Příručka pro federované systémy

Rozměr: px
Začít zobrazení ze stránky:

Download "Příručka pro federované systémy"

Transkript

1 IBM DB2 Information Integrator Příručka pro federoané systémy Verze 8.2 SC

2

3 IBM DB2 Information Integrator Příručka pro federoané systémy Verze 8.2 SC

4 Než použijete tyto informace a odpoídající produkt, nezapomeňte si přečíst šeobecné informace uedené sekci Poznámky na stránce 307. Tento dokument obsahuje informace, které jsou lastnictím společnosti IBM. Je poskytoán na základě licenční smlouy a je chráněn autorským zákonem. Informace obsažené této publikaci neobsahují žádné záruky týkající se produktu a žádný ýrok uedený této příručce nelze tomto smyslu interpretoat. Příručky ydáané společností IBM si můžete objednat síti Internet nebo prostřednictím místního zastoupení společnosti IBM: Chcete-li si příručky objednat síti Internet, přejděte na stránky střediska IBM Publications Center na adrese Chcete-li zjistit, kde najdete místní zastoupení společnosti IBM, přejděte na stránky IBM Directory of Worldwide Contacts na adrese Pokud odešlete informace společnosti IBM, udělujete tím společnosti IBM neýhradní práo použít nebo distribuoat tyto informace liboolným způsobem, který společnost poažuje za odpoídající, bez yžádání ašeho solení. Copyright International Business Machines Corporation 1998, Všechna práa yhrazena.

5 Obsah Informace o této knize ix Komu je určena tato příručka ix Část 1. Úod Kapitola 1. Přehled federoaného systému Federoané systémy Federoaný serer Co je zdroj dat? Podporoané zdroje dat Federoaná databáze Systémoý katalog federoané databáze Kompilátor příkazů SQL Optimalizátor dotazů Kompenzace Průchozí relace Wrappery a moduly wrapper Výchozí jména modulu wrapper Definice a olby sereru Mapoání užiatelů Přezdíky a objekty zdrojů dat Platné objekty zdrojů dat Volby sloupců přezdíek Mapoání datoých typů Mapoání funkcí Specifikace indexů Posloupnosti řazení Jak posloupnost řazení určuje pořadí řazení Nastaení lokální posloupnosti řazení pro optimalizaci dotazů Interakce s federoaným systémem Příkazoý procesor DB2 (CLP) Příkazoé centrum DB Řídicí centrum DB Aplikační programy Skupina produktů DB Poskytoatelé weboých služeb Část 2. Administrace a údržba Kapitola 2. Změna konfigurací zdroje dat Úpraa modulu wrapper Změna modulu wrapper - příklady Změna definicí sereru a oleb sereru Změna definic sereru a podrobností oleb sereru...27 Změna erze zdroje dat definici sereru Změna šech definic sereru pro specifický typ zdrojů dat Použití oleb sereru definicích sereru Změna mapoání užiatele Změna přezdíky Změna podrobností o přezdíkách Omezení e změnách přezdíek Změna jmen sloupců přezdíky Změna oleb přezdíek Změna oleb sloupců přezdíek Zrušení modulu wrapper Zrušení definice sereru Zrušení mapoání užiatele Zrušení přezdíky Kapitola 3. Mapoání datoých typů.. 43 Mapoání datoých typů e federoaném systému...43 Mapoání datoých typů a globální katalog federoané databáze Kdy ytořit alternatiní mapoání datoých typů...45 Mapoání datoých typů pro nerelační zdroje dat...45 Dopředná a zpětná mapoání datoých typů Vytáření mapoání datoých typů Vytoření mapoání datoého typu pro datoý typ zdroje dat příklad Vytoření mapoání typů pro datoý typ zdroje dat a erzi příklad Vytoření mapoání typů pro šechny objekty zdroje dat na sereru příklad Změna lokálního typu pro objekt zdroje dat Změna lokálního typu pro objekt zdroje dat příklady..51 Změna dlouhých datoých typů na datoé typy archar..53 Kapitola 4. Mapoání funkcí a užiatelské funkce Mapoání funkcí e federoaném systému Kdy ytořit lastní mapoání funkce Proč je mapoání funkcí důležité Jak pracují mapoání funkcí e federoaném systému..56 Požadaky pro mapoání užiatelských funkcí (UDF)..57 Šablony funkce Vytáření šablon funkcí Poskytoání informací o režii mapoání funkce optimalizátoru dotazů Aktualizace informací o režii Zadání jmen funkcí mapoání funkcí Jak ytořit mapoání funkce Vytoření podrobností o mapoání funkcí Vytoření mapoání funkce pro specifický typ zdroje dat Vytoření mapoání funkce pro specifický typ a erzi zdroje dat Vytoření mapoání funkce pro šechny objekty zdroje dat na specifickém sereru Užiatelské funkce aplikacích Zákaz ýchozího mapoání funkce Zrušení mapoání užiatelské funkce Kapitola 5. Specifikace indexů Specifikace indexů e federoaném systému Vytoření specifikací indexu pro objekty zdroje dat...68 Copyright IBM Corp. 1998, 2004 iii

6 Vytoření specifikací indexu na tabulkách, pro které jsou ytořeny noé indexy Vytoření specifikací indexu pro pohledy Vytoření specifikací indexu pro synonyma Informix..72 Kapitola 6. Transparentní jazyk DDL.. 75 Co je trasparentní jazyk DDL? Omezení transparentních příkazů DDL Vzdálené sloupce typu LOB a transparentní jazyk DDL 77 Vytoření noých zdálených tabulek s použitím transparentního jazyka DDL Změna zdálených tabulek s použitím transparentního jazyka DDL Zrušení zdálených tabulek s použitím transparentního jazyka DDL Kapitola 7. Podpora transakcí e federoaném systému Základní informace o podpoře transakcí e federoaném systému Co je aktualizace e federoaném systému? Co je transakce aktualizace průchozí relaci?...87 Podpora transakcí s transparentním příkazem DDL..87 Zdroje dat, které automaticky potrzují příkazy DDL 88 Užiatelské funkce předáané do zdroje dat ke zpracoání Kapitola 8. Operace INSERT, UPDATE a DELETE Autorizační opránění pro příkazy INSERT, UPDATE a DELETE Omezení příkazů INSERT, UPDATE a DELETE pro federoaný systém Nepodporoané zdroje dat Referenční integrita e federoaném systému Příkazy INSERT, UPDATE a DELETE a objekty LOB 91 Zachoání atomicity příkazu e federoaném systému..91 Práce s přezdíkami Syntaxe WITH HOLD Spouštěče Práce s přezdíkami - podrobné informace Příkazy SQL, které lze použít s přezdíkami Přístup k noým objektům zdroj dat Přístup ke zdrojům dat pomocí průchozích relací Přístup k heterogenním datům prostřednictím federoaných pohledů Vytoření přezdíky pro přezdíku Výběr dat e federoaném systému Změna dat e federoaném systému Vložení dat do objektů zdrojů dat Aktualizace dat objektech zdrojů dat Odstranění dat z objektů zdrojů dat Sémantika přiřazení e federoaném systému Sémantika přiřazení e federoaném systému - příklady 110 Kapitola 9. Monitoroání federoaného systému Indikátory narušení pro federoané přezdíky a serery 111 Aktiace federoaných indikátorů narušení Monitoroání narušení federoaných přezdíek a sererů 112 Sledoání narušení federoaných přezdíek a sererů - příklady Monitoroání snímků federoaných systémů - přehled 115 Monitoroání fragmentů federoaných dotazů Monitoroání snímků fragmentů federoaných dotazů - příklad Kapitola 10. Podpora kódoání Unicode pro federoané zdroje dat Podpora formátu Unicode pro federoané systémy Zadání kódoé stránky klienta pro podporu formátu Unicode u zdrojů dat Microsoft SQL Serer a ODBC. 119 Podporoané kódoé stránky Unicode pro olbu CODEPAGE modulu wrapper MSSQL a ODBC Zadání kódoé stránky souboru pro podporu formátu Unicode e zdrojích dat typu soubory s tabulkoou strukturou Zadání kódoé stránky souboru pro podporu formátu Unicode e zdrojích dat typu soubory s tabulkoou strukturou - příklad Chyby případě rozdílné elikosti zdáleného a federoaného místa kódu Část 3. Výkon Kapitola 11. Ladění ýkonu federoaného systému Publikace o ladění ýkonu federoaných systémů Vyladění zpracoání dotazů Analýza posunu na nižší úroeň Podrobné údaje o analýze přesunu zpracoání na nižší úroeň Charakteristika sereru oliňující možnosti posunutí na nižší úroeň Charakteristika přezdíek oliňující možnosti posunutí na nižší úroeň Charakteristika dotazu oliňující možnosti posunutí na nižší úroeň Rozhodnutí analýzy přesunu zpracoání na nižší úroeň 134 Analýza, kde má být dotaz yhodnocen Porozumění rozhodnutím při yhodnocení přístupoých plánů Přechody na yšší erzi a přizpůsobení u zdrojů dat 137 Globální optimalizace Globální optimalizace - podrobné údaje Charakteristika sereru oliňující globální optimalizaci Charakteristika přezdíek oliňující globální optimalizaci Rozhodnutí oblasti globální optimalizace Analýza globální optimalizace Porozumění rozhodnutím optimalizace přístupoého plánu Prky monitoru systému oliňující ýkon Kapitola 12. Paralelní zpracoání s dotazy, které odkazují na přezdíky. 147 Paralelní zpracoání dotazů s odkazy na přezdíky i Příručka pro federoané systémy

7 Paralelní zpracoání rámci oblasti pro dotazy s odkazy na přezdíky Poolení paralelního zpracoání rámci oblasti pro dotazy s odkazy na přezdíky Paralelní zpracoání mezi oblastmi pro dotazy s odkazy na přezdíky Poolení paralelního zpracoání mezi oblastmi pro dotazy s odkazy na přezdíky Výpočtoé skupiny oblastí Definoání ýpočtoé skupiny oblastí Paralelní zpracoání mezi oblastmi pro dotazy s odkazy na přezdíky - očekáaný ýkon Smíšené paralelní zpracoání pro dotazy s odkazy na přezdíky Poolení smíšeného paralelního zpracoání pro dotazy s odkazy na přezdíky Paralelní přístupoé plány dotazů s odkazy na přezdíky 155 Paralelní zpracoání rámci oblasti pro dotazy s odkazy na přezdíky - příklady přístupoých plánů Paralelní zpracoání pro dotazy s odkazy na přezdíky mezi oblastmi - příklady přístupoých plánů Smíšené paralelní zpracoání pro dotazy s odkazy na přezdíky - příklady přístupoých plánů Kapitola 13. Tabulky materializoaných dotazů a federoané systémy Federoané systémy a tabulky materializoaných dotazů přehled Vytoření federoané tabulky materializoaného dotazu 162 Specifická omezení zdrojů dat pro tabulky materializoaných dotazů Omezení při použití tabulek materializoaných dotazů s přezdíkami Zobrazení stau aktualizací statistických údajů o přezdíce Část 4. Programoání aplikací Kapitola 17. Scénář programoání aplikací Kapitola 18. Programoání aplikací pro federoané systémy Interakce klientských aplikací se zdroji dat Práce s přezdíkami aplikacích Odkazoání na objekty datoých zdrojů příkazech SQL pomocí přezdíek Přezdíky příkazech DDL Aplikace s liem na statistické údaje o zdrojích dat 191 Přezdíky s možností yolání uložených procedur 192 Definoání oleb sloupce pro přezdíky Vytáření a použití federoaných pohledů Použití úroně oddělení pro zachoání integrity dat Federoaná podpora objektů LOB Federoaná podpora objektů LOB - podrobné informace 197 Lokátory LOB Omezení pro objekty LOB Distribuoané požadaky na dotazy pro zdroje dat Optimalizace distribuoaných požadaků pomocí oleb sereru Použití průchozích relací aplikacích Odesílání dotazů do zdrojů dat přímo prostřednictím průchozí relace Federoaná průchozí relace - některé aspekty a omezení Průchozí relace pro zdroje dat Oracle Kapitola 14. Uložení tabulek do mezipaměti e federoaném systému. 167 Tabulky mezipaměti Vytoření tabulky mezipaměti Poolení mezipaměti Přidání tabulky materializoaných dotazů do tabulky mezipaměti Zrušení tabulky materializoaných dotazů z tabulky mezipaměti Zrušení tabulky mezipaměti Kapitola 15. Informační podmínky pro přezdíky e federoaném systému Informační podmínky přezdíkách Zadání informačních podmínek přezdíkách Zadání informačních podmínek přezdíkách - příklady 174 Část 5. Referenční příručky Kapitola 19. Pohledy globální tabulce katalogu obsahující federoané informace Kapitola 20. Volby modulu wrapper pro federoané systémy Kapitola 21. Volby sereru pro federoané systémy Kapitola 22. Volby mapoání užiatelů pro federoaný systém Kapitola 16. Statistika přezdíek Prostředek pro aktualizaci statistiky přezdíek - přehled 179 Načítání statistiky přezdíek Načítání statistiky přezdíek z příkazoého řádku - příklady Vytoření katalogu nástrojů DB Kapitola 23. Volby přezdíek pro federoané systémy Kapitola 24. Volby sloupců přezdíek pro federoané systémy Obsah

8 Kapitola 25. Volby mapoání funkcí pro federoané systémy Kapitola 26. Platné typy sererů příkazech SQL Modul wrapper pro BioRS Modul wrapper pro BLAST Modul wrapper pro CTLIB Modul wrapper pro Documentum Modul wrapper pro DRDA Modul wrapper pro Entrez Modul wrapper pro Excel Modul wrapper pro Extended Search Modul wrapper pro HMMER Modul wrapper pro Informix Modul wrapper pro MSSQLODBC Modul wrapper pro NET Modul wrapper pro ODBC Modul wrapper pro OLE DB Modul wrapper pro soubory s tabulkoou strukturou Modul wrapper pro Teradata Modul wrapper pro weboé služby Modul wrapper pro WebSphere Business Integration Modul wrapper pro XML Kapitola 27. Výchozí dopředné mapoání datoých typů Zdroje dat produktu DB2 for z/os and OS/ Zdroje dat produktu DB2 for iseries Zdroje dat produktu DB2 Serer for VM and VSE Zdroje dat produktu DB2 for Linux, UNIX, and Windows 252 Zdroje dat Informix Zdroje dat produktu Microsoft SQL Serer Zdroje dat ODBC Zdroje dat produktu Oracle NET Zdroje dat produktu Sybase Zdroje dat produktu Teradata Kapitola 28. Výchozí zpětné mapoání datoých typů Zdroje dat produktu DB2 for z/os and OS/ Zdroje dat produktu DB2 for iseries Zdroje dat produktu DB2 for VM and VSE Zdroje dat produktu DB2 for Linux, UNIX, and Windows 269 Zdroje dat Informix Zdroje dat produktu Microsoft SQL Serer Zdroje dat produktu Oracle NET Zdroje dat produktu Sybase Zdroje dat produktu Teradata Kapitola 29. Výchozí mapoání datoých typů Unicode Výchozí dopředné mapoání datoých typů Unicode - modul wrapper NET Výchozí zpětné mapoání datoých typů Unicode - modul wrapper NET Výchozí dopředné mapoání datoých typů Unicode - modul wrapper Sybase Výchozí zpětné mapoání datoých typů Unicode - modul wrapper Sybase Výchozí dopředné mapoání datoých typů Unicode - modul wrapper ODBC Výchozí zpětné mapoání datoých typů Unicode - modul wrapper ODBC Výchozí dopředné mapoání datoých typů Unicode - modul wrapper Microsoft SQL Serer Výchozí zpětné mapoání datoých typů Unicode - modul wrapper Microsoft SQL Serer Kapitola 30. Datoé typy podporoané pro nerelační zdroje dat Datoé typy podporoané modulem wrapper BioRS Datoé typy podporoané modulem wrapper BLAST 281 Datoé typy podporoané modulem wrapper Documentum Datoé typy podporoané modulem wrapper Entrez Datoé typy podporoané modulem wrapper Excel Datoé typy podporoané modulem wrapper Extended Search Datoé typy podporoané modulem wrapper HMMER 283 Datoé typy podporoané modulem wrapper souborů s tabulkoou strukturou Datoé typy podporoané modulem wrapper weboých služeb Datoé typy podporoané modulem wrapper WebSphere Business Integration Datoé typy podporoané modulem wrapper XML Kapitola 31. Prky monitoru federoaných databázoých systémů. 287 Kapitola 32. Uložená procedura SYSPROC.NNSTAT Kapitola 33. Zotaení HADR (High Aailability Disaster Recoery) s federoanými zdroji dat Kapitola 34. Údaje sereru brány pro dotazy při chybě jádra Dokumentace k produktu DB2 Information Integrator Přístup k dokumentaci produktu DB2 Information Integrator Dokumentace o funkci replikace systému z/os Dokumentace o funkci publikoání událostí produktu DB2 Uniersal Database systému z/os Dokumentace o funkci publikoání událostí pro systém IMS a VSAM systému z/os Dokumentace o funkci publikoání událostí a funkci replikace systémech Linux, UNIX a Windows Dokumentace o federoané funkci systému z/os Dokumentace o federoané funkci systémech Linux, UNIX a Windows i Příručka pro federoané systémy

9 Dokumentace pro podnikoé yhledáání systémech Linux, UNIX a Windows Poznámky k erzi a požadaky na instalaci Usnadnění Vstup a naigace pomocí kláesnice Vstup z kláesnice Naigace pomocí kláesnice Fokus kláesnice Zobrazení pro usnadnění přístupu Nastaení písma Nezáislost na barě Kompatibilita s asistenčními technologiemi Dokumentace podporující funkce usnadnění přístupu Poznámky Ochranné známky Rejstřík Kontaktoání společnosti IBM Informace o produktu Poznámky k dokumentaci Obsah ii

10 iii Příručka pro federoané systémy

11 Informace o této knize Tato příručka popisuje způsob práce s federoaným systémem po nastaení a konfiguraci federoaného sereru k získání přístupu ke zdrojům dat. Obsahuje následující témata: Komu je určena tato příručka Úod k pojmům, součástem a možnostem federoaného sereru Pokyny pro změnu nastaení federoaného sereru a konfigurací zdrojů dat Vysětlení podpory transakcí federoaného systému Doporučení pro administraci a ladění federoaného systému k dosažení optimálního ýkonu Vysětlení položek, které je třeba zít úahu při ýoji aplikací pro federoaný systém Rozsáhlé referenční informace pro jednotlié zdroje dat V této příručce označuje sislá čára podél leého okraje technickou změnu textu. Tato příručka je určena administrátorům systému, administrátorům databáze, administrátorům zabezpečení a obsluze systémů, kteří musejí instaloat, konfiguroat, udržoat nebo použíat federoaný systém. Tuto příručku použijte, pokud chcete spraoat federoaný systém pro přístup k datům z relačních a nerelačních zdrojů dat. Příručka je určena také pro programátory a jiné užiatele, kteří potřebují porozumět konfiguraci, administraci, problémům spojeným s ýojem aplikací a použíání federoaného systému. Tato příručka předpokládá, že znáte produkt DB2 UDB. Měli byste být obeznámeni se standardní terminologií databází, narhoání a administrací databází. Tato příručka předpokládá, že znáte lastní použíané aplikace a zdroje dat, ke kterým chcete přistupoat. Copyright IBM Corp. 1998, 2004 ix

12 x Příručka pro federoané systémy

13 Část 1. Úod Copyright IBM Corp. 1998,

14 2 Příručka pro federoané systémy

15 Kapitola 1. Přehled federoaného systému Federoané systémy Tato kapitola popisuje funkce federoaného systému, definuje základní pojmy a terminologii týkající se federoání a ysětluje způsoby, kterým můžete s federoaným systémem pracoat. Federoaný systém DB2 je speciální typ distribuoaného systému spráy databází (DBMS). Federoaný systém sestáá z instance DB2, která pracuje jako federoaný serer, z databáze, která slouží jako federoaná databáze, z jednoho nebo íce zdrojů dat a z klientů (užiatelů a aplikací), kteří k federoané databázi a zdrojům dat přistupují. Federoaný systém ám umožňuje rámci jediného příkazu SQL rozeslat distribuoané žádosti na íce datoých zdrojů. V jednom příkazu SQL tak můžete například ytořit spojení dat umístěných tabulce databáze DB2 Uniersal Database tabulce databáze Oracle a souborech XML. Na následujícím obrázku jsou znázorněny součásti federoaného systému a ueden příklad zdrojů dat, ke kterým máte přístup. Obrázek 1. Součásti federoaného systému Síla federoaného systému DB2 spočíá následujících možnostech: Spojení dat z místních tabulek a zdálených zdrojů dat, jako by šechna data byla uložena místně e federoané databázi Copyright IBM Corp. 1998,

16 Aktualizace dat relačních zdrojích dat, jako by byla uložena e federoané databázi Replikace dat z a do relačních zdrojů dat Využití ýpočetní síly zdrojů dat odesíláním požadaků na zdroje dat ke zpracoání Kompenzace omezení jazyka SQL e zdrojích dat zpracoáním částí distribuoaných požadaků e federoaném systému Federoaný serer Co je zdroj dat? Serer DB2 e federoaném systému se nazýá federoaný serer. Jako federoané serery lze konfiguroat liboolný počet instancí DB2. K tomuto účelu lze použít existující instance DB2 nebo ytořit noé instance určené přímo pro federoaný systém. Vzhledem k tomu, že instance DB2, která sprauje federoaný systém, reaguje na požadaky koncoých užiatelů a klientských aplikací, je označoána ýrazem serer. Federoaný serer často odesílá části přijatých požadaků zdrojům dat ke zpracoání. Operace posunutí na nižší úroeň je zdáleně zpracoáaná operace. Instance DB2, která sprauje federoaný systém, je označoána jako federoaný serer, a to i přesto, že ystupuje při posunoání požadaků na nižší úroeň do zdrojů dat jako klient. Podobně jako jiné aplikační serery je i federoaný serer instancí spráce databází. Aplikační procesy připojují a odesílají požadaky do databáze rámci federoaného sereru. Dě hlaní funkce jej šak od jiných aplikačních sererů odlišují: Federoaný serer je konfiguroán pro příjem požadaků, které mohou být částečně nebo úplně určeny pro zdroje dat. Federoaný serer distribuuje tyto požadaky zdrojům dat. Podobně jako jiné aplikační serery i federoaný serer použíá ke komunikaci s instancemi typu DB2 komunikační protokoly DRDA (například protokol TCP/IP). Na rozdíl od jiných aplikačních sererů šak federoaný serer použíá pro přístup ke zdroji dat natiního klienta zdroje dat. Federoaný serer například použíá oteřeného klienta Sybase Open Client pro přístup ke zdrojům dat systému Sysbase a oladač ODBC pro systémy společnosti Microsoft pro přístup ke zdrojům dat na sereru Microsoft SQL Serer. Souisející koncepce: Co je zdroj dat? na stránce 4 Ve federoaném systému může být zdrojem dat relační instance DBMS (jako například Oracle nebo Sybase) nebo nerelační zdroj dat (jako například yhledáací algoritmus BLAST nebo soubor XML). Prostřednictím některých zdrojů dat lze přistupoat k jiným zdrojům dat. Například pomocí zdroje dat Extended Search můžete přistupoat k datoým zdrojům, jako jsou databáze Lotus Notes, Microsoft Access, Microsoft Index Serer, weboé yhledáací stroje a adresáře LDAP (Lightweight Directory Access Protocol). Metoda nebo protokol použité k získání přístupu ke zdroji dat záisí na typu zdroje dat. Příklad: Architektura DRDA slouží pro přístup ke zdrojům dat produktu DB2 for z/os and OS/390 a knihona Documentum Client API/Library slouží k získání přístupu ke zdrojům dat Documentum. Zdroje dat jsou částečně autonomní. Federoaný serer může například odesílat dotazy do zdrojů dat databáze Oracle a e stejné době mohou aplikace Oracle přistupoat k těmto zdrojům dat. Federoaný systém DB2 neznemožňuje ani neomezuje přístup k jiným zdrojům dat nad rámec omezujících podmínek integrity a uzamčení. 4 Příručka pro federoané systémy

17 Souisející koncepce: Federoaná databáze na stránce 7 Souisející odkazy: Podporoané zdroje dat na stránce 5 Podporoané zdroje dat Pomocí federoaného systému lze získat přístup k celé řadě zdrojů dat. V následující tabulce naleznete seznam podporoaných zdrojů dat: Tabulka 1. Podporoané erze zdrojů dat a metody přístupu. Zdroj dat Podporoané erze Metoda přístupu DB2 Uniersal Database for 7.2, 8.1, 8.2 DRDA Linux, UNIX, and Windows DB2 Uniersal Database for z/os and OS/ , 7.1 s následujícími opraami APAR: PQ62695 PQ55393 PQ56616 PQ54605 PQ46183 PQ62139 DRDA 8.1 DB2 Uniersal Database for 5.1 iseries s následujícími opraami APAR: SE06003 SE06872 II13348 s následujícími opraami PTF: SI05990 SI05991 DRDA 5.2 s opraou PTF SI0735. DB2 Serer for VM and VSE 7.1 (nebo noější) DRDA s opraami APAR pro funkce schémat. Informix 7.31, 8.32, 8.4, 9.3, 9.4 Informix Client SDK V2.7 (nebo noější) ODBC 3.x Oladač ODBC pro zdroj dat, jako například oladač Redbrick ODBC pro přístup k datům produktu Redbrick. OLE DB 2.7, 2.8 OLE DB 2.0 (nebo noější) Oracle 8.0.6, 8.1.6, 8.1.7, 9.0, 9.1, 9.2, 9i, 10g Klientský software Oracle net nebo NET8 Kapitola 1. Přehled federoaného systému 5

18 Tabulka 1. Podporoané erze zdrojů dat a metody přístupu. (pokračoání) Zdroj dat Podporoané erze Metoda přístupu Microsoft SQL Serer 7.0, 2000 s opraou SP3 a noějšími opraami pro tuto erzi V systému Windows Microsoft SQL Serer oladač klienta ODBC 3.0 (nebo noější). V systému UNIX, oladač DataDirect Technologies (dříe MERANT) Connect ODBC 3.7 (nebo noější). Sybase , 12.x Rozhraní Sybase Open Client ctlib Teradata V2R3, V2R4, V2R5 Rozhraní CLI Teradata erze 2 (CLI2) ydání (nebo noější) BLAST a noější opray FixPak erze 2.2 BioRS Žádná Démon BLAST (dodáán s modulem wrapper) Documentum 3.x, 4.x Documentum Client library/apl3.1.7a (nebo noější) Entrez (zdroje dat PubMed a GenBank) 1,0 Žádná HMMER 2.2g, 2.3 Démon HMMER (dodáán s modulem wrapper) IBM Lotus Extended Search 4.0.1, Knihona Extended Search Client Library (dodáán s modulem wrapper) Microsoft Excel 97, 2000, 2002, 2003 Excel 97, 2000, 2002, nebo 2003 nainstaloaný na federoaném sereru PeopleSoft 8.x IBM WebSphere Business Integration Adapter pro PeopleSoft 2.3.1, 2.4 SAP 3.x, 4.x IBM WebSphere Business Integration Adapter pro mysap.com 2.3.1, 2.4 Siebel 7, 7.5, 2000 IBM WebSphere Business Integration Adapter pro Siebel ebusiness Applications 2.3.1, 2.4 Soubory s tabulkoou strukturou Užiatelská funkce pro KEGG Užiatelské funkce pro biologii Podporoáno Podporoáno Weboé služby Specifikace SOAP 1.0., 1.1, WSDL 1.0, 1.1 Žádná HTTP XML Specifikace 1.0 Žádná Souisející koncepce: 6 Příručka pro federoané systémy

19 Co je zdroj dat? na stránce 4 Federoaná databáze Koncoým užiatelům a klientským aplikacím se zdroje dat jeí jako jediná souborná databáze prostředí DB2. Užiatelé a aplikace komunikují s federoanou databází, která je umístěna rámci federoaného sereru. Federoaná databáze obsahuje systémoý katalog. Systémoý katalog federoané databáze obsahuje položky, které určují zdroje dat a jejich lastnosti. Federoaný serer konzultuje informace uložené systémoém katalogu federoané databáze a modulu wrapper zdroje dat k určení nejlepšího plánu zpracoání příkazů SQL. Federoaný systém zpracoáá příkazy SQL, jako kdyby zdroje dat byly běžné relační tabulky nebo pohledy rámci federoané databáze. Výsledek: Federoaný systém může spojit relační data s daty nerelačních formátech. To platí i případě, že zdroje dat použíají různé podoby příkazů SQL, nebo příkazy SQL ůbec nepodporují. Vlastnosti federoané databáze mají přednost případě, že existují rozdíly mezi lastnostmi federoané databáze a lastnostmi zdrojů dat: Předpokládejme, že kódoá stránka použíaná federoaným sererem se liší od kódoé stránky použíané zdrojem dat. V případě, že jsou data racena federoanému užiateli, jsou znaky ze zdroje dat přeedeny na základě kódoé stránky použíané federoanou databází. Předpokládejme, že posloupnost řazení použíaná federoaným sererem se liší od posloupnosti řazení použíané zdrojem dat. Veškeré operace řazení u znakoých dat jsou proáděny na federoaném sereru a nikoli e zdroji dat. Souisející koncepce: Kompilátor příkazů SQL na stránce 8 Systémoý katalog federoané databáze na stránce 7 Systémoý katalog federoané databáze Systémoý katalog federoané databáze obsahuje informace o objektech e federoané databázi a informace o objektech e zdrojích dat. Katalog e federoané databázi se nazýá globální katalog, protože obsahuje informace o celém federoaném systému. Optimalizátor dotazů produktu DB2 yužíá informace z globálního katalogu a modulu wrapper zdroje dat k plánoání nejlepšího způsobu zpracoání příkazů SQL. Mezi informace uložené globálním katalogu patří zdálené i lokální informace, jako jsou jména sloupců, datoé typy sloupců, ýchozí hodnoty sloupců a informace o indexech. Vzdálené informace katalogu jsou takoé informace nebo jména, která použíá zdroj dat. Lokální informace katalogu jsou takoé informace nebo jména, která použíá federoaná databáze. Předpokládejme například, že zdálená tabulka obsahuje sloupec pojmenoaný EMPNO. V globálním katalogu bude jméno zdáleného sloupce EMPNO. Pokud nezadáte jiné jméno, bude lokální sloupec uložen se jménem EMPNO. Můžete změnit jméno lokálního sloupce na Employee_Number. Užiatelé, kteří odesílají dotazy zahrnující tento sloupec, budou dotazech použíat jméno Employee_Number místo jména EMPNO. Pomocí příkazu ALTER NICKNAME můžete změnit jména lokálních sloupců zdrojů dat. U relačních zdrojů dat zahrnují informace uložené globálním katalogu zdálené i lokální informace. Kapitola 1. Přehled federoaného systému 7

20 U nerelačních zdrojů dat jsou informace uložené globálním katalogu pro různé zdroje dat různé. Chcete-li zobrazit informace z tabulky zdroje dat, které jsou uloženy globálním katalogu, yhledejte e federoané databázi pohledy katalogu SYSCAT.TABLES, SYSCAT.TABOPTIONS, SYSCAT.INDEXES, SYSCAT.COLUMNS a SYSCAT.COLOPTIONS. Globální katalog zahrnuje také další informace o zdrojích dat. Patří sem například informace, které slouží federoanému sereru k připojení ke zdroji dat a mapoání opránění federoaných užiatelů na opránění užiatelů pro zdroje dat. Globální katalog obsahuje atributy zdrojů dat, které explicitně nastaíte, jako jsou olby sereru. Souisející koncepce: Kompilátor příkazů SQL na stránce 8 Souisející odkazy: Kompilátor příkazů SQL Optimalizátor dotazů Kapitola 19, Pohledy globální tabulce katalogu obsahující federoané informace, na stránce 205 K získání dat ze zdrojů dat zadáají užiatelé a aplikace dotazy jazyce DB2 SQL na federoanou databázi. Po odeslání dotazu kompilátor DB2 SQL konzultuje informace s globálním katalogem a modulem wrapper zdroje dat, s jejichž pomocí dotaz zpracuje. Patří sem informace o připojení ke zdroji dat, atributy sereru, mapoání, informace o indexech a statistika zpracoání. Souisející koncepce: Wrappery a moduly wrapper na stránce 11 Optimalizátor dotazů na stránce 8 V rámci procesu kompilátoru SQL slouží optimalizátor dotazů k analýzám dotazu. Kompilátor yine alternatiní strategie zpracoání dotazu, nazané přístupoé plány. Přístupoé plány mohou yolat následující typy zpracoání dotazu: Zpracoání e zdroji dat Zpracoání federoaným sererem Zpracoání částečně e zdroji dat a částečně federoaným sererem Produkt DB2 UDB yhodnotí přístupoé plány primárně na základě informací o možnostech zdroje dat a na základě dat. Modul wrapper a globální katalog tyto informace obsahují. Produkt DB2 UDB rozloží dotaz na segmenty, které se označují jako fragmenty dotazu. Obykle je účinnější zpracoání fragmentu dotazu posunout na nižší úroeň do zdroje dat, pokud zdroj dat může fragment zpracoat. Optimalizátor dotazů šak bere úahu také následující další faktory: Množstí dat, které je třeba zpracoat Rychlost zpracoání zdroje dat Množstí dat, které fragment rátí Šířka komunikačního pásma 8 Příručka pro federoané systémy

21 Skutečnost, zda je na federoaném sereru k dispozici použitelná tabulka materializoaných dotazů, která předstauje stejný ýsledek dotazu Optimalizátor dotazů ygeneruje místní a zdálené přístupoé plány pro zpracoání fragmentu dotazu, a to na základě nákladů na prostředky. Produkt DB2 UDB pak ybere plán, který praděpodobně zpracuje dotaz s nejnižšími náklady na prostředky. Pokud mají být některé fragmenty zpracoán e zdrojích dat, produkt DB2 UDB odešle takoé fragmenty do zdrojů dat. Poté, co zdroje dat zpracují fragmenty, jsou ýsledky načteny a ráceny do produktu DB2 UDB. Pokud produkt DB2 UDB proedl nějakou část zpracoání, zkombinuje jeho ýsledky s ýsledky načtenými ze zdrojů dat. Produkt DB2 UDB poté rátí šechny ýsledky klientoi. Souisející koncepce: Kompilátor příkazů SQL na stránce 8 Kompenzace na stránce 9 Vyladění zpracoání dotazů na stránce 125 Kompenzace Federoaný serer DB2 nepředá fragment dotazu případě, že jej zdroj dat nemůže zpracoat nebo že jej federoaný serer může zpracoat rychleji než zdroj dat. Předpokládejme například, že dialekt příkazu SQL zdroje dat nepodporuje seskupoání typu CUBE klauzuli GROUP BY. Dotaz, který obsahuje seskupoání typu CUBE a odkazy na tabulku tomto zdroji dat, je odeslán na federoaný serer. Produkt DB2 Information Integrator nepředá seskupoání typu CUBE do zdroje dat, ale zpracuje typ CUBE sám. Možnost produktu DB2 Information Integrator zpracoat příkaz SQL, který není podporoán zdrojem dat, se označuje jako kompenzace. Federoaný serer kompenzuje nedostatek funkcí e zdroji dat děma způsoby: Může požádat zdroj dat o použití jedné nebo íce operací, které jsou ekialentní funkci DB2 uedené dotazu. Předpokládejme, že zdroj dat nepodporuje funkci kotangens (COT(x)), ale podporuje funkci tangens (TAN(x)). Produkt DB2 Information Integrator může požádat zdroj dat o proedení ýpočtu (1/TAN(x)), který je ekialentem funkce kotangens (COT(x)). Může rátit sadu dat na federoaný serer a proést tuto funkci místně. U relačních zdrojů dat podporuje každý typ dat RDBMS podmnožinu mezinárodního standardu jazyka SQL. Některé typy dat RDBMS podporují naíc konstrukce jazyka SQL, které tento standard přeyšují. Dialekt jazyka SQLpředstauje celek příkazu SQL, který je podporoán typem dat RDBMS. Pokud je zjištěna konstrukce jazyka SQL dialektu DB2 SQL, ale nikoli dialektu relačního zdroje dat, může federoaný serer tuto konstrukci implementoat za zdroj dat. Produkt DB2 Information Integrator může kompenzoat rozdíly dialektech jazyka SQL. Příkladem takoé možnosti je klauzule obecného tabulkoého ýrazu. Jazyka DB2 SQL zahrnuje klauzuli obecného tabulkoého ýrazu. V této klauzuli může být zadáno jméno, podle kterého mohou šechny klauzule FROM plném ýběru odkazoat na ýslednou sadu. Federoaný serer zpracuje obecný tabulkoý ýraz pro zdroj dat i případě, že dialekt příkazu SQL použitý zdrojem dat obecný tabulkoý ýraz nezahrnuje. Kapitola 1. Přehled federoaného systému 9

22 Průchozí relace Prostřednictím kompenzace může federoaný serer podporoat úplný dialekt jazyka DB2 SQL pro dotazy zdrojů dat. Kompenzace je ýhodná i pro ty zdroje dat, u nichž je podpora jazyka SQL slabá nebo žádná. Dialekt jazyka DB2 SQL je třeba použít e federoaném systému kromě průchozích relací. Souisející koncepce: Průchozí relace na stránce 10 Příkazy SQL můžete předáat přímo do zdrojů dat pomocí zláštního režimu nazaného průchozí. Příkazy SQL se zadáají dialektu SQL použíaném e zdroji dat. Průchozí relaci použijte případě, že chcete proést operaci, která není možná rozhraní SQL/API produktu DB2. Použijte ji například k ytoření procedury, ytoření indexu nebo proádění dotazů přirozeném dialektu zdroje dat. Zdroje dat, které podporují průchozí relace, aktuálně podporují průchozí relace yužíající příkazy SQL. Je možné, že budoucnu budou zdroje dat podporoat průchozí dotazy pomocí jiných jazyků zdroje dat než SQL. Podobně můžete použít průchozí relaci k proádění akcí, které nejsou podporoány jazyce SQL, jako jsou například určité úlohy spráy. Průchozí relaci šak nelze použít k proádění šech úloh spráy. Můžete například ytářet nebo rušit tabulky e zdroji dat, ale nemůžete spustit nebo ukončit zdálenou databázi. V průchozí relaci lze použít statické i dynamické příkazy SQL. Federoaný serer poskytuje následující příkazy SQL pro spráu průchozích relací: SET PASSTHRU Oteře průchozí relaci. Pokud zadáte jiný příkaz SET PASSTHRU ke spuštění noé průchozí relace, bude aktuální relace ukončena. SET PASSTHRU RESET Ukončí aktuální průchozí relaci. GRANT (opránění pro serer) Udělí užiateli, skupině, seznamu autorizačních identifikátorů nebo skupině PUBLIC opránění ke spuštění průchozích relací do zadaného zdroje dat. REVOKE (opránění pro serer) Odebere opránění spouštět průchozí relace. Pro průchozí relace platí následující omezení: Je třeba použíat dialekt jazyka SQL nebo příkazy jazyce zdroje dat nelze použít dialekt jazyka DB2 SQL. V důsledku toho nezadááte dotaz pro přezdíku, ale přímo pro objekty zdroje dat. Při proádění operací UPDATE nebo DELETE průchozí relaci nelze použíat podmínku WHERE CURRENT OF CURSOR. Objekty LOB nejsou průchozích relacích podporoány. Souisející koncepce: Wrappery a moduly wrapper na stránce 11 Odesílání dotazů do zdrojů dat přímo prostřednictím průchozí relace na stránce Příručka pro federoané systémy

23 Wrappery a moduly wrapper Wrappery jsou mechanismy, podle kterých probíhá integrace federoaného sereru se zdroji dat. Federoaný serer použíá rutiny uložené knihoně nazané modul wrapper k implementaci wrapperu. Tyto rutiny umožňují federoanému sereru proádět akce, jako je připojení se ke zdroji dat a iteratiní načítání dat z tohoto sereru. Vlastník federoané instance produktu DB2 zpraidla použíá příkaz CREATE WRAPPER k registraci wrapperu e federoané databázi. Wrapper můžete zaregistroat jako chráněný nebo důěryhodný pomocí olby wrapperu DB2_FENCED. Pro každý typ zdroje dat, se kterým chcete pracoat, je třeba ytořit jeden wrapper. Předpokládejme například, že chcete pracoat se třemi databázoými tabulkami produktu DB2 for z/os, jednou tabulkou produktu DB2 for iseries, děma tabulkami Informix a jedním pohledem Informix. Je třeba ytořit jeden wrapper pro objekty zdroje dat DB2 a jeden pro objekty zdroje dat Informix. Po registraci těchto wrapperů e federoané databázi je můžete použít pro přístup k dalším objektům z těchto zdrojů dat. Můžete například použít wrapper DRDA se šemi objekty zdroje dat řady produktů DB2: DB2 for Linux, UNIX, and Windows, DB2 for z/os and OS/390, DB2 for iseries a DB2 Serer for VM and VSE. Pomocí definicí sereru a přezdíek můžete označit specifika (jméno, umístění atd.) každého objektu zdroje dat. Wrapper slouží k proádění celé řady úloh. Mezi tyto úlohy patří následující: Připojuje se ke zdroji dat. Modul wrapper použíá standardní rozhraní API pro připojení ke zdroji dat. Předáá dotazy do zdroje dat. U zdrojů dat, které podporují příkazy SQL, je dotaz spuštěn jazyce SQL. U zdrojů dat, které příkazy SQL nepodporují, je dotaz přeložen do přirozeného dotazoacího jazyka e zdroji nebo do řady olání API zdroje. Obdrží ýsledky ze zdroje dat. Wrapper použíá standardní rozhraní API zdroje dat pro získání ýsledných sad. Odpoí na dotazy federoaného sereru týkající se ýchozího mapoání datoého typu pro zdroj dat. Wrapper obsahuje ýchozí mapoání typů, která se použíají, jakmile jsou ytořeny přezdíky pro objekt zdroje dat. U relačních modulů wrapper ytořené mapoání datoého typu přepíše ýchozí mapoání datoého typu. Mapoání datoých typů definoaných užiatelem jsou uložena globálním katalogu. Odpoí na dotazy federoaného sereru týkající se ýchozího mapoání funkcí pro zdroj dat. Wrapper obsahuje informace, které federoaný serer potřebuje k určení, zda jsou funkce DB2 mapoány do funkcí e zdroji dat, a také jakým způsobem jsou funkce mapoány. Tyto funkce pak použije kompilátor SQL k určení, zda zdroj dat může proádět operace dotazu. U relačních wrapperů přepíše mapoání funkcí, které ytoříte, ýchozí mapoání typu funkcí. Mapoání užiatelských funkcí jsou uložena globálním katalogu. Volby modulu wrapper slouží ke konfiguraci modulu wrapper nebo k určení způsobu, jakým produkt DB2 Information Integrator použíá modul wrapper. Souisející koncepce: Definice a olby sereru na stránce 13 Souisející úlohy: Trusted and fenced mode process enironments příručce IBM DB2 Information Integrator Wrapper Deeloper s Guide Úpraa modulu wrapper na stránce 25 Kapitola 1. Přehled federoaného systému 11

24 Souisející odkazy: ALTER WRAPPER statement příručce SQL Reference, Volume 2 Kapitola 20, Volby modulu wrapper pro federoané systémy, na stránce 209 Výchozí jména modulu wrapper na stránce 12 Výchozí jména modulu wrapper Pro každý podporoaný zdroj dat existuje modul wrapper. Některé moduly wrapper mají ýchozí jména. Pokud k ytoření modulu wrapper použijete ýchozí jméno, federoaný serer automaticky zolí knihonu zdroje dat spojenou s tímto modulem wrapper. Tabulka 2. Výchozí jména modulu wrapper pro každý zdroj dat. Zdroj dat DB2 Uniersal Database for Linux, UNIX and Windows DB2 Uniersal Database for z/os and OS/390 DB2 Uniersal Database for iseries DB2 Serer for VM and VSE Informix Microsoft SQL Serer ODBC OLE DB Oracle Sybase Teradata BLAST BioRS Documentum Entrez Extended Search HMMER Microsoft Excel Soubory s tabulkoou strukturou Weboé služby WebSphere Business Integration XML Souisející koncepce: Wrappery a moduly wrapper na stránce 11 Výchozí jména modulu wrapper DRDA DRDA DRDA DRDA INFORMIX MSSQLODBC3 ODBC OLEDB NET8 CTLIB TERADATA Žádná Žádná Žádná Žádná Žádná Žádná Žádná Žádná Žádná Žádná Žádná 12 Příručka pro federoané systémy

