŮ I. Vlasta Němcová, Michael Jelínek, Jan Šrámek IZOLACE, SEPARACE A DETEKCE PROTEINŮ I Vlasta Němcová, Michael Jelínek, Jan Šrámek Studium aktinu, mikrofilamentární složky cytoskeletu pomocí dvou metod: detekce přímo v buňkách - fluorescenční barvení

Více

TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně

Více

Metody studia genové exprese

Metody studia genové exprese Metody studia genové exprese Ing. Lucie Němcová, Ph.D. Laboratoř vývojové biologie nemcova@iapg.cas.cz Transkriptom Genová exprese: Geny jsou exprimovány tehdy, jsou-li přepsány do RNA (mrna). Rozdílná

Více

Využití Sequence Capture v diagnostice svalových onemocnění

Využití Sequence Capture v diagnostice svalových onemocnění Využití Sequence Capture v diagnostice svalových onemocnění Kristýna Stehlíková Daniela Skálová Lenka Fajkusová Centrum molekulární biologie a genové terapie IHOK, FN Brno Sekce vrozených genetických poruch

Více

DETEKCE VNITŘNÍHO GENU RÝŽE FOSFOLIPÁZY D POMOCÍ PCR

DETEKCE VNITŘNÍHO GENU RÝŽE FOSFOLIPÁZY D POMOCÍ PCR Mgr. Jan Hodek RNDr. Jaroslava Ovesná, CSc. DETEKCE VNITŘNÍHO GENU RÝŽE FOSFOLIPÁZY D POMOCÍ PCR METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2007 Metodika byla vypracována pracovníky Národní

Více

Kras XL StripAssay. Kat. číslo 5-680. 20 testů 2-8 C

Kras XL StripAssay. Kat. číslo 5-680. 20 testů 2-8 C Kras XL StripAssay Kat. číslo 5-680 20 testů 2-8 C Popis stripu: Pracovní postup 1. Izolace DNA Musí být použity vhodné metody extrakce DNA, v závislosti na typu vzorku, který má být vyšetřován. Doporučení

Více

Ř Ú č č ň č š Ú č š ň Č č š Ž č č č ň Č č š š š ň Č Ž Č ň š č č ň Č Ó ň č Ž ů Ž Ž Č Ú Ř č š ň č š č ú úč ň ů ů ž č ů ů ň Č š Ž ň Ž ž ů ž ň Ž č Č š Ž ň Ž šš ž ž š ů ů ů č č ž ů ž Ž č š č č š ú ň ž Ú ů ž

Více

Izolace RNA. doc. RNDr. Jan Vondráček, PhD..

Izolace RNA. doc. RNDr. Jan Vondráček, PhD.. Izolace RNA doc. RNDr. Jan Vondráček, PhD.. Metodiky izolace RNA celková buněčná RNA ( total RNA) zahrnuje řadu typů RNA, které se mohou lišit svými fyzikálněchemickými vlastnostmi a tedy i nároky na jejich

Více