25 Definice a olby sereru Po ytoření modulů wrapper pro zdroje dat definuje federoaný lastník instance zdroje dat pro federoanou databázi. Vlastník instance zadá jméno pro označení zdroje dat a další informace týkající se zdroje dat. Patří sem: Typ a erze zdroje dat Jméno databáze zdroje dat (pouze RDBMS) Metadata specifická pro daný zdroj dat Zdroj dat skupiny produktů DB2 může mít například několik databází. Definice musí určoat, ke které databázi se federoaný serer může připojoat. Zdroj dat produktu Oracle má naproti tomu jednu databázi a federoaný serer se může připojit k databázi, aniž by znal její jméno. Jméno databáze není definici federoaného sereru pro zdroj dat produktu Oracle obsaženo. Jméno a další informace, které lastník instance zadá na federoaný serer, se souhrnně nazýají definice sereru. Zdroje dat odpoídají na požadaky na data, a samy o sobě jsou tedy serery. Příkazy CREATE SERVER a ALTER SERVER slouží k ytoření a změně definice sereru. Některé informace rámci definice sereru jsou uloženy jako olby sereru. Po ytoření definicí sereru je důležité porozumět olbám, které můžete pro serer zadat. Některé olby sereru slouží ke konfiguraci modulu wrapper a jiné oliňují způsob, jakým produkt DB2 Information Integrator použíá modul wrapper. Volby sereru lze nastait tak, aby přetráaly přes po sobě jdoucí připojení ke zdroji dat, nebo tak, aby traly pouze po dobu jednoho připojení. Mapoání užiatelů Souisející koncepce: Mapoání užiatelů na stránce 13 Souisející odkazy: Kapitola 21, Volby sereru pro federoané systémy, na stránce 211 Když federoaný serer potřebuje posunout požadaek na nižší úroeň do zdroje dat, musí nejpre ytořit připojení ke zdroji dat. Federoaný serer toho u ětšiny zdrojů dat dosáhne s použitím platného jména užiatele a hesla pro příslušný zdroj dat. Pokud je pro připojení ke zdroji dat požadoáno jméno užiatele a heslo, můžete definoat asociaci mezi autorizačním identifikátorem federoaného sereru a jménem užiatele a heslem zdroje dat. Tuto asociaci lze ytořit pro každé jméno užiatele, které federoaný serer použije k odesílání distribuoaných požadaků. Nazýá se mapoání užiatele. V některých případech není nutné ytářet mapoání užiatele, pokud jméno užiatele a heslo použité pro připojení k federoané databázi je stejné jako to, které jste použili pro získání přístupu ke zdálenému zdroji dat. Souisející úlohy: Kapitola 1. Přehled federoaného systému 13

26 Registering user mappings for a data source příručce IBM DB2 Information Integrator Data Source Configuration Guide Souisející odkazy: Kapitola 22, Volby mapoání užiatelů pro federoaný systém, na stránce 225 Přezdíky a objekty zdrojů dat Po ytoření definic sererů a mapoání užiatelů ytoří federoaný lastník instance přezdíky. Přezdíka je identifikátor, který slouží jako reference objektu umístěného e zdrojích dat, ke kterým chcete získat přístup. Objekty, které jsou označeny přezdíkami, se označují jako objekty zdrojů dat. Přezdíky nejsou alternatiními jmény objektů zdrojů dat e smyslu aliasů. Jde o ukazatele, pomocí kterých federoaný serer odkazuje na tyto objekty. Přezdíky jsou obykle definoány pomocí příkazu CREATE NICKNAME spolu se specifickými olbami sloupců přezdíky a olbami přezdíky. Když koncoý užiatel nebo klientská aplikace odešle distribuoaný požadaek na federoaný serer, nemusí být požadaku uedeny zdroje dat. Místo nich něm mohou být uedeny přezdíky objektů zdrojů dat. Přezdíky jsou mapoány na specifické objekty zdrojů dat. Tato mapoání eliminují nutnost kalifikoat přezdíky pomocí jmen zdrojů dat. Umístění objektů zdrojů dat je pro koncoého užiatele nebo klientskou aplikaci transparentní. Příklad: Definoali jste přezdíku DEPT předstaující databázoou tabulku produktu Informix nazanou NFX1.PERSON. Příkaz SELECT * FROM DEPT je pro federoaný serer poolen. Příkaz SELECT * FROM NFX1.PERSON šak pro federoaný serer poolen není (kromě průchozí relace), pokud na federoaném sereru neexistuje místní tabulka nazaná NFX1.PERSON. Po ytoření přezdíky pro objekt zdroje dat budou metadata tohoto objektu přidána do globálního katalogu. Optimalizátor dotazu tato metadata použije spolu s informacemi modulu wrapper k získání přístupu k objektu zdroje dat. Pokud je například přezdíka určena pro tabulku obsahující index, bude globální katalog obsahoat informace o tomto indexu. Modul wrapper obsahuje mapoání mezi datoými typy DB2 a datoými typy zdroje dat. V současné době nelze pro přezdíky spouštět některé operace obslužných programů produktu DB2 UDB. Nelze také použít obslužný program Cross Loader ke křížoému načtení do přezdíky. Souisející koncepce: Volby sloupců přezdíek na stránce 16 Souisející odkazy: Kapitola 24, Volby sloupců přezdíek pro federoané systémy, na stránce 235 Kapitola 23, Volby přezdíek pro federoané systémy, na stránce 227 Platné objekty zdrojů dat na stránce Příručka pro federoané systémy

27 Platné objekty zdrojů dat Přezdíky označují objekty e zdroji dat, ke kterým chcete přistupoat. Následující tabulka uádí typy objektů, pro které můžete ytořit přezdíky pro federoaný systém. Tabulka 3. Platné objekty zdrojů dat Zdroj dat DB2 for Linux, UNIX, and Windows DB2 for z/os and OS/390 DB2 for iseries DB2 for VM and VSE Informix Microsoft SQL Serer ODBC Oracle Sybase Teradata BLAST BioRS Documentum Entrez Extended Search HMMER Microsoft Excel Soubory s tabulkoou strukturou Adaptéry produktu Websphere Business Integration Weboé služby Soubory se značkami XML Souisející koncepce: Přezdíky a objekty zdrojů dat na stránce 14 Volby sloupců přezdíek na stránce 16 Platné objekty Přezdíky, tabulky materializoaných dotazů, tabulky, pohledy Tabulky, pohledy Tabulky, pohledy Tabulky, pohledy Tabulky, pohledy, synonyma Tabulky, pohledy Tabulky, pohledy Tabulky, pohledy, synonyma Tabulky, pohledy Tabulky, pohledy Soubory FASTA indexoané pro algoritmy yhledáání BLAST Databanky BioRS Objekty a registroané tabulky produktu Documentum Docbase Databáze produktu Entrez Soubory ze zdrojů dat, jako jsou databáze Lotus Notes, Microsoft Access, Microsoft Index Serer, moduly yhledáání na webu a adresáře LDAP. Soubory databáze HMM (knihony hierarchických Markooých modelů, jako je PFAM), které lze yhledáat pomocí programů hmmpfam nebo hmmsearch systému HMMER. Soubory s příponou XLS (přístup pouze k prnímu listu sešitu) Textoé soubory, které splňují specifický formát. Objekty produktu Websphere Business Integration, které jsou mapoány do rozhraní BAPI produktu SAP, obchodní objekty produktu Siebel a součásti rozhraní produktu PeopleSoft Operace souboru jazyce popisu weboé služby Množiny položek dokumentu XML Kapitola 1. Přehled federoaného systému 15

28 Volby sloupců přezdíek Do globálního katalogu můžete zadat další informace o metadatech týkající se objektu přezdíky. Tato metadata popisují hodnoty určitých sloupcích objektu zdroje dat. Přiřazují se k parametrům, které se nazýají olby sloupců přezdíek. Volby sloupců přezdíek sdělují modulu wrapper, že má data e sloupci zpracoat jinak, než by tomu bylo za normálních okolností. Kompilátor SQL a optimalizátor dotazů použíají metadata k ytáření lepších plánů pro přístup k datům. Volby sloupců přezdíek také poskytují modulu wrapper další informace. Například u zdrojů dat XML sdělí olba sloupců přezdíek modulu wrapper ýraz XPath, který se má použít, když modul wrapper analyzuje sloupec mimo dokument XML. Prostřednictím federoání pracuje serer DB2 s objektem zdroje dat, na který přezdíka odkazuje, jako by se jednalo o místní tabulku DB2. V důsledku toho můžete nastait olby sloupců přezdíek pro liboolné objekty zdrojů dat, pro které ytáříte přezdíky. Některé olby sloupců přezdíek jsou určeny pro specifické typy zdrojů dat a lze je použít pouze u těchto zdrojů dat. Příklad: Zdroj dat obsahuje posloupnost řazení, která se liší od posloupnosti řazení e federoané databázi. Federoaný serer obykle neřadí žádné sloupce, které obsahují znakoá data, e zdroji dat. Vrátí data do federoané databáze a proede seřazení místně. Předpokládejme šak, že se jedná o sloupec se znakoým datoým typem (CHAR nebo VARCHAR), který obsahuje pouze číselné znaky ( 0, 1,..., 9 ). To můžete označit přiřazením hodnoty Y k olbě sloupce přezdíek NUMERIC_STRING. Tím poskytnete optimalizátoru dotazů DB2 možnost proést řazení e zdroji dat. Pokud řazení proedete zdáleně, můžete se yhnout zatížení spočíajícímu přenesení dat na federoaný serer a místním seřazení. Volby sloupců přezdíek můžete definoat pro relační přezdíky pomocí příkazů ALTER NICKNAME. Pro nerelační přezdíky můžete olby sloupců přezdíek definoat pomocí příkazů CREATE NICKNAME a ALTER NICKNAME. Souisející koncepce: Mapoání datoých typů na stránce 16 Souisející úlohy: Práce s přezdíkami na stránce 93 Souisející odkazy: Kapitola 24, Volby sloupců přezdíek pro federoané systémy, na stránce 235 Mapoání datoých typů Má-li federoaný serer načítat data ze zdrojů dat, musí být datoé typy e zdroji dat mapoány na odpoídající datoé typy produktu DB2. Několik případů ýchozího mapoání datoých typů: Datoý typ produktu Oracle FLOAT je mapoán do typu produktu DB2 DOUBLE. Datoý typ produktu Oracle DATE je mapoán do typu DB2 TIMESTAMP. Datoý typ produktu DB2 for z/os DATE je mapoán do typu produktu DB2 DATE. 16 Příručka pro federoané systémy

29 Pro ětšinu typů dat se ýchozí mapoání typů jsou obsažena modulech wrapper. Výchozí mapoání typů pro zdroje dat DB2 jsou obsažena modulu wrapper DRDA. Výchozí mapoání typů pro produkt Informix jsou obsažena modulu wrapper INFORMIX atd. U některých nerelačních zdrojů dat je třeba zadat informace o typu dat příkazu CREATE NICKNAME. Pro každý sloupec objektu zdroje dat je při ytoření přezdíky třeba zadat odpoídající datoý typ prosuktu DB2 for Linux, UNIX, and Windows. Každý sloupec musí být namapoán do určitého pole nebo sloupce objektu zdroje dat. U relačních zdrojů dat můžete přepsat ýchozí mapoání typů dat. Ve ýchozím nastaení jsou například typy dat INTEGER pro systém Informix mapoány do datoého typu INTEGER produktu DB2. Výchozí mapoání můžete přepsat a namapoat datoý typ INTEGER systému Informix do datoého typu DB2 DECIMAL(10,0). Před ytořením přezdíek byste měli ytořit mapoání noého typu nebo změnit ýchozí typ mapoání. Jinak přezdíky ytořené před změnami typu mapoání nebudou noé mapoání odrážet. Mapoání funkcí Souisející koncepce: Mapoání datoých typů e federoaném systému na stránce 43 Aby mohl federoaný serer rozpoznat funkci zdroje dat, musí být tato funkce namapoána do existující příslušné funkce systému DB2 for Linux, UNIX, and Windows. Produkt DB2 Information Integrator dodá ýchozí mapoání mezi existujícími funkcemi integroaných zdrojů dat a integroanými doplňujícími funkcemi produktu DB2. Pro ětšinu zdrojů dat je ýchozí mapoání typů obsaženo modulech wrapper. Výchozí mapoání funkcí do funkcí systémů DB2 for z/os a OS/390 je obsaženo modulu wrapper DRDA. Výchozí mapoání funkcí pro funkce Sybase jsou modulu wrapper CTLIB atd. U relačních zdrojů dat můžete ytořit mapoání funkce, pokud chcete použít funkci zdroje dat, kterou federoaný serer nerozpozná. Vytořené mapoání je použito mezi funkcí zdroje dat a příslušnou funkcí DB2 e federoané databázi. Mapoání funkcí se použíají typicky při zpřístupnění noé estaěné funkce a noé užiatelské funkce e zdroji dat. Mapoání funkcí se použíají také případě, že příslušná funkce databáze DB2 neexistuje. V tomto případě je třeba také ytořit šablonu funkce. Specifikace indexů Souisející koncepce: Mapoání funkcí e federoaném systému na stránce 55 Specifikace indexů na stránce 17 Po ytoření přezdíky pro tabulku zdroje dat budou informace o indexech, které tabulka zdroje dat obsahuje, přidány do globálního katalogu. Optimalizátor dotazů použije tyto informace k urychlení zpracoání distribuoaných požadaků. Informace katalogu o indexu zdroje dat jsou tořeny sadou metadat a označoány ýrazem specifikace indexu. Federoaný serer neytáří specifikaci indexu, jakmile ytoříte přezdíky pro následující položky: Tabulka bez indexů Pohled, který obykle nemá e zdáleném katalogu uloženy žádné informace o indexu Kapitola 1. Přehled federoaného systému 17

30 Posloupnosti řazení Objekt zdroje dat, který nemá zdálený katalog, ze kterého může federoaný serer získat informace o indexu Předpokládejme například, že tabulka získá noý index ke stáajícím indexům, které obsahoala době ytoření přezdíky. Protože jsou informace o indexech předány globálnímu katalogu době ytoření přezdíky, federoaný serer o noém indexu neí. Pokud je podobně ytořena přezdíka pro pohled, federoaný serer nemá informace o podkladoé tabulce (a jejích indexech), ze které byl pohled generoán. Za těchto okolností můžete požadoané informace o indexu zadat do globálního katalogu. Můžete ytořit specifikace indexů pro tabulky, které nemají žádné indexy. Specifikací indexu sdělíte optimalizátoru dotazů, které sloupce tabulky má prohledáat, aby data našel rychle. Souisející koncepce: Specifikace indexů e federoaném systému na stránce 67 Pořadí, e kterém jsou znakoá data řazena databázi, záisí na struktuře dat a na definoané posloupnosti řazení pro databázi. Předpokládejme, že šechna data databázi jsou tořena elkými písmeny a že neobsahují žádné číselné ani speciální znaky. Řazení dat by mělo ést ke stejnému ýstupu bez ohledu na to, zda jsou data řazena e zdroji dat nebo e federoané databázi. Posloupnost řazení použitá každou databází by neměla mít li na ýsledky řazení. Podobně, pokud jsou šechna data databázi tořena malými písmeny nebo pouze číselnými znaky, musí operace řazení dat ést ke stejným ýsledkům bez ohledu na to, kde je proáděno lastní řazení. Odlišné jsou případy, kdy data mají některou z následujících struktur: Kombinace písmen a číselných znaků Kombinace elkých i malých písmen Speciální znaky, #, Řazení takoých dat může ést k různým ýstupům případech, kdy federoaná databáze a zdroj dat použíají odlišné posloupnosti řazení. Obecně řečeno, posloupnost řazení je definoané pořadí znakoých dat, které určuje, zda je konkrétní znak posloupnosti umístěn před jiným znakem či za ním (nebo je s ním shodný). Jak posloupnost řazení určuje pořadí řazení Posloupnost řazení určuje pořadí při řazení znaků kódoané znakoé sadě. Znakoá sada je množina znaků použíaných počítačoých systémech či programoacích jazycích. V kódoané znakoé sadě je každému znaku přiřazeno jiné číslo rozsahu 0 až 255 (nebo jeho hexadecimální ekialent). Tato čísla se nazýají místa kódu; přiřazení čísel ke znakům sadě je souhrnně označoáno jako kódoá stránka. Kromě přiřazení k určitému znaku může být místo kódu mapoáno na určitou pozici znaku pořadí řazení. Technicky řečeno, posloupnost řazení je souhrnné mapoání míst kódu určité znakoé sady na pozice pořadí řazení znaků této sady. Pozice znaku je reprezentoána číslem. Toto číslo se nazýá áha znaku. V nejjednodušší posloupnosti řazení nazýané posloupnost identity jsou áhy identické s příslušným místem kódu. 18 Příručka pro federoané systémy

31 Předpokládejme, že databáze ALPHA například použíá posloupnost řazení kódoé stránky EBCDIC a že databáze BETA použíá ýchozí posloupnost řazení kódoé stránky ASCII. Pořadí řazení pro znakoé řetězce se budou těchto dou databázích lišit, jak je znázorněno následujícícm příkladu: SELECT... ORDER BY COL2 Řazení podle EBCDIC Řazení podle ASCII COL2 COL V1G 7AB Y2W V1G 7AB Y2W Podobně poronání znaků databázi záisí na posloupnosti řazení definoané pro tuto databázi. V tomto příkladu použíá databáze ALPHA ýchozí posloupnost řazení kódoé stránky EBCDIC. Databáze BETA použíá ýchozí posloupnost řazení kódoé stránky ASCII. Poronání znaků těchto dou databázích poede k různým ýsledkům, jak je uedeno následujícím příkladu: SELECT... WHERE COL2 > TT3 Výsledky podle EBCDIC Výsledky podle ASCII COL2 COL TW4 TW4 X82 X82 39G Nastaení lokální posloupnosti řazení pro optimalizaci dotazů Administrátoři mohou ytářet federoané databáze s určitou posloupností řazení, která je e shodě s posloupností řazení zdroje dat. Poté bude olba sereru COLLATING_SEQUENCE definici sereru každého zdroje dat nastaena na hodnotu Y. Toto nastaení informuje federoanou databázi o tom, že posloupnosti řazení federoané databáze a zdroje dat se shodují. Posloupnost řazení federoané databáze byla nastaena jako součást rozhraní API příkazu CREATE DATABASE. Pomocí tohoto rozhraní API můžete určit některou z následujících posloupností: Posloupnost identity Systémoá posloupnost (posloupnost použíaná operačním systémem podporujícím databázi) Vlastní posloupnost (předdefinoaná posloupnost poskytnutá produktem DB2 UDB nebo definoaná užiatelem) Předpokládejme, že zdrojem dat je produkt DB2 for z/os and OS/390. Řazení definoaná klauzuli ORDER BY jsou implementoána posloupností řazení založenou na kódoé stránce EBCDIC. Chcete-li načíst data produktu DB2 for z/os and OS/390 e shodě s klauzulemi ORDER BY, konfigurujte federoanou databázi tak, aby použíala předdefinoanou posloupnost řazení založenou na příslušné kódoé stránce EBCDIC. Souisející koncepce: Charakteristika sereru oliňující možnosti posunutí na nižší úroeň na stránce 128 Kapitola 1. Přehled federoaného systému 19

32 Collating sequences in a federated system příručce IBM DB2 Information Integrator Data Source Configuration Guide Souisející úlohy: Creating a federated database příručce IBM DB2 Information Integrator Data Source Configuration Guide Souisející odkazy: National language ersions příručce Administration Guide: Planning Federated database national language considerations příručce IBM DB2 Information Integrator Data Source Configuration Guide Interakce s federoaným systémem Protože federoaná databáze součástí produktu DB2 Uniersal Database, můžete pracoat s federoaným systémem pomocí některé z následujících metod: Příkazoý procesor DB2 (CLP) Rozhraní GUI Příkazoého centra DB2 Rozhraní GUI Řídicího centra DB2 Aplikační programy Nástroje skupiny produktů DB2 Poskytoatelé weboých služeb Kroky e federoané dokumentaci nabízejí příkazy a příkazy SQL, které lze zadat příkazoém procesoru DB2 nebo grafickém užiatelském rozhraní Příkazoého centra DB2. Dokumentace označuje, kdy lze proádět úlohy prostřednictím rozhraní GUI Řídicího centra DB2. Protože je rozhraní GUI Řídicího centra DB2 intiutiní, nejsou kroky potřebné k proádění těchto úloh Řídicím centru DB2 součástí této dokumentace. Příkazoý procesor DB2 (CLP) Prostřednictím příkazoého procesoru DB2 můžete proádět ětšinu úloh nezbytných k nastaení, konfiguraci, ladění a údržbě federoaného systému. V některých případech je nutné použít buď příkazoý procesor DB2, nebo Příkazoé centrum DB2. Příklad: Vytoření, změna nebo zrušení mapoání datoých typů definoaných užiatelem Vytoření, změna nebo zrušení mapoání funkcí definoaných užiatelem Příkazoé centrum DB2 Prostřednictím Příkazoého centra DB2 můžete ytářet a spouštět distribuoané požadaky bez nutnosti ručně zadáat dlouhé příkazy SQL. Příkazoé centrum DB2 použijte, pokud ladíte ýkon federoaného systému. Příkazoé centrum DB2 předstauje pohodlný způsob yužití funkce Vysětlení produktu DB2 k získání přístupoých plánů k distribuoaným požadakům. Příkazoé centrum DB2 lze roněž použít k práci s nástrojem Asistent pro dotazy SQL. Řídicí centrum DB2 Grafické užiatelské rozhraní Řídicího centra DB2 umožňuje proádění ětšiny úloh nezbytných k nastaení, konfiguraci a změně federoaného systému. Pomocí panelů, jako jsou dialogoá okna a průodci, ás proede úlohou. Tyto panely zobrazují interaktiní nápoědu po umístění ukazatele myši na oládací prek, jako je okénko se seznamem nebo příkazoé tlačítko. Každý panel má naíc tlačítko nápoědy, která obsahuje informace o úloze panelu a odkazy na souisející pojmy a referenční informace. 20 Příručka pro federoané systémy

33 Průodce můžete použít k ytoření federoaných objektů nebo můžete každý objekt ytořit samostatně. Pomocí Řídicího centra DB2 můžete konfiguroat přístup k weboým službám, produktu WebSphere Business Integration a zdrojům dat XML. Funkce integroané Řídicím centru DB2 zjednodušují kroky, které jsou nutné ke konfiguraci federoaného sereru tak, aby bylo možné k těmto zdrojům dat získat přístup. Grafické užiatelské rozhraní Řídicího centra DB2 je nejjednodušším způsobem proádění základních úloh konfigurace zdrojů dat: Vytoření modulů wrapper a nastaení jejich oleb Zadání proměnných prostředí pro zdroj dat Vytoření definicí sereru a nastaení oleb sereru Vytoření mapoání užiatelů a nastaení užiatelských oleb Vytoření přezdíek a nastaení oleb přezdíek nebo oleb sloupců Po konfiguraci federoaného sereru pro přístup ke zdrojům dat můžete Řídicím centru DB2 proést následující akce: Úpraa atributů sloupce Sledoání stau přezdíek a sererů Udržoání aktuální statistiky přezdíek Vytoření a úpray tabulek mezipaměti Určení informačních podmínek pro přezdíky Vytoření zdálených tabulek prostřednictím produktu DB2 Information Integrator pomocí transparentního jazyka DDL Aplikační programy Aplikace neyžadují žádné zláštní kódoání, aby mohly pracoat s federoanými daty. Mají přístup k systému stejně jako šechny jiné klientské aplikace produktu DB2. Aplikace mají společné rozhraní s federoanou databází, která je na federoaném sereru. K získání dat ze zdrojů dat aplikace odesílají dotazy jazyce DB2 SQL do federoané databáze. Produkt DB2 Information Integrator poté dotazy rozdělí do příslušných zdrojů dat, shromáždí požadoaná data a rátí tato data do aplikací. Protože ale produkt DB2 Information Integrator pracuje se zdroji dat prostřednictím přezdíek, je třeba mít na ědomí následující skutečnosti: Omezení jazyka SQL, která platí při práci s přezdíkami Způsob proádění operací objektech s přezdíkami Skupina produktů DB2 S federoanou databází můžete roněž pracoat pomocí nástrojů pro sáloé počítače a střední serery, jako jsou: DB2 SPUFI pro produkt DB2 for z/os and OS/390 Interactie SQL (STRSQL) pro produkt DB2 for iseries Poskytoatelé weboých služeb S federoanou databází můžete roněž pracoat prostřednictím poskytoatelů weboých služeb pomocí modulu wrapper Weboé služby. Souisející koncepce: The Web serices wrapper and the Web serices description language document příručce IBM DB2 Information Integrator Data Source Configuration Guide Kapitola 1. Přehled federoaného systému 21

34 Souisející úlohy: Adding Web serices data sources to a federated serer příručce IBM DB2 Information Integrator Data Source Configuration Guide 22 Příručka pro federoané systémy

35 Část 2. Administrace a údržba Copyright IBM Corp. 1998,

36 24 Příručka pro federoané systémy

37 Kapitola 2. Změna konfigurací zdroje dat Abyste mohli přistupoat ke zdrojům dat, je třeba praidelně proádět úpray konfigurace, kterou jste nastaili na počátku. Může být například nutné zaregistroat definici sereru pro noý serer, ke kterému chcete přistupoat. Může být nutné změnit mapoání užiatele mezi federoanou databází a zdáleným zdrojem dat, pokud se změní heslo zdáleného zdroje dat. Může být také nutné přidat olby sloupců k přezdíce, aby se ylepšil ýkon. Obsah této kapitoly: Úpraa modulu wrapper Úpraa modulu wrapper Změna definicí sereru a oleb sereru na stránce 26 Změna mapoání užiatele na stránce 30 Změna přezdíky na stránce 31 Zrušení modulu wrapper na stránce 38 Zrušení definice sereru na stránce 39 Zrušení mapoání užiatele na stránce 41 Zrušení přezdíky na stránce 41 Po dokončení konfigurace modulu wrapper budete praděpodobně chtít uprait konfiguraci na základě konkrétních systémoých požadaků. Pomocí příkazu ALTER WRAPPER lze proádět následující akce: Přidat, uprait nebo odebrat jednu nebo íce oleb modulu wraper Nastait proměnné prostředí, registrů či profilů Předpoklady: Autorizačnímu ID sdruženému s příkazem musí odpoídat opránění SYSADM nebo DBADM. Omezení: Volbu modulu wrapper DB2_FENCED nelze zrušit. Postup: Modul wrapper lze uprait z Řídicího centra DB2 nebo s použitím příkazoého řádku DB2. Postup při úpraě modulu wrapper z Řídicího centra DB2: 1. Rozbalte složku Federoané databázoé objekty. V podokně obsahu okně Řídicí centrum DB2 jsou zobrazeny objekty modulů wrapper. 2. Klepněte praým tlačítkem myši na modul wrapper, který chcete změnit, a poté klepněte seznamu akcí na tlačítko Změnit. Oteře se zápisník Změnit modul wrapper. Na stránce Nastaení proeďte požadoané změny. Po klepnutí na olbu Nastait proměnné můžete nastait proměnné prostředí zdroje dat pro daný modul wrapper. Proměnné prostředí nejsou yžadoány pro šechny moduly wrapper. Copyright IBM Corp. 1998,

38 3. Klepnutím na tlačítko OK potrdíte změnu modulu wrapper a zařete okno Změnit modul wrapper. Chcete-li změnit modul wrapper pomocí příkazoého řádku DB2, zadejte příkaz ALTER WRAPPER. Souisející úlohy: Checking the data source enironment ariables příručce IBM DB2 Information Integrator Data Source Configuration Guide Zrušení modulu wrapper na stránce 38 Souisející odkazy: ALTER WRAPPER statement příručce SQL Reference, Volume 2 Změna modulu wrapper - příklady na stránce 26 Změna modulu wrapper - příklady Chcete-li změnit nastaení olby DB2_FENCED na hodnotu Y pro modul wrapper se jménem drda, zadejte následující příkaz: ALTER WRAPPER drda OPTIONS (SET DB2_FENCED Y ); Chcete-li změnit olbu MODULE na hodnotu /opt/odbc/lib/libodbc.a(odbc.so) pro modul wrapper se jménem odbc, zadejte následující příkaz: ALTER WRAPPER odbc OPTIONS (SET MODULE /opt/odbc/lib/libodbc.a(odbc.so) ); Souisející úlohy: Úpraa modulu wrapper na stránce 25 Změna definicí sereru a oleb sereru Definice sereru identifikuje zdroj dat pro federoanou databázi. Definice sereru je tořena lokálním jménem a dalšími údaji týkajícími se příslušného sereru zdroje dat. Definice sereru je modulem wrapper použíána při odesílání příkazů SQL s přezdíkami do federoané databáze. Definici sereru lze uprait pomocí příkazu ALTER SERVER. Některé údaje obsažené definici sereru jsou uloženy jako olby sereru. Při úpraě definice sereru je důležité mít spránou předstau o olbách, které lze pro serer určit. Některé olby sereru určují konfiguraci modulu wrapper a některé mají li na způsob použití modulu wrapper produktu DB2 UDB. Volby sereru jsou zadány jako parametry příkazech CREATE SERVER a ALTER SERVER. Kromě toho lze pro relační zdroje dat dočasně nastait olby sereru pomocí příkazu SET SERVER OPTION. Tento příkaz přepíše hodnotu olby sereru definici sereru na dobu trání jednoho připojení k federoané databázi. Sloo SERVER a jména parametrů začínající řetězcem serer příkazu ALTER SERVER odkazují pouze na zdroje dat e federoané databázi. Tyto hodnoty neodkazují k federoanému sereru ani k aplikačním sererům DRDA. Předpoklady: Autorizační ID zadáající příkaz ALTER SERVER musí mít opránění SYSADM nebo DBADM pro federoanou databázi. 26 Příručka pro federoané systémy

39 Omezení: V příkazu ALTER SERVER nelze zadat modul wrapper, který není pro federoaný serer registroán. Federoaný serer nemůže zpracoat příkaz ALTER SERVER rámci dané transakce následujících případech: Příkaz odkazuje na určitý datoý zdroj a transakce již zahrnuje některý z následujících příkazů: Příkaz SELECT, který odkazuje na přezdíku pro tabulku nebo pohled rámci daného zdroje dat Oteřený kurzor na přezdíce pro tabulku nebo pohled rámci daného zdroje dat Příkaz insert, delete nebo update spuštěný na přezdíku pro tabulku nebo pohled rámci daného zdroje dat Příkaz odkazuje na kategorii zdrojů dat (například na šechny zdroje dat specifického typu a erze) a transakce již obsahuje některý z následujících příkazů: Příkaz SELECT, který odkazuje na přezdíku pro tabulku nebo pohled rámci některého ze zdrojů dat Oteřený kurzor na přezdíce pro tabulku nebo pohled rámci některého ze zdrojů dat Příkaz insert, delete nebo update spuštěný na přezdíku pro tabulku nebo pohled rámci některého ze zdrojů dat Definici sereru uprate následujících případech: pokud proádíte přechod na noou erzi zdroje dat, pokud chcete proést stejnou změnu e šech definicích sereru pro specifický typ zdrojů dat, pokud chcete přidat nebo změnit některou olbu sereru rámci existující definice sereru. Souisející úlohy: Změna erze zdroje dat definici sereru na stránce 27 Zrušení definice sereru na stránce 39 Souisející odkazy: Kapitola 21, Volby sereru pro federoané systémy, na stránce 211 Změna definic sereru a podrobností oleb sereru Definici sereru lze změnit příkazem ALTER SERVER. Změna erze zdroje dat definici sereru V existující definici sereru můžete změnit erzi zdroje dat, kterou zdálený serer použíá. Předpoklady: Autorizační ID zadáající příkaz ALTER SERVER musí mít opránění SYSADM nebo DBADM pro federoanou databázi. Postup: Definici sereru lze změnit z Řídicího centra DB2 nebo pomocí příkazoého řádku. Kapitola 2. Změna konfigurací zdroje dat 27

40 Chcete-li proést tuto úlohu pomocí Řídicího centra DB2, postupujte takto: 1. Rozbalte složku Federoané databázoé objekty. Objekty definice sereru jsou zobrazeny podokně obsahu Řídicího centra DB2. 2. Klepněte praým tlačítkem myši na definici sereru, kterou chcete změnit, a poté seznamu akcí klepněte na olbu Změnit. Oteře se zápisník Změnit definici sereru. 3. Na stránce Serer klepněte na tlačítko se šipkou Verze a zadejte jinou erzi zdroje dat. 4. Klepnutím na tlačítko OK potrďte změny definice sereru a zařete zápisník Změnit definici sereru. Chcete-li proést tuto úlohu z příkazoého řádku, postupujte takto: Zadejte příkaz ALTER SERVER. Předpokládejme, že máte definici sereru pro zdroj dat Microsoft SQL Serer erze 6.5. Sereru bylo příkazem CREATE SERVER přiřazeno jméno SQLSVR_ASIA. Při přechodu sereru Microsoft SQL Serer na erzi 7.0 bude příkaz pro změnu definice sereru ypadat následoně: ALTER SERVER SQLSVR_ASIA VERSION 7 Souisející úlohy: Změna šech definic sereru pro specifický typ zdrojů dat na stránce 28 Souisející odkazy: ALTER SERVER statement příručce SQL Reference, Volume 2 Změna šech definic sereru pro specifický typ zdrojů dat Všechny existující definice sereru pro určitý typ zdrojů dat můžete změnit pomocí jediného příkazu ALTER SERVER. Pokud chcete proést stejnou změnu e šech definicích sereru stejného typu, můžete použít tento jediný příkaz. Předpoklady: Autorizační ID zadáající příkaz ALTER SERVER musí mít opránění SYSADM nebo DBADM pro federoanou databázi. Omezení: Pokud byly olby sereru přidány při předchozí operaci příkazu ALTER SERVER, lze tyto olby nastait nebo zrušit pouze pomocí příkazu ALTER SERVER pro celý typ zdrojů dat. Postup: Předpokládejme, že globálním katalogu pro zdroje dat Sybase je registroáno pět sererů Sybase. Kdykoli je některému z těchto sererů Sybase odesláno ID užiatele pro oěření, budete chtít, aby federoaný serer ždy přeedl ID užiatele na elká písmena. Kromě toho budete chtít nastait dobu, po kterou má federoaný serer čekat na odezu od těchto sererů Sybase na příkaz SQL. Dobu je třeba zadat sekundách. Definice šech pěti sererů lze uprait najednou pomocí jediného příkazu, například: ALTER SERVER TYPE sybase OPTIONS (ADD FOLD_ID U, ADD TIMEOUT 600 ) Souisející úlohy: 28 Příručka pro federoané systémy

41 Změna erze zdroje dat definici sereru na stránce 27 Souisející odkazy: ALTER SERVER statement příručce SQL Reference, Volume 2 Použití oleb sereru definicích sereru Existují obecné olby sereru a olby sereru, které odpoídají specifickým typům zdrojů dat. Definici sereru lze změnit přidáním nebo úpraou oleb sereru. Volby sereru jsou nastaeny na hodnoty, které přetráají po úspěšných připojeních ke zdroji dat. Tyto hodnoty jsou uloženy katalogu federoaného systému. Předpoklady: Autorizační ID zadáající příkaz ALTER SERVER musí mít opránění SYSADM nebo DBADM pro federoanou databázi. Postup: Definici sereru lze změnit z Řídicího centra DB2 nebo pomocí příkazoého řádku. Chcete-li proést tuto úlohu pomocí Řídicího centra DB2, postupujte takto: 1. Rozbalte složku Federoané databázoé objekty. Objekty definice sereru jsou zobrazeny podokně obsahu Řídicího centra DB2. 2. Klepněte praým tlačítkem myši na definici sereru, kterou chcete změnit, a poté seznamu akcí klepněte na olbu Změnit. Oteře se zápisník Změnit definici sereru. 3. Na stránce Nastaení yberte olbu sereru, kterou chcete přidat nebo odebrat. 4. Zadejte požadoané hodnoty pro přidáané či upraoané olby. 5. Klepnutím na tlačítko OK potrďte změny definice sereru a zařete zápisník Změnit definici sereru. Některé olby sereru jsou poinné a nelze je odebrat. Jiné olby sereru nelze přidat případě, že jsou již nastaeny specifické olby sereru. Seznam s popisem jednotliých oleb najdete tématu Volby sereru pro federoané systémy. Chcete-li proést tuto úlohu z příkazoého řádku, postupujte takto: Zadejte příkaz ALTER SERVER. Příklady oleb sereru: Předpokládejme, že byla ytořena definice sereru pro serer Informix s použitím jména sereru INFMX01. Nyní chcete změnit olbu DB2_MAXIMAL_PUSHDOWN na hodnotu Y. Příkaz pro změnu definice sereru bude ypadat následoně: ALTER SERVER INFMX01 OPTIONS (SET DB2_MAXIMAL_PUSHDOWN Y ) Předpokládejme, že byla ytořena definice sereru pro serer Oracle s použitím jména sereru ORCL99. Nyní chcete do definice přidat olby FOLD_ID a FOLD_PW. Příkaz pro úprau definice sereru bude ypadat následoně: ALTER SERVER ORCL99 OPTIONS (ADD FOLD_ID U, FOLD_PW U ) Předpokládejme, že chcete nastait dobu časoého limitu sekundách, po kterou má modul wrapper CTLIB čekat na odezu od sereru Sybase. Tuto hodnotu lze nastait pomocí olby sereru TIMEOUT. Příkaz pro úprau definice sereru bude ypadat následoně: ALTER SERVER SYBSERVER OPTIONS (ADD TIMEOUT 60 ) Kapitola 2. Změna konfigurací zdroje dat 29

42 Dočasná změna oleb sereru pro relační zdroje dat Hodnotu olby sereru pro relační zdroj dat lze dočasně nastait pomocí příkazu SET SERVER OPTION. Tento příkaz přepíše hodnotu olby sereru definici sereru na dobu trání jednoho připojení k federoané databázi. Hodnota přepisu nebude uložena globálním katalogu. Příklad příkazu SET SERVER OPTION: SET SERVER OPTION PLAN_HINTS TO Y FOR SERVER ORA_SERVER Při použití se statickými příkazy SQL nebude mít příkaz SET SERVER OPTION na olbu sereru IUD_APP_SVPT_ ENFORCE žádný li. Hierarchie nastaení oleb sereru Pokud je pro olbu sereru nastaena pro některý typ zdrojů dat určitá hodnota a jiná hodnota je pro tuto olbu nastaena pro specifický serer zdroje dat, jsou zadané hodnoty použíány podle předem dané hierarchie. Předpokládejme například, že olba sereru PLAN_HINTS je pro typ zdrojů dat ORACLE nastaena na hodnotu Y. Volba sereru PLAN_HINTS definici sereru pro specifický serer zdroje dat Oracle PURNELL je šak nastaena na hodnotu N. Nastaení pro specifický serer zdroje dat má přednost před nastaením pro typ zdrojů dat. V této konfiguraci bude olba PLAN_HINTS poolena pro šechny serery datoých zdrojů Oracle, s ýjimkou sereru PURNELL. Souisející koncepce: Definice a olby sereru na stránce 13 Souisející odkazy: Kapitola 21, Volby sereru pro federoané systémy, na stránce 211 ALTER SERVER statement příručce SQL Reference, Volume 2 SET SERVER OPTION statement příručce SQL Reference, Volume 2 Změna mapoání užiatele Mapoání užiatele je přiřazení mezi autorizačním identifikátorem na federoaném sereru a autorizačním identifikátorem datoém zdroji. Užiatelská mapoání jsou potřebná pro odesílání distribuoaných požadaků do zdroje dat. Autorizační identifikátor nebo heslo použité u zdroje dat pro autorizační identifikátor specifického federoaného sereru lze změnit pomocí příkazu ALTER USER MAPPING. Předpoklady: Pokud se autorizační ID zadáající příkaz liší od autorizačního ID mapoaného na zdroj dat, musí mít autorizační ID zadáající příkaz ALTER SERVER opránění SYSADM nebo DBADM pro federoanou databázi. Omezení: Federoaný serer nemůže zpracoat příkaz ALTER USER MAPPING rámci dané transakce, pokud tato transakce již obsahuje některý z následujících příkazů: Příkaz SELECT odkazující na přezdíku pro tabulku nebo pohled rámci zdroje dat zahrnutého mapoání Oteřený kurzor na přezdíce pro tabulku nebo pohled rámci zdroje dat zahrnutého mapoání 30 Příručka pro federoané systémy

43 Příkaz INSERT, DELETE nebo UPDATE zadaný pro přezdíku tabulky nebo pohledu e zdroji dat zahrnutém mapoání Postup: Mapoání užiatele lze změnit z Řídicího centra DB2 nebo pomocí příkazoého řádku. Chcete-li proést tuto úlohu pomocí Řídicího centra DB2, postupujte takto: 1. Rozbalte složku Federoané databázoé objekty. V podokně obsahu okně Řídicí centrum DB2 jsou zobrazeny objekty mapoání užiatele. 2. Klepněte praým tlačítkem myši na mapoání užiatele, které chcete změnit, a poté klepněte seznamu akcí na tlačítko Změnit. Oteře se okno Změnit mapoání užiatele. 3. Uprate hodnotu olby. 4. Klepnutím na tlačítko OK potrďte změnu mapoání užiatele a zařete okno Změnit mapoání užiatele. Chcete-li proést tuto úlohu z příkazoého řádku, postupujte takto: Zadejte příkaz ALTER USER MAPPING. Příklad: Jennifer použíá federoaný serer pro připojení k sereru Sybase se jménem SYBSERVER. Pro přístup k federoanému sereru použíá autorizační ID jennifer. Autorizační ID jennifer je na sereru Sybase mapoáno na autorizační ID jenn. Autorizační ID pro Jennifer je na sereru Sybase změněno na jen123. Příkaz ALTER USER MAPPING pro mapoání identifikátoru jennifer na jen123 bude ypadat následoně: ALTER USER MAPPING FOR jennifer SERVER SYBSERVER OPTIONS (SET REMOTE_AUTHID jen123 ) Tomáš použíá federoaný serer pro připojení k sereru Oracle se jménem ORASERVER. Pro přístup k federoanému sereru použíá autorizační ID tomas. Autorizační ID tomas je mapoáno na autorizační ID tom na sereru Oracle. Tomášoo heslo na sereru Oracle bylo změněno. Jeho noé heslo nyní je day2night. Příkaz ALTER USER MAPPING pro mapoání identifikátoru tomas na noé heslo bude ypadat následoně: ALTER USER MAPPING FOR tomas SERVER ORASERVER OPTIONS (SET REMOTE_PASSWORD day2night ) U oleb užiatele REMOTE_AUTHID a REMOTE_PASSWORD jsou rozlišoána malá a elká písmena s ýjimkou případů, kdy jsou olby sereru FOLD_ID a FOLD_PW příkazem CREATE SERVER nastaeny na hodnotu U nebo L. Souisející odkazy: ALTER USER MAPPING statement příručce SQL Reference, Volume 2 Kapitola 22, Volby mapoání užiatelů pro federoaný systém, na stránce 225 Změna přezdíky Přezdíky jsou identifikátory použíané k odkazům na objekty e zdroji dat, k nimž chcete přistupoat. Účel změny přezdíky může být následující: Změna lokálních jmen sloupců pro sloupce objektu zdroje dat Změna lokálních datoých typů pro sloupce objektu zdroje dat Kapitola 2. Změna konfigurací zdroje dat 31

44 Přidání, nastaení nebo zrušení oleb sloupce či přezdíky Přidání nebo zrušení primárního klíče Přidání nebo odstranění jedné či íce jedinečných, referenčních nebo kontrolních podmínek Změna atributů referenční či kontrolní podmínky nebo podmínky funkční záislosti Předpoklady: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí obsahoat alespoň jedno z následujících opránění: Opránění SYSADM nebo DBADM Opránění ALTER pro přezdíku zadanou příkazu Opránění CONTROL pro přezdíku zadanou příkazu Opránění ALTERIN pro schéma (pokud jméno schématu přezdíky existuje) Autor definice přezdíky zaznamenaný e sloupci DEFINER pohledu katalogu pro přezdíku Omezení: Další informace naleznete tématu omezení změny přezdíek. Postup: Přezdíku lze změnit z Řídicího centra DB2 nebo pomocí příkazoého řádku DB2. Chcete-li proést tuto úlohu pomocí Řídicího centra DB2, postupujte takto: 1. Vyberte složku Přezdíky. 2. Klepněte praým tlačítkem myši na přezdíku, kterou chcete změnit, a pak klepněte na tlačítko Změnit. Oteře se okno Změnit přezdíku. 3. Na stránce Přezdíky změňte lokální jména sloupců, lokální datoé typy nebo podmínky sloupců pro sloupce uložené globálním katalogu. 4. Na stránce Klíče zadejte podmínky referenční integrity pro přezdíku. Nastait lze podmínku primárního klíče, jedinečného klíče nebo cizího klíče. 5. Na stránce Kontrolní podmínky zadejte kontrolní podmínky nebo podmínky funkční záislosti pro přezdíku. 6. Na stránce Nastaení zadejte olby přezdíky. 7. Klepnutím na tlačítko OK změníte přezdíku a zařete zápisník. Některé olby přezdíky jsou poinné a nelze je odstranit. Jiné olby přezdíek zase nelze přidat případech, kdy jsou již nastaeny určité specifické olby. Seznam s popisy jednotliých oleb najdete tématech popisujících olby přezdíek pro federoané systémy a olby sloupců přezdíek pro federoané systémy. Chcete-li tuto úlohu proést z příkazoého řádku DB2, zadejte příkaz ALTER NICKNAME spolu s příslušnými parametry. Pokud je podstatným způsobem změněna struktura nebo obsah objektu zdroje dat, je třeba aktualizoat statistické údaje pro přezdíku. Mezi podstatné změny patří také přidání nebo odebrání íce řádků. Souisející koncepce: Informační podmínky přezdíkách na stránce 173 Prostředek pro aktualizaci statistiky přezdíek - přehled na stránce Příručka pro federoané systémy

45 Souisející úlohy: Změna oleb přezdíek na stránce 35 Změna lokálního typu pro objekt zdroje dat na stránce 50 Změna jmen sloupců přezdíky na stránce 34 Změna oleb sloupců přezdíek na stránce 37 Souisející odkazy: Omezení e změnách přezdíek na stránce 33 Kapitola 23, Volby přezdíek pro federoané systémy, na stránce 227 Kapitola 24, Volby sloupců přezdíek pro federoané systémy, na stránce 235 ALTER NICKNAME statement příručce SQL Reference, Volume 2 Změna podrobností o přezdíkách Můžete změnit jména sloupců zdrojů dat, která jsou uložena globálním katalogu, a nastait olby sloupců změnou přezdíek. Omezení e změnách přezdíek Měníte-li přezdíku, uědomte si následující omezení: Jména sloupců Příkaz ALTER NICKNAME nelze použít ke změně jmen sloupců následujících zdrojích dat. Přezdíku musíte zrušit a ytořit ji znou se spránými jmény sloupců. BLAST Documentum HMMER Volby sloupců Pokud je u sloupce nastaena jedna z následujících oleb, nelze tomuto sloupci přidat žádné další olby: SOAPACTIONCOLUMN URLCOLUMN PRIMARY_KEY FOREIGN_KEY Pro BioRS Změníte-li jméno prku sloupce pomocí olby ELEMENT_NAME, nebude oěřena spránost noého jména. Chybná olba může ést při odkazoání na sloupec dotazu k chybám. Pokud proádíte změny e olbě sloupce IS_INDEXED, nebudou tyto změny oěřeny sererem BioRS. Chybná olba může ést při odkazoání na sloupec dotazu k chybám. Datoé typy Změníte-li datoý typ sloupce, musí být noý datoý typ kompatibilní s datoým typem odpoídajícího sloupce nebo prku zdroje dat. Změna lokálního datoého typu na datoý typ, který není kompatibilní se zdáleným datoým typem, může ést k nepředídatelným chybám. Lokální datoý typ nemůže být long archar, long argraphic, DATALINK ani užiatelský datoý typ. Datoý typ zdroje dat nemůže být užiatelským typem. Kapitola 2. Změna konfigurací zdroje dat 33

46 Pro žádný z nerelačních zdrojů dat nelze přepsat existující lokální typy, ani ytořit noé. Další informace o tomto omezení naleznete dokumentaci ke specifickým zdrojům dat modulu wrapper. Změníte-li lokální specifikaci datoého typu sloupce, federoaný spráce databází zneplatní šechny statistiky (např. HIGH2KEY a LOW2KEY), které jsou pro tento sloupec shromážděny. Pokud ke konkrétnímu objektu zdroje dat přistupujete pomocí přezdíky, bude pro něj nastaen tento lokální typ. Stejný objekt zdroje dat může mít jinou přezdíku použíající ýchozí mapoání typu dat. Indexy Příkaz ALTER NICKNAME nelze použít k registraci noého indexu zdroje dat e federoané databázi. Chcete-li ytořit specifikaci indexu, použijte příkaz CREATE INDEX s klauzulí SPECIFICATION ONLY. Parametry LOCAL NAME a LOCAL TYPE Příkaz ALTER NICKNAME nelze použít ke změně lokálních jmen nebo datoých typů pro sloupce přezdíce následujících případech: Přezdíka se použíá pohledu, metodě SQL nebo e funkci SQL Pro přezdíku jste definoali informační podmínku Potřebujete-li příkazu ALTER NICKNAME zadat také parametr LOCAL NAME, LOCAL TYPE nebo oba tyto parametry, je třeba zadat klauzuli oleb federoaného sloupce. Přezdíky Příkaz ALTER NICKNAME nelze použít ke změně jména databanky BioRS, která se použíá přezdíce BioRS, nebo je ní na ni ueden odkaz. Změní-li se jméno databanky BioRS, musíte přezdíku zrušit a ytořit ji znou. Transakce Za následujících podmínek není federoaný serer schopen zpracoat příkaz ALTER NICKNAME unitř dané transakce: Souisející úlohy: Pokud je pro přezdíku, na kterou je odkaz příkazu ALTER NICKNAME, oteřený kurzor e stejných transakcích. Pokud je téže transakci přezdíky, na kterou je odkaz příkazu ALTER NICKNAME, proáděno kládání, odstranění nebo aktualizace. Pokud nerelačních zdrojích dat odkazuje příkaz ALTER NICKNAME na přezdíku, na kterou je odkaz také příkazu SELECT téže transakci. Změna oleb přezdíek na stránce 35 Změna lokálního typu pro objekt zdroje dat na stránce 50 Změna přezdíky na stránce 31 Změna jmen sloupců přezdíky na stránce 34 Změna oleb sloupců přezdíek na stránce 37 Změna jmen sloupců přezdíky Vytoříte-li přezdíku, budou jména sloupců asocioaná s objektem zdroje dat uložena e federoané databázi. Pro některé zdroje dat určuje jména sloupců modul wrapper. Pro jiné zdroje dat je nutné jména sloupců zadat při ytoření přezdíky. Přezdíku lze uprait změnou jmen sloupců. Předpoklady: 34 Příručka pro federoané systémy

47 Autorizační ID zadáající příkaz musí obsahoat alespoň jedno z následujících opránění: Opránění SYSADM nebo DBADM Opránění ALTER pro přezdíku zadanou příkazu Opránění CONTROL pro přezdíku zadanou příkazu Opránění ALTERIN pro schéma (pokud jméno schématu přezdíky existuje) Autor definice přezdíky zaznamenaný e sloupci DEFINER pohledu katalogu pro přezdíku Omezení: Další informace naleznete tématu omezení změny přezdíek. Postup: Jména sloupců můžete změnit pomocí Řídicího centra DB2 nebo z příkazoého řádku DB2. Chcete-li proést tuto úlohu pomocí Řídicího centra DB2, postupujte takto: 1. Vyberte složku Přezdíky. 2. Klepněte praým tlačítkem myši na přezdíku, kterou chcete změnit, a pak klepněte na tlačítko Změnit. Oteře se okno Změnit přezdíku. 3. Na stránce Přezdíky yberte sloupec, který chcete změnit, a klepněte na olbu Změnit. Oteře se okno Změnit sloupec. 4. Zadejte jméno sloupce. 5. Klepnutím na tlačítko OK potrďte změnu jména sloupce a zařete okno. 6. Klepnutím na tlačítko OK změníte přezdíku a zařete zápisník. Chcete-li tuto úlohu proést z příkazoého řádku DB2, zadejte následující příkaz ALTER NICKNAME: ALTER NICKNAME přezdíka ALTER COLUMN aktuální_jméno LOCAL NAME noé_jméno Příklad: Změna lokálního jména sloupce přezdíky: Předpokládejme, že přezdíka Z_EMPLOYEES pro tabulku produktu DB2 UDB for z/os obsahuje sloupec se jménem EMPNO. Chcete-li přezdíku uprait tak, aby jméno lokálního sloupce, se kterým pracují užiatelé, bylo Cislo_zamestnance namísto jména EMPNO, zadejte následující příkaz: ALTER NICKNAME Z_EMPLOYEES ALTER COLUMN EMPNO LOCAL NAME "Cislo_zamestnance" Souisející úlohy: Změna přezdíky na stránce 31 Souisející odkazy: Omezení e změnách přezdíek na stránce 33 ALTER NICKNAME statement příručce SQL Reference, Volume 2 Změna oleb přezdíek Volby přezdíek jsou parametry, které pro přezdíku zadááte při zadání příkazů CREATE NICKNAME a ALTER NICKNAME. Kapitola 2. Změna konfigurací zdroje dat 35

48 Volby přezdíek lze přidáat, nastaoat a rušit pomocí příkazu ALTER NICKNAME. Předpoklady: Autorizační ID zadáající příkaz musí obsahoat alespoň jedno z následujících opránění: Opránění SYSADM nebo DBADM Opránění ALTER pro přezdíku zadanou příkazu Opránění CONTROL pro přezdíku zadanou příkazu Opránění ALTERIN pro schéma (pokud jméno schématu přezdíky existuje) Autor definice přezdíky zaznamenaný e sloupci DEFINER pohledu katalogu pro přezdíku Omezení: Další informace naleznete tématu omezení změny přezdíek. Postup: Jména sloupců můžete změnit pomocí Řídicího centra DB2 nebo z příkazoého řádku DB2. Chcete-li proést tuto úlohu pomocí Řídicího centra DB2, postupujte takto: 1. Vyberte složku Přezdíky. 2. Klepněte praým tlačítkem myši na přezdíku, kterou chcete změnit, a pak klepněte na tlačítko Změnit. Oteře se okno Změnit přezdíku. 3. Na stránce Nastaení zaškrtněte políčka edle oleb, které chcete přidat nebo odebrat. Vyžadoané olby nelze odebrat. 4. Chcete-li zadat nebo změnit hodnotu olby, klepněte na pole olby Hodnota. V záislosti na olbě můžete ybrat hodnotu ze seznamu, zadat noou hodnotu nebo můžete klepnutím na tlačítko... ybrat íce hodnot. 5. Klepnutím na tlačítko OK změníte přezdíku a zařete zápisník. Chcete-li proést tuto úlohu z příkazoého řádku, použijte příkaz ALTER NICKNAME: Příklad: ALTER NICKNAME přezdíka OPTIONS (SET jméno_olby řetězcoá_hodnota_olby ) Například přezdíka DRUGDATA1 byla ytořena pro soubor drugdata1.txt. Úplná cesta, která byla půodně definoána příkazu CREATE NICKNAME, byla /user/pat/drugdata1.txt. Chcete-li změnit olbu přezdíky FILE_PATH, zadejte následující příkaz: ALTER NICKNAME DRUGDATA1 OPTIONS (SET FILE_PATH /usr/kelly/data/drugdata1.txt ) Souisející úlohy: Změna přezdíky na stránce 31 Souisející odkazy: Omezení e změnách přezdíek na stránce 33 ALTER NICKNAME statement příručce SQL Reference, Volume 2 Kapitola 23, Volby přezdíek pro federoané systémy, na stránce Příručka pro federoané systémy

49 Změna oleb sloupců přezdíek Údaje o sloupcích lze příkazech CREATE NICKNAME a ALTER NICKNAME zadat pomocí parametrů označoaných jako olby sloupců přezdíek. Kterékoli z těchto hodnot lze zadat malými nebo elkými písmeny. Pomocí příkazu ALTER NICKNAME lze přidat, nastait nebo zrušit olby sloupců přezdíek. Předpoklady: Autorizační ID zadáající příkaz musí obsahoat alespoň jedno z následujících opránění: Opránění SYSADM nebo DBADM Opránění ALTER pro přezdíku zadanou příkazu Opránění CONTROL pro přezdíku zadanou příkazu Opránění ALTERIN pro schéma (pokud jméno schématu přezdíky existuje) Autor definice přezdíky zaznamenaný e sloupci DEFINER pohledu katalogu pro přezdíku Omezení: Další informace naleznete tématu omezení změny přezdíek. Postup: Jména sloupců můžete změnit pomocí Řídicího centra DB2 nebo z příkazoého řádku DB2. Chcete-li proést tuto úlohu pomocí Řídicího centra DB2, postupujte takto: 1. Vyberte složku Přezdíky. 2. Klepněte praým tlačítkem myši na přezdíku, kterou chcete změnit, a pak klepněte na tlačítko Změnit. Oteře se okno Změnit přezdíku. 3. Na stránce Přezdíky yberte sloupec, který chcete změnit, a klepněte na olbu Změnit. Oteře se okno Změnit sloupec. 4. Vyberte olbu sloupce, kterou chcete přidat nebo odebrat. 5. Zadejte požadoané hodnoty pro přidáané či upraoané olby. 6. Klepnutím na tlačítko OK potrďte změnu olby sloupce a zařete okno. 7. Klepnutím na tlačítko OK změníte přezdíku a zařete zápisník. Chcete-li proést tuto úlohu z příkazoého řádku, použijte příkaz ALTER NICKNAME: Příklad 1: Zadání olby sloupce NUMERIC_STRING pro relační zdroje dat: Volba sloupce NUMERIC_STRING se ztahuje ke sloupcům znakoého typu (CHAR a VARCHAR). Předpokládejme, že zdroj dat obsahuje posloupnost řazení odlišnou od posloupnosti řazení federoané databáze. Federoaný serer obykle e zdroji dat neproádí řazení žádných sloupců obsahujících znakoá data. Narací data do federoané databáze a řazení je proáděno lokálně. Předpokládejme šak, že sloupec je znakoého datoého typu a že obsahuje pouze numerické znaky ( 0, 1,..., 9 ). To lze indikoat přiřazením hodnoty Y olbě sloupce NUMERIC_STRING. V takoém případě má optimalizátor dotazu DB2 UDB možnost proést e zdroji dat řazení. Pokud je řazení proáděno na dálku, lze se yhnout zbytečnému zatížení způsobenému řazením dat na federoaném sereru. Kapitola 2. Změna konfigurací zdroje dat 37

50 Přezdíka ORA_INDSALES odpoídá tabulce Oracle se jménem INDONESIA_SALES. Tato tabulka obsahuje sloupec POSTAL_CODE s datoým typem VARCHAR. Půodně tento sloupec obsahoal pouze numerické znaky a olba sloupce NUMERIC_STRING byla nastaena na hodnotu Y. Sloupec šak nyní obsahuje směs numerických a jiných než numerických znaků. Chcete-li změnit nastaení olby sloupce NUMERIC_STRING na hodnotu N, použijte tento příkaz: ALTER NICKNAME ORA_INDSALES ALTER COLUMN POSTAL_CODE OPTIONS (SET NUMERIC_STRING N ) Příklad 2: Zadání olby sloupce VARCHAR_NO_TRAILING_BLANKS pro relační zdroje dat: Volbu sloupce VARCHAR_NO_TRAILING_BLANKS lze použít pro identifikaci specifických sloupců, které neobsahují žádné koncoé mezery. Kompilátor SQL ezme toto nastaení úahu při posuzoání šech operací proáděných na sloupcích (jako jsou například operace poronání). Přezdíka ORA_INDSALES odpoídá tabulce Oracle se jménem INDONESIA_SALES. Tato tabulka obsahuje sloupec NAME s datoým typem VARCHAR. Sloupec NAME neobsahuje koncoé mezery. Chcete-li pro přezdíku přidat olbu VARCHAR_NO_TRAILING_BLANKS, použijte následující příkaz: ALTER NICKNAME ORA_INDSALES ALTER COLUMN NAME OPTIONS (ADD VARCHAR_NO_TRAILING_BLANKS Y ) Příklad 3: Zadání olby sloupce XPATH pro nerelační zdroje dat: Zdroji dat XML odpoídá přezdíka EMPLOYEE. Pro sloupec fname byla zadána olba XPATH. Chcete-li nastait olbu sloupce XPATH na hodnotu jiné cesty, použijte tento příkaz: ALTER NICKNAME EMPLOYEE ALTER COLUMN fname OPTIONS (SET ) Souisející úlohy: Změna přezdíky na stránce 31 Souisející odkazy: Zrušení modulu wrapper Omezení e změnách přezdíek na stránce 33 ALTER NICKNAME statement příručce SQL Reference, Volume 2 Kapitola 24, Volby sloupců přezdíek pro federoané systémy, na stránce 235 V některých situacích je třeba zrušit modul wrapper. Důody mohou být následující: Někdy existuje íce modulů wrapper, pomocí kterých lze přistupoat ke zdroji dat. Výběr určitého modulu může záiset na použíané erzi klientského softwaru zdroje dat. Dále může záiset na operačním systému použitém na federoaném sereru. Předpokládejme například, že chcete přistupoat ke děma tabulkám Oracle a jednomu pohledu Oracle. Použíáte produkt Oracle erze 8 a na federoaném sereru je spuštěn operační systém Windows NT. Půodně jste ytořili modul wrapper SQLNET. Vzhledem k tomu, že produkt DB2 Information Integrator již modul wrapper SQLNET nepodporuje, můžete modul wrapper SQLNET zrušit a ytořit modul wrapper NET8. 38 Příručka pro federoané systémy

51 Jiným důodem ke zrušení modulu wrapper může být to, že již není nutný přístup ke zdroji dat, se kterým je daný modul wrapper asocioán. Předpokládejme například, že aše organizace požaduje přístup k informacím klientů databázi sereru Microsoft SQL Serer i Informix. Bude ytořen jeden modul wrapper pro zdroj dat Informix a jeden modul wrapper pro zdroj dat Microsoft SQL Serer. Později bude této organizaci rozhodnuto migroat šechny informace ze zdroje dat Microsoft SQL Serer do zdroje dat Informix. Poté již nebude modul wrapper Microsoft SQL Serer potřeba a bude možné jej zrušit. Upozornění: Zrušení modulu wrapper může ést k záažným důsledkům. Operace bude mít dopad na další objekty, které byly pro federoaný serer registroány: Všechny definice sereru, mapoání užiatelských funkcí a mapoání užiatelských datoých typů záislá na daném modulu wrapper jsou také zrušena. Zrušení šech definicí sereru záislých na daném modulu wrapper má li na objekty záislé na těchto definicích sereru. Všechna mapoání užiatelských funkcí, mapoání užiatelských datoých typů a mapoání užiatelů záislá na zrušených definicích sereru budou také zrušena. Všechny přezdíky záislé na zrušených definicích sereru jsou také zrušeny. Zrušení přezdíek záislých na definicích sereru má li na objekty, které na těchto přezdíkách záisí: Všechny specifikace indexů záisející na zrušených přezdíkách jsou také zrušeny. Všechny federoané pohledy záisející na zrušených přezdíkách jsou označeny jako nefunkční. Všechny tabulky materializoaných dotazů záislé na zrušených přezdíkách jsou také zrušeny. Všechny aplikace záisející na zrušených objektech a nefunkčních pohledech jsou zneplatněny. Předpoklady: K zadání příkazu DROP WRAPPER je nutné mít opránění SYSADM nebo DBADM. Postup: Modul wrapper lze zrušit pomocí příkazu DROP. Chcete-li například zrušit modul wrapper sereru Microsoft SQL Serer MSSQLODBC3, bude použitý příkaz ypadat následoně: DROP WRAPPER MSSQLODBC3 Souisející odkazy: Zrušení definice sereru DROP statement příručce SQL Reference, Volume 2 CREATE WRAPPER statement příručce SQL Reference, Volume 2 Při operaci zrušení definice sereru bude definice odstraněna z globálního katalogu, přičemž objekt zdroje dat, na který tato definice sereru odkazuje, nebude nijak oliněna. Při zrušení definice sereru jsou oliněny další objekty registroané na federoaném sereru: Všechna užiatelská mapoání funkcí, užiatelská mapoání datoých typů a užiatelská mapoání záislá na zrušené definici sereru budou také zrušena. Kapitola 2. Změna konfigurací zdroje dat 39

52 Všechny přezdíky záislé na zrušené definici sereru budou také zrušeny. Zrušení přezdíek záislých na definici sereru má li na objekty, které na těchto přezdíkách záisí: Všechny specifikace indexů záisející na zrušených přezdíkách jsou také zrušeny. Všechny federoané pohledy záisející na zrušených přezdíkách jsou označeny jako nefunkční. Všechny aplikace záisející na zrušených objektech a nefunkčních pohledech jsou zneplatněny. Definici sereru lze odstranit pomocí příkazu DROP. Předpoklady: Chcete-li zrušit definici sereru, musíte mít opránění SYSADM nebo DBADM. Omezení: Federoaný serer nemůže zpracoat příkaz DROP SERVER rámci dané transakce následujících případech: Příkaz odkazuje na určitý datoý zdroj a transakce již zahrnuje některý z následujících příkazů: Příkaz SELECT odkazující na přezdíku pro tabulku nebo pohled rámci daného zdroje dat Oteřený kurzor na přezdíce pro tabulku nebo pohled rámci daného zdroje dat Příkaz insert, delete nebo update spuštěný na přezdíku pro tabulku nebo pohled rámci daného zdroje dat Příkaz odkazuje na kategorii zdrojů dat (například na šechny zdroje dat specifického typu a erze) a transakce obsahuje některý z následujících příkazů: Příkaz SELECT, který odkazuje na přezdíku pro tabulku nebo pohled rámci některého ze zdrojů dat Oteřený kurzor na přezdíce pro tabulku nebo pohled rámci některého ze zdrojů dat Příkaz insert, delete nebo update spuštěný na přezdíku pro tabulku nebo pohled rámci některého ze zdrojů dat Postup: Pokud již není nutné zachoat přístup k některému sereru zdroje dat, odeberte definici sereru z federoané databáze. Definici sereru můžete zrušit prostřednictím Řídicího centra DB2 nebo pomocí příkazu DROP z příkazoého procesoru DB2. Syntaxe pro zrušení definice sereru je následující: DROP SERVER jméno_sereru kde jméno_sereru identifikuje definici sereru, která má být zrušena. Pokud jste například definoali serer Informix, pro který je použito jméno sereru INFMX01, bude příkaz pro odstranění definice sereru ypadat následoně: DROP SERVER INFMX01 Souisející úlohy: Změna definicí sereru a oleb sereru na stránce 26 Souisející odkazy: 40 Příručka pro federoané systémy

53 Zrušení mapoání užiatele DROP statement příručce SQL Reference, Volume 2 Pokud již užiatel nepotřebuje přístup ke zdálenému zdroji dat, zrušte mapoání mezi federoaným sererem a sererem zdáleného zdroje dat. Pokud je užiatel mapoán na íce sererů zdrojů dat, bude nutné zrušit každé mapoání samostatně. Předpoklady: Chcete-li zadat příkaz DROP USER MAPPING a pokud se autorizační ID liší od jména užiatele federoané databáze specifikoaného mapoání užiatele, musí být autorizačnímu identifikátoru příkazu DROP přiřazeno opránění SYSADM nebo DBADM. Pokud si opačném případě autorizační ID a jméno užiatele mapoání užiatele odpoídají, nejsou yžadoána žádná opránění. Postup: Mapoání užiatele lze zrušit příkazem DROP: DROP USER MAPPING FOR ID_užiatele SERVER jméno_lokálního_sereru ID_užiatele je autorizační ID pro užiatele na federoaném sereru. jméno_lokálního_sereru je lokální jméno použité definici sereru k identifikaci sereru zdáleného zdroje dat. Souisející úlohy: Změna mapoání užiatele na stránce 30 Souisející odkazy: DROP statement příručce SQL Reference, Volume 2 Zrušení přezdíky V některých situacích je třeba zrušit přezdíku. Důody mohou být například následující: Pokud dojde k ýrazné změně podkladoé struktury objektu zdroje dat nebo jeho obsahu, může dojít k rozhodnutí zrušit přezdíku. Přezdíku lze poté ytořit znou s cílem aktualizace metadat týkajících se objektu globálním katalogu. Chcete-li změnit jméno přezdíky, je nutné přezdíku zrušit a poté ji znou ytořit s použitím noého jména. Pokud již není potřeba přistupoat k podkladoému objektu zdroje dat, můžete přezdíku zrušit. Při zrušení je přezdíka odstraněna z globálního katalogu na federoaném sereru. Zdroj dat, na který přezdíka odkazuje, není oliněn. Při zrušení přezdíky jsou oliněny další objekty registroané na federoaném sereru: Při zrušení přezdíky jsou oliněny objekty, které na této přezdíce záisí: Všechny specifikace indexů záisející na zrušených přezdíkách jsou také zrušeny. Všechny federoané pohledy záisející na zrušených přezdíkách jsou označeny jako nefunkční. Kapitola 2. Změna konfigurací zdroje dat 41

54 Všechny aplikace záisející na zrušených objektech a nefunkčních pohledech jsou zneplatněny. Přezdíku lze odstranit pomocí příkazu DROP. Předpoklady: Přezdíka musí být uedena katalogu. Autorizačnímu identifikátoru pro proedení příkazu DROP zrušení přezdíky musí být přiřazeno některé z následujících opránění: Opránění SYSADM nebo DBADM Opránění DROPIN e schématu pro přezdíku Autor definice přezdíky zaznamenaný e sloupci DEFINER pohledu katalogu pro přezdíku Opránění CONTROL pro přezdíku Omezení: Pro přezdíky odpoídající relačním zdrojům dat nemůže federoaný serer zpracoat příkaz DROP NICKNAME rámci dané transakce následujících případech: Pro přezdíku, na kterou je odkazoáno příkazu, je e stejné transakci oteřen kurzor. Pro přezdíku, na kterou je odkazoáno příkazu, je e stejné transakci zadán příkaz insert, delete nebo update. Pro přezdíky odpoídající nerelačním zdrojům dat nemůže federoaný serer zpracoat příkaz DROP NICKNAME rámci dané transakce za některé z následujících podmínek: Pro přezdíku, na kterou je odkazoáno tomto příkazu, je e stejné transakci oteřen kurzor. Na přezdíku, na kterou je odkazoáno tomto příkazu, je e stejné transakci již odkazoáno příkazu SELECT. Pro přezdíku, na kterou je odkazoáno tomto příkazu, je e stejné transakci zadán příkaz insert, delete nebo update. Postup: Syntaxe příkazu pro zrušení přezdíky je následující: DROP NICKNAME přezdíka kde ýraz přezdíka označuje přezdíku, která má být zrušena. Souisející úlohy: Změna přezdíky na stránce 31 Souisející odkazy: DROP statement příručce SQL Reference, Volume 2 42 Příručka pro federoané systémy

55 Kapitola 3. Mapoání datoých typů Moduly wrapper, které jsou součástí produktu DB2 Information Integrator, obsahují ýchozí mapoání datoých typů mezi zdroji dat a produktem DB2 Uniersal Database for Linux, UNIX, and Windows. Obsah této kapitoly: Mapoání datoých typů e federoaném systému Mapoání datoých typů a globální katalog federoané databáze na stránce 44 Kdy ytořit alternatiní mapoání datoých typů na stránce 45 Mapoání datoých typů pro nerelační zdroje dat na stránce 45 Dopředná a zpětná mapoání datoých typů na stránce 46 Vytáření mapoání datoých typů na stránce 46 Vytoření mapoání datoého typu pro datoý typ zdroje dat příklad na stránce 47 Vytoření mapoání typů pro datoý typ zdroje dat a erzi příklad na stránce 48 Vytoření mapoání typů pro šechny objekty zdroje dat na sereru příklad na stránce 49 Změna lokálního typu pro objekt zdroje dat na stránce 50 Změna lokálního typu pro objekt zdroje dat příklady na stránce 51 Změna dlouhých datoých typů na datoé typy archar na stránce 53 Mapoání datoých typů e federoaném systému Datoé typy e zdroji dat musí být mapoány na odpoídající datoé typy produktu DB2. Toto mapoání umožňuje federoanému sereru načítat data ze zdroje dat. Produkt DB2 Information Integrator podporuje pro některé zdroje dat sadu ýchozích mapoání datoých typů. U dalších zdrojů dat musíte zadat mapoání datoých typů, které chcete použít. U nerelačních zdrojů dat nelze existující mapoání datoých typů přepsat, ani ytořit noé mapoání. Některé příklady ýchozích mapoání datoých typů: Typ FLOAT systému Oracle je podle ýchozího nastaení mapoán na typ DOUBLE produktu DB2 Typ DATE systému Oracle je podle ýchozího nastaení mapoán na typ TIMESTAMP produktu DB2 Typ DATE produktu DB2 Uniersal Database for z/os and OS/390 je podle ýchozího nastaení mapoán na typ DATE produktu DB2 Přezdíky, které byly ytořeny až po změně mapoání, použíají noý typ mapoání. Přezdíky ytořené před změnou mapoání použíají ýchozí typ mapoání. Pokud jste přezdíky již ytořili, můžete existující přezdíky aktualizoat jedním z následujících způsobů: Můžete každou přezdíku změnit Můžete každou přezdíky zrušit a znou ytořit Federoané serery DB2 nepodporují mapoání následujících datoých typů: Copyright IBM Corp. 1998,

56 Lokální datoý typ nemůže být LONG VARCHAR, LONG VARGRAPHIC, DATALINK, ani užiatelský datoý typ. Vzdálený datoý typ nemůže být užiatelský typ. Můžete ošem použít funkci přetypoání, která přeede užiatelský datoý typ pohledu e zdáleném zdroji dat, který je identický se zdrojem dat, na estaěný nebo systémoý datoý typ. Pak můžete pro pohled ytořit přezdíku. Pokud takoé pohledy ytoříte, nebudou mít žádnou statistiku ani indexy a nebude je možné aktualizoat. Souisející koncepce: Mapoání datoých typů a globální katalog federoané databáze na stránce 44 Kdy ytořit alternatiní mapoání datoých typů na stránce 45 Mapoání datoých typů pro nerelační zdroje dat na stránce 45 Dopředná a zpětná mapoání datoých typů na stránce 46 Souisející úlohy: Vytáření mapoání datoých typů na stránce 46 Souisející odkazy: Kapitola 27, Výchozí dopředné mapoání datoých typů, na stránce 249 Kapitola 28, Výchozí zpětné mapoání datoých typů, na stránce 265 Změna dlouhých datoých typů na datoé typy archar na stránce 53 Mapoání datoých typů a globální katalog federoané databáze Když zapíšete příkaz CREATE NICKNAME, zadáte objekt zdroje dat, který přezdíka reprezentuje. Ve ětšině případů definuje federoaný serer pro každý sloupec nebo pole tomto objektu zdroje dat datoý typ podporoaný produktem DB2. U některých nerelačních zdrojů dat musíte dodat datoý typ DB2. Tyto lokální definice jsou uloženy pohledu katalogu SYSCAT.COLUMNS globálního katalogu federoané databáze. U relačních zdrojů dat yhledá federoaný serer při určoání, který lokální datoý typ ukládat do pohledu katalogu SYSCAT.COLUMNS,informace o dopředném mapoání datoých typů modulech wrapper a pohledu katalogu SYSCAT.TYPEMAPPINGS. Mapoání pohledu katalogu SYSCAT.TYPEMAPPINGS budou nadřazená nad ýchozími mapoáními modulech wrapper. Pokud ytáříte alternatiní mapoání, kterým chcete přepsat ýchozí mapoání datoých typů, bude federoaný serer použíat alternatiní mapoání. Pokud je na sloupec použito íce mapoání, bude federoaný serer použíat nejnoěji ytořené mapoání. U nerelačních zdrojů dat yhledá federoaný serer při určoání, který lokální datoý typ ukládat do pohledu katalogu SYSCAT.COLUMNS, informace o mapoání datoých typů modulech wrapper. Míra, e které můžete upraoat datoé typy definoané modulem wrapper, se mění záislosti na nerelačním zdroji dat. U některých nerelačních zdrojů dat nezadááte žádné sloupce. Datoé typy definuje modul wrapper. U jiných zdrojů dat je možné datoé typy přepsat. A u dalších zdrojů dat musíte zadat typ dat sloupce do příkazu CREATE NICKNAME. Pokud zapíšete příkaz CREATE TABLE pomocí transparentního jazyka DDL pro relační zdroje dat, zadejte příkazu datoé typy DB2. Federoaný serer zkontroluje informace o zpětném mapoání datoých typů mezi produktem DB2 UDB a zdrojem dat. Federoaný serer tyto informace yhledá modulu wrapper a pohledu katalogu SYSCAT.TYPEMAPPINGS. 44 Příručka pro federoané systémy

57 Když jsou hodnoty ze sloupce zdroje dat ráceny federoané databázi, odpoídají zcela datoému typu DB2, na který je sloupec zdroje dat mapoán. V případě ýchozích mapoání tyto hodnoty naíc plně odpoídají datoému typu zdroje dat mapoání. Pokud je například pro federoanou databázi definoána tabulka produktu Oracle se sloupcem typu FLOAT, bude pro tento sloupec automaticky použito ýchozí mapoání datoého typu FLOAT produktu Oracle na datoý typ DOUBLE produktu DB2. Hodnoty rácené ze sloupce plně odpoídají oběma datoým typům, FLOAT i DOUBLE. Souisející koncepce: Mapoání datoých typů e federoaném systému na stránce 43 Kdy ytořit alternatiní mapoání datoých typů Alternatiní mapoání datoých typů lze ytářet pro relační zdroje dat. Alternatiní mapoání datoých typů může být hodné ytořit následujících situacích: Chcete-li přepsat ýchozí mapoání datoých typů U některých modulů wrapper můžete změnit formát nebo délku racených hodnot. Formát nebo délku je možné změnit, změníte-li datoý typ produktu DB2, kterému musí hodnoty odpoídat. Například datoý typ DATE produktu Oracle se použíá jako časoá značka a obsahuje hodnoty odpoídající století, roku, měsíci, dnu, hodinám, minutám a sekundám. Podle ýchozího nastaení je datoý typ DATE produktu Oracle mapoán na datoý typ TIMESTAMP produktu DB2. Chcete-li racet pouze informace o hodinách, minutách a sekundách, můžete potlačit ýchozí mapoání datoých typů a mapoat tak datoý typ DATE produktu Oracle na datoý typ TIME produktu DB2. Po zadání dotazu na sloupce typu DATE produktu Oracle je federoanému sereru rácena pouze část hodnoty časoé značky produktu Oracle. Pokud ýchozí mapoání neexistuje Pokud není ýchozí mapoání datoých typů pro datoý typ zdroje dat k dispozici, musíte ytořit mapoání pro noý datoý typ. Pomocí příkazu CREATE TYPE MAPPING můžete definoat noá mapoání datoých typů. Vytořená mapoání budou uložena pohledu katalogu SYSCAT.TYPEMAPPINGS e federoané databázi. Souisející koncepce: Mapoání datoých typů e federoaném systému na stránce 43 Souisející úlohy: Vytáření mapoání datoých typů na stránce 46 Mapoání datoých typů pro nerelační zdroje dat U některých nerelačních zdrojů dat nejsou mapoání datoých typů modulech wrapper. V některý případech musíte zadat informace o lokálním typu do příkazu CREATE NICKNAME. Následující příklad ukazuje, jak jsou datoé typy sloupců některých nerelačních zdrojů dat zadány příkazu CREATE NICKNAME: Kapitola 3. Mapoání datoých typů 45

58 CREATE NICKNAME DRUGDATA1 (Dcode Integer NOT NULL, Drug CHAR(20), Manufacturer CHAR(20)) FOR SERVER biochem_lab OPTIONS (FILE_PATH /usr/pat/drugdata1.txt, COLUMN_DELIMITER,, SORTED Y, KEY_COLUMN DCODE, VALIDATE_DATA_FILE Y ) Souisející koncepce: Mapoání datoých typů e federoaném systému na stránce 43 Souisející úlohy: Registering nicknames for a data source příručce IBM DB2 Information Integrator Data Source Configuration Guide Dopředná a zpětná mapoání datoých typů Dopředné mapoání typů je mapoání ze zdáleného datoého typu na sronatelný lokální datoý typ. Tato mapoání se použíají při ytáření přezdíek pro objekty zdroje dat. Sronatelné lokální typy pro šechny sloupce objektu zdroje dat se ukládají do globálního katalogu. Zpětné mapoání typů je mapoání z lokálního datoého typu na sronatelný zdálený datoý typ. Zpětné mapoání typů se použíá s transparentním jazykem DDL. Část Obrázek 2 zobrazuje dopředné a zpětné mapoání datoých typů. Obrázek 2. Dopředné a zpětné mapoání datoých typů Souisející koncepce: Mapoání datoých typů e federoaném systému na stránce 43 Souisející odkazy: Kapitola 27, Výchozí dopředné mapoání datoých typů, na stránce 249 Kapitola 28, Výchozí zpětné mapoání datoých typů, na stránce 265 Vytáření mapoání datoých typů Pro ytoření mapoání datoých typů se použíá příkaz CREATE TYPE MAPPING. Můžete jej zadat Příkazoého centra DB2, z příkazoého procesoru, nebo jej zahrnout do aplikačního programu. Řídicí centrum DB2 nelze pro ytáření ani úprau mapoání datoých typů použít. Předpoklady: 46 Příručka pro federoané systémy

59 Opránění příslušející autorizačnímu ID daného příkazu musí mít opránění SYSADM nebo DBADM. Omezení: Hodnota lokální_datoý_typ nemůže být long archar, long argraphic, DATALINK, ani užiatelský datoý typ. Hodnota datoý_typ_zdroje_dat nemůže být užiatelský datoý typ. U nerelačních zdrojů dat nelze existující mapoání datoých typů přepsat, ani ytořit noé mapoání. Postup: Chcete-li ytořit mapoání datoých typů, zadejte příkaz CREATE TYPE MAPPING. Souisející koncepce: Mapoání datoých typů e federoaném systému na stránce 43 Souisející odkazy: Kapitola 27, Výchozí dopředné mapoání datoých typů, na stránce 249 Kapitola 28, Výchozí zpětné mapoání datoých typů, na stránce 265 Vytoření mapoání datoého typu pro datoý typ zdroje dat příklad na stránce 47 Vytoření mapoání typů pro datoý typ zdroje dat a erzi příklad na stránce 48 Vytoření mapoání typů pro šechny objekty zdroje dat na sereru příklad na stránce 49 Změna lokálního typu pro objekt zdroje dat příklady na stránce 51 Změna dlouhých datoých typů na datoé typy archar na stránce 53 Plan the data type mappings příručce IBM DB2 Information Integrator Data Source Configuration Guide Vytoření mapoání datoého typu pro datoý typ zdroje dat příklad V tomto příkladu musí být šechny tabulky a pohledy systému Oracle, které použíají datoý typ NUMBER systému Oracle, mapoány na datoý typ DECIMAL(8,2) produktu DB2. Datoý typ NUMBER systému Oracle je podle ýchozího nastaení mapoán na datoý typ DOUBLE produktu DB2, datoý typ s pohybliou řádoou čárkou. Pomocí příkazu ALTER NICKNAME změňte lokální typy existujících přezdíek. Chcete-li změnit lokální datoý typ na typ DECIMAL(8,2), musíte změnit každou přezdíku jednotliě. Pokud přezdíky neexistují, ytořte mapoání datoého typu, které určuje typ zdroje dat. Chcete-li například ytořit mapoání datoého typu NUMBER systému Oracle na datoý typ DECIMAL(8,2) produktu DB2, zadejte následující příkaz: CREATE TYPE MAPPING MY_ORACLE_DEC FROM SYSIBM.DECIMAL(8,2) TO SERVER TYPE ORACLE TYPE NUMBER MY_ORACLE_DEC Jméno, které dáte mapoání typu. Jméno nesmí duplikoat jméno mapoání datoého typu, které již katalogu existuje. FROM SYSIBM.DECIMAL(8,2) Lokální schéma DB2 a lokální typ dat. Pokud není zadána délka nebo přesnost a počet desetinných míst, jsou tyto hodnoty určeny podle datoého typu zdroje. Kapitola 3. Mapoání datoých typů 47

60 TO SERVER TYPE ORACLE Typ dat zdroje. TYPE NUMBER Datoý typ zdroje dat, který mapujete na lokální datoý typ. Užiatelské datoé typy nejsou pooleny. Datoý typ DECIMAL(8,2) produktu DB2 je definoán lokálně pro sloupce systému Oracle. Všechny noé tabulky a pohledy systému Oracle obsahující sloupce NUMBER také mapují datoý typ NUMBER systému Oracle na datoý typ DECIMAL(8,2) produktu DB2, pokud pro tyto tabulky a pohledy ytoříte přezdíky. Souisející úlohy: Vytáření mapoání datoých typů na stránce 46 Souisející odkazy: ALTER NICKNAME statement příručce SQL Reference, Volume 2 CREATE TYPE MAPPING statement příručce SQL Reference, Volume 2 Vytoření mapoání typů pro datoý typ zdroje dat a erzi příklad V tomto příkladu existují tabulky a pohledy Oracle na různých erzích sereru Oracle. Pro šechny tabulky a pohledy sereru Oracle erze platí, že sloupce použíající datoý typ NUMBER(23,3) systému Oracle musí být mapoány na datoý typ DECIMAL(8,2) produktu DB2. Datoý typ NUMBER(23,3) systému Oracle je podle ýchozího nastaení mapoán na datoý typ DECIMAL(23,3) produktu DB2. Pomocí příkazu ALTER NICKNAME změňte lokální typy existujících přezdíek. Chcete-li změnit lokální datoý typ na typ DECIMAL(8,2), musíte změnit každou přezdíku jednotliě. Pokud přezdíky neexistují, ytořte mapoání datoého typu, které určuje typ zdroje dat. Chcete-li například mapoat datoý typ NUMBER(23,3) systému Oracle na datoý typ DECIMAL(8,2) produktu DB2 pro serery Oracle použíající erzi 8.0.3, zadejte následující příkaz: CREATE TYPE MAPPING ORA_DEC FROM SYSIBM.DECIMAL(8,2) TO SERVER TYPE ORACLE VERSION TYPE NUMBER(23,3) ORA_DEC Jméno, které dáte mapoání typu. Jméno nesmí duplikoat jméno mapoání datoého typu, které již katalogu existuje. FROM SYSIBM.DECIMAL(8,2) Lokální schéma DB2 a lokální typ dat. Pokud není zadána délka nebo přesnost a počet desetinných míst, jsou tyto hodnoty určeny podle datoého typu zdroje. TO SERVER TYPE ORACLE Typ dat zdroje. VERSION Verze sereru zdroje dat. Musíte zadat erzi. Můžete také zadat ydání a modifikaci ydání, jak je uedeno příkladu. TYPE NUMBER(23,3) Datoý typ zdroje dat, který mapujete na lokální datoý typ. Užiatelské datoé typy nejsou pooleny. 48 Příručka pro federoané systémy

61 Produkt DB2 UDB definuje datoý typ DECIMAL(8,2) produktu DB2 lokálně pro sloupce Oracle na sererech erze Všechny noé tabulky a pohledy systému Oracle erze obsahující sloupce NUMBER(23,3) také mapují datoý typ NUMBER(23,3) systému Oracle na datoý typ DECIMAL(8,2) produktu DB2, pokud pro tyto tabulky a pohledy ytoříte přezdíky. Tabulky a pohledy systému Oracle na sererech, které nepoužíají erzi 8.0.3, použíají ýchozí mapoání datoých typů. Souisející úlohy: Vytáření mapoání datoých typů na stránce 46 Souisející odkazy: ALTER NICKNAME statement příručce SQL Reference, Volume 2 CREATE TYPE MAPPING statement příručce SQL Reference, Volume 2 Vytoření mapoání typů pro šechny objekty zdroje dat na sereru příklad V tomto příkladu je serer pro federoanou databázi definoán jako ORA2SERVER. Každá tabulka obsahuje sloupec s datoým typem DATE systému Oracle. Datoý typ DATE produktu Oracle obsahuje hodnoty odpoídající století, roku, měsíci, dnu, hodinám, minutám a sekundám. Datoý typ DATE systému Oracle je podle ýchozího nastaení mapoán na datoý typ TIMESTAMP produktu DB2. Pokud ošem zadáte dotaz na kterýkoli objekt na tomto sereru, musí ýsledná sada rátit pouze informace o čase (hodiny, minuty a sekundy). Pomocí příkazu ALTER NICKNAME změňte lokální typy existujících přezdíek. Chcete-li změnit lokální datoý typ na typ TIME, musíte změnit každou přezdíku jednotliě. Pokud přezdíky neexistují, ytořte mapoání datoého typu, které určuje typ zdroje dat. Chcete-li mapoat datoý typ DATE systému Oracle na datoý typ TIME produktu DB2 pro serer ORA2SERVER, zadejte následující příkaz: CREATE TYPE MAPPING ORA2_DATE FROM SYSIBM.TIME TO SERVER ORA2SERVER TYPE DATE ORA2_DATE Jméno, které dáte mapoání typu. Jméno nesmí duplikoat jméno mapoání datoého typu, které již katalogu existuje. FROM SYSIBM.TIME Lokální schéma DB2 a lokální typ dat. Pokud není zadána délka nebo přesnost a počet desetinných míst, jsou tyto hodnoty určeny podle datoého typu zdroje. TO SERVER ORA2SERVER Lokální jméno sereru zdroje dat. TYPE DATE Datoý typ zdroje dat, který mapujete na lokální datoý typ. Užiatelské datoé typy nejsou pooleny. Produkt DB2 UDB lokálně definuje datoý typ TIME produktu DB2 pro sloupce Oracle datoého typu DATE. Kapitola 3. Mapoání datoých typů 49

62 Veškeré noé objekty, které budou přidány na tento serer a obsahují sloupce typu DATE, také mapují datoý typ DATE systému Oracle na datoý typ TIME produktu DB2, pokud pro tyto objekty ytoříte přezdíky. Objekty zdroje dat na jiných sererech Oracle nejsou tímto mapoáním typů dat nijak oliněny. Souisející úlohy: Vytáření mapoání datoých typů na stránce 46 Souisející odkazy: ALTER NICKNAME statement příručce SQL Reference, Volume 2 CREATE TYPE MAPPING statement příručce SQL Reference, Volume 2 Změna lokálního typu pro objekt zdroje dat Vytoříte-li přezdíku, budou datoé typy asocioané s objektem zdroje dat uloženy e federoané databázi. U některých zdrojů dat určí modul wrapper datoé typy za ás. U jiných zdrojů dat musíte zadat datoé typy při ytoření přezdíky. Je možné zadat lokální typ pro sloupec specifického objektu zdroje dat. Namísto příkazu CREATE TYPE MAPPING použijte příkaz ALTER NICKNAME. Upozornění: Změna lokálního datoého typu může ést k chybám nebo ke ztrátě informací, pokud změníte lokální datoý typ sloupce na typ, který se od sého zdáleného typu ýrazně liší. Předpoklady: Autorizační ID zadáající příkaz musí obsahoat alespoň jedno z následujících opránění: Opránění SYSADM nebo DBADM Opránění ALTER pro přezdíku zadanou příkazu Opránění CONTROL pro přezdíku zadanou příkazu Opránění ALTERIN pro schéma (pokud jméno schématu přezdíky existuje) Autorizační ID asocioané s příkazem musí být autor definice přezdíky zaznamenaný sloupci DEFINER pohledu katalogu pro přezdíku. Omezení: Další informace naleznete tématu omezení změny přezdíek. Postup: Datoý typ můžete změnit pomocí Řídicího centra DB2 nebo z příkazoého řádku DB2. Chcete-li proést tuto úlohu pomocí Řídicího centra DB2, postupujte takto: 1. Vyberte složku Přezdíky. 2. Klepněte praým tlačítkem myši na přezdíku, kterou chcete změnit, a pak klepněte na tlačítko Změnit. Oteře se okno Změnit přezdíku. 3. Na stránce Přezdíky yberte sloupec, který chcete změnit, a klepněte na příkaz Změnit. Oteře se okno Změnit sloupec. 4. Vyberte datoý typ. 50 Příručka pro federoané systémy

63 5. Klepnutím na tlačítko OK změníte datoý typ a zařete okno. 6. Klepnutím na tlačítko OK změníte přezdíku a zařete zápisník. Chcete-li proést tuto úlohu z příkazoého řádku, použijte příkaz ALTER NICKNAME: Příklad: ALTER NICKNAME přezdíka ALTER COLUMN jméno_sloupce LOCAL TYPE datoý_typ Chcete-li upraoat obsah lokálního sloupce, jehož znakoý datoý typ jsou bitoá (binární) data, použijte klauzuli FOR BIT DATA příkazu ALTER NICKNAME. Pokud použijete pro změnu lokálního datoého typu sloupce tuto klauzuli, nebudou se při ýměně dat s jinými systémy proádět přeody kódoých stránek. Poronání probíhá binárně, bez ohledu na posloupnost řazení zdálené databáze. Souisející úlohy: Změna přezdíky na stránce 31 Souisející odkazy: Omezení e změnách přezdíek na stránce 33 ALTER NICKNAME statement příručce SQL Reference, Volume 2 Kapitola 27, Výchozí dopředné mapoání datoých typů, na stránce 249 Změna lokálního typu pro objekt zdroje dat příklady na stránce 51 Kapitola 30, Datoé typy podporoané pro nerelační zdroje dat, na stránce 281 Změna lokálního typu pro objekt zdroje dat příklady Následující příklady ukazují, jak změnit datoé typy pro objekt zdroje dat. Příklad: Mapoání numerických datoých typů: V tabulce systému Oracle pro informace o zaměstnancích je sloupec BONUS definoán pomocí datoého typu NUMBER(32,3). Datoý typ NUMBER(32,3) systému Oracle je mapoán na datoý typ DOUBLE produktu DB2, číselný datoý typ s pohybliou řádoou čárkou a dojitou přesností. Dotaz zahrnující sloupec BONUS může racet hodnoty podobné následujícím: E E+003 Vědecká notace označuje počet desetinných míst a směr, e kterém se má posunout desetinný odděloač. V tomto příkladu hodnota +002 znamená, že se má desetinný odděloač posunout o dě místa dopraa, a hodnota +003 znamená, že se má desetinný odděloač posunout o tři místa dopraa. Dotazy zahrnující sloupec BONUS mohou racet hodnoty, které ypadají jako hodnota korunách. Změňte lokální definici sloupce BONUS tabulce z datoého typu DOUBLE na datoý typ DECIMAL. Použijte přesnost a počet desetinných míst odpoídající formátu skutečných bonusům. Pokud například bonusoá částka dolarech nepřesáhne šest cifer, proeďte mapoání typu NUMBER(32,3) na typ DECIMAL(8,2). Za podmínky tohoto noého lokálního typu budou dotazy zahrnující sloupec BONUS racet podobné hodnoty: Kapitola 3. Mapoání datoých typů 51

64 Přezdíka pro tabulku Oracle je ORASALES. Chcete-li mapoat sloupec BONUS tabulce ORASALES na datoý typ DECIMAL(8,2) produktu DB2, zadejte následující příkaz ALTER NICKNAME: ALTER NICKNAME ORASALES ALTER COLUMN BONUS LOCAL TYPE DECIMAL(8,2) ORASALES Přezdíka, kterou jste definoali pro tabulku Oracle. ALTER COLUMN BONUS Jméno sloupce, které je definoáno lokálně pohledu katalogu SYSCAT.COLUMNS federoané databáze. LOCAL TYPE DECIMAL(8,2) Identifikuje noý lokální typ pro sloupec. Toto mapoání se použíá pouze pro sloupec BONUS tabulce Oracle identifikoané přezdíkou ORASALES. Všechny ostatní objekty zdroje dat Oracle obsahující sloupec BONUS budou použíat ýchozí mapoání datoých typů pro datoý typ NUMBER systému Oracle. Příklad: Mapoání datoých typů data: Přezdíka pro tabulku Oracle jménem SALES je ORASALES. Tabulka SALES obsahuje sloupec s datoým typem DATE systému Oracle. Podle ýchozího nastaení je datoý typ DATE produktu Oracle mapoán na datoý typ TIMESTAMP produktu DB2. Chcete ošem zobrazit hodnotu data pouze po načtení dat z tohoto sloupce. Můžete změnit přezdíku pro tabulku SALES a změnit tak lokální datoý typ DATE produktu DB2. ALTER NICKNAME ORASALES ALTER COLUMN ORDER_DATE LOCAL TYPE DATE Příklad: Mapoání datoých typů pro nerelační zdroje dat: Přezdíka pro tabulkoý soubor jménem drugdata1.txt je DRUGDATA1. Soubor drugdata1.txt obsahuje sloupec uádějící seznam jmen farmaceutických produktů. Jméno sloupce je DRUG. Sloupec DRUG byl půodně definoán jako CHAR(20). Délka sloupce musí být změněna na CHAR(30). Přezdíku souboru drugdata1.txt lze změnit, a změnit tak i mapoání na spránou délku: ALTER NICKNAME DRUGDATA1 ALTER COLUMN DRUG LOCAL TYPE CHAR(30) Souisející úlohy: Vytáření mapoání datoých typů na stránce 46 Změna lokálního typu pro objekt zdroje dat na stránce 50 Souisející odkazy: ALTER NICKNAME statement příručce SQL Reference, Volume 2 Omezení e změnách přezdíek na stránce Příručka pro federoané systémy

65 Změna dlouhých datoých typů na datoé typy archar Chcete-li poolit operace kládání a aktualizace pro dlouhé datoé typy, můžete změnit dlouhé datoé typy na datoé typy VARCHAR. Oddíl Tabulka 4 uádí dlouhé datoé typy podle zdroje dat, který můžete změnit. Tabulka 4. Dlouhé datoé typy podle zdroje dat, které lze změnit na datoé typy archar Zdroj dat Vzdálený datoý typ Délka Lokální ýchozí datoý typ Změna na VARCHAR DRDA BLOB BLOB archar for bit data CLOB CLOB archar long archar CLOB archar long archar for bit data BLOB archar for bit data Informix byte BLOB archar for bit data Microsoft SQL Serer text CLOB archar image text proměnné hostitele; literály proměnné hostitele; literály Oracle NET8 long proměnné hostitele; literály long raw proměnné hostitele; literály BLOB CLOB CLOB BLOB archar for bit data archar archar archar for bit data Sybase CTLIB image BLOB archar for bit data text CLOB archar Teradata byte BLOB archar for bit data(32672) CHAR CLOB archar(32672) arbyte BLOB archar for bit data(32672) archar CLOB archar(32672) Souisející koncepce: Mapoání datoých typů e federoaném systému na stránce 43 Příkazy INSERT, UPDATE a DELETE a objekty LOB na stránce 91 Souisející odkazy: Kapitola 27, Výchozí dopředné mapoání datoých typů, na stránce 249 Kapitola 3. Mapoání datoých typů 53

66 54 Příručka pro federoané systémy

67 Kapitola 4. Mapoání funkcí a užiatelské funkce Moduly wrapper, které jsou součástí produktu DB2 Information Integrator, obsahují ýchozí mapoání funkcí mezi zdroji dat a produktem DB2 for Linux, UNIX, and Windows. Mapoání funkcí e federoaném systému Jak pracují mapoání funkcí e federoaném systému na stránce 56 Požadaky pro mapoání užiatelských funkcí (UDF) na stránce 57 Šablony funkce na stránce 57 Vytáření šablon funkcí na stránce 58 Poskytoání informací o režii mapoání funkce optimalizátoru dotazů na stránce 59 Zadání jmen funkcí mapoání funkcí na stránce 61 Jak ytořit mapoání funkce na stránce 62 Užiatelské funkce aplikacích na stránce 65 Zákaz ýchozího mapoání funkce na stránce 65 Zrušení mapoání užiatelské funkce na stránce 66 Mapoání funkcí e federoaném systému Produkt DB2 Information Integrator poskytuje ýchozí mapoání mezi existujícími estaěnými funkcemi zdroje dat a odpoídajícími estaěnými funkcemi produktu DB2. Aby federoaný serer rozpoznal funkci zdroje dat, musí být funkce mapoána na existující odpoídající funkci produktu DB2 for Linux, UNIX, and Windows. Výchozí mapoání funkce je modulech wrapper. U nerelačních zdrojů dat nelze existující mapoání funkce přepsat, ani ytořit noé mapoání. Kdy ytořit lastní mapoání funkce Pokud není ýchozí mapoání funkce pro funkci zdroje dat k dispozici, můžete mapoání funkce ytořit. Jeden z důodů, proč není mapoání funkce dostupné, může spočíat tom, že neexistuje žádná odpoídající funkce mezi zdrojem dat a produktem DB2 for Linux, UNIX, and Windows. Jiným důodem nedostupnosti mapoání je, pokud má zdroj dat funkci podobnou funkci produktu DB2, ale ta nerací stejné ýsledky. Pokud zdroj dat rací poněkud odlišné ýsledky, případně odlišné ýsledky pro určité sady stupních dat, neproedou moduly wrapper mapoání na tyto funkce. Pokud ám ošem odlišnosti e ýsledných sadách neadí, můžete mezi funkcemi mapoání ytořit. Vytoření mapoání může zýšit ýkon. Mapoání funkcí použijte následujících případech: Ve zdroji dat je k dispozici noá estaěná funkce. Ve zdroji dat je k dispozici noá užiatelská funkce. Odpoídající funkce DB2 neexistuje. Odpoídající funkce existuje, ale rací poněkud odlišné ýsledky, což ám neadí. Nastaení pro mapoání funkcí se ukládají do pohledu katalogu SYSCAT.FUNCMAPPINGS. Copyright IBM Corp. 1998,

68 Když ytoříte mapoání funkce, je možné, že se náratoé hodnoty z funkce yhodnocené e zdroji dat budou lišit od náratoých hodnot z kompatibilní funkce yhodnocené e federoané databázi DB2. Produkt DB2 Information Integrator použíá mapoání funkcí, může něm ale dojít k chybám syntaxe SQL nebo neočekáaným ýsledkům. Proč je mapoání funkcí důležité Mapoání funkcí jsou jedním z několika důležitých stupů analýzy pro přesun zpracoání na nižší úroeň proáděnou optimalizátorem dotazu. Při ybírání nejlepšího přístupoého plánu pro dotaz zhodnotí optimalizátor dotazu schopnost zdroje dat proést konkrétní typ funkce nebo operace SQL. Pokud funkce nemá mapoání, nebude odeslána do zdroje dat ke zpracoání. Funkce a další operace, které je možné přesunout na nižší úroeň, zyšují ýkon. Pokud zdroj dat obsahuje funkci podobnou funkci produktu DB2, která ošem rací poněkud odlišné ýsledky, může ytoření mapoání funkce zlepšit ýkon. Například funkce STDEV (směrodatná odchylka) produktu Informix dáá pro některé sady stupních dat jiné ýsledky než funkce STDDEV produktu DB2. Z tohoto důodu modul wrapper pro Informix nemá mezi těmito funkcemi ýchozí mapoání. Pokud ám rozdíly e ýsledných sadách neadí, můžete zlepšit ýkon dotazů, které mají přístup ke zdrojům dat produktu Informix, použitím funkce STDDEV produktu DB2. Vytořením mapoání funkce mezi funkcí STDEV produktu Informix a funkcí STDDEV produktu DB2 dáte optimalizátoru dotazu možnost olby, zda přesunout zpracoání této funkce na nižší úroeň do zdroje dat. Souisející koncepce: Jak pracují mapoání funkcí e federoaném systému na stránce 56 Požadaky pro mapoání užiatelských funkcí (UDF) na stránce 57 Šablony funkce na stránce 57 Jak ytořit mapoání funkce na stránce 62 Souisející úlohy: Poskytoání informací o režii mapoání funkce optimalizátoru dotazů na stránce 59 Zadání jmen funkcí mapoání funkcí na stránce 61 Jak pracují mapoání funkcí e federoaném systému Když předáte dotazy obsahující jednu nebo íce funkcí federoanému sereru, federoaný serer zkontroluje informace o mapoání mezi funkcemi produktu DB2 a funkcemi zdroje dat. Federoaný serer tyto informace oěřuje na dou místech: Modul wrapper. Modul wrapper zdroje dat obsahuje ýchozí mapoání funkce. Pohled katalogu SYSCAT.FUNCMAPPINGS. Tento pohled obsahuje ytořené položky, které přepíší nebo rozšíří ýchozí mapoání funkce uedené modulu wrapper. Dále obsahuje noě ytořená mapoání, pokud ýchozí mapoání funkce neexistuje. Pokud lze pro funkci použít íce mapoání, použije se mapoání ytořené naposledy. Volby mapoání funkcí určují informace o funkci a o potenciálních nákladech zpracoání funkce e zdroji dat. Volby mapoání funkcí uádějí například následující informace: Jméno funkce zdáleného zdroje dat. Předpokládaný počet instrukcí zpracoaných při prním a posledním yolání funkce zdroje dat. Předpokládaný počet stupů a ýstupů proedených při prním a posledním yolání funkce zdroje dat. Předpokládaný počet instrukcí zpracoaných během jednoho yolání funkce zdroje dat. 56 Příručka pro federoané systémy

69 Vytáříte-li mapoání funkce, mapujete funkci zdroje dat na odpoídající funkci e federoané databázi. Pokud příslušná funkce produktu DB2 neexistuje nebo pokud chcete ynutit použití funkce zdroje dat federoaným sererem, můžete ytořit šablonu funkce, která bude ystupoat jako protějšek. Souisející koncepce: Mapoání funkcí e federoaném systému na stránce 55 Požadaky pro mapoání užiatelských funkcí (UDF) na stránce 57 Požadaky pro mapoání užiatelských funkcí (UDF) Šablony funkce Než bude možné yolat užiatelskou funkci zdroje dat e federoaném systému, musí federoaná databáze přiřadit funkci zdroje dat ke specifikaci funkce uložené globálním katalogu na federoaném sereru. Existují dě podmínky, za nichž může federoaná databáze přiřadit specifikaci funkce k funkci zdroje dat: Produkt DB2 UDB obsahuje funkci, jejíž signatura odpoídá signatuře funkce zdroje dat. Signatura se skládá ze jména funkce a stupních parametrů funkce. Signatury si odpoídají, jsou-li splněny obě následující podmínky: Obsahují stejná jména a stejný počet parametrů Datoý typ každého parametru jedné signatuře je stejný jako datoý typ odpoídajícího parametru druhé signatuře (nebo jej lze na takoý typ přeést). Pokud produkt DB2 UDB nemá funkci s potřebnou signaturou, můžete definoat šablonu funkce, která tuto signaturu obsahuje. Pak proedete mapoání šablony funkce na funkci zdroje dat, kterou chcete yolat. Nastaení pro mapoání funkcí se ukládají do pohledu katalogu SYSCAT.FUNCMAPPINGS. Souisející koncepce: Mapoání funkcí e federoaném systému na stránce 55 Užiatelské funkce aplikacích na stránce 65 Souisející úlohy: Zrušení mapoání užiatelské funkce na stránce 66 Federoaný serer rozpozná funkci zdroje dat případě, že existuje mapoání mezi funkcí zdroje dat a příslušnou funkcí DB2 e federoané databázi. Pokud žádná příslušná funkce neexistuje, můžete ytořit šablonu funkcí, která se bude choat jako příslušná funkce produktu DB2. Šablona funkce je funkce produktu DB2, kterou ytoříte, abyste přinutili federoaný serer yolat funkci zdroje dat. Na rozdíl od běžných funkcí šak šablona funkce nemá žádný spustitelný kód. Když federoaný serer přijme dotazy, které odkazují na šablonu funkce, yolá funkci zdroje dat. Šablona funkce se ytáří pomocí příkazu CREATE FUNCTION s parametrem AS TEMPLATE. Kapitola 4. Mapoání funkcí a užiatelské funkce 57

70 Po ytoření šablony funkce musíte ytořit mapoání funkcí mezi šablonou funkce a funkcí zdroje dat. Mapoání funkce se ytáří pomocí příkazu CREATE FUNCTION MAPPING. Souisející koncepce: Mapoání funkcí e federoaném systému na stránce 55 Souisející úlohy: Vytáření šablon funkcí Vytáření šablon funkcí na stránce 58 Federoaný serer rozpozná funkci zdroje dat případě, že existuje mapoání mezi funkcí zdroje dat a příslušnou funkcí e federoané databázi. Pokud žádná příslušná funkce neexistuje, můžete ytořit šablonu funkce, která se bude choat jako příslušná funkce. Předpoklady: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí obsahoat alespoň jedno z následujících opránění: Opránění SYSADM nebo DBADM Opránění IMPICIT_SCHEMA pro databázi, pokud neexistuje implicitní nebo explicitní jméno schématu funkce Opránění CREATEIN pro schéma, pokud jméno schématu funkce existuje Omezení: Pokud má funkce zdroje dat stupní parametry, platí následující omezení: Příslušná funkce databáze DB2 musí mít stejný počet stupních parametrů jako funkce zdroje dat. Datoé typy stupních parametrů příslušné funkce DB2 musí být kompatibilní s příslušnými datoými typy stupních parametrů funkce zdroje dat. Datoý typ nemůže být typu LONG VARCHAR, LONG VARGRAPHIC, DATALINK ani užiatelský datoý typ. Nemá-li funkce zdroje dat žádné stupní parametry, nesmí mít žádné stupní parametry ani příslušná funkce databáze DB2. Postup: Šablona funkce se ytáří pomocí příkazu CREATE FUNCTION s parametrem AS TEMPLATE, například: CREATE FUNCTION BONUS () RETURNS DECIMAL(8,2) AS TEMPLATE DETERMINISTIC NO EXTERNAL ACTION BONUS () Jméno, které dáte šabloně funkce. RETURNS DECIMAL(8,2) Datoý typ ýstupu. AS TEMPLATE Označuje, že se jedná o šablonu funkce, nikoli o funkci. 58 Příručka pro federoané systémy

71 DETERMINISTIC Určuje, že funkce pro danou sadu hodnot argumentů ždy rací stejné ýsledky. NO EXTERNAL ACTION Určuje, že funkce nemá externí li na objekty, které nejsou spraoány sprácem databází. Klauzule DETERMINISTIC a NO EXTERNAL ACTION je třeba zadat podle toho, zda je funkce sama deterministická a zda způsobuje nějakou externí akci. Jinak budou na operace SQL podporoané touto šablonou funkce ualena omezení. Po ytoření šablony funkce musíte ytořit mapoání funkcí mezi šablonou funkce a funkcí zdroje dat. Mapoání funkce se ytáří pomocí příkazu CREATE FUNCTION MAPPING, například: CREATE FUNCTION MAPPING MY_INFORMIX_FUN FOR BONUS() SERVER TYPE INFORMIX OPTIONS (REMOTE_NAME BONUS() ) MY_INFORMIX_FUN Jméno, které dáte mapoání funkce. Jméno nesmí duplikoat jméno mapoání funkce, které je již popsáno globálním katalogu federoané databáze. Musí být jedinečné. FOR BONUS() Jméno lokální šablony funkce DB2. Zahrnuje stupní parametry datoého typu záorkách. SERVER TYPE INFORMIX Identifikuje typ zdroje dat obsahující funkci, kterou chcete mapoat. OPTIONS (REMOTE_NAME BONUS() ) Volba určující jméno funkce zdáleného zdroje dat, kterou mapujete na lokální šablonu funkce DB2. Souisející koncepce: Mapoání funkcí e federoaném systému na stránce 55 Šablony funkce na stránce 57 Souisející odkazy: CREATE FUNCTION (Sourced or Template) statement příručce SQL Reference, Volume 2 Poskytoání informací o režii mapoání funkce optimalizátoru dotazů Když kompilátor DB2 SQL obdrží dotaz obsahující funkci, optimalizátor dotazů určí, zda lze zpracoání funkce přesunout do zdroje dat. Předpokládejme, že tato analýza přesunu na nižší úroeň rozhodne, že zdroj dat nebo produkt DB2 UDB je schopen tuto funkci zpracoat. Když ytoříte mapoání funkce, můžete produktu DB2 UDB poskytnout důležité informace o potenciálních nákladech nebo režii proedení funkce zdroje dat e zdroji dat. Optimalizátoru dotazů může díky těmto předpokladům režie poronat předpokládané náklady na proedení funkce zdroje dat s předpokládanými náklady na proedení funkce DB2. Tyto informace pomohou optimalizátoru dotazů produktu DB2 určit nejlepší strategii pro proedení dotazu. Je-li zpracoáán distribuoaný požadaek, optimalizátor yhodnotí několik přístupoých strategií a odhadne režii pro yolání funkce DB2 a funkce zdroje dat. Použije se strategie s nejnižší předpokládanou režií. Kapitola 4. Mapoání funkcí a užiatelské funkce 59

72 Předpokládanou statistiku režie zahrnete do příkazu CREATE FUNCTION MAPPING. Tento příkaz může například udáat předpokládaný počet instrukcí požadoaných k yolání funkce zdroje dat. Může také určoat předpokládaný počet stupů a ýstupů potřebných pro každý bajt sady argumentů předáané této funkci. Tyto předpoklady jsou uloženy do globálního katalogu a zobrazeny pohledu SYSCAT.FUNCMAPOPTIONS. Pokud je mapoání použita funkce produktu DB2 (namísto funkce zdroje dat nebo šablony funkce DB2), bude globální katalog obsahoat odhady režie potřebné při yolání funkce DB2. Tyto odhady jsou zobrazeny pohledu SYSCAT.ROUTINES. Předpoklady: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí mít opránění SYSADM nebo DBADM. Postup: Předpokládanou statistiku zadejte do příkazu CREATE FUNCTION MAPPING pomocí oleb mapoání funkce. Následující tabulka uádí olby mapoání funkce určující režii funkce a ýchozí hodnoty těchto oleb. Tabulka 5. Volby mapoání funkce určující režii funkce Volba INITIAL_INSTS INITIAL_IOS INSTS_PER_ARGBYTE INSTS_PER_INVOC IOS_PER_ARGBYTE IOS_PER_INVOC PERCENT_ARGBYTES Platná nastaení Předpokládaný počet instrukcí zpracoaných při prním a posledním yolání funkce zdroje dat. Předpokládaný počet stupů a ýstupů proedených při prním a posledním yolání funkce zdroje dat. Předpokládaný počet instrukcí zpracoaných na každý bajt sady argumentů předaný funkci zdroje dat. Předpokládaný počet instrukcí zpracoaných během jednoho yolání funkce zdroje dat. Předpokládaný počet stupů a ýstupů ynaložených na každý bajt sady argumentů předaný funkci zdroje dat. Předpokládaný počet stupů a ýstupů na jedno yolání funkce zdroje dat. Odhadoané průměrné procento bajtů stupního argumentu, které budou funkcí e skutečnosti načteny. Výchozí nastaení Příklad: Volba mapoání funkce PERCENT_ARGBYTES: Předpokládejme, že chcete mapoat užiatelskou funkci jménem US_DOLLAR e zdroji dat systému Oracle na ámi ytořenou užiatelskou funkci produktu DB2. Serer zdroje dat Oracle se jmenuje ORACLE2. Rozhodnete se pojmenoat užiatelskou funkci produktu DB2 DOLLAR a zobrazení této funkce ORACLE_DOLLAR. Chcete nastait olbu funkce PERCENT_ARGBYTES tak, aby poskytoala optimalizátoru přesnější informace o režii. Příkaz SQL bude následující: CREATE FUNCTION MAPPING ORACLE_DOLLAR FOR DOLLAR() SERVER ORACLE2 OPTIONS (REMOTE_NAME US_DOLLAR(), PERCENT_ARGBYTES 250 ) Příklad: Volba mapoání funkce INSTS_PER_INVOC: 60 Příručka pro federoané systémy

73 Předpokládejme, že chcete mapoat lokální funkci UCASE(CHAR) na užiatelskou funkci systému Oracle jménem UPPERCASE. Funkce systému Oracle se e zdroji dat nazýá ORACLE2. Chcete zahrnout předpokládaný počet instrukcí na yolání užiatelské funkce systému Oracle. Syntaxe je následující: CREATE FUNCTION MAPPING MY_ORACLE_FUN4 FOR SYSFUN.UCASE(CHAR) SERVER ORACLE2 OPTIONS (REMOTE_NAME UPPERCASE, INSTS_PER_INVOC 1000 ) Aktualizace informací o režii Pokud se odhady režie změní, můžete změnu zaznamenat do globálního katalogu. Chcete-li zaznamenat noé odhady pro funkci zdroje dat, musíte nejpre zrušit nebo zakázat mapoání funkce. Pak mapoání znou ytořte a zadejte noé odhady do příkazu CREATE FUNCTION MAPPING. Noé odhady budou přidány do pohledu katalogu SYSCAT.FUNCMAPPINGS. Chcete-li zaznamenat změněné odhady pro funkci produktu DB2, můžete přímo aktualizoat pohled katalogu SYSSTAT.ROUTINES. Souisející koncepce: Mapoání funkcí e federoaném systému na stránce 55 Souisející odkazy: Kapitola 25, Volby mapoání funkcí pro federoané systémy, na stránce 241 Zadání jmen funkcí mapoání funkcí Hodnoty zadané příkazu CREATE FUNCTION MAPPING záisí na tom, zda společně mapoané funkce mají shodné jméno či různá jména. Předpoklady: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí mít opránění SYSADM nebo DBADM. Mapoání funkcí se shodným jménem: Mezi děma funkcemi (nebo mezi šablonou funkce DB2 a funkcí zdroje dat), které mají shodné jméno, můžete ytořit mapoání. Předpokládejme například, že chcete mapoat užiatelskou funkci MYFUN e zdroji dat Informix na užiatelskou funkci DB2 TINA.MYFUN. Serer zdroje dat Informix je pojmenoán INFORMIX2. Syntaxe příkazu bude následující: CREATE FUNCTION MAPPING FOR TINA.MYFUN(SYSTEM.INTEGER) SERVER INFORMIX2 Mapoání funkcí s různými jmény: Chcete-li ytořit mapoání mezi děma funkcemi (nebo mezi šablonou funkce DB2 a funkcí zdroje dat) s různými jmény, postupujte takto: Přiřaďte jméno funkce DB2 nebo šablony funkce parametru jméno_funkce. Zadejte olbu mapoání funkce REMOTE_NAME a přiřaďte této olbě jméno funkce zdroje dat. Délka olby REMOTE_NAME nesmí překročit 255 znaků. Předpokládejme například, že chcete mapoat užiatelskou funkci UPPERCASE e zdroji dat Oracle na funkci DB2 UCASE(CHAR). Jméno sereru zdroje dat Oracle je ORACLE2. Chcete též zadat odhadoaný počet instrukcí na jedno yolání funkce UPPERCASE. Toto mapoání funkce pojmenujete například jako ORACLE_UPPER. Syntaxe příkazu bude následující: Kapitola 4. Mapoání funkcí a užiatelské funkce 61

74 CREATE FUNCTION MAPPING ORACLE_UPPER FOR SYSFUN.UCASE(CHAR) SERVER ORACLE2 OPTIONS (REMOTE_NAME UPPERCASE, INSTS_PER_INVOC 1000 ) Souisející koncepce: Jak ytořit mapoání funkce Mapoání funkcí e federoaném systému na stránce 55 Příkaz CREATE FUNCTION MAPPING určuje alternatiní mapoání funkce, které přepíše mapoání ýchozí. Pokud ytáříte alternatiní mapoání funkcí, zobrazují se položky pohledu katalogu SYSCAT.FUNCMAPPINGS. Pro určení oleb mapoání funkcí můžete také použít příkaz CREATE FUNCTION MAPPING. Když zadáte olby mapoání funkcí, zobrazí se informace pohledu katalogu SYSCAT.FUNCMAPOPTIONS. Pomocí příkazu CREATE FUNCTION MAPPING lze proést následující: Vytořit mapoání funkce pro šechny zdroje dat konkrétního typu. Například šechny zdroje dat produktu Informix. Vytořit mapoání funkce pro šechny zdroje dat konkrétního typu a erze. Například šechny zdroje dat produktu Informix 9. Vytořit mapoání funkce pro specifický serer. Poskytnout optimalizátoru statistické informace o mapoání funkce. Zakázat ýchozí nebo ámi definoané mapoání funkce. Příkaz CREATE FUNCTION MAPPING lze zadat Příkazoém centru DB2 nebo příkazoém procesoru (CLP). Příkaz CREATE FUNCTION MAPPING lze také ložit do aplikačního programu. Řídicí centrum DB2 nepodporuje ytáření ani úpray mapoání funkcí. Souisející úlohy: Vytoření mapoání funkce pro specifický typ zdroje dat na stránce 62 Vytoření mapoání funkce pro specifický typ a erzi zdroje dat na stránce 63 Vytoření mapoání funkce pro šechny objekty zdroje dat na specifickém sereru na stránce 64 Vytoření podrobností o mapoání funkcí Pomocí příkazu CREATE FUNCTION MAPPING můžete ytořit mapoání na funkci nebo šablonu funkce produktu DB2. Vytoření mapoání funkce pro specifický typ zdroje dat Je možné ytořit mapoání funkce pro šechny zdroje dat specifického typu. Předpoklady: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí mít opránění SYSADM nebo DBADM. Omezení: 62 Příručka pro federoané systémy

75 U nerelačních zdrojů dat nelze existující mapoání funkce přepsat, ani ytořit noé mapoání. Postup: Předpokládejme, že chcete mapoat šablonu funkce produktu DB2 na užiatelskou funkci systému Oracle pro šechny zdroje dat Oracle. Šablona se jmenuje STATS a náleží schématu jménem NOVA. Užiatelská funkce systému Oracle se jmenuje STATISTICS a náleží schématu jménem STAR. Příkaz CREATE FUNCTION MAPPING ypadá takto: CREATE FUNCTION MAPPING MY_ORACLE_FUN1 FOR NOVA.STATS ( DOUBLE, DOUBLE ) SERVER TYPE ORACLE OPTIONS (REMOTE_NAME STAR.STATISTICS ) Souisející koncepce: Jak ytořit mapoání funkce na stránce 62 Souisející úlohy: Vytoření mapoání funkce pro specifický typ a erzi zdroje dat na stránce 63 Vytoření mapoání funkce pro šechny objekty zdroje dat na specifickém sereru na stránce 64 Zrušení mapoání užiatelské funkce na stránce 66 Zadání jmen funkcí mapoání funkcí na stránce 61 Souisející odkazy: CREATE FUNCTION MAPPING statement příručce SQL Reference, Volume 2 Vytoření mapoání funkce pro specifický typ a erzi zdroje dat Je možné ytořit mapoání funkce pro šechny zdroje dat použíající specifickou erzi typu zdroje dat. Předpoklady: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí mít opránění SYSADM nebo DBADM. Omezení: U nerelačních zdrojů dat nelze existující mapoání funkce přepsat, ani ytořit noé mapoání. Postup: Předpokládejme, že chcete mapoat šablonu funkce produktu DB2 na užiatelskou funkci systému Sybase pro šechny zdroje dat Sybase použíající erzi 12. Šablona se jmenuje SYB_STATS a náleží schématu jménem EARTH. Užiatelská funkce systému Sybase se jmenuje STATISTICS a náleží schématu jménem MOON. Příkaz CREATE FUNCTION MAPPING ypadá takto: CREATE FUNCTION MAPPING SYBASE_STATS FOR EARTH.SYB_STATS ( DOUBLE, DOUBLE ) SERVER TYPE SYBASE VERSION 12 OPTIONS (REMOTE_NAME MOON.STATISTICS ) Kapitola 4. Mapoání funkcí a užiatelské funkce 63

76 Souisející koncepce: Jak ytořit mapoání funkce na stránce 62 Souisející úlohy: Vytoření mapoání funkce pro specifický typ zdroje dat na stránce 62 Vytoření mapoání funkce pro šechny objekty zdroje dat na specifickém sereru na stránce 64 Zrušení mapoání užiatelské funkce na stránce 66 Zadání jmen funkcí mapoání funkcí na stránce 61 Souisející odkazy: CREATE FUNCTION MAPPING statement příručce SQL Reference, Volume 2 Vytoření mapoání funkce pro šechny objekty zdroje dat na specifickém sereru Je možné ytořit mapoání pro funkci, kterou použíají šechny objekty zdroje dat na specifickém zdáleném sereru. Předpoklady: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí mít opránění SYSADM nebo DBADM. Omezení: U nerelačních zdrojů dat nelze existující mapoání funkce přepsat, ani ytořit noé mapoání. Postup: Předpokládejme, že chcete mapoat šablonu funkce jménem BONUS na užiatelskou funkci jménem BONUS. Chcete, aby mapoání platilo pouze pro serer zdroje dat Oracle jménem ORA_SALES. Vzhledem k tomu, že jsou jména funkcí totožná, nemusíte zadáat olbu mapoání funkce REMOTE_NAME. CREATE FUNCTION MAPPING BONUS_CALC FOR BONUS() SERVER ORA_SALES Souisející koncepce: Jak ytořit mapoání funkce na stránce 62 Souisející úlohy: Vytoření mapoání funkce pro specifický typ zdroje dat na stránce 62 Vytoření mapoání funkce pro specifický typ a erzi zdroje dat na stránce 63 Zrušení mapoání užiatelské funkce na stránce 66 Zadání jmen funkcí mapoání funkcí na stránce 61 Souisející odkazy: CREATE FUNCTION MAPPING statement příručce SQL Reference, Volume 2 64 Příručka pro federoané systémy

77 Užiatelské funkce aplikacích Výojáři aplikací často potřebují ytořit lastní sadu funkcí specifických pro určitou aplikaci či doménu. K tomuto účelu mohou použíat užiatelské skalární funkce. Pro maloobchodní systém může být například definoán datoý typ PRICE umožňující sledoat cenu prodáaných položek. Pro tento systém může být potřeba definoat také funkci SALES_TAX (obchodní daň). Vstupem této funkce by byla daná cena zboží, z ní by byla ypočtena příslušná obchodní daň a získaná hodnota by byla narácena užiateli či aplikaci, která zadala dotaz. Tyto funkce mohou pracoat se šemi databázoými typy, četně objektů typu LOB a odlišených typů. Dotazy odesílané do užiatelských funkcí mohou obsahoat ýkonné ýpočtoé a yhledáací predikáty za účelem odfiltroání nepodstatných dat blízkých zdroji dat, a tím mohou omezit sou dobu odezy. Optimalizátor SQL pracuje se šemi užiatelskými funkcemi stejně jako s estaěnými funkcemi (například SUBSTR či LENGTH). Aplikace lze yíjet různých jazykoých prostředí pro aplikace (například C, C++, COBOL či FORTRAN). Aplikace mohou sdílet sadu užiatelských funkcí SQL i případě, kdy jsou yinuty různých jazykoých prostředích pro aplikace. Užiatelské funkce mohou manipuloat s daty a mohou proádět různé akce. Pro užiatelské funkce můžete například poolit odesílání elektronických zprá za účelem aktualizace prostých souborů. V produktu DB2 mohou užiatelské funkce obsahoat následující prky: Noě definoané funkce. Funkce e schématu SYSFUN. Mezi ně patří například matematické funkce SIN, COS či TAN, ědecké funkce RADIANS, LOG10 či POWER nebo obecné funkce LEFT, DIFFERENCE či UCASE. Souisející koncepce: User-defined functions příručce SQL Reference, Volume 1 Mapoání funkcí e federoaném systému na stránce 55 Požadaky pro mapoání užiatelských funkcí (UDF) na stránce 57 Jak ytořit mapoání funkce na stránce 62 Souisející úlohy: Zrušení mapoání užiatelské funkce na stránce 66 Zákaz ýchozího mapoání funkce Výchozí mapoání funkcí nelze zrušit. Je ošem možné je zakázat, čímž je yřadíte z proozu. Předpoklady: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí mít opránění SYSADM nebo DBADM. Postup: Chcete-li zakázat ýchozí mapoání funkce, určete příkazem CREATE FUNCTION MAPPING jméno funkce DB2 a nastate olbu DISABLE na hodnotu Y. Kapitola 4. Mapoání funkcí a užiatelské funkce 65

78 Předpokládejme, že existuje ýchozí zobrazení funkce mezi funkcí WEEK produktu DB2 a podobnou funkcí e zdrojích dat Oracle. Během zpracoání dotazu s požadakem na data Oracle a odkazem na funkci WEEK může být yolána jedna z funkcí. Vyolaná funkce záisí na tom, která funkce podle předpokladů optimalizátoru dotazů yžaduje nejnižší režii. Chcete určit, jak bude oliněn ýkon, pokud bude yolána pouze funkce WEEK e zdroji dat Oracle. Chcete-li zajistit, že funkce WEEK e zdroji dat Oracle bude yolána ždy, musíte zakázat ýchozí mapoání funkce. Syntaxe je následující: CREATE FUNCTION MAPPING FOR SYSFUN.WEEK(INT) TYPE ORACLE OPTIONS (DISABLE Y ) Souisející koncepce: Mapoání funkcí e federoaném systému na stránce 55 Souisející úlohy: Zrušení mapoání užiatelské funkce na stránce 66 Souisející odkazy: CREATE FUNCTION MAPPING statement příručce SQL Reference, Volume 2 Zrušení mapoání užiatelské funkce Pokud již nepotřebujete ytořené mapoání funkce, můžete je odstranit. Zrušíte-li užiatelské mapoání funkce ytořené pro přepis ýchozího mapoání funkce, bude opět použito ýchozí mapoání funkce. Užiatelská mapoání funkcí jsou uedena pohledu katalogu SYSCAT.FUNCMAPPINGS. Předpoklady: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí mít opránění SYSADM nebo DBADM. Postup: Chcete-li zrušit mapoání funkce, které jste ytořili, použijte příkaz DROP FUNCTION MAPPING. Předpokládejme, že máte mapoání funkce jménem BONUS_CALC. Chcete-li mapoání funkce zrušit, použijte následující příkaz DROP FUNCTION MAPPING: DROP FUNCTION MAPPING BONUS_CALC Souisející koncepce: Jak ytořit mapoání funkce na stránce 62 Souisející úlohy: Zákaz ýchozího mapoání funkce na stránce 65 Souisející odkazy: DROP statement příručce SQL Reference, Volume 2 66 Příručka pro federoané systémy

79 Kapitola 5. Specifikace indexů Specifikace indexů předstauje množinu metadat, která jsou přidána do globálního katalogu při ytoření přezdíky pro objekt zdroje dat. Tyto informace použije optimalizátor dotazů k urychlení zpracoání distribuoaných požadaků. V určitých případech není specifikace indexů při ytoření přezdíky pro objekt zdroje dat ytořena. V těchto případech budete muset specifikaci indexů ytořit sami. Tato kapitola obsahuje následující témata: Specifikace indexů e federoaném systému Vytoření specifikací indexu pro objekty zdroje dat na stránce 68 Vytoření specifikací indexu na tabulkách, pro které jsou ytořeny noé indexy na stránce 69 Vytoření specifikací indexu pro pohledy na stránce 70 Vytoření specifikací indexu pro synonyma Informix na stránce 72 Specifikace indexů e federoaném systému Ve federoaném systému můžete pomocí příkazu CREATE INDEX s přezdíkou zadat informace o specifikaci indexu do globálního katalogu. Pokud bude pro tabulku ytořen noý index, bude ytořený příkaz CREATE INDEX odkazoat na přezdíku pro tabulku a obsahoat informace o indexu tabulky zdroje dat. Pokud je přezdíka ytořena pro pohled, bude ytořený příkaz CREATE INDEX odkazoat na přezdíku pro pohled a obsahoat informace o indexu podkladoé tabulky pohledu. Specifikace indexu informuje federoaný serer o sloupcích, které toří zdálený index, a jejich lastnostech jedinečnosti. Neinformuje federoaný serer o statistických lastnostech indexu, jako je počet jedinečných hodnot klíče indexu. Specifikace indexu není třeba zadáat, pokud byl zdálený index k dispozici době ytoření přezdíky. Federoaný serer neytoří specifikaci indexu, pokud ytáříte přezdíku pro následující položky: Tabulka bez indexů Pohled, který obykle nemá e zdáleném katalogu uloženy žádné informace o indexu Objekt zdroje dat, který nemá zdálený katalog, ze kterého může federoaný serer získat informace o indexu Předpokládejme například, že tabulka získá noý index ke stáajícím indexům, které obsahoala době ytoření přezdíky. Protože jsou informace o indexech předány globálnímu katalogu době ytoření přezdíky, federoaný serer o noém indexu neí. Pokud je podobně ytořena přezdíka pro pohled, federoaný serer nemá informace o podkladoé tabulce (a jejích indexech), ze které byl pohled generoán. Za těchto okolností můžete požadoané informace o indexu zadat do globálního katalogu. Můžete ytořit specifikace indexů pro tabulky, které nemají žádné indexy. Specifikací indexu sdělíte optimalizátoru dotazů, které sloupce tabulky má prohledáat, aby data našel rychle. Specifikace indexu použíejte u relačních zdrojů dat. Vytoření specifikace indexu pro nerelační zdroj dat nepoede ke zlepšení ýkonu. Copyright IBM Corp. 1998,

80 Souisející úlohy: Vytoření specifikací indexu pro objekty zdroje dat na stránce 68 Vytoření specifikací indexu na tabulkách, pro které jsou ytořeny noé indexy na stránce 69 Vytoření specifikací indexu pro pohledy na stránce 70 Vytoření specifikací indexu pro synonyma Informix na stránce 72 Charakteristika přezdíek oliňující globální optimalizaci na stránce 140 Vytoření specifikací indexu pro objekty zdroje dat Při ytáření přezdíky pro tabulku zdroje dat poskytuje federoaný serer globální katalog s údaji o šech indexech, které obsahuje tabulka zdroje dat. Tyto údaje jsou použity optimalizátorem při urychleném zpracoání distribuoaných požadaků. Jsou tořeny sadou metadat a jsou označoány jako specifikace indexu. Federoaný serer neytáří specifikaci indexu následujících případech: Byla ytořena přezdíka pro tabulku, která nemá žádný index. Je ytořena přezdíka pro objekt zdroje dat, který neobsahuje žádné indexy (například pohled, synonymum Informix, soubor s tabulkoou strukturou, tabulka Excel, algoritmus BLAST nebo soubor se značkami XML). Vzdálený index se nachází e sloupci LOB. Vzdálenému indexu odpoídá celkoá délka klíče přesahující 1024 bajtů. Maximální počet částí klíče je ětší než 16. V těchto situacích federoaný serer neukládá specifikace indexu pro objekty zdroje dat. Pro prní dě položky předchozího seznamu šak lze zadat potřebné údaje indexu do globálního katalogu. Údaje indexu lze specifikoat pomocí příkazu CREATE INDEX. Předpoklady: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí obsahoat alespoň jedno z následujících opránění: Opránění SYSADM nebo DBADM Opránění CONTROL pro objekt nebo opránění INDEX pro objekt. A dále jedno z opránění IMPLICIT_SCHEMA pro databázi (pokud neexistuje implicitní nebo explicitní jméno schématu indexu) nebo opránění CREATEIN pro schéma (pokud jméno schématu indexu odkazuje na existující schéma). Omezení: Při ytáření specifikací indexu pro přezdíku platí některá omezení. Je-li použita olba DYNAMICRULES BIND, příkaz nelze dynamicky připrait. Dále nelze příkazu CREATE INDEX použít parametry INCLUDE, CLUSTER, PCTFREE, MINPCTUSED, DISALLOW REVERSE SCANS a ALLOW REVERSE SCANS. Volbu UNIQUE lze použít pouze případě, pokud data klíče indexu obsahují jedinečné hodnoty pro každý řádek tabulky zdroje dat. Jedinečnost nebude kontroloána. Součet uložených délek určených sloupců nesmí být ětší než Jako součást indexu nelze použít sloupce LOB, DATALINK ani sloupce odlišeného typu založeného na typu LOB nebo DATALINK. Toto omezení platí i případě, kdy atribut délky sloupce je tak malý, že nedojde k překročení limitu 1024 bajtů. 68 Příručka pro federoané systémy

81 Syntaxe příkazu CREATE INDEX: Příkaz CREATE INDEX lze ložit do aplikačního programu nebo jej lze zadat prostřednictím dynamických příkazů SQL z Řídicího centra nebo z příkazoého řádku. Pokud je příkaz CREATE INDEX použit spolu s přezdíkami, budou ytořeny specifikace indexu e federoaném globálním katalogu; tabulce zdroje dat nebude index ytořen. Chcete-li ytořit specifikace indexu, použijte následující syntaxi: CREATE INDEX jméno_indexu ON přezdíka (jméno_sloupce) SPECIFICATION ONLY CREATE UNIQUE INDEX jméno_indexu ON přezdíka (jméno_sloupce DESC) SPECIFICATION ONLY Pro specifikaci indexu předstauje jméno_sloupce jméno, pomocí nějž federoaný serer odkazuje na některý sloupec tabulky zdroje dat. Souisející koncepce: Specifikace indexů e federoaném systému na stránce 67 Souisející úlohy: Vytoření specifikací indexu na tabulkách, pro které jsou ytořeny noé indexy na stránce 69 Vytoření specifikací indexu pro pohledy na stránce 70 Vytoření specifikací indexu pro synonyma Informix na stránce 72 Souisející odkazy: CREATE INDEX statement příručce SQL Reference, Volume 2 Vytoření specifikací indexu na tabulkách, pro které jsou ytořeny noé indexy Pro tabulku je ytořen noý index několika následujících situacích: Vytáříte přezdíku pro tabulku bez indexů, pro niž šak má být index ytořen později. Vytáříte přezdíku pro tabulku s indexem, pro niž šak má být později ytořen další index. V těchto situacích je třeba pro danou tabulku ytořit specifikace indexu, aby tyto údaje mohly být kompilátorem SQL použity při zpracoání dotazů odkazujících na tuto tabulku. Předpoklady: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí obsahoat alespoň jedno z následujících opránění: Opránění SYSADM nebo DBADM Opránění CONTROL pro objekt nebo opránění INDEX pro objekt. A dále jedno z opránění IMPLICIT_SCHEMA pro databázi (pokud neexistuje implicitní nebo explicitní jméno schématu indexu) nebo opránění CREATEIN pro schéma (pokud jméno schématu indexu odkazuje na existující schéma). Omezení: Při ytáření indexu pro přezdíku platí některá omezení. Kapitola 5. Specifikace indexů 69

82 Je-li použita olba DYNAMICRULES BIND, příkaz nelze dynamicky připrait. Dále nelze příkazu CREATE INDEX použít parametry INCLUDE, CLUSTER, PCTFREE, MINPCTUSED, DISALLOW REVERSE SCANS a ALLOW REVERSE SCANS. Volbu UNIQUE lze použít pouze případě, pokud data klíče indexu obsahují jedinečné hodnoty pro každý řádek tabulky zdroje dat. Jedinečnost nebude kontroloána. Součet uložených délek určených sloupců nesmí být ětší než Jako součást indexu nelze použít sloupce LOB, DATALINK ani sloupce odlišeného typu založeného na typu LOB nebo DATALINK. Toto omezení platí i případě, kdy atribut délky sloupce je tak malý, že nedojde k překročení limitu 1024 bajtů. Příklad: Tabulka bez indexu, pro niž má být ytořen index později: Předpokládejme, že pro tabulku zdroje dat se jménem CURRENT_EMP bez indexů ytoříte přezdíku employee. Po určité době od ytoření této přezdíky byl pro tabulku CURRENT_EMP definoán index s použitím sloupců WORKDEPT a JOB pro klíč indexu. Chcete-li ytořit specifikaci popisující tento index, bude syntaxe ypadat následoně: CREATE UNIQUE INDEX job_by_dept ON employee (WORKDEPT, JOB) SPECIFICATION ONLY kde job_by_dept je jméno indexu. Příklad: Pro tabulku je ytořen noý index: Předpokládejme, že byla ytořena přezdíka jp_sales pro tabulku JAPAN_SALES. Pro tabulku je edle indexů, které již pro ni byly definoány okamžiku ytoření přezdíky, později přidán noý index. Pro tento noý index je jako klíč indexu použit sloupec MARKUP. Chcete-li ytořit specifikaci popisující tento index, bude syntaxe ypadat následoně: CREATE UNIQUE INDEX jp_markup ON jp_sales (MARKUP) SPECIFICATION ONLY kde jp_markup je jméno indexu. Souisející koncepce: Specifikace indexů e federoaném systému na stránce 67 Souisející úlohy: Vytoření specifikací indexu pro objekty zdroje dat na stránce 68 Vytoření specifikací indexu pro pohledy na stránce 70 Vytoření specifikací indexu pro synonyma Informix na stránce 72 Souisející odkazy: CREATE INDEX statement příručce SQL Reference, Volume 2 Vytoření specifikací indexu pro pohledy Pokud je ytořena přezdíka pro pohled, federoaný serer nemá informace o podkladoé tabulce (a jejích indexech), ze které byl pohled generoán. Proto je třeba pro daný pohled ytořit specifikace indexu, aby tyto údaje mohly být kompilátorem SQL použity při zpracoání dotazů odkazujících na tento pohled. Předpoklady: 70 Příručka pro federoané systémy

83 Opránění příslušející autorizačnímu identifikátoru daného příkazu musí obsahoat alespoň jedno z následujících opránění: Opránění SYSADM nebo DBADM Opránění CONTROL pro objekt nebo opránění INDEX pro objekt. A dále jedno z opránění IMPLICIT_SCHEMA pro databázi (pokud neexistuje implicitní nebo explicitní jméno schématu indexu) nebo opránění CREATEIN pro schéma (pokud jméno schématu indexu odkazuje na existující schéma). Omezení: Při ytáření indexu pro přezdíku platí některá omezení. Je-li použita olba DYNAMICRULES BIND, příkaz nelze dynamicky připrait. Dále nelze příkazu CREATE INDEX použít parametry INCLUDE, CLUSTER, PCTFREE, MINPCTUSED, DISALLOW REVERSE SCANS a ALLOW REVERSE SCANS. Volbu UNIQUE lze použít pouze případě, pokud data klíče indexu obsahují jedinečné hodnoty pro každý řádek tabulky zdroje dat. Jedinečnost nebude kontroloána. Součet uložených délek určených sloupců nesmí být ětší než Jako součást indexu nelze použít sloupce LOB, DATALINK ani sloupce odlišeného typu založeného na typu LOB nebo DATALINK. Toto omezení platí i případě, kdy atribut délky sloupce je tak malý, že nedojde k překročení limitu 1024 bajtů. Pro pohled je ytořena přezdíka: Předpokládejme, že pro pohled JAPAN_SALES2003 byla ytořena přezdíka jp_sales2003. Podkladoou tabulkou pro tento pohled je tabulka JAPAN_SALES, která obsahuje několik indexů: REGION, AMOUNT, SALES_REP. Příkaz CREATE INDEX, který ytoříte, bude odkazoat na přezdíku pro daný pohled a bude obsahoat informace o indexu podkladoé tabulky pro tento pohled. Při ytáření specifikací indexu pro pohled zkontrolujte, zda sloupec či sloupce, na nichž je index tabulky založen, jsou součástí pohledu. Chcete-li ytořit specifikace indexu pro šechny indexy podkladoé tabulce, musí být jednotlié specifikace indexu ytořeny samostatně. Chcete-li například ytořit specifikaci popisující index REGION, bude syntaxe příkazu ypadat následoně: CREATE UNIQUE INDEX jp_2003_region ON jp_sales2003 (REGION) SPECIFICATION ONLY kde jp_2003_region je jméno indexu a jp_sales2003 je přezdíka pro pohled JAPAN_SALES2003. Souisející koncepce: Specifikace indexů e federoaném systému na stránce 67 Souisející úlohy: Vytoření specifikací indexu pro objekty zdroje dat na stránce 68 Vytoření specifikací indexu na tabulkách, pro které jsou ytořeny noé indexy na stránce 69 Vytoření specifikací indexu pro synonyma Informix na stránce 72 Souisející odkazy: CREATE INDEX statement příručce SQL Reference, Volume 2 Kapitola 5. Specifikace indexů 71

84 Vytoření specifikací indexu pro synonyma Informix V systému Informix můžete ytořit synonymum pro tabulku nebo pohled. Zatímco federoaný serer DB2 umožňuje ytářet přezdíky pro synonyma Informix, bude akce proedená federoaným sererem záiset na tom, zda je určité synonymum založeno na tabulce nebo na pohledu: Předpokládejme, že pro určité synonymum je ytořena přezdíka a že toto synonymum je založeno na tabulce Informix. Pokud federoaný serer zjistí, že tabulka, na kterou dané synonymum odkazuje, obsahuje index, bude pro synonymum ytořena specifikace indexu. Pokud tabulka, na kterou synonymum odkazuje, neobsahuje žádný index, nebude pro synonymum žádná specifikace indexu ytořena. Specifikaci indexu šak můžete ytořit ručně pomocí příkazu CREATE INDEX. Předpokládejme, že pro určité synonymum je ytořena přezdíka a že toto synonymum je založeno na pohledu Informix. Federoaný serer nemůže určit, na kterých podkladoých tabulkách je daný pohled založen. Z tohoto důodu není pro synonymum ytořena žádná specifikace indexu. Specifikaci indexu šak můžete ytořit ručně pomocí příkazu CREATE INDEX. Předpoklady: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí obsahoat alespoň jedno z následujících opránění: Opránění SYSADM nebo DBADM Opránění CONTROL pro objekt nebo opránění INDEX pro objekt. A dále jedno z opránění IMPLICIT_SCHEMA pro databázi (pokud neexistuje implicitní nebo explicitní jméno schématu indexu) nebo opránění CREATEIN pro schéma (pokud jméno schématu indexu odkazuje na existující schéma). Omezení: Při ytáření indexu pro přezdíku platí některá omezení. Je-li použita olba DYNAMICRULES BIND, příkaz nelze dynamicky připrait. Dále nelze příkazu CREATE INDEX použít parametry INCLUDE, CLUSTER, PCTFREE, MINPCTUSED, DISALLOW REVERSE SCANS a ALLOW REVERSE SCANS. Volbu UNIQUE lze použít pouze případě, pokud data klíče indexu obsahují jedinečné hodnoty pro každý řádek tabulky zdroje dat. Jedinečnost nebude kontroloána. Součet uložených délek určených sloupců nesmí být ětší než Jako součást indexu nelze použít sloupce LOB, DATALINK ani sloupce odlišeného typu založeného na typu LOB nebo DATALINK. Toto omezení platí i případě, kdy atribut délky sloupce je tak malý, že nedojde k překročení limitu 1024 bajtů. Příklad: Pro synonymum Informix založené na tabulce je ytořena přezdíka: Je-li synonymum založeno na tabulce Informix, která neobsahuje žádný index, můžete ytořením specifikace indexu pro synonymum poskytnout optimalizátoru údaje o tom, který sloupec nebo sloupce mají být prohledány, a tím urychlit yhledání dat. Vytořený příkaz určí pro dané synonymum přezdíku a y zadáte informace o sloupci nebo sloupcích tabulce, na kterých je synonymum založeno. Předpokládejme, že byla ytořena přezdíka contracts pro synonymum SALES_CONTRACTS a že tabulkou, na které je toto synonymum založeno, je tabulka obsahující několik indexů: REGION, AMOUNT, SALES_REP. Příkaz CREATE INDEX, který ytoříte, bude odkazoat na přezdíku pro daný pohled a bude obsahoat informace o indexu podkladoé tabulky pro tento pohled. 72 Příručka pro federoané systémy

85 Příklad: Pro synonymum Informix založené na pohledu je ytořena přezdíka: Předpokládejme, že pro pohled JAPAN_SALES2003 byla ytořena přezdíka jp_sales2003. Podkladoou tabulkou pro tento pohled je tabulka JAPAN_SALES, která obsahuje několik indexů: REGION, AMOUNT, SALES_REP. Příkaz CREATE INDEX, který ytoříte, bude odkazoat na přezdíku pro daný pohled a bude obsahoat informace o indexu podkladoé tabulky pro tento pohled. Při ytáření specifikací indexu pro pohled zkontrolujte, zda sloupec či sloupce, na nichž je index tabulky založen, jsou součástí daného pohledu. Chcete-li ytořit specifikace indexu pro šechny indexy podkladoé tabulce, musí být jednotlié specifikace indexu ytořeny samostatně. Chcete-li ytořit specifikaci popisující index REGION, bude syntaxe příkazu ypadat následoně: CREATE UNIQUE INDEX jp_2003_region ON jp_sales2003 (REGION) SPECIFICATION ONLY kde jp_2003_region je jméno indexu a jp_sales2003 je přezdíka pro pohled JAPAN_SALES2003. Souisející koncepce: Specifikace indexů e federoaném systému na stránce 67 Souisející úlohy: Vytoření specifikací indexu pro objekty zdroje dat na stránce 68 Vytoření specifikací indexu na tabulkách, pro které jsou ytořeny noé indexy na stránce 69 Vytoření specifikací indexu pro pohledy na stránce 70 Souisející odkazy: CREATE INDEX statement příručce SQL Reference, Volume 2 Kapitola 5. Specifikace indexů 73

86 74 Příručka pro federoané systémy

87 Kapitola 6. Transparentní jazyk DDL Ve federoaném systému je možné ytářet tabulky prostřednictím federoaného sereru produktu DB2 Linux, UNIX, and Windows e zdálených zdrojích dat. Tabulky, které byly ytořeny prostřednictím federoaného sereru, lze z federoaného sereru také měnit a rušit. Možnost ytáření zdálených tabulek prostřednictím federoaného sereru DB2 se nazýá transparentní jazyk DDL. Tato kapitola obsahuje následující témata: Co je trasparentní jazyk DDL? Co je trasparentní jazyk DDL? Vzdálené sloupce typu LOB a transparentní jazyk DDL na stránce 77 Vytoření noých zdálených tabulek s použitím transparentního jazyka DDL na stránce 77 Změna zdálených tabulek s použitím transparentního jazyka DDL na stránce 80 Zrušení zdálených tabulek s použitím transparentního jazyka DDL na stránce 82 Transparentní jazyk DDL poskytuje možnost ytářet a upraoat zdálené tabulky pomocí produktu DB2 Information Integrator, aniž byste museli použíat průchozí relace. Příkazy SQL použíané s transparentním jazykem DDL jaou CREATE TABLE, ALTER TABLE a DROP TABLE. Příkaz CREATE TABLE transparentního jazyka DDL ytoří zdálenou tabulku e zdroji dat a přezdíku pro tuto tabulku na federoaném sereru. Proede mapoání zadaných datoých typů DB2 na zdálené datoé typy pomocí ýchozího zpětného mapoání typů. U ětšiny zdrojů dat jsou ýchozí mapoání typů obsažena modulech wrapper. Výchozí mapoání typů pro zdroje dat skupiny produktů DB2 jsou modulu wrapper pro DRDA. Výchozí mapoání typů pro systém Informix jsou modulu wrapper pro INFORMIX atd. Výhodou použíání transparentního jazyka DDL je, že administrátoři DB2 mohou pro ytáření lokálních i zdálených tabulek použíat známé procedury. Transparentní jazyk DDL centralizuje administraci tabulek a usnadňuje uděloání autorizací. Transparentní jazyk DDL je podporoán následujícími zdroji dat: DB2 for z/os and OS/390 DB2 for iseries DB2 for Linux, UNIX, and Windows DB2 Serer for VM and VSE Informix Microsoft SQL Serer ODBC Oracle Sybase Teradata Copyright IBM Corp. 1998,

88 Administrátor databáze může k ytáření tabulek použíat buď Řídicí centrum DB2, nebo příkazy DDL příkazoém procesoru DB2. Použíáním transparentního jazyka DDL se yhnete studiu různých syntaxí DDL potřebných pro jednotlié zdroje dat. Než budete moci ytořit zdálené tabulky e zdroji dat pomocí produktu DB2 Information Integrator, musíte nakonfiguroat přístup ke zdroji dat: Modul wrapper pro tento zdroj dat musí být registroán globálním katalogu. Musí být ytořena definice sereru pro serer, kde bude zdálená tabulka umístěna. Musí být ytořeno mapoání užiatelů mezi produktem DB2 Information Integrator a sererem zdroje dat. Pomocí průodce zdálené tabulky Řídicím centru DB2 ytořte zdálenou tabulku. Opránění příslušející autorizačnímu ID zadáajícímu transparentní příkaz DDL musí obsahoat alespoň jedno z následujících opránění: Opránění SYSADM nebo DBADM Opránění CREATETAB pro databázi a opránění USE pro tabulkoý prostor a dále jedno z následujících opránění: Opránění IMPLICIT_SCHEMA pro databázi (pokud neexistuje implicitní nebo explicitní jméno schématu tabulky) Opránění CREATEIN pro schéma (pokud jméno schématu tabulky odkazuje na existující schéma) Chcete-li zadat transparentní příkazy DDL, musí aše autorizační ID mít potřebná opránění pro přezdíku (aby federoaná databáze akceptoala požadaek) a sronatelná opránění pro serer zdáleného zdroje dat (aby zdroj dat akceptoal požadaek). Omezení transparentních příkazů DDL Transparentní příkazy DDL mají některá omezení: Tabulky, které byly ytořeny přirozeným způsobem e zdáleném zdroji dat, nelze měnit ani rušit. Tabulky materializoaných dotazů nelze e zdáleném zdroji dat ytořit. Do definice tabulky můžete zadat základní informace o sloupci, ale nebudete schopni zadat olby tabulky nebo sloupce. Například olby pro objekt LOB (LOGGED a COMPACT) nejsou podporoány. Není možné zadat poznámku ke sloupci. Nelze generoat obsah sloupců. Můžete zadat primární klíč, ale zadat cizí klíč, jedinečný klíč ani kontrolní podmínky není možné. Sloupce použíané pro primární klíč nesmí být sloupce s poolenou hodnotou Null a nemohou zahrnoat sloupce obsahující objekty LOB. Nelze upraoat parametry existujících sloupců, jako například datoý typ nebo délku. Klauzule DEFAULT není příkazech CREATE TABLE a ALTER TABLE podporoána. Souisející úlohy: Vytoření noých zdálených tabulek s použitím transparentního jazyka DDL na stránce 77 Změna zdálených tabulek s použitím transparentního jazyka DDL na stránce 80 Zrušení zdálených tabulek s použitím transparentního jazyka DDL na stránce Příručka pro federoané systémy

89 Vzdálené sloupce typu LOB a transparentní jazyk DDL Některé zdroje dat, jako například Oracle nebo Informix, neukládají délku sloupců typu LOB do systémoých katalogů. Když ytoříte přezdíku tabulky, budou informace ze systémoého katalogu zdroje dat načteny četně délky sloupce. Vzhledem k tomu, že pro sloupce typu LOB není dána žádná délka, bude federoaná databáze předpokládat, že délkou je maximální délka sloupce typu LOB produktu DB2 for Linux, UNIX, and Windows. Federoaná databáze ukládá maximální délku produktu DB2 for Linux, UNIX, and Windows do katalogu federoané databáze jako délku sloupce přezdíky. Pokud ošem ytoříte zdálenou tabulku pomocí transparentního jazyka DDL, musíte délku sloupce typu LOB zadat. Když federoaný serer ytoří přezdíku e zdálené tabulce, uloží ámi zadanou délku do katalogu federoané databáze jako délku sloupce přezdíky. Souisející koncepce: Co je trasparentní jazyk DDL? na stránce 75 Federoaná podpora objektů LOB na stránce 195 Souisející úlohy: Vytoření noých zdálených tabulek s použitím transparentního jazyka DDL na stránce 77 Vytoření noých zdálených tabulek s použitím transparentního jazyka DDL Chcete-li ytořit zdálenou tabulku s použitím transparentního jazyka DDL, můžete použít průodce rámci Řídicího centra DB2 nebo příkaz CREATE TABLE. Při použití průodce ytořením zdálené tabulky Řídicím centru DB2 se yhnete zadání parametru nebo olby, které nejsou podporoány. V průodci můžete sloupce určit ýběrem ze seznamu předdefinoaných sloupců nebo zadáním atributů pro noý sloupec. Předpoklady: Před ytořením zdálené tabulky je nutné konfiguroat federoaný serer pro přístup k danému zdroji dat. Tato konfigurace zahrnuje následující kroky: Vytoření modulu wrapper pro daný typ zdroje dat Zadání definice sereru pro serer, na kterém bude umístěna zdálená tabulka Vytoření mapoání užiatelů mezi produktem DB2 Information Integrator a sererem zdroje dat Chcete-li zadat transparentní příkazy DDL, musí aše autorizační ID mít potřebná opránění pro přezdíku (aby federoaná databáze akceptoala požadaek) a sronatelná opránění pro serer zdáleného zdroje dat (aby zdroj dat akceptoal požadaek). Opránění příslušející autorizačnímu identifikátoru zadáajícímu transparentní příkaz DDL musí obsahoat alespoň jedno z následujících opránění: Opránění SYSADM nebo DBADM Opránění CREATETAB pro databázi a opránění USE pro tabulkoý prostor a dále jedno z následujících opránění: Opránění IMPLICIT_SCHEMA pro databázi (pokud neexistuje implicitní nebo explicitní jméno schématu tabulky) Kapitola 6. Transparentní jazyk DDL 77

90 Opránění CREATEIN pro schéma (pokud jméno schématu tabulky odkazuje na existující schéma) Omezení: Tabulky materializoaných dotazů nelze e zdáleném zdroji dat ytořit. Můžete zadat údaje základních sloupců definici tabulky, ašak nebude možné určit olby tabulek ani olby sloupců. Nejsou například podporoány olby pro objekt LOB (LOGGED a COMPACT). Nelze zadat komentáře ke sloupcům. Nelze generoat obsah sloupce. Můžete určit primární klíč, ašak nelze zadat cizí klíč ani kontrolní podmínky. Sloupce použité pro primární klíč nesmí mít hodnotu NULL a nesmí mezi ně patřit sloupce obsahující objekty LOB. Klauzule DEFAULT příkazu CREATE TABLE není podporoána. Postup: Vzdálenou tabulku můžete ytořit pomocí transparentního jazyka DDL Řídicím centru DB2 nebo pomocí příkazoého řádku. Chcete-li ytořit zdálenou tabulku Řídicí centru DB2, použijte Průodce ytořením zdálené tabulky: 1. Rozbalte složku Federoané databázoé objekty. 2. Rozbalte objekty modulu wrapper a definice sereru pro zdroj dat, pro který chcete ytořit zdálenou tabulku. 3. Praým tlačítkem myši klepněte na složku Vzdálené tabulky a klepněte na příkaz Vytořit. Spustí se Průodce ytořením zdálené tabulky. 4. Dokončete kroky průodce. Chcete-li tuto úlohu proést z příkazoého řádku, zadejte příkaz CREATE TABLE spolu s příslušnými parametry. Vzdálený zdroj dat musí pro příkaz CREATE TABLE podporoat datoé typy sloupců a olbu primárního klíče. Předpokládejme například, že zdálený datoý zdroj nepodporuje primární klíče. Podle způsobu, jakým zdroj dat reaguje na nepodporoané požadaky, může být narácena chyba nebo může být daný požadaek ignoroán. V klauzuli OPTIONS musí být určen zdálený serer. Klauzule OPTIONS může být použita pro přepsání zdáleného jména nebo zdáleného schématu ytářené tabulky. Předpokládejme, že chcete na sereru Oracle ytořit tabulku EMPLOYEE. V příkazu CREATE TABLE použijte při specifikaci jednotliých sloupců datoé typy DB2. Syntaxe příkazu pro ytoření tabulky příkazoém procesoru ypadá následoně: CREATE TABLE EMPLOYEE ( EMP_NO CHAR(6) NOT NULL, FIRSTNAME VARCHAR(12) NOT NULL, MIDINT CHAR(1) NOT NULL, LASTNAME VARCHAR(15) NOT NULL, HIREDATE DATE, JOB CHAR(8), 78 Příručka pro federoané systémy

91 SALARY DECIMAL(9,2), PRIMARY KEY (EMP_NO) ) OPTIONS (REMOTE_SERVER ORASERVER, REMOTE_SCHEMA J15USER1, REMOTE_TABNAME EMPLOY ) EMPLOYEE Jméno lokální tabulky. Toto jméno je použito také pro přezdíku asocioanou s tabulkou. REMOTE_SERVER ORASERVER Jméno pro serer zadané příkazu CREATE SERVER. V této hodnotě se rozlišují elká a malá písmena. REMOTE_SCHEMA J15USER1 Jméno zdáleného schématu. Ačkoli je tento parametr olitelný, doporučuje se jméno schématu zadat. Pokud tento parametr není zadán, je jako jméno zdáleného schématu použita hodnota AUTHID (zadaná elkými písmeny). V této hodnotě se rozlišují elká a malá písmena. REMOTE_TABNAME EMPLOY Jméno zdálené tabulky. Tento parametr je nepoinný. Pokud není tento parametr zadán, je jako jméno zdáleného schématu použito jméno lokální tabulky. Tato hodnota musí být platným jménem e zdáleném zdroji dat a nesmí se jednat o jméno existující tabulky. V této hodnotě se rozlišují elká a malá písmena. Při ytoření zdálené tabulky prostřednictím produktu DB2 Information Integrator s použitím transparentního jazyka DDL dojde k několika dalším akcím: Pro zdálenou tabulku je automaticky ytořena přezdíka. Tato přezdíka má stejné jméno jako lokální tabulka. Pokud není určeno jiné jméno pomocí olby REMOTE_TABNAME, bude mít zdálená tabulka stejné jméno jako lokální tabulka. Přezdíku zdálené tabulky lze použíat stejným způsobem jako kteroukoli jinou přezdíku. Pro zdálenou tabulku můžete použít operace ALTER (Změnit) či DROP (Zrušit) (tyto operace nelze proést s přezdíkami ytořenými příkazem CREATE NICKNAME). Do pohledu katalogu SYSCAT.TABOPTIONS je přidán řádek se jménem olby TRANSPARENT a hodnotou. Ve ýše uedeném příkladu je produktu DB2 Information Integrator použito zpětné mapoání datoých typů, které mapuje datoé typy DB2 na datoé typy Oracle. Na zdáleném sereru Oracle je ytořena tabulka EMPLOY s použitím datoých typů Oracle. V následující tabulce jsou uedena mapoání datoých typů DB2 na datoé typy Oracle pro sloupce určené daném příkladu. Tabulka 6. Příklad zpětného mapoání datoých typů z produktu DB2 Information Integrator na datoé typy Oracle Sloupec Datoý typ DB2 určený příkazu CREATE TABLE Datoý typ Oracle použitý e zdálené tabulce EMP_NO CHAR(6) NOT NULL CHAR(6) NOT NULL FIRST_NAME VARCHAR(12) NOT NULL VARCHAR2(12) NOT NULL MID_INT CHAR(1) NOT NULL CHAR(1) NOT NULL LAST_NAME VARCHAR(15) NOT NULL VARCHAR2(15) NOT NULL HIRE_DATE DATE DATE JOB CHAR(8) CHAR(8) SALARY DECIMAL(9,2) NUMBER(9,2) Kapitola 6. Transparentní jazyk DDL 79

92 Použití olby SQL_SUFFIX je pooleno na konci příkazu CREATE TABLE. Tato olba je primárně použíána ke specifikaci klauzule IN TABLESPACE při ytáření zdálených tabulek e zdrojích dat skupiny produktů DB2. Souisející koncepce: Co je trasparentní jazyk DDL? na stránce 75 Souisející úlohy: Změna zdálených tabulek s použitím transparentního jazyka DDL na stránce 80 Zrušení zdálených tabulek s použitím transparentního jazyka DDL na stránce 82 Souisející odkazy: CREATE TABLE statement příručce SQL Reference, Volume 2 Kapitola 28, Výchozí zpětné mapoání datoých typů, na stránce 265 Změna zdálených tabulek s použitím transparentního jazyka DDL Tabulky zdálených zdrojů dat ytořené prostřednictím produktu DB2 Information Integrator s použitím transparentního jazyka DDL lze změnit. Nelze změnit tabulky, které byly ytořeny přímo e zdáleném zdroji dat. Tabulky ytořené prostřednictím produktu DB2 Information Integrator s použitím transparentního jazyka DDL lze změnit pomocí příkazu ALTER TABLE. Pomocí příkazu ALTER TABLE lze proádět následující operace: Přidat noé sloupce Přidat primární klíč tabulky Předpoklady: Sada opránění příslušejících autorizačnímu identifikátoru zadáajícímu příkazy transparentního jazyka DDL musí obsahoat alespoň jedno z následujících opránění: Opránění SYSADM nebo DBADM Opránění CREATETAB pro databázi a opránění USE pro tabulkoý prostor a dále jedno z následujících opránění: Opránění IMPLICIT_SCHEMA pro databázi (pokud neexistuje implicitní nebo explicitní jméno schématu tabulky) Opránění CREATEIN pro schéma (pokud jméno schématu tabulky odkazuje na existující schéma) Chcete-li zadat transparentní příkazy DDL, musí aše autorizační ID mít potřebná opránění pro přezdíku (aby federoaná databáze akceptoala požadaek) a sronatelná opránění pro serer zdáleného zdroje dat (aby zdroj dat akceptoal požadaek). Omezení: Nelze uprait tabulky, které byly půodně ytořeny e zdáleném zdroji dat. Ve zdálené tabulce nelze změnit ani zrušit existující primární klíč. Při změně zdálené tabulky budou zneplatněny šechny balíky záisející na přezdíce asocioané s danou zdálenou tabulkou. 80 Příručka pro federoané systémy

93 Vzdálený zdroj dat musí podporoat změny příkazu ALTER TABLE. Předpokládejme například, že zdálený datoý zdroj nepodporuje primární klíče. Podle způsobu, jakým zdroj dat reaguje na nepodporoané požadaky, může být narácena chyba nebo může být daný požadaek ignoroán. Nelze zadat komentáře ke sloupcům. Nelze generoat obsah sloupce. Můžete určit primární klíč, ašak nelze zadat cizí klíč ani kontrolní podmínky. Sloupce použité pro primární klíč nesmí mít hodnotu NULL a nesmí mezi ně patřit sloupce obsahující objekty LOB. Nelze změnit parametry existujících sloupců (jako je například datoý typ nebo délka). Klauzule DEFAULT příkazu ALTER TABLE není podporoána. Postup: Chcete-li změnit zdálenou tabulku s použitím transparentního jazyka DDL, můžete použít Řídicí centrum DB2 nebo příkaz ALTER TABLE. Při použití Řídicího centra DB2 se yhnete zadání parametru nebo olby, které nejsou podporoány. Operaci přidání ani úpra oleb sloupců neproádějte pomocí příkazu ALTER TABLE. Namísto toho použijte příkaz ALTER NICKNAME. Předpokládejme, že chcete přidat primární klíč pro zdálenou tabulku EMPLOYEE, která byla ytořena s použitím transparentního jazyka DDL. Při použití příkazoého řádku bude syntaxe příkazu pro úprau tabulky ypadat následoně: ALTER TABLE EMPLOYEE ADD PRIMARY KEY (EMP_NO, WORK_DEPT) Sloupce použité pro primární klíč nesmí mít hodnotu NULL a nesmí mezi ně patřit sloupce obsahující objekty LOB. Předpokládejme, že chcete přidat sloupce ORDER_DATE a SHIP_DATE do zdálené tabulky SPALTEN, která byla ytořena s použitím transparentního jazyka DDL. Při použití příkazoého řádku bude syntaxe příkazu pro ytoření tabulky ypadat následoně: ALTER TABLE SPALTEN ADD COLUMN ORDER_DATE DATE ADD COLUMN SHIP_DATE DATE Souisející koncepce: Co je trasparentní jazyk DDL? na stránce 75 Souisející úlohy: Vytoření noých zdálených tabulek s použitím transparentního jazyka DDL na stránce 77 Zrušení zdálených tabulek s použitím transparentního jazyka DDL na stránce 82 Souisející odkazy: ALTER TABLE statement příručce SQL Reference, Volume 2 Kapitola 6. Transparentní jazyk DDL 81

94 Zrušení zdálených tabulek s použitím transparentního jazyka DDL Tabulky zdálených zdrojů dat ytořené prostřednictím produktu DB2 Information Integrator s použitím transparentního jazyka DDL lze zrušit. Nelze zrušit tabulky, které byly ytořeny přímo e zdáleném zdroji dat. Předpoklady: Sada opránění příslušejících autorizačnímu identifikátoru zadáajícímu příkazy transparentního jazyka DDL musí obsahoat alespoň jedno z následujících opránění: Opránění SYSADM nebo DBADM Opránění CREATETAB pro databázi a opránění USE pro tabulkoý prostor a dále jedno z následujících opránění: Opránění IMPLICIT_SCHEMA pro databázi (pokud neexistuje implicitní nebo explicitní jméno schématu tabulky) Opránění CREATEIN pro schéma (pokud jméno schématu tabulky odkazuje na existující schéma) Chcete-li zadat transparentní příkazy DDL, musí aše autorizační ID mít potřebná opránění pro přezdíku (aby federoaná databáze akceptoala požadaek) a sronatelná opránění pro serer zdáleného zdroje dat (aby zdroj dat akceptoal požadaek). Omezení: Tabulky, které byly půodně ytořeny e zdáleném zdroji dat, zrušit nelze. Postup: Chcete-li zrušit zdálenou tabulku, která byla ytořena pomocí produktu DB2 Information Integrator s použitím transparentního jazyka DDL, můžete použít Řídicí centrum DB2 nebo příkaz DROP. Při zrušení přezdíky pro zdálenou tabulku ytořenou s použitím transparentního jazyka DDL je odstraněna pouze lokální přezdíka pro tuto tabulku. Vzdálená tabulka při použití příkazu DROP NICKNAME odstraněna není. Odstranění zdálené tabulky je nutné proést pomocí příkazu DROP TABLE. Při odstranění zdálené tabulky je nejpre odstraněna tabulka e zdroji dat a poté je zrušena odpoídající přezdíka pro danou zdálenou tabulku e federoané databázi. Při zrušení přezdíky jsou zneplatněny šechny balíky založené na této přezdíce. Syntaxe příkazu pro odstranění tabulky SPALTEN ypadá následoně: DROP TABLE SPALTEN kde SPALTEN je lokální jméno zdálené tabulky. Souisející koncepce: Co je trasparentní jazyk DDL? na stránce 75 Souisející úlohy: Vytoření noých zdálených tabulek s použitím transparentního jazyka DDL na stránce 77 Změna zdálených tabulek s použitím transparentního jazyka DDL na stránce 80 Souisející odkazy: 82 Příručka pro federoané systémy

95 DROP statement příručce SQL Reference, Volume 2 Kapitola 6. Transparentní jazyk DDL 83

96 84 Příručka pro federoané systémy

97 Kapitola 7. Podpora transakcí e federoaném systému Podpora transakcí e federoaném systému je založena na funkcích distribuoaných databázoých transakcí produktu DB2. Tato kapitola předpokládá, že rozumíte základním pojmům zpracoání distribuoaných transakcí, které jsou popsány následujících příručkách produktu DB2: DB2 Administration Guide: Planning (SC ) DB2 Application Deelopment Guide: Programming Client Applications (SC ) DB2 Application Deelopment Guide: Programming Serer Applications (SC ) Tato kapitola obsahuje následující témata: Základní informace o podpoře transakcí e federoaném systému Co je aktualizace e federoaném systému? na stránce 86 Základní informace o podpoře transakcí e federoaném systému Zpracoání transakcí e federoaném systému ychází ze schopností transakcí distribuoané databázi produktu DB2. Pro porozumění zpracoání transakcí e federoaném systému je třeba se seznámit s následujícími zásadními koncepty zpracoání distribuoaných transakcí produktu DB2: transakce (UOW), zdálená transakce (RUOW), distribuoaná transakce (DUOW), ícemístná aktualizace, spráce transakcí (TM), spráce prostředků (RM), připojení typu 1, připojení typu 2, jednofázoé potrzoání, doufázoé potrzoání. Tyto koncepty fungují identicky e federoaném i nefederoaném systému DB2. Rozsah jednotliých konceptů se šak mění e federoaném systému. Například transakce je implicitně zahájena při čtení jakýchkoli dat z databáze nebo při jejich zápisu. U transakce e federoaném systému se může jednat o federoanou databázi nebo databázi zdroje dat. Při distribuoané transakci e federoaném systému můžete přistupoat k federoané databázi i databázi zdroje dat. Aplikace musí ukončit transakci zadáním příkazu COMMIT nebo ROLLBACK bez ohledu na počet databází, ke kterým se přistupuje. Příkaz COMMIT způsobí, že budou šechny změny proedené rámci transakce poažoány za tralé. Příkaz ROLLBACK odebere tyto změny z databáze. Po úspěšném potrzení se změny proedené transakcí stanou iditelnými pro další aplikace. Doporučení: Vždy explicitně potrďte nebo odolejte transakce aplikacích. Copyright IBM Corp. 1998,

98 Je-li rámci transakce aktualizoán pouze jeden zdroj dat, může být příkaz COMMIT pro tuto transakci odeslán jedné operaci. Tato operace se nazýá jednofázoé potrzení nebo jednomístná aktualizace. Místo odpoídá definici sereru e federoaném systému. Federoaný serer předstauje pro operace aktualizace e federoaném systému lokální místo. Liboolný zdálený zdroj dat předstauje pro operace aktualizace e federoaném systému zdálené místo. V operaci jednofázoého potrzení nejsou e stejné transakci požadoány žádné další zdroje dat pro oěření jejich schopnosti potrdit data. Příklady operací jednofázoého potrzení: Nedistribuoaná transakce Distribuoaná transakce zahrnující čtení z jednoho nebo íce zdrojů dat, ale aktualizace pouze jednom zdroji. V distribuoané transakci zahrnující aktualizace íce databází na několika sererech musí být data konzistentní. Vícemístná aktualizace nebo protokol doufázoého potrzoání se obykle použíá k zajištění konzistence dat mezi několika databázemi distribuoané transakci. Federoané systémy aktuálně nepodporují protokol doufázoého potrzoání. Souisející koncepce: Units of work příručce Administration Guide: Planning DB2 transaction manager příručce Administration Guide: Planning Two-phase commit příručce Administration Guide: Planning Resource manager setup příručce Administration Guide: Planning Multisite Update příručce Application Deelopment Guide: Programming Client Applications Co je aktualizace e federoaném systému? na stránce 86 Souisející úlohy: Updating a database from a host or iseries client příručce Administration Guide: Planning Updating a single database in a transaction příručce Administration Guide: Planning Co je aktualizace e federoaném systému? Ve federoaném systému není aktualizace pouhou transakcí zahrnující příkaz INSERT, UPDATE nebo DELETE. Existují určité akce, četně určitých transakcí obsahujících další příkazy, které jsou federoaným sererem roněž poažoány za aktualizace. Aktualizace lze proádět lokálně nebo zdáleně. Aktualizace lokálním systému jsou aktualizace objektů e federoané databázi. Lokální objekty jsou tabulky a pohledy e federoané databázi. Pro tyto objekty neytáříte přezdíky; příkazech použíáte skutečné jméno objektu. Aktualizace e zdáleném systému jsou aktualizace objektů e zdáleném zdroji dat. Vzdálené zdroje dat předstaují: další databáze nebo instance produktu DB2 for Linux, UNIX, and Windows na federoaném sereru, další databáze nebo instance produktu DB2 for Linux, UNIX, and Windows na jiném sereru, 86 Příručka pro federoané systémy

99 jiné zdroje dat než zdroje produktu DB2 for Linux, UNIX, and Windows, například DB2 for iseries, Informix, Oracle a Teradata. Je důležité, abyste porozuměli tomu, co je federoaným sererem poažoáno za transakci aktualizace, a seznámili se s typy aktualizací poolených e federoaném systému. Existují čtyři typy akcí, které federoaný serer poažuje za transakce aktualizace. Následující tabulka zobrazuje aktualizace, které lze proést e federoaném systému. Tabulka 7. Typy aktualizací a místa jejich proedení Typ akce Lokální aktualizace (DDL a DML) Vzdálená aktualizace (přezdíka) Dynamický příkaz SQL průchozích relacích Lokální systém Vzdálený systém Vysětlení A N Aktualizace objektu e federoané databázi N A Aktualizace objektu zdáleného zdroje dat, pro který jste ytořili přezdíku N A Aktualizace objektu zdáleného zdroje dat. Průchozí relaci nelze použít pro aktualizaci lokálních objektů. Transparentní příkaz DDL A A Dojice transakcí, které ytáří, mění nebo ruší zdálené tabulky a jejich odpoídající přezdíky e federoané databázi. Například se může jednat o dojici transakcí, které ytářejí zdálenou tabulku u zdroje dat a přezdíku u federoaného sereru. Co je transakce aktualizace průchozí relaci? Federoaný serer poažuje šechny dynamické příkazy SQL odeslané prostřednictím průchozí relací za aktualizace. Toto choání zajišťuje integritu dat. Pokud je dynamický příkaz SQL odeslaný prostřednictím průchozí relace úspěšný, je transakce zaznamenána jako aktualizace. Příkazem SQL může být jakýkoli typ příkazu, četně příkazů SELECT. Podpora transakcí s transparentním příkazem DDL Transparentní příkaz DDL ytáří tabulku e zdáleném zdroji dat a přezdíku lokální federoané databázi pro zdálenou tabulku. Federoaný serer poažuje transakce transparentních příkazů DDL za aktualizace. Před a po transakcích transparentních příkazů DDL je třeba zadat příkazy COMMIT nebo ROLLBACK. Protože transparentní příkaz DDL ytáří zároeň lokální i zdálený objekt, každý zadaný transparentní příkaz DDL musí být jedinou aktualizací transakci jednofázoého potrzení. Pokud dojde před transakcí transparentního příkazu DDL k aktualizaci, je třeba příkaz COMMIT nebo ROLLBACK zadat před transakcí transparentního příkazu DDL. Podobně je třeba příkaz COMMIT nebo ROLLBACK zadat po transakci transparentního příkazu DDL, než dojde k další aktualizaci. Kapitola 7. Podpora transakcí e federoaném systému 87

100 Zdroje dat, které automaticky potrzují příkazy DDL Některé zdroje dat po úspěšné transakci příkazu DDL automaticky potrzují aktuální transakci lokálně. Pokud pomocí transparentního příkazu DDL nebo průchozí relaci ytoříte zdálenou tabulku, nemohou ji tyto zdroje dat po ytoření odolat. Vzdálenou tabulku je třeba odstranit ručně. Jediný federoaný zdroj dat, který automaticky potrzuje příkazy DDL, je Oracle. Užiatelské funkce předáané do zdroje dat ke zpracoání Federoaný serer poažuje užiatelské funkce předáané do zdroje dat ke zpracoání za příkazy pouze pro čtení. Pokud zdálená užiatelská funkce proede aktualizaci zdroje dat, federoaný serer o této aktualizaci neí. Protože federoaný serer nepoažuje užiatelské funkce za příkazy pro aktualizaci, nedochází k odolání příkazů. Důležité: Integritu dat nelze zaručit, pokud užiatelská funkce předaná do zdroje dat proede aktualizaci. Souisející koncepce: Odesílání dotazů do zdrojů dat přímo prostřednictím průchozí relace na stránce 200 Základní informace o podpoře transakcí e federoaném systému na stránce Příručka pro federoané systémy

101 Kapitola 8. Operace INSERT, UPDATE a DELETE Tato kapitola popisuje způsob přístupu k datům a jejich aktualizace e zdrojích dat. Obsah této kapitoly: Autorizační opránění pro příkazy INSERT, UPDATE a DELETE Omezení příkazů INSERT, UPDATE a DELETE pro federoaný systém na stránce 90 Referenční integrita e federoaném systému na stránce 90 Příkazy INSERT, UPDATE a DELETE a objekty LOB na stránce 91 Zachoání atomicity příkazu e federoaném systému na stránce 91 Práce s přezdíkami na stránce 93 Výběr dat e federoaném systému na stránce 103 Vložení dat do objektů zdrojů dat na stránce 106 Aktualizace dat objektech zdrojů dat na stránce 107 Odstranění dat z objektů zdrojů dat na stránce 107 Autorizační opránění pro příkazy INSERT, UPDATE a DELETE Opránění požadoaná pro zadáání příkazů INSERT, UPDATE a DELETE nebo přezdíky jsou podobné opráněním požadoaným pro zadáání stejných příkazů tabulkách. Kromě toho je třeba míst adekátní opránění ke zdrojům dat, aby bylo možné proádět operace ýběru, kládání, aktualizací a odstraňoání podkladoém objektu. Opránění SELECT, INSERT, UPDATE a DELETE můžete udělit přezdíce. Udělením nebo odebráním opránění přezdíce šak neudělí ani neodolá opránění e zdroji dat. Ve zdroji dat musí být opránění udělena nebo odolána pro prek REMOTE_AUTHID určený mapoání užiatele na federoaném sereru. Opránění příslušející autorizačnímu identifikátoru daného příkazu musí obsahoat nezbytná opránění pro přezdíku (aby federoaná databáze akceptoala požadaek). Jméno užiatele e zdroji dat, který je mapoán na autorizační ID (prostřednictím mapoání užiatele) musí mít nezbytná opránění k podkladoému objektu tabulky (aby zdroj dat akceptoal požadaek). Po odeslání dotazu do federoané databáze jsou zkontroloána autorizační opránění přezdíky dotazu. Požadaky na autorizaci objektu zdroje dat, na který se odkazuje přezdíce, jsou použita pouze případě, že byl dotaz skutečně zpracoán. Pokud pro přezdíku nemáte opránění SELECT, nemůžete ybírat z objektu zdroje dat, na který tato přezdíka odkazuje. Podobně skutečnost, že máte opránění UPDATE pro přezdíku, neznamená, že jste automaticky autorizoáni k aktualizaci objektu zdroje dat, který daná přezdíka určuje. Projdete-li kontrolou opránění na federoaný serer, nemusíte nutně projít kontrolou opránění e zdáleném zdroji dat. Prostřednictím mapoání užiatelů je autorizační ID federoaného sereru mapoáno do ID užiatele zdroje dat. Omezení opránění budou uplatněna na zdroji dat. Souisející úlohy: Copyright IBM Corp. 1998,

102 Změna mapoání užiatele na stránce 30 Příkazy SQL, které lze použít s přezdíkami na stránce 94 Omezení příkazů INSERT, UPDATE a DELETE pro federoaný systém Ve federoaných systémech není aktualizace pouhou transakcí, která zahrnuje příkazy INSERT, UPDATE nebo DELETE. Existují určité akce, které jsou federoaným sererem také požadoány za aktualizace. Jedná se o některé transakce, které použíají příkazy SELECT. Viz oddíl Co je aktualizace e federoaném systému?. Aktualizace lze proádět lokálně nebo zdáleně. Aktualizace lokálního systému jsou aktualizace objektů e federoané databázi. Tabulky a pohledy e federoané databázi jsou lokální objekty. Aktualizace zdáleného sereru jsou aktualizace objektů e zdáleném zdroji dat. Pro aktualizace přezdíek platí následující omezení: Objekt, jehož zdroj dat neumožňuje aktualizace, nelze aktualizoat. Objekt zdroje dat, který je určen pouze pro čtení, jako například pohled JOIN, nelze aktualizoat. Není možné proádět operace kládání, aktualizace a odstranění e federoaných pohledech ytořených pomocí příkazů UNION ALL. Federoané pohledy ytořené pomocí příkazů UNION ALL jsou pohledy jen pro čtení. Nepodporoané zdroje dat Federoání nepodporuje operace kládání, aktualizace a odstranění u následujících zdrojů dat: BLAST BioRS Documentum Entrez Excel Extended Search HMMER Soubory s tabulkoou strukturou Weboé služby WebSphere Business Integration XML Souisející koncepce: Autorizační opránění pro příkazy INSERT, UPDATE a DELETE na stránce 89 Referenční integrita e federoaném systému na stránce 90 Příkazy INSERT, UPDATE a DELETE a objekty LOB na stránce 91 Referenční integrita e federoaném systému Ve federoaném systému produkt DB2 UDB neproádí kompenzaci rozdílů referenční integrity mezi zdroji dat. Produkt DB2 UDB nekoliduje s ynucením referenční integrity e zdrojích dat. 90 Příručka pro federoané systémy

103 Omezení referenční integrity e zdroji dat šak mohou olinit aktualizace přezdíek. Předpokládejme například, že federoaná databáze obdrží transakci ložení dat do přezdíky. Jakmile federoaný serer odešle toto ložení do zdroje dat, poruší podmínky referenční integrity e zdroji dat. Produkt DB2 UDB mapuje ýslednou chybu na chybu produktu DB2 UDB. Za referenční integritu mezi zdroji dat jsou zodpoědné aplikace. Produkt DB2 Information Integrator podporuje informační podmínky, které můžete použít k informoání dotazoacího procesoru o podmínkách referenční integrity. Souisející koncepce: Informační podmínky přezdíkách na stránce 173 Interakce klientských aplikací se zdroji dat na stránce 189 Zachoání atomicity příkazu e federoaném systému na stránce 91 Příkazy INSERT, UPDATE a DELETE a objekty LOB Tři typy datoých typů LOB produktu DB2 UDB předstaují objekty CLOB, DBCLOB a BLOB. Prostřednictím federoání můžete u objektů LOB umístěných e šech relačních zdrojích dat proádět operace čtení. Operace zápisu lze proádět u objektů LOB umístěných e zdrojích dat Oracle (erze 8 nebo yšší) pomocí modulu wrapper NET8. Souisející koncepce: Federoaná podpora objektů LOB na stránce 195 Lokátory LOB na stránce 197 Omezení pro objekty LOB na stránce 197 Souisející odkazy: Změna dlouhých datoých typů na datoé typy archar na stránce 53 Zachoání atomicity příkazu e federoaném systému Během operací aktualizace se federoané systémy pokoušejí zachoat data atomickém stau při dokončení příkazu DML. Pokud jsou data atomickém stau, je zaručeno, že buď budou úspěšně zpracoána, nebo zůstanou nezměněna. Pokud klient nebo aplikace zadá příkaz INSERT, UPDATE či DELETE pro přezdíku, federoaný serer interně tento příkaz zpracuje jako jeden příkaz DML nebo jako posloupnost několika příkazů DML. Jestliže federoaný serer musí do cíloého zdroje dat odeslat ke zpracoání několik příkazů DML, je možné, že atomicita dat bude narušena. Aby se zabránilo narušení atomicity dat, federoané systémy použíají rozhraní API bodů uložení zdroje dat pro monitoroání posloupnosti několika příkazů DML. Některé zdroje dat nebo erze zdrojů dat neexternalizují rozhraní API bodů uložení, které použíá federoaný systém. Za těchto okolností se federoané příkazy INSERT, UPDATE nebo DELETE spouští bez ochrany rozhraní API bodů uložení. Kapitola 8. Operace INSERT, UPDATE a DELETE 91

104 Pokud dojde k chybě při federoaných transakcích ložení, aktualizace nebo odstranění, může u zdrojů dat dojít pouze k částečné aktualizaci. Aby se yřešily problémy s nekonzistencí, federoaný systém automaticky proede před rácením chyby sqlcode do aplikací odolání interní transakce. Následující zdroje dat neexternalizují rozhraní API bodů uložení, které může federoaný serer použít: DB2 for Linux, UNIX, and Windows erze 6 (nebo dříější) DB2 for iseries DB2 for VM and VSE DB2 for z/os and OS/390 erze 5 (nebo dříější) Informix Microsoft SQL Serer ODBC Teradata V případě přenesení zpracoání celé transakce ložení, aktualizace nebo odstranění do zdroje dat předpokládá federoaný serer, že zdroj dat zachoá atomicitu příkazu, pokud dojde k chybě. V případě přenesení zpracoání pouze části transakce ložení, aktualizace nebo odstranění do zdroje dat je případě chyby odolána celá transakce. Toto choání řídí olba sereru IUD_APP_SVPT_ENFORCE. Podle ýchozího nastaení je tato olba sereru nastaena na hodnotu Y, což znamená odolání transakcí, u kterých došlo k chybě. Použití příkazu SET SERVER OPTION k nastaení olby sereru IUD_APP_SVPT_ENFORCE pro dobu trání připojení neoliní statické příkazy SQL. Použití příkazu SET SERVER OPTION k nastaení této olby sereru oliní pouze dynamické příkazy SQL. Scénář choání olby sereru IUD_APP_SVPT_ENFORCE: Předpokládejme, že ytoříte přezdíku INFMX_UT pro tabulku Informix s názem UT. Tabulka UT obsahuje čtyři sloupce celých čísel: i1, i2, i3 a i4. Sloupec i1 je sloupec jedinečného indexu. Tabulka UT je prázdná. Zadáte příkaz INSERT přezdíce INFX_UT pro ložení hodnot 1, 22, 34 a 40 do řádky 1 tabulky. Příkaz byl úspěšný. Potom zadáte íceřádkoý příkaz INSERT pro přezdíku INFX_UT k ložení tří řádků dat: Řádek 2: 2, 37, 34, 55 Řádek 3: 3,42, 59, 40 Řádek 4: 1, 55, 62, 75 Protože data posledním řádku určeném ke ložení porušují požadaek na jedinečný index e sloupci i1, rátí serer Informix do federoaného systému chyboou zpráu. Federoaný systém rátí do aplikace chybu SQL SQL0803N. Chyboá zpráa SQL0803N popisuje narušení jedinečných indexů. Následující tabulka uádí seznam řádků tabulky UT po ložení: 92 Příručka pro federoané systémy

105 Tabulka 8. Příklad tabulky Informix UT Sloupec (jedinečný index) Sloupec Sloupec Sloupec Řádek i1 i2 i3 i4 Řádek Řádek Řádek Výchozí choání olby sereru IUD_APP_SVPT_ENFORCE: Podle ýchozího nastaení je olba sereru IUD_APP_SVPT_ENFORCE nastaena na hodnotu Y. Při nastaení hodnoty Y proede tato olba sereru interní odolání celé transakce. Ačkoli prní da řádky dat byly úspěšně loženy, budou tyto řádky odolány, protože je odolána celá transakce. Chcete-li změnit ýchozí hodnotu olby sereru IUD_APP_SVPT_ENFORCE, použijte příkaz ALTER SERVER. Tato změna platí pro šechny objekty zdroje dat, ke kterým se přistupuje prostřednictím zadaného sereru. Alternatiní choání olby sereru IUD_APP_SVPT_ENFORCE: Pokud je olba sereru IUD_APP_SVPT_ENFORCE nastaena na hodnotu N, nebude transakce odolána. Druhý a třetí řádek dat zůstane tabulce. Aplikace musí proést zotaení z chyby. Souisející koncepce: Referenční integrita e federoaném systému na stránce 90 Souisející odkazy: Kapitola 21, Volby sereru pro federoané systémy, na stránce 211 Práce s přezdíkami Chcete-li ybrat nebo uprait data ze zdroje dat, yhledááte pomocí dotazů použíajících příkaz SELECT, INSERT, UPDATE a DELETE přezdíky. Dotazy odesíláte jazyce SQL produktu DB2 do federoané databáze. Data z lokálních tabulek a zdálených zdrojů dat můžete spojit pomocí jednoho příkazu SQL, jako by šechna data byla lokální. Můžete například spojit data umístěná : lokální tabulce produktu DB2 pro Windows e federoané databázi, tabulce Oracle a pohledu Sybase, tabulce produktu DB2 UDB for z/os na jednom sereru, tabulce produktu DB2 UDB for z/os na jiném sereru a tabulce aplikace Excel. Díky tomu, že federoaný systém příkazy SQL zpracoáá, jako by zdroje dat byly běžné relační tabulky nebo pohledy rámci federoané databáze, může spojit relační data s daty nerelačních formátech. Tabulky a pohledy e federoané databázi jsou lokální objekty. Pro tyto objekty neytářejte přezdíky; příkazech použíejte skutečné jméno objektu. Vzdálené objekty jsou objekty, které nejsou umístěny e federoané databázi. Pro tyto objekty je třeba ytořit přezdíky. Například: Kapitola 8. Operace INSERT, UPDATE a DELETE 93

106 tabulky a pohledy jiné databázi nebo instanci produktu DB2 for Linux, UNIX, and Windows e federoaném systému, tabulky a pohledy jiné databázi nebo instanci produktu DB2 for Linux, UNIX, and Windows jiném systému, objekty umístěné jiných zdrojích dat než produkt DB2 for Linux, UNIX, and Windows, například: Oracle, Sybase, Documentum a ODBC Postup: Abyste mohli yužít možností federoaného systému, je třeba porozumět těmto oblastem: seznámit se s příkazy SQL, které lze použít s přezdíkou, ědět, jak získat přístup k objektům noého zdroje dat, naučit se, jak pomocí průchozí relace přistupoat přímo ke zdrojům dat, seznámit se s ýhodami použití federoaných pohledů pro přístup k heterogenním datům. Syntaxe WITH HOLD Syntaxi WITH HOLD můžete použít u kurzoru definoaného u přezdíky. Pokusíte-li se šak použít tuto syntaxi (s příkazem COMMIT) a zdroj dat syntaxi WITH HOLD nepodporuje, obdržíte chybu. Spouštěče Přezdíka nemůže být e spouštěči cílem aktualizace. Do přezdíek těle spouštěče můžete zahrnout příkazy SELECT. Do přezdíek těle spouštěče nelze zahrnout příkazy INSERT, UPDATE nebo DELETE. Souisející koncepce: Autorizační opránění pro příkazy INSERT, UPDATE a DELETE na stránce 89 Omezení příkazů INSERT, UPDATE a DELETE pro federoaný systém na stránce 90 Souisející úlohy: Odkazoání na objekty datoých zdrojů příkazech SQL pomocí přezdíek na stránce 190 Příkazy SQL, které lze použít s přezdíkami na stránce 94 Přístup k noým objektům zdroj dat na stránce 98 Přístup ke zdrojům dat pomocí průchozích relací na stránce 100 Přístup k heterogenním datům prostřednictím federoaných pohledů na stránce 101 Práce s přezdíkami - podrobné informace Tato část popisuje operace kládání, aktualizace a odstranění na přezdíkách. Příkazy SQL, které lze použít s přezdíkami Ve federoaném systému můžete snadno přistupoat k datům bez ohledu na to, kde jsou skutečně umístěna. Pro přístup k datům ytáříte přezdíky pro šechny objekty zdrojů dat (jako jsou tabulky a pohledy), ke kterým chcete přistupoat. Je-li například ytořena přezdíka DEPT předstaující zdálenou tabulku EUROPE.PERSON.DEPT, můžete informace e zdálené tabulce yhledat pomocí příkazu 94 Příručka pro federoané systémy

107 SELECT * FROM DEPT. Namísto nutnosti si pamatoat informace podkladoého zdroje dat proedete hledání pro přezdíku. Vytoříte-li dotaz, nemusíte se zabýat mimo jiné těmito záležitostmi: jméno objektu e zdroji dat, serer, e kterém se objekt zdroje dat nachází, typ zdroje dat, e kterém se objekt nachází, například Informix a Oracle, jazyk dotazu nebo dialekt SQL použíaný zdrojem dat, mapoání datoých typů mezi zdrojem dat a produktem DB2 Information Integrator. Mapoání funkcí mezi zdrojem dat a produktem DB2 Information Integrator Informace potřebné pro zpracoání dotazů poskytují federoanému sereru šechna podkladoá metadata uložená katalogu federoané databáze. Tato metadata se shromažďují ze zdrojů dat při nastaení a konfiguraci federoaného sereru pro přístup ke zdrojům dat. Po nastaení federoaného systému použijete přezdíky pro yhledání zdrojů dat nebo další rozšíření konfigurace federoaného systému. Následující tabulka uádí příkazy SQL, které podporují použití přezdíek: Tabulka 9. Běžné příkazy SQL, které podporují použití přezdíek Příkaz SQL Popis Autorizace yžadoána ALTER NICKNAME Upraí existující přezdíku změnou SYSADM nebo DBADM lokálního jména sloupce, lokálního Opránění ALTER nebo datoého typu, oleb federoaných CONTROL pro přezdíku sloupců nebo informačních podmínek. Tabulka nebo pohled u zdroje dat nejsou oliněny. Opránění ALTERIN pro schéma (pokud jméno schématu přezdíky existuje) ALTER TABLE COMMENT ON Změní zdálenou tabulku ytořenou prostřednictím produktu DB2 Information Integrator pomocí transparentního jazyka DDL. Tabulky, které byly ytořeny přirozeným způsobem e zdroji dat, měnit nelze. Lze použít informační podmínky pro přidání podmínky referenční integrity k přezdíce. Přidá nebo nahradí poznámky popisech katalogu u různých objektů, četně funkcí, mapoání funkcí, indexů, přezdíek, sererů, oleb sererů, mapoání typů, modulů wrapper. Autor definice přezdíky zaznamenaný e sloupci DEFINER pohledu katalogu pro přezdíku SYSADM nebo DBADM Opránění ALTER nebo CONTROL pro přezdíku Opránění ALTERIN pro schéma (pokud jméno schématu přezdíky existuje) SYSADM nebo DBADM Opránění ALTER nebo CONTROL pro objekt Opránění ALTERIN pro schéma Autor definice objektu zaznamenaný e sloupci DEFINER pohledu katalogu pro objekt Kapitola 8. Operace INSERT, UPDATE a DELETE 95

108 Tabulka 9. Běžné příkazy SQL, které podporují použití přezdíek (pokračoání) Příkaz SQL Popis Autorizace yžadoána CREATE ALIAS Definuje alias pro přezdíku. SYSADM nebo DBADM CREATE INDEX (s klauzulí SPECIFICATION ONLY) CREATE TABLE (s klauzulí OPTIONS) CREATE TABLE (s klauzulemi plného ýběru AS a DATA INITIALLY DEFERRED REFRESH) CREATE VIEW DELETE Vytoří specifikaci indexu (metadata), která indikuje optimalizátoru dotazu, že objekt zdroje dat má index. Není ytořen žádný skutečný index, pouze specifikace. Vytoří zdálenou tabulku prostřednictím produktu DB2 Information Integrator pomocí transparentního jazyka DDL. Vytoří tabulku materializoaného dotazu použíající plný ýběr, která odkazuje na přezdíku. Vytoří pohled, který odkazuje na jednu nebo íce přezdíek. Odstraní řádky z objektu zdroje dat (například tabulky nebo pohledu), který má přezdíku. Opránění IMPLICIT_SCHEMA pro databázi (pokud neexistuje implicitní nebo explicitní jméno schématu aliasu) Opránění CREATEIN pro schéma (pokud jméno schématu aliasu odkazuje na existující schéma) SYSADM nebo DBADM Opránění CONTROL nebo INDEX pro podkladoý objekt zdroje dat a buď opránění IMPLICIT_SCHEMA pro databázi, nebo opránění CREATEIN pro schéma SYSADM nebo DBADM Opránění CREATETAB pro databázi a opránění USE pro tabulkoý prostor a buď opránění IMPLICIT_SCHEMA pro databázi, nebo opránění CREATEIN pro schéma SYSADM nebo DBADM Opránění CREATETAB pro databázi a opránění USE pro tabulkoý prostor a buď opránění IMPLICIT_SCHEMA pro databázi, nebo opránění CREATEIN pro schéma Opránění CONTROL pro tabulku nebo pohled Opránění SELECT pro tabulku nebo pohled a opránění ALTER případě, je-li zadána olba REFRESH DEFERRED SYSADM nebo DBADM Opránění CONTROL nebo SELECT pro přezdíku a buď opránění IMPLICIT_SCHEMA pro databázi, nebo opránění CREATEIN pro schéma SYSADM nebo DBADM Opránění DELETE pro přezdíku a opránění DELETE pro podkladoý objekt zdroje dat Opránění CONTROL pro podkladoý objekt zdroje dat 96 Příručka pro federoané systémy

109 Tabulka 9. Běžné příkazy SQL, které podporují použití přezdíek (pokračoání) Příkaz SQL Popis Autorizace yžadoána DROP GRANT INSERT LOCK TABLE REVOKE SELECT UPDATE Odstraní objekt, například přezdíku, federoaný pohled, specifikaci indexu. Tabulka, pohled nebo index u zdroje dat nejsou oliněny. Při zrušení tabulek ytořených transparentním jazykem DDL je zrušena také odpoídající přezdíka pro tuto tabulku. Udělí opránění pro přezdíky a federoané pohledy, jako jsou ALTER, DELETE, INDEX, INSERT, SELECT, UPDATE. Opránění u zdroje dat je třeba udělit samostatně. Vloží řádky do objektu zdroje dat (například tabulky nebo pohledu), který má přezdíku. Způsobí uzamčení zdáleného objektu u zdroje dat. Zabrání procesům aplikace e změně tabulky zdroje dat, která má přezdíku. Tento příkaz není podporoán systému ODBC, Microsoft SQL Serer a nerelačních zdrojích dat. Odolá opránění pro přezdíky a federoané pohledy, jako jsou ALTER, DELETE, INDEX, INSERT, SELECT, UPDATE. Opránění u zdroje dat je třeba odolat samostatně. Vybere řádky z objektu zdroje dat (například tabulky nebo pohledu), který má přezdíku. Aktualizuje hodnoty zadaných sloupcích řádcích objektu zdroje dat (například tabulce nebo pohledu), který má přezdíku. SYSADM nebo DBADM Opránění DROPIN pro schéma daného objektu Opránění CONTROL pro objekt SYSADM nebo DBADM WITH GRANT OPTION pro každé identifikoané opránění Opránění CONTROL pro objekt SYSADM nebo DBADM Opránění INSERT pro přezdíku a opránění INSERT pro podkladoý objekt zdroje dat Opránění CONTROL pro podkladoý objekt zdroje dat SYSADM nebo DBADM Opránění SELECT pro podkladoou tabulku Opránění CONTROL pro podkladoou tabulku SYSADM nebo DBADM Opránění CONTROL pro objekt SYSADM nebo DBADM Opránění SELECT pro přezdíku a opránění SELECT pro podkladoý objekt zdroje dat Opránění CONTROL pro podkladoý objekt zdroje dat SYSADM nebo DBADM Opránění UPDATE pro přezdíku a opránění UPDATE pro podkladoý objekt zdroje dat Opránění CONTROL pro podkladoý objekt zdroje dat Při odeslání dotazu do federoané databáze se zkontrolují autorizační opránění pro přezdíku dotazu. Požadaky na autorizaci u objektu zdroje dat, na který odkazuje přezdíka, jsou uplatněny, až když je dotaz skutečně zpracoán e zdroji dat. Kapitola 8. Operace INSERT, UPDATE a DELETE 97

110 Chcete-li ybrat, ložit, aktualizoat nebo odstranit data pomocí přezdíky, musejí opránění obsažená autorizačním identifikátoru příkazu zahrnoat: Příslušné opránění pro přezdíku (aby federoaná databáze mohla přijmout požadaek) Příslušné opránění pro podkladoý tabulkoý objekt (aby zdroj dat mohl přijmout požadaek) Například k aktualizaci zdroje dat pomocí přezdíky potřebujete opránění UPDATE pro přezdíku a opránění UPDATE pro podkladoý objekt zdroje dat. Souisející úlohy: Odkazoání na objekty datoých zdrojů příkazech SQL pomocí přezdíek na stránce 190 Souisející odkazy: ALTER TABLE statement příručce SQL Reference, Volume 2 COMMENT statement příručce SQL Reference, Volume 2 CREATE ALIAS statement příručce SQL Reference, Volume 2 CREATE INDEX statement příručce SQL Reference, Volume 2 CREATE VIEW statement příručce SQL Reference, Volume 2 DELETE statement příručce SQL Reference, Volume 2 DROP statement příručce SQL Reference, Volume 2 GRANT (Database Authorities) statement příručce SQL Reference, Volume 2 INSERT statement příručce SQL Reference, Volume 2 LOCK TABLE statement příručce SQL Reference, Volume 2 REVOKE (Table, View, or Nickname Priileges) statement příručce SQL Reference, Volume 2 SELECT statement příručce SQL Reference, Volume 2 UPDATE statement příručce SQL Reference, Volume 2 ALTER NICKNAME statement příručce SQL Reference, Volume 2 Přístup k noým objektům zdroj dat Občas budete chtít přistupoat k objektům zdrojů dat, které nemají přezdíky. Mohou to být noé objekty přidané do zdroje dat, například noě ytořený pohled. Může se jednat o existující objekty, které nebyly registroána na federoaném sereru při počátečním nastaení. V každém případě jsou tyto objekty noé pro federoaný serer. Abyste mohli přistupoat k těmto noým objektům, je pro ně třeba ytořit přezdíky pomocí příkazu CREATE NICKNAME. Předpoklady: Federoaný systém je třeba konfiguroat pro přístup ke zdroji dat. Ve federoané databázi musí existoat definice sereru pro serer zdroje dat, e kterém se objekt nachází. Definici sereru ytoříte pomocí příkazu CREATE SERVER. Chcete-li data ložit, aktualizoat nebo odstranit pomocí přezdíky, musí platit šechna následující opránění: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí pro přezdíku obsahoat opránění SELECT, INSERT, UPDATE a DELETE (aby federoaná databáze mohla přijmout požadaek). 98 Příručka pro federoané systémy

111 Jméno užiatele e zdroji dat musí mít opránění SELECT, INSERT, UPDATE a DELETE pro podkladoý tabulkoý objekt (aby zdroj dat mohl přijmout požadaek). Jméno užiatele na zdroji dat musí být mapoáno pomocí mapoání užiatele na autorizační ID na federoaném sereru. Pro zadání příkazu CREATE NICKNAME musíte mít některé z následujících opránění: SYSADM nebo DBADM Opránění IMPLICIT_SCHEMA pro federoanou databázi (pokud neexistuje implicitní nebo explicitní jméno schématu přezdíky) Opránění CREATEIN pro schéma (pokud jméno schématu přezdíky existuje) Postup: Příkaz CREATE NICKNAME se mírně liší u relačních a nerelačních zdrojů dat. U relačních zdrojů dat má tento příkaz CREATE NICKNAME tuto syntaxi: CREATE NICKNAME jméno_přezdíky FOR jméno_sereru."zdálené_schéma"."jméno_objektu" OPTIONS (seznam_oleb) jméno_přezdíky Jedinečná přezdíka pro objekt zdroje dat. Přezdíka je jméno o dou částech: schéma a přezdíka. Vynecháte-li při ytáření přezdíky schéma, bude schématem přezdíky oěřoací ID užiatele, který přezdíku ytáří. Přezdíky mohou mít délku až 128 znaků. FOR jméno_sereru. zdálené_schéma. jméno_objektu Identifikátor o třech částech pro objekt zdáleného zdroje dat. Pokud zdroj dat nepodporuje schémata, ynechejte příkazu CREATE NICKNAME schéma. jméno_sereru je jméno přiřazené sereru zdroje dat příkazu CREATE SERVER. zdálené_schéma je jméno zdáleného schématu, ke kterému objekt patří. jméno_objektu je jméno zdáleného objektu, ke kterému chcete přistupoat. OPTIONS (seznam_oleb) Informace o přezdíce, které umožňují kompilátoru dotazů SQL a modulu wrapper efektině proádět dotazy. U nerelačních zdrojů dat má tento příkaz CREATE NICKNAME tuto syntaxi: CREATE NICKNAME jméno_přezdíky seznam_definicí_sloupců FOR SERVER jméno_sereru OPTIONS (seznam_oleb) jméno_přezdíky Jedinečná přezdíka pro objekt zdroje dat. Přezdíka je jméno o dou částech: schéma a přezdíka. Vynecháte-li při ytáření přezdíky schéma, bude schématem přezdíky oěřoací ID užiatele, který přezdíku ytáří. Přezdíky mohou mít délku až 128 znaků. seznam_definicí_sloupců Seznam sloupců a datoých typů dané přezdíky. FOR SERVER jméno_sereru Lokální jméno ytořené pro zdálený serer informacích definice sereru příkazem CREATE SERVER. Kapitola 8. Operace INSERT, UPDATE a DELETE 99

112 OPTIONS (seznam_oleb) Informace o přezdíce, které umožňují kompilátoru dotazů SQL a modulu wrapper efektině proádět dotazy. Souisející úlohy: Práce s přezdíkami na stránce 93 Souisející odkazy: CREATE NICKNAME statement příručce SQL Reference, Volume 2 Přístup ke zdrojům dat pomocí průchozích relací Příkazy SQL můžete spouštět přímo ke zdrojům dat pomocí speciálního režimu nazýaného průchod. Příkazy SQL se spouští dialektu SQL použíaném e zdroji dat. Průchozí relaci použijte, pokud chcete proést operaci, která není možná pomocí rozhraní DB2 SQL/API. Například je použijte k ytoření procedury, ytoření indexu nebo proedení dotazů natiním dialektu zdroje dat. V současnosti zdroje dat podporující průchod přijímají průchozí relaci pouze příkazy SQL. Je možné, že budoucnosti budou zdroje dat podporoat průchod pomocí jiného jazyka zdroje dat než SQL. Podobně můžete průchozí relaci použít k proedení akcí, které nejsou podporoány jazykem SQL, například některé úlohy spráy. Průchozí relaci šak nelze použít pro proádění šech úloh spráy. Úlohy spráy, které můžete proést, záisí na zdroji dat. Například u produktu DB2 UDB můžete spustit obslužný program statistiky použíaný e zdroji dat, ale nemůžete spustit nebo zastait zdálenou databázi. V průchozí relaci lze najednou spustit dotaz jen pro jeden zdroj dat. Relaci oteřete příkazem SET PASSTHRU. Použitím příkazu SET PASSTHRU RESET průchozí relaci uzařete. Použijete-li příkaz SET PASSTHRU namísto příkazu SET PASSTHRU RESET, bude uzařena aktuální průchozí relace a oteřena noá průchozí relace. U kurzoru definoaného průchozí relaci můžete použít syntaxi WITH HOLD. Pokusíte-li se šak použít tuto syntaxi (s příkazem COMMIT) a zdroj dat syntaxi WITH HOLD nepodporuje, obdržíte chybu. Průchozí relace nepodporují nerelační zdroje dat. Souisející koncepce: Průchozí relace na stránce 10 Odesílání dotazů do zdrojů dat přímo prostřednictím průchozí relace na stránce 200 Souisející úlohy: Práce s přezdíkami na stránce 93 Souisející odkazy: SET PASSTHRU statement příručce SQL Reference, Volume Příručka pro federoané systémy

113 Přístup k heterogenním datům prostřednictím federoaných pohledů Federoaný pohled je pohled e federoané databázi, jejíž základní tabulky jsou umístěny e zdálených zdrojích dat. Na základní tabulky se e federoaném pohledu odkazuje pomocí přezdíek, nikoli pomocí jmen tabulek e zdrojích dat. Při hledání e federoaném pohledu pomocí dotazu se data načtou ze zdáleného zdroje dat. Akce ytoření pohledu federoané databáze pro data ze zdroje dat se někdy nazýá ytoření pohledu pro přezdíku. Důodem je, že se při ytáření pohledu odkazuje na přezdíky namísto zdrojů dat. Tyto pohledy nabízejí ysoký stupeň nezáislosti dat pro globálně integroanou databázi, stejně jako ji nabízejí pohledy definoané několika lokálních tabulkách pro spráce centralizoaných relačních databází. Předpoklady: Pro zadání příkazu CREATE VIEW musíte mít některé z následujících opránění: SYSADM nebo DBADM Pro každou přezdíku liboolném plném ýběru obě z následujících opránění: Opránění CONTROL nebo SELECT pro podkladoou tabulku nebo pohled Některé z následujících opránění: - Opránění IMPLICIT_SCHEMA pro federoanou databázi (pokud neexistuje implicitní nebo explicitní jméno schématu pohledu) - Opránění CREATEIN pro schéma (pokud jméno schématu pohledu odkazuje na existující schéma) Opránění pro podkladoé objekty nejsou při definoání pohledu pro přezdíku federoané databáze brána úahu. Omezení: Federoané pohledy s příkazy UNION ALL jsou pouze pro čtení. Federoané pohledy, které zahrnují íce než jednu přezdíku klauzuli FROM, jsou pouze pro čtení. Federoané pohledy, které zahrnují pouze jednu přezdíku klauzuli FROM, mohou být pouze pro čtení. Pokud přezdíka klauzuli FROM patří nerelačnímu zdroji dat, je federoaný pohled pouze pro čtení. Pokud při ytáření pohledu zahrnete další přezdíky jako predikáty nebo poddotazy, lze federoaný pohled aktualizoat. Postup: K ytoření federoaného pohledu slouží příkaz CREATE VIEW. Požadaky na autorizaci u zdroje dat pro tabulku nebo pohled, na které odkazuje přezdíka, jsou uplatněny při zpracoání dotazu. Autorizační ID příkazu lze mapoat k jinému autorizačnímu ID pro zdálený přístup pomocí mapoání užiatele. Vytoření federoaného pohledu slučujícího podobná data z několika objektů zdrojů dat: Kapitola 8. Operace INSERT, UPDATE a DELETE 101

114 Předpokládejme, že máte údaje o zákaznících na třech samostatných sererech, jednom Eropě, jednom Asii a jednom Jižní Americe. Údaje o zákaznících Eropě jsou tabulce Oracle. Přezdíka pro tuto tabulku je ORA_EU_CUST. Údaje o zákaznících Asii jsou tabulce Sybase. Přezdíka pro tuto tabulku je SYB_AS_CUST. Údaje o zákaznících Jižní Americe se nacházejí tabulce Informix. Přezdíka pro tuto tabulku je INFMX_SA_CUST. Každá tabulka má sloupce obsahující číslo zákazníka (CUST_NO), jméno zákazníka (CUST_NAME), číslo produktu (PROD_NO) a objednané množstí (QUANTITY). Syntaxe pro ytoření pohledu z těchto tří přezdíek, který bude slučoat tyto údaje o zákaznících, je: CREATE VIEW FV1 AS SELECT * FROM ORA_EU_CUST UNION ALL SELECT * FROM SYB_AS_CUST UNION ALL SELECT * FROM INFMX_SA_CUST Spojení dat pro ytoření federoaného pohledu: Předpokládejme, že máte údaje o zákaznících na jednom sereru a data o prodeji na jiném sereru. Údaje o zákaznících jsou tabulce Oracle. Přezdíka pro tuto tabulku je ORA_EU_CUST. Data o prodeji jsou tabulce Sybase. Přezdíka pro tuto tabulku je SYB_SALES. Informace o zákaznících chcete přiřadit k nákupům, které tito zákazníci učinili. Každá tabulka má sloupec obsahující číslo zákazníka (CUST_NO). Syntaxe pro ytoření federoaného pohledu z těchto dou přezdíek, který bude slučoat tato data, je: CREATE VIEW FV4 AS SELECT A.CUST_NO, A.CUST_NAME, B.PROD_NO, B.QUANTITY FROM ORA_EU_CUST A, SYB_SALES B WHERE A.CUST_NO=B.CUST_NO Souisející úlohy: Vytáření a použití federoaných pohledů na stránce 193 Práce s přezdíkami na stránce 93 Souisející odkazy: CREATE VIEW statement příručce SQL Reference, Volume 2 Vytoření přezdíky pro přezdíku Je možné, že občas budete potřeboat ytořit přezdíku pro přezdíku. Postup: Předpokládejme, že máte federoaný serer použíající systém AIX a federoaný serer použíající systém Windows. Chcete přistupoat k tabulce aplikace Excel z obou federoaných sererů. Modul wrapper aplikace Excel je šak podporoán pouze na federoaných sererech použíajících systém Windows. Chcete-li získat přístup k tabulce aplikace Excel z federoaného sereru AIX, postupujte takto: 1. Na federoaném sereru Windows nainstalujte produkt DB2 Information Integrator. 2. Nakonfigurujte federoaný serer Windows pro přístup ke zdrojům dat aplikace Excel. 3. Na federoaném sereru Windows ytořte přezdíku pro tabulku aplikace Excel. 4. Na federoaném sereru AIX nainstalujte produkt DB2 Information Integrator. 5. Nakonfigurujte federoaný serer AIX pro přístup ke zdrojům dat skupiny produktů DB2. 6. Na federoaném sereru AIX ytořte přezdíku pro přezdíku tabulky aplikace Excel na federoaném sereru Windows. 102 Příručka pro federoané systémy

115 Výběr dat e federoaném systému Mezi typy distribuoaných požadaků použíané e federoaném systému patří požadaky, které yhledáají pomocí dotazu : jednom zdáleném zdroji dat, lokálním zdroji dat a zdáleném zdroji dat, několika zdálených zdrojích dat, kombinaci zdálených a lokálních zdrojů dat. Chcete-li ybrat data ze zdrojů dat, použijte příkazu SELECT přezdíky pro objekty zdrojů dat. Předpoklady: Chcete-li ybrat data pomocí přezdíky, musí platit šechna následující opránění: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí pro přezdíku obsahoat opránění SELECT (aby federoaná databáze mohla přijmout požadaek). Jméno užiatele e zdroji dat musí mít opránění SELECT pro podkladoý tabulkoý objekt (aby zdroj dat mohl přijmout požadaek). Jméno užiatele na zdroji dat musí být mapoáno pomocí mapoání užiatele na autorizační ID na federoaném sereru. Postup: Federoaná databáze je lokální zdroj dat. Lokální objekty jsou tabulky a pohledy e federoané databázi. Pro tyto objekty neytáříte přezdíky; příkazech SELECT použíáte skutečné jméno objektu. Mezi zdálené zdroje dat patří: jiná instance databáze DB2 for Linux, UNIX, and Windows na federoaném sereru, jiná instance databáze DB2 for Linux, UNIX, and Windows na jiném sereru a jiné zdroje dat než produkt DB2 for Linux, UNIX, and Windows. Objekty, které se nacházejí e zdálených zdrojích dat, jsou zdálené objekty. Předpokládejme, že federoaný serer je konfiguroán pro přístup ke zdroji dat DB2 for OS/390, zdroji dat DB2 for iseries a zdroji dat Oracle. V každém zdroji dat je uložena tabulka, která obsahuje informace o prodeji. Tato konfigurace je znázorněna na následujícím obrázku. Kapitola 8. Operace INSERT, UPDATE a DELETE 103

116 Obrázek 3. Ukázka federoaného systému se zdroji dat DB2 a Oracle Tabulky prodeje obsahují sloupce, které zaznamenáají číslo zákazníka (CUST_NO), objednané množstí (QUANTITY) a číslo objednaného produktu (PROD_NO). Máte také lokální tabulku e federoané databázi, která obsahuje informace o cenách. Tabulka cen obsahuje sloupce, které zaznamenáají číslo produktu (PROD_NO) a aktuální cenu (PRICE). Přezdíky pro objekty zdáleného zdroje dat se ukládají tabulkách SYSCAT.TABLES, jak zobrazuje následující obrázek. Sloupec TYPE označuje typ objektu, například přezdíka (N), lokální tabulka (T) nebo pohled (V). Obrázek 4. Tabulky a přezdíky pro ukázkoé dotazy 104 Příručka pro federoané systémy

117 Následují příklady příkazu SELECT s yužitím ýše popsaného ukázkoého federoaného systému. Příklad: Dotaz na jeden zdroj dat: Tabulka Z_EU_SALES obsahuje produkty seřazené podle ašich eropských zákazníků. Roněž zahrnuje množstí objednané při každém prodeji. Tento dotaz použíá příkaz SELECT s klauzulí ORDER BY pro ytoření ýpisu prodeje Eropě, který bude seřazen podle čísla zákazníka: SELECT CUST_NO, PROD_NO, QUANTITY FROM Z_EU_SALES ORDER BY CUST_NO Příklad: Spojení lokálního zdroje dat a zdáleného zdroje dat: Objekt PRICES je tabulka, která se nachází e federoané databázi. Obsahuje ceník prodáaných produktů. Z této lokální tabulky chcete ybrat ceny, které odpoídají produktům uedeným tabulce Z_EU_SALES. Roněž chcete seřadit ýslednou sadu podle čísla zákazníka. SELECT sales.cust_no, sales.prod_no, sales.quantity FROM Z_EU_SALES sales, PRICES WHERE sales.prod_no=prices.prod_no ORDER BY sales.cust_no Příklad: Dotaz na několik zdálených zdrojů dat: Předpokládejme, že chcete shromáždit šechny informace o prodeji z každé oblasti a seřadit ýslednou sadu podle čísla produktu. WITH GLOBAL_SALES (Customer, Product, Quantity) AS (SELECT CUST_NO, PROD_NO, QUANTITY FROM Z_EU_SALES UNION ALL SELECT CUST.NO,PROD.NO, QUANTITY FROM is_us_sales UNION ALL SELECT CUST.NO,PROD.NO, QUANTITY FROM ORA_JAPANSALES) SELECT Customer, Product, Quantity FROM GLOBAL_SALES ORDER BY Product Předpokládejme, že e zdroji dat Oracle máte pohled, který uádí prodej pro Japonsko a Indonésii. Přezdíka pro tento pohled je ORA_SALESREGION. Tyto informace chcete sloučit s prodejem e Spojených státech a zobrazit ceny produktů edle každého prodeje. SELECT us_jpn_ind.cust_no, us_jpn_ind.prod_no, us_jpn_ind.quantity, us_jpn_ind.quantity*prices.price AS SALEPRICE FROM (SELECT CUST_NO, PROD_NO, QUANTITY FROM ORA_SALESREGION UNION ALL SELECT CUST_NO, PROD_NO, QUANTITY FROM is_us_sales us ) us_jpn_ind,prices WHERE us_jpn_ind.prod_no = PRICES.PROD_NO ORDER BY SALEPRICE DESC Souisející odkazy: SELECT statement příručce SQL Reference, Volume 2 Kapitola 8. Operace INSERT, UPDATE a DELETE 105

118 Změna dat e federoaném systému Ve federoaném systému můžete zadat příkazy INSERT, UPDATE a DELETE u objektů zdrojů dat použíajících přezdíky. Následující části obsahují příklady proádění těchto operací. Vložení dat do objektů zdrojů dat Chcete-li ložit data do zdrojů dat, použijte příkazu INSERT přezdíky pro objekty zdrojů dat. Předpoklady: Chcete-li data ložit pomocí přezdíky, musí platit šechna následující opránění: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí u přezdíky obsahoat opránění INSERT (aby federoaná databáze mohla přijmout požadaek). Jméno užiatele e zdroji dat musí mít opránění INSERT podkladoém tabulkoém objektu (aby zdroj dat mohl přijmout požadaek). Jméno užiatele na zdroji dat musí být mapoáno pomocí mapoání užiatele na autorizační ID na federoaném sereru. Omezení: Federoání nepodporuje operace INSERT u některých zdrojů dat, iz Omezení příkazů INSERT, UPDATE a DELETE pro federoaný systémomezení příkazů INSERT, UPDATE a DELETE pro federoaný systém. Postup: Předstame si, že tabulka Informix se skládá ze dou sloupců. Prní sloupec obsahuje data typu INTEGER a druhý sloupec obsahuje data typu VARCHAR (do 20 znaků). Na federoaném sereru je pro tabulku Informix registroána přezdíka infx_table_nn. V tabulce Informix můžete pomocí přezdíky infx_table_nn zadat příkazy INSERT, UPDATE a DELETE. Například pro ložení noého řádku informací do tabulky Informix by příkaz zněl: INSERT INTO db2user1.infx_table_nn VALUES(1, Walter ) Souisející koncepce: Omezení příkazů INSERT, UPDATE a DELETE pro federoaný systém na stránce 90 Souisející úlohy: Výběr dat e federoaném systému na stránce 103 Aktualizace dat objektech zdrojů dat na stránce 107 Odstranění dat z objektů zdrojů dat na stránce 107 Souisející odkazy: INSERT statement příručce SQL Reference, Volume Příručka pro federoané systémy

119 Aktualizace dat objektech zdrojů dat Chcete-li aktualizoat data e zdrojích dat, použijte příkazu UPDATE přezdíky pro objekty zdrojů dat. Předpoklady: Chcete-li data aktualizoat pomocí přezdíky, musí platit šechna následující opránění: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí u přezdíky obsahoat opránění UPDATE (aby federoaná databáze mohla přijmout požadaek). Jméno užiatele e zdroji dat musí mít opránění UPDATE podkladoém tabulkoém objektu (aby zdroj dat mohl přijmout požadaek). Jméno užiatele na zdroji dat musí být mapoáno pomocí mapoání užiatele na autorizační ID na federoaném sereru. Omezení: Federoání nepodporuje operace UPDATE u některých zdrojů dat, iz Omezení příkazů INSERT, UPDATE a DELETE pro federoaný systémomezení příkazů INSERT, UPDATE a DELETE pro federoaný systém Postup: Předstame si, že tabulka Informix se skládá ze dou sloupců. Prní sloupec obsahuje data typu INTEGER a druhý sloupec obsahuje data typu VARCHAR (do 20 znaků). Na federoaném sereru je pro tabulku Informix registroána přezdíka infx_table_nn. V tabulce Informix můžete pomocí přezdíky infx_table_nn zadat příkazy INSERT, UPDATE a DELETE. Například pro aktualizaci řádku informací tabulce Informix by příkaz zněl: UPDATE db2user1.infx_table_nn SET c2= Bill WHERE c1=2 Souisející koncepce: Omezení příkazů INSERT, UPDATE a DELETE pro federoaný systém na stránce 90 Souisející úlohy: Výběr dat e federoaném systému na stránce 103 Vložení dat do objektů zdrojů dat na stránce 106 Odstranění dat z objektů zdrojů dat na stránce 107 Souisející odkazy: UPDATE statement příručce SQL Reference, Volume 2 Odstranění dat z objektů zdrojů dat Chcete-li odstranit data ze zdrojů dat, použijte příkazu DELETE přezdíky pro objekty zdrojů dat. Předpoklady: Chcete-li data odstranit pomocí přezdíky, musí platit šechna následující opránění: Opránění příslušející autorizačnímu identifikátoru daného příkazu musí u přezdíky obsahoat opránění DELETE (aby federoaná databáze mohla přijmout požadaek). Kapitola 8. Operace INSERT, UPDATE a DELETE 107

120 Jméno užiatele e zdroji dat musí mít opránění DELETE podkladoém tabulkoém objektu (aby zdroj dat mohl přijmout požadaek). Jméno užiatele na zdroji dat musí být mapoáno pomocí mapoání užiatele na autorizační ID na federoaném sereru. Omezení: Federoání nepodporuje operace DELETE u některých zdrojů dat, iz Omezení příkazů INSERT, UPDATE a DELETE pro federoaný systém. Postup: Předstame si, že tabulka Informix se skládá ze dou sloupců. Prní sloupec obsahuje data typu INTEGER a druhý sloupec obsahuje data typu VARCHAR (do 20 znaků). Na federoaném sereru je pro tabulku Informix registroána přezdíka infx_table_nn. V tabulce Informix můžete pomocí přezdíky infx_table_nn zadat příkazy INSERT, UPDATE a DELETE. Například pro odstranění řádku informací z tabulky Informix by příkaz zněl: DELETE FROM infx_table_nn WHERE c1=3 Souisející koncepce: Omezení příkazů INSERT, UPDATE a DELETE pro federoaný systém na stránce 90 Souisející úlohy: Výběr dat e federoaném systému na stránce 103 Vložení dat do objektů zdrojů dat na stránce 106 Aktualizace dat objektech zdrojů dat na stránce 107 Souisející odkazy: DELETE statement příručce SQL Reference, Volume 2 Sémantika přiřazení e federoaném systému Když přiřadíte data ke sloupci přezdíky, může se typ dat změnit na základě praidel přiřazení použíaných produktem DB2 Information Integrator. Chcete-li získat požadoané ýsledky, měli byste nastudoat praidla přiřazení. Praidla pro určení typu dat cíle přiřazení ke sloupci přezdíky jsou následující: Určete lokální typ zdroje: Lokální typ zdroje je určen lokálním typem sloupce a lokálním typem ýsledku ýrazu. Je-li zdroj konstanta, je lokální typ zdroje stejný jako typ konstanty. Určete typ cíle: Pokud nemá zdroj přiřazení žádný typ, jako například značky parametru nebo hodnoty Null, pak je cíloým typem MIN(lokální_typ_cíle, zdálený_typ_cíle), kde lokální_typ_cíle je aktualizoaný sloupec lokálního datoého typu a zdálený_typ_cíle je aktualizoaný datoý typ sloupce zdroje dat. Parametr zdálený_typ_cíle odkazuje na ýchozí typ dopředného mapoání datoého typu zdáleného cíloého sloupce. Pokud zdroj přiřazení nemá hodnotu Null nebo značky parametru, pak je typ cíle MIN(lokální_typ_cíle, zdálený_typ_cíle, lokální_typ_zdroje). Definice funkce MIN(typ1, typ2) 108 Příručka pro federoané systémy

121 Typy typ1 a typ2 nejsou přesně stejné. MIN(typ1, typ2) = MIN(typ2, typ1) MIN(typ1, typ2) = zdálený_typ_cíle(lokální_typ_cíle), když MIN(typ1, typ2) = DECIMAL(0,0) Objekt BLOB je kompatibilní pouze s objektem BLOB, takže MIN(BLOB(x), BLOB(y))=BLOB(z), kde z=min(x,y) Datoé typy TIME a DATE nejsou kompatibilní. Typy data a času a znakoé řetezce jsou kompatibilní. V databázích Unicode jsou kompatibilní znakoé a grafické řetězce. Následující tabulky uádějí minimální ze dou datoých typů pro numerický datoý typ, znakoý řetězec, grafický řetězec a datum a čas. Tabulka 10. Numerické datoé typy typ1 typ2 MIN(typ1, typ2) SMALLINT INTEGER SMALLINT nebo INTEGER nebo BIGINT nebo REAL nebo DOUBLE BIGINT nebo REAL nebo DOUBLE SMALLINT INTEGER BIGINT REAL nebo DOUBLE BIGINT REAL DOUBLE REAL DECIMAL(w,x) SMALLINT DECIMAL(p,0) kde p=w-x, pokud p<5; SMALLINT, jinak DECIMAL(w,x) INTEGER DECIMAL(p,0) kde p=w-x, pokud p<11; INTEGER, jinak DECIMAL(w,x) BIGINT DECIMAL(p,0) kde p=w-x, pokud p<19; BIGINT, jinak DECIMAL(w,x) DECIMAL(y,z) DECIMAL(p,s) kde p=min(w,y)+min(w-x,y-z), s=min(x,z) DECIMAL(w,x) DOUBLE nebo REAL DECIMAL(w,x) Následující tabulka uádí minimální ze dou datoých typů pro datoé typy znakoých řetězců. Tabulka 11. Datoé typy znakoých řetězců typ1 typ2 MIN(typ1, typ2) CHAR(x) VARCHAR(x) CHAR(y) nebo VARCHAR(y) nebo LONG VARCHAR nebo CLOB(y) VARCHAR(y) nebo LONG VARCHAR nebo CLOB(y) CHAR(z) kde z=min(x,y) VARCHAR(z) kde z=min(x,y) LONG VARCHAR CLOB(y) LONG VARCHAR kde x>32700, CLOB(x) kde x<=32700 CLOB(x) CLOB(y) CLOB(z) kde z=min(x,y) Následující tabulka uádí minimální ze dou datoých typů pro datoé typy grafických řetězců. Kapitola 8. Operace INSERT, UPDATE a DELETE 109

122 Tabulka 12. Datoé typy grafických řetězců typ1 typ2 MIN(typ1, typ2) GRAPHIC(x) VARGRAPHIC(x) GRAPHIC(y) nebo VARGRAPHIC(y) nebo LONG VARGRAPHIC nebo DBCLOB(y) VARGRAPHIC(y) nebo LONG VARGRAPHIC nebo DBCLOB(y) GRAPHIC(z) kde z=min(x,y) VARGRAPHIC(z) kde z=min(x,y) LONG VARGRAPHIC DBCLOB(y) LONG VARGRAPHIC kde x>32700, DBCLOB(x) kde x<=32700 DBCLOB(x) DBCLOB(y) DBCLOB(z) kde z=min(x,y) Následující tabulka uádí minimální ze dou datoých typů pro datoé typy data a času. Tabulka 13. Datoé typy data a času typ1 typ2 MIN(typ1, typ2) DATE TIMESTAMP DATE TIME TIMESTAMP TIME Pokud jsou kládaná data datoého typu CHAR kratší než cíloá délka, zdroj dat zbytek sloupce doplní. Pokud kládáte data datoého typu DATE nebo TIME do zdáleného sloupce s datoým typem TIMESTAMP, zdroj dat zbytek sloupce doplní. Sémantika přiřazení e federoaném systému - příklady Oddíl Tabulka 14 ukazuje několik příkladů aplikace federoané sémantiky přiřazení daných dotazech lokálního a zdáleného typu. Tabulka 14. Příklady sémantiky přiřazení Lokální typ Vzdálený typ Váš dotaz Generoaný zdálený dotaz FLOAT INTEGER set c1= set c1=integer(123.23) INTEGER FLOAT set c1= set c1=integer(123.23) FLOAT INTEGER set c1=123 set c1=123 CHAR(10) CHAR(20) set c1= 123 set c1= 123 (hodnota 123 je typu VARCHAR(3) a je ze šech nejkratší) CHAR(10) CHAR(20) set c1=char23col set c1=char(char23col, 10) CHAR(10) CHAR(20) set c1=expr1 set c1=expr1 -- pokud expr1 rací char(n) n<= 10 TIMESTAMP DATE set c1= current timestamp set c1=char(expr1, 10) pokud expr1 rací char(n) n>10 set c1=date(current timestamp) 110 Příručka pro federoané systémy

123 Kapitola 9. Monitoroání federoaného systému Tato kapitola popisuje, jak má být monitoroáno narušení přezdíek a sererů a jak lze pořizoat snímky fragmentů dotazů monitoru. Obsah této kapitoly: Indikátory narušení pro federoané přezdíky a serery Aktiace federoaných indikátorů narušení na stránce 112 Monitoroání narušení federoaných přezdíek a sererů na stránce 112 Sledoání narušení federoaných přezdíek a sererů - příklady na stránce 114 Monitoroání snímků federoaných systémů - přehled na stránce 115 Monitoroání fragmentů federoaných dotazů na stránce 115 Monitoroání snímků fragmentů federoaných dotazů - příklad na stránce 115 Indikátory narušení pro federoané přezdíky a serery V Centru narušení DB2 můžete použíat indikátory narušení pro sledoání stau federoaných přezdíek a sererů. Indikátorem narušení pro přezdíky je db.fed_nicknames_op_status. Indikátorem narušení pro definice sererů je db.fed_serers_op_status. Federoané indikátory narušení jsou nainstaloány při instalaci monitoru narušení. Ve ýchozím nastaení nejsou federoané indikátory narušení Centru narušení aktioány. Indikátory je nutné aktioat. Pokud není sta přezdíky nebo sereru normální, indikátory narušení yšlou aronou zpráu. Výsledky sledoání lze zobrazit Centru narušení nebo pomocí příkazoého řádku. Federoané serery, které použíají operační systémy AIX, HP-UX, Linux, Microsoft Windows či Solaris, podporují použití indikátorů narušení. Indikátory narušení pro federoané přezdíky a serery jsou popsány tématu Tabulka 15. Tabulka 15. Indikátory narušení pro přezdíky a serery Indikátory narušení db.fed_nicknames_op_status Popis Indikuje agregační míru narušení pro šechny relační přezdíky definoané databázi na federoaném sereru DB2 UDB. db.fed_serers_op_status Pokud je některá přezdíka neplatná, je zobrazena aroná zpráa. Zároeň jsou uedeny podrobné údaje o neplatných přezdíkách spolu s doporučenými akcemi pro náprau. Indikuje agregační míru narušení pro šechny federoané serery definoané databázi na federoaném sereru DB2 UDB. Pokud je serer nedostupný, bude zobrazena aroná zpráa. Zároeň jsou uedeny podrobné údaje o nedostupných sererech spolu s doporučenými akcemi pro jejich zpřístupnění. Copyright IBM Corp. 1998,

124 Indikátory narušení mohou yhodnocoat údaje následujících zdrojů dat: Skupina produktů DB2 (DRDA) Excel Informix Microsoft SQL Serer ODBC Oracle (NET8) Sybase (CTLIB) Soubory s tabulkoou strukturou Teradata XML (pouze kořenoé přezdíky) Souisející koncepce: Introduction to the health monitor příručce System Monitor Guide and Reference Souisející úlohy: Monitoroání narušení federoaných přezdíek a sererů na stránce 112 Aktiace federoaných indikátorů narušení na stránce 112 Souisející odkazy: db2hc - Start Health Center Command příručce Command Reference db.fed_nicknames_op_status - Nickname Status health indicator příručce System Monitor Guide and Reference db.fed_serers_op_status - Data Source Serer Status health indicator příručce System Monitor Guide and Reference Aktiace federoaných indikátorů narušení Chcete-li sledoat míru narušení přezdíek a sererů, je nutné aktioat federoané indikátory narušení. Indikátorem narušení pro přezdíky je db.fed_nicknames_op_status. Indikátorem narušení pro definice sererů je db.fed_serers_op_status. Postup: Chcete-li aktioat federoané indikátory narušení, oteřete Centrum narušení DB2 a proeďte operaci konfigurace indikátorů narušení. Souisející úlohy: Configuring health indicators using Health Center příručce System Monitor Guide and Reference Monitoroání narušení federoaných přezdíek a sererů na stránce 112 Monitoroání narušení federoaných přezdíek a sererů Služba monitoroání stau přezdíek a sererů slouží k určoání a odstraňoání problémů e federoaném systému. Sta federoaných přezdíek a sererů můžete monitoroat pomocí indikátorů narušení Centru narušení. 112 Příručka pro federoané systémy

125 Výsledky sledoání lze zobrazit Centru narušení nebo pomocí příkazoého řádku. Problémy identifikoané indikátory narušení lze odstranit pomocí Centra narušení DB2 nebo pomocí příkazoého řádku DB2. Předpoklady: Zkontrolujte, zda jsou na federoaném sereru DB2 pro přezdíky definoána opránění SELECT. Nastate konfigurační parametr spráce databází FEDERATED na hodnotu YES. Pokud zdroj dat yžaduje oěření, musí pro zdroj dat existoat mapoání užiatele odpoídající identifikátoru monitoru narušení. Monitor narušení použíá toto mapoání pro připojení ke zdroji dat. Omezení: Indikátory narušení nemohou yhodnocoat údaje následujících zdrojů dat: BioRS BLAST Documentum Entrez Extended Search HMMER Weboé služby WebSphere Business Integration XML (jiné přezdíky než kořenoé) Postup: Chcete-li proést tuto úlohu pomocí Řídicího centra DB2, postupujte takto: 1. Oteřete okno Centrum narušení. 2. Oteřete okno Poradce s doporučeními obsahující doporučené akce pro odstranění problémů s neplatnými přezdíkami nebo nedostupnými serery. Chcete-li tuto úlohu proést z příkazoého řádku, zadejte příkaz GET HEALTH SNAPSHOT. Souisející koncepce: Introduction to the health monitor příručce System Monitor Guide and Reference Indikátory narušení pro federoané přezdíky a serery na stránce 111 Souisející úlohy: Resoling alerts using the Health Center příručce System Monitor Guide and Reference Souisející odkazy: Sledoání narušení federoaných přezdíek a sererů - příklady na stránce 114 Kapitola 9. Monitoroání federoaného systému 113

126 Sledoání narušení federoaných přezdíek a sererů - příklady V následujícím příkladě je ueden snímek míry narušení pro databázi se jménem fedhi. Jména federoaných indikátorů narušení jsou db.fed_nicknames_op_status a db.fed_serers_op_status. V tomto příkladě se oba tyto indikátory narušení nacházejí normálním stau. Normální sta znamená, že přezdíky a serery jsou platné. GET HEALTH SNAPSHOT FOR DATABASE ON fedhi: Snímek narušení databáze Časoá značka snímku = 02/10/ :10: Jméno databáze = FEDHI Cesta k databázi = C:\DB2\NODE0000\SQL00006\ Alias stupní databáze = FEDHI Oper. systém spuštěný sereru databáze = NT Umístění databáze = Lokální Sta ýstrahy nejyšší záažnosti pro databázi = Upozornění Indikátory narušení: Jméno indikátoru = db.fed_serers_op_status Hodnota = 0 Časoá značka yhodnocení = 02/10/ :09: Sta ýstrahy = Normal Jméno indikátoru = db.fed_nicknames_op_status Hodnota = 0 Časoá značka yhodnocení = 02/10/ :09: Sta ýstrahy = Běžný Jméno indikátoru = db.db_op_status Hodnota = 0 Časoá značka yhodnocení = 02/10/ :08: Sta ýstrahy = Běžný Jméno indikátoru = db.sort_shrmem_util Hodnota = 0 Jednotka = % Časoá značka yhodnocení = 02/10/ :08: Sta ýstrahy = Běžný Jméno indikátoru = db.spilled_sorts Hodnota = 0 Jednotka = % Časoá značka yhodnocení = 02/10/ :09: Sta ýstrahy = Běžný Souisející koncepce: Indikátory narušení pro federoané přezdíky a serery na stránce 111 Souisející úlohy: Monitoroání narušení federoaných přezdíek a sererů na stránce Příručka pro federoané systémy

127 Monitoroání snímků federoaných systémů - přehled Pomocí služby monitoroání snímků lze zachytit informace o federoaných zdrojích dat či liboolných připojených aplikacích určeném čase. Snímky jsou užitečné pro určení stau federoaného systému. Pokud jsou snímky pořizoány praidelných interalech, lze je též yužít při sledoání trendů a pro předídání možných problémů. Souisející koncepce: Snapshot monitor příručce System Monitor Guide and Reference Souisející úlohy: Monitoroání fragmentů federoaných dotazů na stránce 115 Souisející odkazy: Kapitola 31, Prky monitoru federoaných databázoých systémů, na stránce 287 Monitoroání snímků fragmentů federoaných dotazů - příklad na stránce 115 Monitoroání fragmentů federoaných dotazů Prostřednictím monitoroání fragmentů dotazů můžete sledoat činnost federoaného systému. Chcete-li získat lepší předstau o tom, jak federoaný systém zpracoáá dotaz, můžete ytořit snímek segmentů zdáleného dotazu. Postup: Chcete-li sledoat fragmenty dotazu, zadejte příkaz GET SNAPSHOT FOR DYNAMIC SQL ON <jméno_db>, kde jméno_db je jméno lokální databáze na federoaném sereru. Souisející koncepce: Monitoroání snímků federoaných systémů - přehled na stránce 115 Souisející odkazy: GET SNAPSHOT Command příručce Command Reference Monitoroání snímků fragmentů federoaných dotazů - příklad na stránce 115 Monitoroání snímků fragmentů federoaných dotazů - příklad V následujícím příkladu je ueden ýstup snímků dynamického jazyka SQL pro fragment dotazu odeslaný do zdáleného zdroje dat Oracle se jménem ORACLE817. Výstup byl generoán příkazem GET SNAPSHOT FOR DYNAMIC SQL ON LOCAL_FEDERATED_DATABASE. Výsledky poskytují údaje pro šechny zdálené dotazy a šechny dotazy mezipaměti příkazů. Vzhledem k tomu, že údaje fondu yronáacích pamětí nelze použít pro zdálené dotazy, nebude snímek obsahoat žádné údaje o fondu yronáacích pamětí. Snímek dynamického jazyka SQL - ýsledky Počet proedení = 1 Počet kompilací = 1 Nejhorší doba přípray (ms) = 215 Nejlepší doba přípray (ms) = 215 Počet odstraněných interních řádků = 0 Počet ložených interních řádků = 0 Počet čtených řádků = Kapitola 9. Monitoroání federoaného systému 115

128 Počet aktualizoaných inter. řádků = 0 Počet zapsaných řádků = Počet řazení příkazů = 0 Data fondu yro. pamětí - log. čtení = Neshromážděno Data fondu yro. pamětí - fyz. čtení = Neshromážděno Dočasná data fondu yro. pamětí - log. čtení = Neshromážděno Dočasná data fondu yro. pamětí - fyz. čtení = Neshromážděno Index fondu yro. pamětí - log. čtení = Neshromážděno Index fondu yro. pamětí - fyz. čtení = Neshromážděno Dočasný index fondu yro. pamětí - log. čtení = Neshromážděno Dočasný index fondu yro. pamětí - fyz. čtení = Neshromážděno Celkoá doba proádění (sek.ms) = Celkoý čas procesoru pro užiatele (sek.ms) = Celkoý čas procesoru pro systém (sek.ms) = Text příkazu = [ORACLE817]SELECT A0.C1,A0.C2 FROM ORA_T A0 WHERE A0.C3 = :H0 Souisející koncepce: Monitoroání snímků federoaných systémů - přehled na stránce 115 Souisející úlohy: Monitoroání fragmentů federoaných dotazů na stránce 115 Souisející odkazy: GET SNAPSHOT Command příručce Command Reference 116 Příručka pro federoané systémy

129 Kapitola 10. Podpora kódoání Unicode pro federoané zdroje dat Tato kapitola popisuje podporu kódoání Unicode e federoaném systému. Obsah této kapitoly: Podpora formátu Unicode pro federoané systémy Zadání kódoé stránky klienta pro podporu formátu Unicode u zdrojů dat Microsoft SQL Serer a ODBC na stránce 119 Podporoané kódoé stránky Unicode pro olbu CODEPAGE modulu wrapper MSSQL a ODBC na stránce 120 Zadání kódoé stránky souboru pro podporu formátu Unicode e zdrojích dat typu soubory s tabulkoou strukturou na stránce 120 Zadání kódoé stránky souboru pro podporu formátu Unicode e zdrojích dat typu soubory s tabulkoou strukturou - příklad na stránce 121 Chyby případě rozdílné elikosti zdáleného a federoaného místa kódu na stránce 121 Podpora formátu Unicode pro federoané systémy Relační a nerelační moduly wrapper a užiatelské funkce lze spouštět databázi Unicode (databáze UTF-8). Databáze Unicode poskytuje prostředí federoaných sererů, která nejsou záislá na platformě. Databáze Unicode může manipuloat s daty uloženými různých kódoých stránkách jiných zdrojích dat. Moduly wrapper a užiatelské funkce podporující formát Unicode: Relační moduly wrapper DRDA Informix MS SQL Serer ODBC OLE DB Oracle Sybase Teradata Nerelační moduly wrapper a užiatelské funkce Modul wrapper pro BioRS Modul wrapper pro BLAST Modul wrapper pro Documentum Modul wrapper pro Entrez Modul wrapper pro Excel Modul wrapper pro HMMER Modul wrapper pro IBM Lotus Extended Search Užiatelské funkce KEGG Užiatelské funkce MQ Modul wrapper pro soubory s tabulkoou strukturou Užiatelské funkce pro weboé služby Modul wrapper pro weboé služby Modul wrapper pro WebSphere Business Integration Modul wrapper pro XML Copyright IBM Corp. 1998,

130 V příkladu Obrázek 5 má společnost pobočky různých zemích. Každá pobočka ukládá data o zákaznících e lastních databázích e lastní kódoé stránce. Databáze na sereru Microsoft SQL Serer ukládá data kódoé stránce A. Databáze Oracle ukládá data kódoé stránce B. Kódoá stránka A a kódoá stránka B jsou jiných teritoriích. Pro integraci dat z různých teritorií může společnost nastait kódoou stránku federoané databáze na Unicode. Společnost potom může spojit tabulky, aby se zobrazily šechny nákupní objednáky bez ohledu na teritorium. Obrázek 5. Příklad použití formátu Unicode Souisející úlohy: Zadání kódoé stránky klienta pro podporu formátu Unicode u zdrojů dat Microsoft SQL Serer a ODBC na stránce 119 Zadání kódoé stránky souboru pro podporu formátu Unicode e zdrojích dat typu soubory s tabulkoou strukturou na stránce 120 Souisející odkazy: Výchozí dopředné mapoání datoých typů Unicode - modul wrapper NET8 na stránce 277 Podporoané kódoé stránky Unicode pro olbu CODEPAGE modulu wrapper MSSQL a ODBC na stránce Příručka pro federoané systémy

131 Výchozí zpětné mapoání datoých typů Unicode - modul wrapper NET8 na stránce 277 Výchozí dopředné mapoání datoých typů Unicode - modul wrapper Sybase na stránce 278 Výchozí zpětné mapoání datoých typů Unicode - modul wrapper Sybase na stránce 278 Výchozí dopředné mapoání datoých typů Unicode - modul wrapper ODBC na stránce 279 Výchozí zpětné mapoání datoých typů Unicode - modul wrapper ODBC na stránce 279 Výchozí dopředné mapoání datoých typů Unicode - modul wrapper Microsoft SQL Serer na stránce 280 Výchozí zpětné mapoání datoých typů Unicode - modul wrapper Microsoft SQL Serer na stránce 280 Zadání kódoé stránky souboru pro podporu formátu Unicode e zdrojích dat typu soubory s tabulkoou strukturou - příklad na stránce 121 Zadání kódoé stránky klienta pro podporu formátu Unicode u zdrojů dat Microsoft SQL Serer a ODBC Chcete-li zajistit spránost přeodu kódoé stránky pro zdroje dat Microsoft SQL Serer a ODBC, je třeba zadat kódoou stránku klienta, pokud se tato kódoá stránka liší od kódoé stránky federoané databáze. Postup: Zadejte příkaz CREATE SERVER s olbou CODEPAGE nastaenou na hodnotu kódoé stránky klienta. Pokud je například zdrojem dat Microsoft SQL Serer a federoaný serer je systému Windows a ýchozí lokalita operačního systému je nastaena na japonštinu (Shift-JIS), olbu sereru CODEPAGE je třeba nastait na hodnotu 943 (Shift-JIS) nebo 1202 (UTF-16LE). Chcete-li zadat kódoou stránku 1202 pro zdroj dat Microsoft SQL Serer se jménem FEDSERVERW, zadejte následující příkaz: CREATE SERVER FEDSERVERW TYPE MSSQLSERVER VERSION 2000 WRAPPER MSSQLODBC3 OPTIONS(NODE SAMPLE, DBNAME TESTDB, CODEPAGE 1202 ); Pokud je zdrojem dat Microsoft SQL Serer a federoaný serer je spuštěn systému UNIX a nastaení AppCodePage nebo IANAAppCodePage klienta DataDirect Connect je 6 (Shift-JIS), olba sereru CODEPAGE musí být nastaena na hodnotu 943 (Shift-JIS) nebo 1208 (UTF-8). Chcete-li zadat kódoou stránku 1208 pro zdroj dat Microsoft SQL Serer se jménem FEDSERVERU, zadejte následující příkaz: CREATE SERVER FEDSERVERU TYPE MSSQLSERVER VERSION 2000 WRAPPER MSSQLODBC3 OPTIONS(NODE SAMPLE, DBNAME TESTDB, CODEPAGE 1208 ); Souisející koncepce: Podpora formátu Unicode pro federoané systémy na stránce 117 Souisející odkazy: CREATE SERVER statement příručce SQL Reference, Volume 2 Kapitola 10. Podpora kódoání Unicode pro federoané zdroje dat 119

132 Kapitola 21, Volby sereru pro federoané systémy, na stránce 211 Podporoané kódoé stránky Unicode pro olbu CODEPAGE modulu wrapper MSSQL a ODBC na stránce 120 Podporoané kódoé stránky Unicode pro olbu CODEPAGE modulu wrapper MSSQL a ODBC Platnými hodnotami kódoých stránek jsou ty, které podporuje produkt DB2 Uniersal Database, a ty, které jsou zobrazeny části Tabulka 16. Tabulka 16. Podporoané kódoé stránky Unicode pro olbu CODEPAGE modulu wrapper MSSQL a ODBC Hodnota olby CODEPAGE Popis 1200 Codepage UCS-2 (big-endian) 1202 Codepage UCS-2 (little-endian) 1208 Codepage UTF Codepage UTF-32 (big-endian) 1234 Codepage UTF-32 (little-endian) Souisející úlohy: Zadání kódoé stránky klienta pro podporu formátu Unicode u zdrojů dat Microsoft SQL Serer a ODBC na stránce 119 Souisející odkazy: Supported territory codes and code pages příručce Administration Guide: Planning Zadání kódoé stránky souboru pro podporu formátu Unicode e zdrojích dat typu soubory s tabulkoou strukturou Chcete-li zajistit spránost přeodu kódoé stránky pro zdroje dat typu soubory s tabulkoou strukturou, je třeba zadat kódoou stránku souboru, pokud se tato kódoá stránka liší od kódoé stránky federoané databáze. Omezení: Volbu CODEPAGE můžete použít pouze e federoané databázi Unicode. Postup: Zadejte příkaz CREATE NICKNAME s olbou CODEPAGE nastaenou na hodnotu kódoé stránky dat souboru s tabulkoou strukturou. Platnými hodnotami jsou ty, které podporuje produkt DB2 Uniersal Database. Výchozí hodnota je kódoá stránka federoané databáze produktu DB2 Uniersal Database. Souisející koncepce: Podpora formátu Unicode pro federoané systémy na stránce 117 Souisející odkazy: CREATE NICKNAME statement příručce SQL Reference, Volume 2 Supported territory codes and code pages příručce Administration Guide: Planning 120 Příručka pro federoané systémy

133 Zadání kódoé stránky souboru pro podporu formátu Unicode e zdrojích dat typu soubory s tabulkoou strukturou - příklad na stránce 121 CREATE NICKNAME statement syntax - Table-structured file wrapper příručce IBM DB2 Information Integrator Data Source Configuration Guide Zadání kódoé stránky souboru pro podporu formátu Unicode e zdrojích dat typu soubory s tabulkoou strukturou - příklad Kódoá stránka dat souboru s názem DRUGDATA1.TXT je 943. Chcete-li zadat kódoou stránku souboru s tabulkoou strukturou jako 943, zadejte následující příkaz CREATE NICKNAME: CREATE NICKNAME DRUGDATA1(Dcode Integer NOT NULL, Drug CHAR(20), Manufacutuer CHAR(20)) FOR SERVER biochem_lab OPTIONS(FILE_PATH /usr/pat/drugdata1.txt,codepage 943, COLUMN_DELIMITER., SORTED Y, KEY_COLUMN DCODE, VALIDATE_DATA_FILE Y ); Souisející úlohy: Zadání kódoé stránky souboru pro podporu formátu Unicode e zdrojích dat typu soubory s tabulkoou strukturou na stránce 120 Chyby případě rozdílné elikosti zdáleného a federoaného místa kódu Pokud se liší elikost místa kódu mezi federoanou databází a zdáleným zdrojem dat, mohou být rácena nespráná data nebo může dojít k selhání ložení. Pokud má federoaná databáze ětší elikost místa kódu než zdálený datoý zdroj, může federoaný serer zkrátit data ybraná ze zdáleného zdroje dat. Data jsou zkrácena, pokud je ýsledkem přeodu znakoého řetězce ětší počet bajtů než elikost sloupce přezdíek. Zbýající bajty zůstanou prázdné. Můžete také ložit data, která jsou ětší než elikost sloupce přezdíek. Tento typ ložení je úspěšný, pokud je ýsledkem přeodu menší nebo stejný počet bajtů jako elikost zdáleného sloupce. Pokud má federoaná databáze menší elikost místa kódu než zdálený zdroj dat, může ložení dat selhat. Vložení jsou zkrácena, pokud je ýsledkem přeodu znakoého řetězce ětší počet bajtů než elikost zdáleného sloupce zdroje dat. Oěřte, zda se elikosti místa kódu mezi federoanou databází a zdáleným zdrojem dat neliší takoé míře, aby to způsobilo ýše zmíněné chyby. Kapitola 10. Podpora kódoání Unicode pro federoané zdroje dat 121

134 122 Příručka pro federoané systémy

135 Část 3. Výkon Copyright IBM Corp. 1998,

136 124 Příručka pro federoané systémy

137 Kapitola 11. Ladění ýkonu federoaného systému Problémy s ýkonem mohou mít půod e federoané databázi, e zdroji dat nebo obojím. Úzké místo e federoané databázi nebo e zdrojích dat může ést ke snížení ýkonu. Izoloání problémů zahrnuje yladění federoané databáze a zdrojů dat pro maximální ýkon. Může yžadoat yladění dotazů, aplikací, konfiguračních parametrů a použití sítě, aby došlo k yřešení těchto problémů. Tato kapitola pojednáá o následujících tématech: Publikace o ladění ýkonu federoaných systémů Vyladění zpracoání dotazů Analýza posunu na nižší úroeň na stránce 127 Globální optimalizace na stránce 137 Prky monitoru systému oliňující ýkon na stránce 144 Publikace o ladění ýkonu federoaných systémů Podrobné údaje o ladění ýkonu lze najít následující dokumentaci společnosti IBM: Data Federation with IBM DB2 Information Integrator V8.1 (Federoání dat produktu IBM DB2 Information Integrator erze 8.1) na adrese Using the federated database technology of IBM DB2 Information Integrator (Použití technologie federoané databáze produktu IBM DB2 Information Integrator) na adrese ftp://ftp.software.ibm.com/software/data/pubs/papers/iifed.pdf DB2 Information Integrator XML Wrapper Performance (Výkon modulu wrapper XML produktu DB2 Information Integrator) na adrese ftp://ftp.software.ibm.com/software/data/pubs/papers/db2iixmlwrapper.pdf Vyladění zpracoání dotazů Při získáání dat ze zdrojů dat odesílají klienti (užiatelé a aplikace) dotazy jazyce SQL produktu DB2 do federoané databáze. Kompilátor DB2 SQL poté yhledá informace globálním katalogu a modulu wrapper zdroje dat, aby se usnadnilo zpracoání dotazu. Patří mezi ně informace o připojení ke zdroji dat, atributech sereru, mapoání, indexech a statistice přezdíek. V rámci procesu kompilátoru SQL je dotaz analyzoán optimalizátorem dotazu. Kompilátor ytoří pro zpracoání dotazu alternatiní strategie, nazýané přístupoé plány. Přístupoé plány mohou dotaz yolat tak, že bude: zpracoán zdroji dat, zpracoán federoaným sererem, zpracoán částečně zdroji dat a částečně federoaným sererem. Produkt DB2 UDB yhodnotí přístupoé plány primárně na základě informací o schopnostech zdroje dat a datech. Tyto informace obsahuje modul wrapper a globální katalog. Produkt DB2 UDB rozloží dotaz do segmentů, nazýaných fragmenty dotazu. Obykle je efektinější fragment dotazu posunout na nižší úroeň do zdroje dat, pokud zdroj dat může fragment zpracoat. Optimalizátor dotazu šak zažuje další faktory, například: Copyright IBM Corp. 1998,

138 množstí dat, které je třeba zpracoat, rychlost zpracoání e zdroji dat, množstí dat, které fragment rátí, šířka komunikačního pásma. Analýza posunu na nižší úroeň se proádí pouze relačních zdrojích dat. Nerelační zdroje dat použíají protokol požadaek-odpoěď-kompenzace. Následující obrázek ilustruje kroky proáděné kompilátorem SQL při zpracoání dotazu. Obrázek 6. Graf průběhu analýzy dotazu kompilátoru SQL Optimalizátor dotazu generuje na základě nákladů na prostředky lokální a zdálené přístupoé plány pro zpracoání fragmentu dotazu. Produkt DB2 UDB potom zolí plán, u kterého dojde k záěru, že zpracuje dotaz s nejnižšími náklady na prostředky. Pokud jsou některé fragmenty určeny ke zpracoání e zdrojích dat, odešle je produkt DB2 UDB do zdrojů dat. Po jejich zpracoání e zdrojích dat budou ýsledky načteny a ráceny 126 Příručka pro federoané systémy

139 do produktu DB2 UDB. Pokud produkt DB2 UDB proádí určitou část zpracoání, sloučí lastní ýsledky s ýsledky ze zdroje dat. Produkt DB2 UDB potom rátí šechny ýsledky klientoi. Primární úlohou analýzy posunu na nižší úroeň je určení operací, které lze zdáleně yhodnotit. To se analýze proádí na základě přijatého příkazu SQL a schopností zdáleného zdroje dat. Na základě této analýzy yhodnotí optimalizátor dotazu alternatiy a zolí přístupoý plán ycházející z nákladů. Optimalizátor se může rozhodnout neproádět operaci přímo e zdáleném zdroji dat, protože je méně efektiní z hlediska nákladů. Sekundární úlohou analýzy posunu na nižší úroeň je pokus o transformaci dotazu do podoby, kterou může lépe optimalizoat optimalizátor DB2 i zdálené optimalizátory dotazu. Konečný přístupoý plán ybraný optimalizátorem se může skládat z operací u zdáleného zdroje dat. U těch operací, které budou proedeny určitým zdrojem dat, se zdáleně ygeneruje efektiní příkaz SQL na základě dialektu jazyka SQL e zdroji dat. To usnadňuje ytořit pro dotaz optimální plán pro šechny zdroje dat. Tento proces se nazýá globální optimalizace. U nerelačních zdrojů použíají moduly wrapper protokol požadaek-odpoěď-kompenzace. Souisející koncepce: Analýza posunu na nižší úroeň na stránce 127 Souisející úlohy: Request-reply-compensate protocol příručce IBM DB2 Information Integrator Wrapper Deeloper s Guide Globální optimalizace na stránce 137 Analýza posunu na nižší úroeň Analýza posunu na nižší úroeň se proádí relačních zdrojích dat. Nerelační zdroje použíají protokol požadaek-odpoěď-kompenzace. Analýza posunu na nižší úroeň poskytuje optimalizátoru dotazu informace, zda může zdálený zdroj dat proést operaci. Operací může být funkce, jako je relační operátor, systémoá nebo užiatelská funkce, nebo operátor SQL (GROUP BY, ORDER BY apod.). Funkce, které nelze posunout na nižší úroeň, mohou ýrazně olinit ýkon dotazu. Posuďte, jaký efekt by mělo ynucení yhodnocení ýběroého predikátu lokálně namísto jeho yhodnocení e zdáleném zdroji dat. Tento postup by mohl yžadoat načtení celé tabulky ze zdáleného zdroje dat federoaným sererem a následné filtroání tabulky lokálně pomocí predikátu. Platí-li pro síť omezení a tabulka je přitom elká, mohl by utrpět ýkon dotazu. Operátory, které se neposunou na nižší úroeň, mohou roněž ýrazně olinit ýkon dotazu. Například agregace zdálených dat lokálně pomocí operátoru GROUP BY by opět mohla yžadoat načtení celé tabulky ze zdáleného zdroje dat federoaným sererem. Předpokládejme například, že přezdíka EMP odkazuje na tabulku EMPLOYEE. Tato tabulka obsahuj řádků. Jeden sloupec obsahuje příjmení zaměstnanců a jeden sloupec obsahuje plat každého zaměstnance. Na federoaný serer je odeslán následující dotaz, aby zjistil počet zaměstnanců s příjmením začínajícím písmenem B, kteří mají plat yšší než SELECT LASTNAME, COUNT(*) FROM EMP WHERE LASTNAME LIKE B% AND SALARY > GROUP BY LASTNAME; Kapitola 11. Ladění ýkonu federoaného systému 127

140 Když kompilátor DB2 SQL přijme tento příkaz, záží několik možností: Posloupnosti řazení jsou stejné. Je praděpodobné, že predikát dotazu bude posunut na nižší úroeň do zdroje dat. Je obykle efektinější filtroat a seskupit ýsledky u zdroje dat namísto kopíroání celé tabulky na federoaný serer a proedení těchto operací lokálně. Analýza posunu na nižší úroeň určí, které operace lze u zdroje dat proést. Protože posloupnosti řazení jsou stejné, lze predikát a operaci GROUP BY proést u zdroje dat. Posloupnosti řazení jsou stejné a optimalizátor dotazu í, že federoaný serer je elmi rychlý. Je možné, že optimalizátor dotazu rozhodne, že nejlepší postup (s nejnižšími náklady) je proedení operace GROUP BY lokálně. Predikát bude posunut na nižší úroeň k yhodnocení e zdroji dat. Jedná se o příklad analýzy posunu na nižší úroeň kombinoané s globální optimalizací. Posloupnosti řazení nejsou stejné. Analýza posunu na nižší úroeň určí, že nelze yhodnotit celou klauzuli WHERE e zdroji dat. Optimalizátor dotazu šak může rozhodnout, že je efektinější na nižší úroeň posunout část LIKE predikátu. I potom je třeba e federoané databázi proést poronání rozsahu. Jedná se o další příklad analýzy posunu na nižší úroeň kombinoané s globální optimalizací. Kompilátor SQL posoudí dostupné přístupoé plány a potom zolí nejefektinější plán. Obecně řečeno, cílem je zajistit, aby optimalizátor dotazu zážil posun funkcí a operací na nižší úroeň k yhodnocení e zdrojích dat. To, zda bude funkce nebo operátor SQL yhodnocen e zdáleném zdroji dat, oliňuje mnoho faktorů. Klíčoými faktory oliňujícími optimalizátor dotazu jsou: charakteristika sereru, charakteristika přezdíek a charakteristika dotazů. Souisející koncepce: Charakteristika sereru oliňující možnosti posunutí na nižší úroeň na stránce 128 Charakteristika přezdíek oliňující možnosti posunutí na nižší úroeň na stránce 132 Charakteristika dotazu oliňující možnosti posunutí na nižší úroeň na stránce 133 Souisející úlohy: Request-reply-compensate protocol příručce IBM DB2 Information Integrator Wrapper Deeloper s Guide Podrobné údaje o analýze přesunu zpracoání na nižší úroeň Charakteristika sereru oliňující možnosti posunutí na nižší úroeň Následující sekce obsahují faktory specifické pro zdroje dat, které mohou olinit možnosti posunutí na nižší úroeň. Tyto faktory existují u relačních zdrojů dat, protože k odesílání dotazů použíáte dialekt jazyka SQL pro produkt DB2 a tento dialekt může nabízet íce funkcí než dialekt SQL u daného zdroje dat. Federoaný serer produktu DB2 může kompenzoat chybějící funkci u datoého sereru, ale to by mohlo yžadoat proedení operace na federoaném sereru. Faktory oliňující možnosti posunutí na nižší úroeň u nerelačních zdrojů dat se liší od faktorů oliňujících možnosti posunutí na nižší úroeň u relačních zdrojů dat. U ětšiny nerelačních zdrojů dat není faktorem dialekt SQL, protože nepoužíají jazyk SQL. 128 Příručka pro federoané systémy

141 Rozdíly jazyce SQL Možnosti jazyka SQL. Každý zdroj dat podporuje určitou ariantu dialektu SQL a různé úroně funkčnosti. Vezměme například úahu seznam GROUP BY. Většina zdrojů dat podporuje operátor GROUP BY. U některých zdrojů dat je šak omezen počet položek seznamu GROUP BY nebo to, zda je seznamu GROUP BY poolen ýraz. Existuje-li omezení e zdáleném zdroji dat, je možné, že federoaný serer proede operaci GROUP BY lokálně. Omezení jazyka SQL. Každý zdroj dat může mít odlišná omezení jazyka SQL. Některé zdroje dat například yžadují značky parametrů pro ázání hodnot na zdálené příkazy SQL. Je tedy třeba zkontroloat omezení značek parametrů, aby se zajistilo, že každý zdroj dat bude takoý mechanizmus ázání podporoat. Pokud federoaný serer nemůže určit spránou metodu pro ázání hodnoty k funkci, musí být tato funkce yhodnocena lokálně. Limity jazyka SQL. Federoaný serer může pooloat použití yšších celých čísel než zdálené zdroje dat. Hodnoty přesahující limit nelze ložit do příkazů odesílaných do zdrojů dat. Funkci nebo operátor spuštěné u této konstanty je třeba yhodnotit lokálně. Specifika sereru. Do této kategorie spadá několik faktorů. Jedním příkladem může být řazení hodnot Null (nejyšší, nejnižší nebo záislosti na řazení). Pokud je například hodnota Null řazena e zdroji dat jinak než na federoaném sereru, nelze operace ORDER BY u ýrazu s poolenou hodnotou Null yhodnotit zdáleně. Posloupnost řazení Pokud nastaíte olbu sereru COLLATING_SEQUENCE na hodnotu Y, sdělujete federoané databázi, že posloupnost řazení e zdroji dat odpoídá posloupnosti řazení produktu DB2. Toto nastaení umožňuje optimalizátoru zážit možnost, že zpracoání záislé na pořadí proběhne u zdroje dat, což může zlepšit ýkon. Pokud posloupnost řazení e zdroji dat není stejná jako posloupnost řazení e federoané databázi, můžete obdržet nespráné ýsledky. Pokud například plán použíá spojení sloučením, optimalizátor co nejětší míře posouá operace řazení na nižší úroeň do zdrojů dat. Pokud posloupnost řazení e zdroji dat není stejná, ýsledky spojení nemusejí předstaoat spránou ýslednou sadu. Nastate olbu sereru COLLATING_SEQUENCE na hodnotu N, pokud si nejste jisti, zda posloupnost řazení e zdroji dat data je identická s posloupností řazení produktu DB2. Případně může federoanou databázi nakonfiguroat tak, aby použíala stejnou posloupnost řazení jako zdroj dat. Potom můžete nastait olbu sereru COLLATING_SEQUENCE na hodnotu Y. Díky tomu může optimalizátor zážit možnost posunutí na nižší úroeň u predikátů pro poronání rozsahu znaků. Při určoání, zda zdroj dat a produkt DB2 UDB mají stejné posloupnosti řazení, posuďte následující faktory: Podpora národního jazyka Posloupnost řazení souisí s jazykem podporoaným na sereru. Poronejte informace NLS produktu DB2 u ašeho operačního systému z informacemi NLS e zdroji dat. Charakteristika zdroje dat Některé zdroje dat se ytářejí s posloupností řazení bez rozlišení malých a elkých písmen, což může operacích záislých na pořadí přinášet jiné ýsledky oproti produktu DB2 UDB. Přizpůsobení Některé zdroje dat poskytují íce oleb pro posloupnosti řazení nebo umožňují přizpůsobení posloupností řazení. Pokud dotaz z federoaného sereru yžaduje řazení, bude místo, kde se řazení zpracuje, záiset na několika faktorech. Pokud je posloupnost řazení u federoané databáze stejná jako Kapitola 11. Ladění ýkonu federoaného systému 129

142 130 Příručka pro federoané systémy posloupnost řazení e zdroji dat, může se řazení uskutečnit e zdroji dat. Pokud jsou posloupnosti řazení stejné, může optimalizátor dotazu rozhodnout, který způsob proedení dotazu je nejefektinější - lokální řazení, nebo zdálené řazení. Podobně, pokud dotaz yžaduje poronání znakoých dat, lze toto poronání proést u zdroje dat. Poronání numerických typů lze obecně řečeno proádět kterémkoli umístění i případě, že posloupnost řazení je jiná. Můžete šak obdržet nespráné ýsledky, pokud se mezi federoanou databází a zdrojem dat liší yhodnocení áhy znaků Null. Podobně u příkazů poronání buďte opatrní při odesílání příkazů do zdrojů dat bez rozlišení elkých a malých písmen. Váha přiřazená znakům I a i e zdroji dat bez rozlišení elkých a malých písmen je stejná. Například e zdroji dat bez rozlišení elkých a malých písmen s anglickou kódoou stránkou budou sloa STEWART, SteWArT a stewart poažoána za stejná. Federoaná databáze produktu DB2 podle ýchozího nastaení elká a malá písmena rozlišuje a těmto znakům by přiřadila různou áhu. Pokud se posloupnost řazení federoané databáze a zdroje dat liší, načte federoaný serer data do federoané databáze, aby mohl proést řazení a poronání lokálně. Důodem je, že užiatelé očekáají ýsledky dotazu, které budou zobrazeny podle posloupnosti řazení definoané pro federoaný serer; seřazením dat lokálně zajistí federoaný serer, že je toto očekáání naplněno. Pokud dotaz obsahuje ronítko, je možné tuto část dotazu posunout na nižší úroeň i případě, že se posloupnosti řazení liší (nastaení na hodnotu N ). Například predikát C1 = A lze posunout na nižší úroeň do zdroje dat. Takoé dotazy samozřejmě nelze posunout na nižší úroeň, pokud se posloupnosti řazení e zdroji dat nerozlišují elká a malá písmena. Pokud se e zdroji dat nerozlišují elká a malá písmena, je ýsledek C1= A a C1 = a stejný, což není přijatelné prostředí rozlišujícím elká a malá písmena, jako je produkt DB2 UDB. Administrátoři mohou ytořit federoané databáze s konkrétní posloupnosti řazení, která odpoídá posloupnosti řazení e zdroji dat. Tento postup může urychlit ýkon, pokud šechny zdroje dat použíají stejnou posloupnost řazení nebo pokud je ětšina nebo šechny funkce sloupců směroána na zdroje dat, které použíají stejnou posloupnost řazení. Načtení dat pro lokální řazení a poronání obykle snižuje ýkon. Zažte tedy konfiguraci federoané databáze tak, aby použíala stejné posloupnosti řazení jako zdroje dat. Tímto způsobem se může zýšit ýkon, protože federoaný serer může poolit proedení řazení a poronání u zdrojů dat. Například produktu DB2 for z/os and OS/390 se řazení definoaná klauzulemi ORDER BY implementují podle posloupnosti řazení založené na kódoé stránce EBCDIC. Chcete-li pomocí federoaného sereru načíst data produktu DB2 for z/os and OS/390 seřazená souladu s klauzulemi ORDER BY, doporučuje se nakonfiguroat federoanou databázi tak, aby použíala předdefinoanou posloupnost řazení založenou na kódoé stránce EBCDIC. Pokud se posloupnosti řazení e federoané databázi a e zdroji dat liší a potřebujete zobrazit data seřazená pořadí datoého zdroje, můžete dotaz odeslat průchozí relaci nebo dotaz definoat pohledu zdroje dat. Volby federoaného sereru Dosud uedené faktory oliňující možnosti posunutí na nižší úroeň předstaují charakteristiku databázoých sererů a y je nemůžete změnit. Nastait můžete následující olby sereru, které některých případech mohou olinit ýkon dotazu: COLLATING_SEQUENCE. Pokud zdroj dat obsahuje posloupnost řazení, která se liší od posloupnosti řazení produktu DB2 for Linux, UNIX, and Windows, nelze u zdroje dat yhodnotit žádnou operaci záisející na posloupnosti řazení produktu DB2. Příkladem je

143 proedení funkcí sloupce MAX u znakoého sloupce přezdíek datoém zdroji s odlišnou posloupností řazení. Protože ýsledky se mohou lišit, pokud by byla funkce MAX yhodnocena u zdáleného zdroje dat, proede federoaná databáze operaci agregace a funkci MAX lokálně. VARCHAR_NO_TRAILING_BLANKS. Tato olba je určena pro znakoé řetězce proměnlié délky bez koncoých mezer. Některé zdroje dat, například Oracle, nepoužíají sémantiku poronání doplňujících mezer stejným způsobem jako produkt DB2 for Linux, UNIX, and Windows. Tento rozdíl u doplňujících mezer může způsobit neočekáané ýsledky. Pokud jste si jisti, že žádné sloupce VARCHAR a VARCHAR2 u zdroje dat neobsahují koncoé mezery, zažte nastaení této olby sereru pro zdroj dat. Je třeba zážit šechny objekty, které mohou potenciálně obsahoat přezdíky, četně pohledů. DB2_MAXIMAL_PUSHDOWN. Tato olba určuje primární kritéria, která optimalizátor dotazu použíá při ýběru přístupoého plánu. Optimalizátor dotazu může přístupoý plán zolit na základě nákladů, nebo na základě požadaku užiatele, že co nejětší objem zpracoání by měly proést zdálené zdroje dat. Pokud je olba DB2_MAXIMAL_PUSHDOWN nastaena na hodnotu Y, stane se snížení síťoého proozu pro optimalizátor dotazu rozhodujícím kritériem. Optimalizátor dotazu použije přístupoý plán, který proádí nejnižší počet odeslání do datoých zdrojů. Nastaení této olby sereru na hodnotu Y ynutí, že federoaný serer použije přístupoý plán, který nemusí být plánem s nejnižšími náklady. Použití jiného přístupoého plánu než toho s nejnižšími náklady může snížit ýkon. Pokud tabulka materializoaného dotazu (MQT) e federoaném sereru může zpracoat část dotazu nebo celý dotaz, mohl by být použit přístupoý plán zahrnující tabulku materializoaného dotazu. Použití tabulky materializoaného dotazu namísto posunutí operací na nižší úroeň do zdrojů dat sníží síťoý prooz. Pokud je olba sereru DB2_MAXIMAL_PUSHDOWN nastaena na hodnotu Y, dotaz, jehož ýsledkem bude kartézký součin, nebude posunut na nižší úroeň do zdálených zdrojů dat. Dotazy, jejichž ýsledkem bude kartézký součin, budou zpracoány federoanou databází. Volba sereru DB2_MAXIMAL_PUSHDOWN nemusí být u federoaného sereru nastaena na hodnotu Y, aby se zpracoání posunulo na nižší úroeň do zdálených zdrojů dat. Pokud je tato olba sereru nastaena na hodnotu N (ýchozí), optimalizátor dotazu posune zpracoání na nižší úroeň do zdrojů dat. Ašak primární kritéria, která optimalizátor použíá, pokud je olba nastaena na hodnotu N, jsou náklady, nikoli síťoý prooz. Faktory souisející s mapoáním typů a funkcí Výchozí mapoání datoých typů jsou estaěna do modulů wrapper zdrojů dat. Tato mapoání jsou naržena tak, aby byl poskytnut dostatečný prostor yronáací paměti pro každý datoý typ zdroje dat a aby nedošlo k přetečení yronáací paměti za běhu. Mapoání typu můžete pro specifický zdroj dat přizpůsobit, aby odpoídalo specifickým aplikacím. Pokud například přistupujete ke sloupci e zdroji dat Oracle s datoým typem DATE, bude podle ýchozího nastaení mapoán k datoému typu TIMESTAMP produktu DB2 for Linux, UNIX, and Windows. Lokální datoý typ můžete změnit na datoý typ DATE produktu DB2 for Linux, UNIX, and Windows. Tato změna obchází použití funkce SCALAR pro extrahoání podmnožiny šech dat uložených datoém typu TIMESTAMP. Výchozí mapoání funkcí jsou také estaěna do modulů wrapper zdrojů dat. Federoaná databáze kompenzuje funkce, které nejsou podporoané zdrojem dat. Existují tři případy, kdy dochází ke kompenzaci funkce: Funkce jednoduše neexistuje e zdroji dat. Například některé z funkcí SYSFUN neexistují e zdrojích dat produktu DB2 for z/os and OS/390, a proto yžadují lokální kompenzaci. Funkce existuje u zdroje dat; charakteristika operandu šak porušuje omezení funkce. Příkladem je relační operátor IS NULL. Většina zdrojů dat jej podporuje, u některých šak platí omezení, například poolení pouze jména sloupce na leé straně operátoru IS NULL. Kapitola 11. Ladění ýkonu federoaného systému 131

144 Funkce může případě zdáleného yhodnocení rátit jiný ýsledek. Příkladem je operátor > (ětší než). U zdrojů dat s jinými posloupnostmi řazení může operátor ětší než rátit jiné ýsledky než případě lokálního yhodnocení produktem DB2 for Linux, UNIX, and Windows. Souisející koncepce: Collating Sequences příručce Application Deelopment Guide: Programming Client Applications Mapoání datoých typů e federoaném systému na stránce 43 Vyladění zpracoání dotazů na stránce 125 Analýza posunu na nižší úroeň na stránce 127 Charakteristika přezdíek oliňující možnosti posunutí na nižší úroeň na stránce 132 Charakteristika dotazu oliňující možnosti posunutí na nižší úroeň na stránce 133 Souisející odkazy: Kapitola 21, Volby sereru pro federoané systémy, na stránce 211 Charakteristika přezdíek oliňující možnosti posunutí na nižší úroeň Existuje několik faktorů specifických pro přezdíky, které mohou olinit možnosti posunutí na nižší úroeň. Lokální datoý typ sloupce přezdíek může olinit počet možností posloupnosti spojení yhodnocených optimalizátorem. Přezdíky lze označit olbou sloupce označující, že sloupce neobsahují koncoé mezery. To poskytuje kompilátoru SQL možnost generoat efektinější podobu predikátu pro příkaz SQL odesílaný do zdrojů dat. Lokální datoý typ sloupce přezdíek Zajistěte, aby lokální datoý typ sloupce nezabraňoal yhodnocení predikátu u zdroje dat. Jsou poskytoána ýchozí mapoání datoých typů, aby se zabránilo jakémukoli možnému přetečení. Predikát spojení mezi děma sloupci různé délky by šak nemusel být brán úahu u zdroje dat, jehož spojoací sloupec je kratší, záislosti na tom, jak produkt DB2 UDB áže delší sloupec. Tato situace může olinit počet možností posloupnosti spojení yhodnocených optimalizátorem. Například pro sloupec zdroje dat Oracle ytořený pomocí datoého typu INTEGER nebo INT je zadán typ NUMBER(38). Pro sloupec přezdíek tohoto datoého typu Oracle bude zadán lokální datoý typ FLOAT, protože rozsah celého čísla produktu DB2 je od 2**31 do (-2**31)-1, což se zhruba roná typu NUMBER(9). V takoém případě se spojení mezi sloupcem celých čísel DB2 a sloupcem celých čísel Oracle mohou uskutečnit e zdroji dat DB2 (kratší sloupec spojení). Pokud šak lze doménu tohoto sloupce celých čísel Oracle umístit do datoého typu DB2 INTEGER, změňte jeho lokální datoý typ příkazem ALTER NICKNAME, aby se spojení mohlo uskutečnit u zdroje dat DB2. Volby federoaných sloupců Volby sloupců instruují modul wrapper, aby s daty e sloupci manipuloal jinak než obykle. Kompilátor SQL a optimalizátor dotazu yíjí pomocí metadat lepší plány pro přístup k datům. Produkt DB2 UDB poažuje objekt, na který odkazuje přezdíka, za tabulku. Díky tomu lze olby sloupců nastait pro liboolný objekt zdroje dat, pro který ytoříte přezdíku. K přidání nebo změně oleb sloupce pro přezdíky slouží příkaz ALTER NICKNAME. Existují dě olby sloupců: NUMERIC_STRING. Tato olba sloupce platí pro sloupce znakoého typu (CHAR a VARCHAR). Předpokládejme, že zdroj dat má posloupnost řazení, která se liší od posloupnosti řazení federoané databáze. Federoaný serer by obykle neřadil žádné sloupce obsahující znakoá data u zdroje dat. Vrátil by data do federoané databáze 132 Příručka pro federoané systémy

145 a proedl řazení lokálně. Předpokládejme šak, že sloupec je znakoého datoého typu a obsahuje pouze numerické znaky ( 0, 1,..., 9 ). To můžete označit přiřazením hodnoty Y k olbě sloupce NUMERIC_STRING. To poskytuje optimalizátoru dotazu DB2 možnost proést řazení u zdroje dat. Pokud je řazení proedeno zdáleně, můžete se yhnout zatížení spojenému s přenesením dat na federoaný serer a proedením řazení lokálně. VARCHAR_NO_TRAILING_BLANKS. Na rozdíl od stejnojmenné olby sereru lze tuto olbu sloupce použít k označení konkrétních sloupců Oracle bez koncoých mezer. V kroku analýzy posunutí na nižší úroeň kompilátoru SQL pak budou tyto informace brány úahu pro šechny operace proáděné u sloupců s tímto nastaením. Na základě nastaení olby VARCHAR_NO_TRAILING_BLANKS může kompilátor SQL generoat odlišnou, ašak ekialentní podobu predikátu použitého e zdáleném příkazu SQL odeslaném do zdroje dat. Může se zobrazit jiný predikát yhodnocený u zdroje dat, ale čistý ýsledek by měl být ekialentní. Tabulky materializoaného dotazu Tabulka materializoaného dotazu je souhrnná tabulka ytořená z ýsledné sady dotazu. Dotaz použitý k ytoření tabulky materializoaného dotazu použíá plný ýběr s klauzulí GROUP BY pro sumarizaci dat z tabulek, na které dotaz odkazuje. Na rozdíl od pohledu ukládá tabulka materializoaného dotazu skutečná data z ýsledné sady tabulce. Ve federoaném systému můžete ytořit tabulku materializoaného dotazu, která odkazuje na jednu nebo íce přezdíek nebo na kombinaci přezdíek a lokálních tabulek. Tabulka materializoaného dotazu definoaná dotazem, který odkazuje na přezdíku, je lokální tabulka na federoaném sereru. Tabulka materializoaného dotazu obsahuje kopii dat uložených e zdálených zdrojích dat, která byla rácena e ýsledné sadě dotazu. Užiatelé federoaného systému si nemusí být existence tabulky materializoaného dotazu ědomi. Pokud je dotaz odeslán na federoaný serer, který odkazuje na přezdíky, na kterých je tabulka materializoaného dotazu založena, optimalizátor dotazu může transparentně použít tabulku materializoaného dotazu namísto přístupu ke zdálenému zdroji dat. Přístup k lokálním datům namísto zdálených dat může zýšit ýkon. Tabulky materializoaného dotazu lze ytořit pouze pomocí olby REFRESH DEFERRED. Souisející koncepce: Tabulky mezipaměti na stránce 167 Vyladění zpracoání dotazů na stránce 125 Analýza posunu na nižší úroeň na stránce 127 Charakteristika sereru oliňující možnosti posunutí na nižší úroeň na stránce 128 Charakteristika dotazu oliňující možnosti posunutí na nižší úroeň na stránce 133 Souisející úlohy: Změna přezdíky na stránce 31 Souisející odkazy: Kapitola 24, Volby sloupců přezdíek pro federoané systémy, na stránce 235 Charakteristika dotazu oliňující možnosti posunutí na nižší úroeň Dotaz může odkazoat na operátor SQL zahrnující přezdíky z několika zdrojů dat. Pokud federoaný serer kombinuje ýsledky ze dou odkazoaných zdrojů dat pomocí jednoho Kapitola 11. Ladění ýkonu federoaného systému 133

146 operátoru, musí se operace uskutečnit na federoaném sereru. Příkladem je množinoý operátor, jako je UNION. Operátor nelze yhodnotit přímo e zdáleném zdroji dat. Souisející koncepce: Charakteristika sereru oliňující možnosti posunutí na nižší úroeň na stránce 128 Charakteristika přezdíek oliňující možnosti posunutí na nižší úroeň na stránce 132 Rozhodnutí analýzy přesunu zpracoání na nižší úroeň Přepsání příkazů SQL může poskytoat další možnosti přesunu zpracoání na nižší úroeň při zpracoání dotazů na federoaném sereru. Následující části uádějí několik nástrojů, které ám pomohou určit, zda je dotaz yhodnocený pro přesunu zpracoání na nižší úroeň, a které uádějí seznam obyklých otázek (a doporučených oblastí k prozkoumání) spojených s analýzami dotazů a pojednáají o problémech spojených s přechodem na yšší erzi u zdrojů dat. Analýza, kde má být dotaz yhodnocen Podrobné informace optimalizátoru dotazu se ukládají do tabulek Explain, odděleně od skutečného přístupoého plánu. Tyto informace umožňují důkladnou analýzu přístupoého plánu. Tabulky Explain jsou přístupné e šech podporoaných operačních systémech a obsahují informace o statických a dynamických příkazech SQL. K tabulkám Explain můžete přistupoat pomocí příkazů SQL. To umožňuje snadnou manipulaci s ýstupem pro poronání různých dotazů nebo poronání stejného dotazu průběhu času. Postup: Existují da způsoby získání globálních informací přístupoého plánu z tabulek Explain. Nástroj pro formátoání tabulky Explain. Pomocí nástroje db2exfmt lze informace z tabulek Explain prezentoat předdefinoaném formátu. Nástroje db2expln a dynexpln slouží k usnadnění porozumění přístupoému plánu zolenému pro konkrétní příkaz SQL. K pochopení přístupoého plánu zolenému pro konkrétní příkaz SQL můžete roněž použít integroaný prostředek Explain Řídicím centru DB2 kombinaci s modulem Vizuální ysětlení. Pomocí prostředku Explain lze ysětlit dynamické i statické příkazy SQL. Jedním rozdílem oproti nástrojům Explain je, že pomocí modulu Vizuální ysětlení jsou informace ysětlení prezentoány grafickém formátu. Úroeň podrobností poskytoaná těmito děma metodami je jinak shodná. Chcete-li plně yužít nástroje db2expln a dynexpln, je třeba se seznámit s: různými podporoanými příkazy SQL a terminologií souisející s těmito příkazy (například predikáty příkazu SELECT), účelem balíku (přístupoého plánu), účelem a obsahem tabulek systémoého katalogu, obecnými koncepcemi ladění aplikací. Zažte použití nástrojů Explain s olbou sereru DB2_MAXIMAL_PUSHDOWN. Spusťte nástroje Explain u dotazu s olbou sereru DB2_MAXIMAL_PUSHDOWN nastaenou na hodnotu N. Toto je ýchozí nastaení této olby. Analýzy posunutí na nižší úroeň určuje, které části příkazu SQL lze posunout na nižší úroeň. Potom optimalizátor dotazu ygeneruje šechny alternatiní plány, které neporušují kritéria nastaená pro analýzu posunutí na nižší úroeň. Optimalizátor dotazu odhadne náklady každého plánu a ybere plán s nejnižšími odhadoanými náklady. Potom nastate olbu sereru DB2_MAXIMAL_PUSHDOWN na hodnotu Y. Použijte nástroje Explain u stejného příkazu SQL. Plán zobrazený e ýstupu Explain zobrazuje šechny operace SQL, které lze posunout na nižší úroeň do zdroje dat. 134 Příručka pro federoané systémy

147 Pokud idíte rozdíl mezi oběma plány, jedná se o ýsledek yplýající z informací použitých pro optimalizaci nákladů. Tyto informace zahrnují informace o indexech přezdíek, statistiku přezdíek a atributy sereru. Souisející koncepce: Explain tools příručce Administration Guide: Performance SQL explain tools příručce Administration Guide: Performance dynexpln příručce Administration Guide: Performance Description of db2expln and dynexpln output příručce Administration Guide: Performance Vyladění zpracoání dotazů na stránce 125 Analýza posunu na nižší úroeň na stránce 127 Porozumění rozhodnutím při yhodnocení přístupoých plánů na stránce 135 Přechody na yšší erzi a přizpůsobení u zdrojů dat na stránce 137 Souisející úlohy: Globální optimalizace na stránce 137 Souisející odkazy: db2exfmt - Explain Table Format Command příručce Command Reference db2expln - SQL Explain Command příručce Command Reference Porozumění rozhodnutím při yhodnocení přístupoých plánů Tato sekce uádí typické otázky týkající se analýzy přístupoého plánu a oblasti, které můžete dále prozkoumat pro rozšíření možností posunutí na nižší úroeň. Proč se tento predikát neyhodnocuje zdáleně? Tato otázka ystáá, pokud je predikát elmi ýběroý, a proto by mohl být použit k filtroání řádků a snížení síťoého proozu. Vzdálené yhodnocení predikátů roněž oliňuje to, zda lze zdáleně yhodnotit spojení mezi děma tabulkami stejného zdroje dat. Lze prozkoumat tyto oblasti: Predikáty poddotazů. Obsahuje tento predikát poddotaz, který patří k jinému zdroji dat? Obsahuje tento predikát poddotaz zahrnující operátor SQL, který není podporoán tímto zdrojem dat? Ne šechny zdroje dat podporují predikátu množinoé operátory. Funkce predikátu. Obsahuje tento predikát funkci, kterou nemůže yhodnotit tento zdálený zdroj dat? Relační operátory jsou klasifikoány jako funkce. Požadaky na azby predikátů. Vyžaduje tento predikát případě zdáleného yhodnocení ázání některé hodnoty? Pokud ano, narušilo by to omezení SQL u tohoto zdroje dat? Globální optimalizace. Optimalizátor rozhodl, že lokální zpracoání je efektinější z hlediska nákladů. Proč se operátor GROUP BY neyhodnocuje zdáleně? Existuje několik oblastí, které můžete zkontroloat: Vyhodnocuje se zdáleně stup pro operátor GROUP BY? Je-li odpoěď ne, prozkoumejte stup. Platí e zdroji dat jakákoli omezení pro tento operátor? Příklady: omezený počet položek operátoru GROUP BY, omezené počty bajtů kombinoaných položek operátoru GROUP BY, Kapitola 11. Ladění ýkonu federoaného systému 135

148 pouze specifikace sloupce seznamu operátoru GROUP BY. Podporuje zdroj dat tento operátor SQL? Globální optimalizace. Optimalizátor rozhodl, že lokální zpracoání je efektinější z hlediska nákladů. Proč se množinoý operátor neyhodnocuje zdáleně? Existuje několik oblastí, které můžete zkontroloat: Vyhodnocují se oba jeho operandy zcela u stejného zdáleného zdroje dat? Zní-li odpoěď ne a měla by znít ano, prozkoumejte každý operand. Platí e zdroji dat jakákoli omezení pro tento množinoý operátor? Jsou například objekty typu LOB nebo pole typu LOB platným stupem pro tento konkrétní množinoý operátor? Proč se operace ORDER BY neyhodnocuje zdáleně? K uážení: Vyhodnocuje se zdáleně stup pro operaci ORDER BY? Je-li odpoěď ne, prozkoumejte stup. Obsahuje klauzule ORDER BY znakoý ýraz? Pokud ano, má zdálený zdroj dat jinou posloupnost řazení, než je posloupnost řazení na federoaném sereru? Platí e zdroji dat jakákoli omezení pro tento operátor? Je například počet položek operátoru ORDER BY omezen? Omezuje zdroj dat specifikaci sloupce na seznam operátoru ORDER BY? Proč se zdálený příkaz INSERT s plným ýběrem neyhodnocuje zcela zdáleně? K uážení: Může být podýběr zcela yhodnocen u zdáleného zdroje dat? Pokud ne, prozkoumejte podýběr. Obsahuje podýběr množinoý operátor? Pokud ano, podporuje tento zdroj dat množinoé operátory pro příkaz INSERT? Odkazuje podýběr na cíloou tabulku? Pokud ano, pooluje tento zdroj dat tuto syntaxi? Proč se zdálený příkaz INSERT s klauzulí VALUES neyhodnocuje zcela zdáleně? K uážení: Může se klauzule VALUES zcela yhodnotit e zdáleném zdroji dat? Jinými sloy, obsahuje ýraz funkci nepodporoanou e zdáleném zdroji dat? Zahrnuje ýraz skalární poddotaz? Je tato syntaxe podporoána? Odkazuje ýraz na cíloou tabulku? Je tato syntaxe podporoána? Proč se zdálený, yhledaný příkaz UPDATE neyhodnocuje zcela zdáleně? K uážení: Může se klauzule SET zcela yhodnotit e zdáleném zdroji dat? Jinými sloy, obsahuje ýraz pro aktualizaci funkci nepodporoanou e zdáleném zdroji dat? Zahrnuje klauzule SET skalární poddotaz? Pooluje zdroj dat tuto syntaxi? Může se podmínka pro yhledáání zcela yhodnotit e zdáleném zdroji dat? Je-li odpoěď ne, prozkoumejte místo toho podmínku pro yhledáání. Odkazuje podmínka pro yhledáání nebo klauzule SET na cíloou tabulku? Pooluje zdroj dat tuto syntaxi? Odkazuje podmínka pro yhledáání nebo klauzule SET na cíloou tabulku s korelací? Pooluje zdroj dat tuto syntaxi? 136 Příručka pro federoané systémy

149 Proč se umístěný příkaz UPDATE neyhodnocuje zcela zdáleně? K tomu dochází, pokud se produkt DB2 UDB rozhodne yhodnotit ýraz pro aktualizaci lokálně před odesláním příkazu UPDATE do zdroje dat. Tento postup by neměl ýrazně olinit ýkon. Může se klauzule SET zcela yhodnotit e zdáleném zdroji dat? Jinými sloy, obsahuje ýraz pro aktualizaci funkci nepodporoanou e zdáleném zdroji dat? Zahrnuje klauzule SET skalární poddotaz? Pooluje zdroj dat tuto syntaxi? Proč se zdálený, yhledaný příkaz DELETE neyhodnocuje zcela zdáleně? K uážení: Může se podmínka pro yhledáání zcela yhodnotit e zdáleném zdroji dat? Je-li odpoěď ne, prozkoumejte místo toho podmínku pro yhledáání. Odkazuje podmínka pro yhledáání na cíloou tabulku? Pooluje zdroj dat tuto syntaxi? Odkazuje podmínka pro yhledáání na cíloou tabulku s korelací? Pooluje zdroj dat tuto syntaxi? Souisející koncepce: Analýza posunu na nižší úroeň na stránce 127 Analýza, kde má být dotaz yhodnocen na stránce 134 Přechody na yšší erzi a přizpůsobení u zdrojů dat Kompilátor DB2 ychází z informací uložených globálním katalogu a dodáá jim možnosti jazyka SQL pro zdroje dat. Tyto informace je třeba periodicky aktualizoat. Možnosti jazyka SQL pro zdroje dat se mohou noých erzích zdrojů dat změnit. Pokud jsou zdroje dat přeedeny na yšší erzi nebo přizpůsobeny, aktualizujte informace globálního katalogu, aby kompilátor SQL použíal nejaktuálnější informace. K aktualizaci katalogu použijte příkazy DB2 SQL DDL, například CREATE FUNCTION MAPPING a ALTER SERVER. Souisející koncepce: Vyladění zpracoání dotazů na stránce 125 Analýza posunu na nižší úroeň na stránce 127 Souisející úlohy: Globální optimalizace Globální optimalizace na stránce 137 Kompilátor SQL zahrnuje dě fáze, které usnadňují ytoření optimální strategie přístupu pro yhodnocení dotazu odkazujícího na zdálený zdroj dat. Tyto fáze jsou zdálené generoání příkazu SQL a globální optimalizace. U dotazu odeslaného do federoané databáze může strategie přístupu zahrnoat rozložení půodního dotazu do sady fragmentů dotazu a následné sloučení ýsledků. S yužitím ýstupu fáze analýzy posunutí na nižší úroeň jako doporučení rozhodne optimalizátor dotazu, kde budou jednotlié operace yhodnoceny. Operace může být yhodnocena lokálně na federoaném sereru DB2 nebo zdáleně e zdroji dat. Rozhodnutí je založeno na ýstupu sofistikoaného modelu pených nákladů použíaného optimalizátorem. Tento model určuje: Kapitola 11. Ladění ýkonu federoaného systému 137

150 náklady na yhodnocení operace, náklady na přenos dat nebo zprá mezi federoaným sererem DB2 a zdroji dat. Cílem je ytořit optimalizoaný dotaz. Optimalizoaný dotaz je dotaz s přístupoým plánem, který optimalizuje operace dotazu u šech zdrojů dat, a to globálně celém federoaném systému. Globální optimalizace je dosažena ýběrem přístupoého plánu s nejnižšími náklady. Kompilátor DB2 SQL zahrnuje bázi znalostí optimalizátoru, která obsahuje data o natiních zdrojích dat. Optimalizátor negeneruje zdálené přístupoé plány, které nemohou generoat specifické systémy DBMS. Jinými sloy se optimalizátor yhýbá generoání plánů, kterým optimalizátory u zdálených zdrojů dat nemohou porozumět, ani je přijmout. Výstup z globální optimalizace oliňuje mnoho faktorů, které tak oliňují i ýkon dotazu. Klíčoými faktory jsou charakteristika sereru a charakteristika přezdíky. Relační a nerelační moduly wrapper se liší detailech způsobu ytoření přístupoého plánu, ale koncepce a konečný efekt jsou stejné. Souisející koncepce: Vyladění zpracoání dotazů na stránce 125 Analýza posunu na nižší úroeň na stránce 127 Charakteristika sereru oliňující globální optimalizaci na stránce 138 Souisející úlohy: Charakteristika přezdíek oliňující globální optimalizaci na stránce 140 Globální optimalizace - podrobné údaje Charakteristiky sereru a přezdíek oliňují globální optimalizaci, zatímco charakteristiky přezdíek mají ětší dopad na odhady nákladů ygeneroané optimalizátorem dotazů. Charakteristika sereru oliňující globální optimalizaci Do optimalizátoru dotazu poskytujete informace o charakteristice sereru zdroje dat pomocí nastaení oleb sereru. Nastaení oleb sereru jsou součástí definice sereru zdroje dat. Volby sereru lze nastait příkazu CREATE SERVER, pokud nejpre nastaíte definici sereru. Příkaz ALTER SERVER slouží k přidání oleb sereru k existující definici sereru. Nastaení oleb sereru se ukládají do globálního katalogu federoané databáze. Tyto olby se rozdělují na olby umístění (například jméno počítače zdroje dat), olby zabezpečení (například informace o oěření) a olby ýkonu (například poměr procesoru). Volby ýkonu usnadňují optimalizátoru určení, zda lze operace yhodnocení proést u zdrojů dat. Volbami sereru oliňujícími ýkon, které yžadují yladění, jsou: CPU_RATIO IO_RATIO COMM_RATE COLLATING_SEQUENCE PLAN_HINTS 138 Příručka pro federoané systémy

151 Při ladění oleb sereru CPU_RATIO, IO_RATIO nebo COMM_RATE postupujte opatrně, protože se mohou yskytnout neočekáané ýsledky, pokud ýpočet nákladů pro dotaz způsobuje přetečení nebo podtečení. Relatiní poměr rychlosti procesoru Tato hodnota označuje, kolikrát yšší či nižší je rychlost procesoru zdroje dat poronání s procesorem produktu DB2. Nízký poměr označuje, že procesor praconí stanice zdroje dat je rychlejší než procesor praconí stanice DB2. U nízkých poměrů záží optimalizátor posunutí operací s ysokým nárokem na procesor na nižší úroeň do zdroje dat. Nízký poměr je hodnota nižší než 1. Nastaení olby sereru CPU_RATIO na hodnotu 1 znamená, že federoaný procesor produktu DB2 a procesor zdroje dat mají stejnou rychlost (poměr 1:1). Pokud je rychlost federoaného procesoru produktu DB2 o 50 % nižší než rychlost procesoru zdroje dat, měla by být pro olbu sereru CPU_RATIO nastaena hodnota 0,5. Pokud je rychlost federoaného procesoru produktu DB2 dakrát yšší než rychlost procesoru zdroje dat, měla by být pro olbu sereru CPU_RATIO nastaena hodnota 2. Relatiní poměr rychlosti stup/ýstup Tato hodnota označuje, kolikrát yšší nebo nižší je rychlost stup/ýstup zdroje dat poronání s rychlostí stup/ýstup u federoaného sereru. Nízký poměr označuje, že rychlost stup/ýstup praconí stanice zdroje dat je yšší než rychlost stup/ýstup praconí stanice DB2. U nízkých poměrů záží optimalizátor posunutí operací s ysokým nárokem na stup-ýstup na nižší úroeň do zdroje dat. Nízký poměr je hodnota nižší než 1. Nastaení olby sereru IO_RATIO na hodnotu 1 znamená, že federoaná rychlost stup/ýstup produktu DB2 a rychlost stup/ýstup zdroje dat jsou stejné (poměr 1:1). Pokud je federoaná rychlost stup/ýstup produktu DB2 o 50 % nižší než rychlost stup/ýstup zdroje dat, měla by být pro olbu sereru IO_RATIO nastaena hodnota 0,5. Pokud je federoaná rychlost stup/ýstup produktu DB2 dakrát yšší než rychlost stup/ýstup zdroje dat, měla by být pro olbu sereru IO_RATIO nastaena hodnota 2. Komunikační rychlost mezi federoaným sererem a zdrojem dat Nízká komunikační rychlost znamená pomalou síťoou komunikaci mezi federoaným sererem a zdrojem dat. Nižší komunikační rychlosti ybízejí optimalizátor dotazu ke snížení počtu zprá odesílaných na tento zdroj dat nebo z něj. Pokud je olba sereru COMM_RATE nastaena na elmi nízkou hodnotu, ytoří optimalizátor dotaz yžadující minimální síťoý prooz. Posloupnost řazení e zdroji dat Váš ýběr posloupnosti řazení může olinit ýkon federoané databáze. Volba sereru COLLATING_SEQUENCE slouží k označení, zda posloupnost řazení u zdroje dat odpoídá lokální posloupnosti řazení federoané databáze DB2. Produkt DB2 UDB může posunout zpracoání záislé na pořadí zahrnující znakoá data na nižší úroeň do zdroje dat. Pokud posloupnost řazení u zdroje dat neodpoídá posloupnosti řazení u federoané databáze, poažuje optimalizátor data načtená z tohoto zdroje dat za neseřazená. Produkt DB2 UDB načte releantní data a proede eškeré zpracoání záislé na pořadí u znakoých dat lokálně (což může zpomalit ýkon). Posloupnost řazení je probírána tématu Charakteristika sereru oliňující možnosti posunutí na nižší úroeň. Pokyny ke zdálenému plánu Volba sereru PLAN_HINTS slouží ke generoání pokynů ke zdáleného plánu. Pokyny k plánu jsou fragmenty příkazu, které poskytují další informace pro optimalizátory zdroje dat. Tyto informace mohou u některých typů dotazů zýšit ýkon. Pokyny k plánu usnadňují optimalizátoru zdroje dat rozhodnutí, zda použít index, který index použít nebo kterou posloupnost spojení tabulek použít. Kapitola 11. Ladění ýkonu federoaného systému 139

152 Měli byste proést testy a určit tak, zda tato olba sereru zdokonalí ýkon dotazů. Do dotazu nelze kódoat lastní pokyny k plánu. Jsou-li pokyny k plánu pooleny, obsahuje dotaz odeslaný do zdroje dat další informace. Například příkaz odeslaný do optimalizátoru Oracle s pokyny k plánu může ypadat takto: SELECT /*+ INDEX (table1, tlindex)*/ col1 FROM table1 Pokyn k plánu je řetězec /*+ INDEX (table1, t1index)*/ Souisející koncepce: Vyladění zpracoání dotazů na stránce 125 Charakteristika sereru oliňující možnosti posunutí na nižší úroeň na stránce 128 Souisející úlohy: Změna definicí sereru a oleb sereru na stránce 26 Globální optimalizace na stránce 137 Charakteristika přezdíek oliňující globální optimalizaci na stránce 140 Souisející odkazy: Kapitola 21, Volby sereru pro federoané systémy, na stránce 211 Charakteristika přezdíek oliňující globální optimalizaci Existuje několik faktorů specifických pro přezdíky, které mohou olinit globální optimalizaci, mezi které patří informace indexu a statistika globálního katalogu. Je důležité, aby informace indexů a statistické údaje globálního katalogu, které jsou dostupné pro kompilátor SQL, byly aktuální. Specifikace indexů Kompilátor SQL použíá informace indexu pro optimalizaci dotazů. Informace indexu pro tabulku zdroje dat budou získány, pouze pokud je pro tuto tabulku ytořena přezdíka. Po ytoření přezdíky se informace indexu pro danou tabulku zdroje dat neaktualizují na federoaném sereru. Pokud se změní informace zdáleného indexu můžete aktualizoat informace indexu uložené na federoaném sereru zrušením přezdíky pro tabulku a jejím opakoaným ytořením. Případně, pokud je k tabulce zdroje dat přidáán noý index, můžete na federoaném sereru pro tuto tabulku definoat specifikaci indexu. Informace indexu se neshromažďují pro objekty, které nemají indexy, jako jsou pohledy, synonyma nebo nerelační objekty zdroje dat. Pokud objekt s přezdíkou nemá index, můžete pro něj ytořit specifikaci indexu. Specifikace indexu ytářejí definici indexu globálním katalogu. Specifikace indexu není skutečný index. Specifikaci indexu ytoříte příkazem CREATE INDEX s klauzulí SPECIFICATION ONLY. Syntaxe pro ytoření indexu u přezdíky se podobá syntaxi pro ytoření indexu lokální tabulce. Vytoření specifikací indexů zažte těchto případech: Tabulka získáá noý index. Vytáříte přezdíku pro objekt zdroje dat, který neobsahuje indexy, například pohled nebo synonymum. 140 Příručka pro federoané systémy

153 Před zadáním příkazů CREATE INDEX...SPECIFICATION ONLY u přezdíky pro pohled zdroje dat zažte sé potřeby: Pokud zdálený pohled předstauje jednoduchý příkaz SELECT u tabulky zdroje dat s indexem, může ytoření specifikace indexu u přezdíky, která odpoídá indexu u tabulky zdroje dat, ýrazně zýšit ýkon dotazu. Pokud je specifikace indexu ytořena pro zdálený pohled, který nepředstauje jednoduché příkazy SELECT (například pohled ytořený spojením dou tabulek), může ýkon dotazu utrpět. Předpokládejme, že je ytořena specifikace indexu pro zdálený pohled, který je spojením dou tabulek. Optimalizátor může zolit tento pohled jako nitřní prek e spojení s nořeným cyklem. Dotaz by mohl mít horší ýkon, protože spojení bude yhodnoceno několikrát. Alternatiou je ytoření přezdíek pro každou z tabulek odkazoaných pohledu zdroje dat a ytoření federoaného pohledu, který odkazuje na obě přezdíky. Statistika globálního katalogu Federoaná databáze ychází ze statistiky katalogu pro objekty s přezdíkou při optimalizaci zpracoání dotazů. Tato statistika se načítá ze zdroje dat, pokud pro objekt zdroje dat ytoříte pomocí příkazu CREATE NICKNAME přezdíku. Federoaná databáze oěří přítomnost objektu e zdroji dat a pokusí se shromáždit statistická data o existujícím zdroji dat. Z katalogů zdroje dat se načtou informace užitečné pro optimalizátor a uloží se do globálního katalogu na federoaném sereru. Protože některé nebo šechny informace katalogu zdroje dat mohou být yužity optimalizátorem, doporučuje se před ytořením přezdíky aktualizoat u zdroje dat statistiku (pomocí příkazu zdroje dat odpoídajícího příkazu RUNSTATS). Statistika katalogu popisuje celkoou elikost tabulek a pohledů a rozsah hodnot asocioaných sloupcích. Načtené informace zahrnují: Počet řádků objektu přezdíek Počet stránek obsazených přezdíkou Počet odlišených hodnot každém sloupci tabulky Počet odlišených hodnot e sloupcích indexu Nejyšší/nejnižší hodnota sloupce Federoaná databáze může načíst statistická data obsažená e zdroji dat, nemůže šak automaticky detekoat aktualizace e zdrojích dat oproti existujícím statistickým datům. Kromě toho federoaná databáze nemá žádný mechanizmus pro manipulaci s definicí objektu nebo strukturálními změnami u objektů e zdrojích dat (například když je do tabulky přidán sloupec). Pokud se změní statistická data nebo strukturální charakteristika pro zdálený objekt, u kterého je definoána přezdíka, máte tři možnosti aktualizace statistiky: Použijte prostředek pro aktualizaci statistiky přezdíek Řídicím centru DB2. Spusťte ekialent příkazu RUNSTATS e zdroji dat. Potom zrušte aktuální přezdíku a ytořte ji znou. To je doporučený postup aktualizace statistiky. Ručně aktualizujte statistiku pohledu katalogu SYSSTAT.TABLES. Tuto metodu použijte, pouze pokud íte, že statistické informace u zdáleného zdroje dat jsou nespráné nebo neúplné. Aktualizace změn řádků: Pokud byl u zdroje dat přidán nebo změněn elký počet řádků, nebude o nich federoaná databáze ědět. Můžete si šak šimnout pomalejšího ýkonu, protože optimalizátor proádí Kapitola 11. Ladění ýkonu federoaného systému 141

154 rozhodnutí na základě informací přezdíek, které již nejsou přesné. Aktualizujte statistiku přezdíky, aby měl optimalizátor přesnou statistiku při ytáření přístupoých plánů pro zpracoání dotazů u zdroje dat. Aktualizace změn sloupců: Pokud jsou u zdroje dat přidány, odstraněny nebo změněny sloupce, můžete si šimnout nespráných ýsledků nebo obdržet chyboou zpráu. Předpokládejme, že máme přezdíku EUROSALES, která odkazuje na tabulku europe databázi Sybase. Je-li do tabulky přidán noý sloupec s názem CZECH, nebude federoaná databáze o sloupci CZECH ědět. Dotazy, které odkazují na tento sloupec, způsobí chyboou zpráu. Dojde-li ke změnám sloupců objektu zdroje dat, je třeba pro aktualizaci statistiky pro tento objekt katalogu federoané databáze proést několik kroků: 1. Spusťte u zdroje dat obslužný program odpoídajícího příkazu RUNSTATS produktu DB2. Tím aktualizujete statistiku uloženou katalogu zdroje dat. 2. Zrušte aktuální přezdíku pro objekt zdroje dat pomocí příkazu DROP NICKNAME. 3. Znou ytořte přezdíku pomocí příkazu CREATE NICKNAME. Přezdíka bude mít nyní obsahoat aktualizoané statistické informace konzistentní se schématem objektu zdroje dat. Souisející koncepce: Prostředek pro aktualizaci statistiky přezdíek - přehled na stránce 179 Charakteristika přezdíek oliňující možnosti posunutí na nižší úroeň na stránce 132 Charakteristika sereru oliňující globální optimalizaci na stránce 138 Souisející úlohy: Zrušení přezdíky na stránce 41 Vytoření specifikací indexu pro objekty zdroje dat na stránce 68 Rozhodnutí oblasti globální optimalizace Následující části předstaují několik nástrojů, které lze použít k analýze optimalizace dotazů, a uádějí obyklé otázky (a doporučené oblasti k prozkoumání) spojené s optimalizací dotazů. Analýza globální optimalizace Podrobné informace optimalizátoru dotazu se ukládají do tabulek Explain, odděleně od skutečného přístupoého plánu. Tyto informace umožňují důkladnou analýzu přístupoého plánu. Tabulky Explain jsou přístupné e šech podporoaných operačních systémech a obsahují informace o statických a dynamických příkazech SQL. K tabulkám Explain můžete přistupoat pomocí příkazů SQL. To umožňuje snadnou manipulaci s ýstupem pro poronání různých dotazů nebo poronání stejného dotazu průběhu času. Postup: Existují da způsoby získání globálních informací přístupoého plánu z tabulek Explain. Nástroj pro formátoání tabulky Explain. Pomocí nástroje db2exfmt lze informace z tabulek Explain prezentoat předdefinoaném formátu. Nástroje db2expln a dynexpln slouží k usnadnění porozumění přístupoému plánu zolenému pro konkrétní příkaz SQL. K pochopení přístupoého plánu zolenému pro 142 Příručka pro federoané systémy

155 konkrétní příkaz SQL můžete roněž použít integroaný prostředek Explain Řídicím centru DB2 kombinaci s modulem Vizuální ysětlení. Pomocí prostředku Explain lze ysětlit dynamické i statické příkazy SQL. Jedním rozdílem oproti nástrojům Explain je, že pomocí modulu Vizuální ysětlení jsou informace ysětlení prezentoány grafickém formátu. Úroeň podrobností poskytoaná těmito děma metodami je jinak shodná. Chcete-li plně yužít nástroje db2expln a dynexpln, je třeba se seznámit s: různými podporoanými příkazy SQL a terminologií souisející s těmito příkazy (například predikáty příkazu SELECT), účelem balíku (přístupoého plánu), účelem a obsahem tabulek systémoého katalogu, obecnými koncepcemi ladění aplikací. Souisející koncepce: Explain tools příručce Administration Guide: Performance SQL explain tools příručce Administration Guide: Performance dynexpln příručce Administration Guide: Performance Description of db2expln and dynexpln output příručce Administration Guide: Performance Vyladění zpracoání dotazů na stránce 125 Porozumění rozhodnutím optimalizace přístupoého plánu na stránce 143 Souisející úlohy: Globální optimalizace na stránce 137 Souisející odkazy: db2exfmt - Explain Table Format Command příručce Command Reference db2expln - SQL Explain Command příručce Command Reference Porozumění rozhodnutím optimalizace přístupoého plánu Tato sekce uádí typické otázky týkající se optimalizace a oblasti, které můžete dále prozkoumat s cílem zýšit ýkon. Proč se spojení mezi děma přezdíkami stejného zdroje dat neyhodnocujete zdáleně? Lze prozkoumat tyto oblasti: Operace spojení. Může je zdroj dat podporoat? Predikáty spojení. Může se predikát spojení yhodnotit e zdáleném zdroji dat? Je-li odpoěď ne, prozkoumejte predikát spojení. Počet řádků e ýsledku spojení. Počet řádků můžete určit pomocí modulu Vizuální ysětlení. Vrací spojení mnohem ětší počet řádků než dané dě přezdíky dohromady? Dáají čísla smysl? Je-li odpoěď ne, zažte aktualizaci statistiky přezdíky pomocí obslužného programu RUNSTATS. Proč se operátor GROUP BY neyhodnocuje zdáleně? Lze prozkoumat tyto oblasti: Syntaxe operátora. Oěřte, zda lze operátor yhodnotit e zdáleném zdroji dat. Počet řádků. Zkontrolujte odhadoaný počet řádků e stupu a ýstupu operátoru GROUP BY pomocí modulu Vizuální ysětlení. Jsou tato dě čísla elmi blízká? Je-li odpoěď ano, bude optimalizátor poažoat za efektinější yhodnotit tento operátor GROUP BY Kapitola 11. Ladění ýkonu federoaného systému 143

156 lokálně. Dáají tato dě čísla smysl? Je-li odpoěď ne, zažte aktualizaci statistiky přezdíky pomocí obslužného programu RUNSTATS. Proč se příkaz neyhodnocuje zcela zdáleně? Optimalizátor proádí optimalizaci na základě nákladů. I případě, že analýza posunutí na nižší úroeň indikuje, že lze každý operátor yhodnotit u zdáleného zdroje dat, optimalizátor při generoání globálně optimálního plánu nadále ychází z odhadu nákladů. Existuje mnoho faktorů, které mohou tento plán olinit. Předpokládejme, že zdálený zdroj dat může zpracoat každou operaci půodním dotazu. Jeho rychlost procesoru je šak mnohem nižší než rychlost federoaného sereru. Může se ukázat, že místo u něj je mnohem ýhodnější proést operace na federoaném sereru DB2. Pokud ýsledky nejsou uspokojié, oěřte statistiku sereru tabulce katalogu SYSSTAT.SERVEROPTIONS. Proč má plán generoaný optimalizátorem a zcela yhodnocený zdáleně mnohem horší ýkon než půodní dotaz proedený přímo u zdáleného zdroje dat? Lze prozkoumat tyto oblasti: Vzdálený příkaz SQL generoaný optimalizátorem dotazu DB2. Oěřte, zda je identický s půodním dotazem. Zkontrolujte změny řazení predikátů. Dobrý optimalizátor dotazu by neměl být citliý na řazení predikátů dotazu. Bohužel ne šechny optimalizátory DBMS jsou stejné. Je možné, že optimalizátor u zdáleného zdroje dat generuje na základě stupního řazení predikátů jiný plán. Pokud je to tak, jedná se o problém, který je inherentní e zdáleném optimalizátoru. Zažte změnu řazení predikátů e stupu do produktu DB2 UDB nebo požádejte o pomoc serisní organizaci u zdáleného zdroje dat. Zkontrolujte také náhrady predikátů. Dobrý optimalizátor dotazu by neměl být citliý na ekialentní náhrady predikátů. Je možné, že optimalizátor u zdáleného zdroje dat generuje na základě stupního predikátu jiný plán. Některé optimalizátory například nemohou jako predikáty generoat příkazy tranzitiního uzáěru. Počet rácených řádků. Tuto hodnotu můžete získat z modulu Vizuální ysětlení. Pokud dotaz rátí elký počet řádků, je možným slabým bodem síťoý prooz. Další funkce. Obsahuje zdálený příkaz SQL íce funkcí než půodní dotaz? Některé z těchto dalších funkcí mohou být generoány pro přeod datoých typů. Oěřte, zda jsou potřebné. Souisející koncepce: Analýza posunu na nižší úroeň na stránce 127 Porozumění rozhodnutím při yhodnocení přístupoých plánů na stránce 135 Analýza globální optimalizace na stránce 142 Souisející úlohy: Globální optimalizace na stránce 137 Prky monitoru systému oliňující ýkon Monitor databázoého systému DB2 shromažďuje statistické informace týkající se aktuálního stau spráce databází a informace o aktiitě, jako jsou čítače a další měření zpracoání databáze. Ve federoaném systému můžete monitor databázoého systému DB2 použíat pro shromažďoání informací o aktiitě databází, ýkonu systému a ýkonu aplikace. 144 Příručka pro federoané systémy

157 Přepínač monitoru Časoá značka slouží ke sledoání času odezy interakcí, které federoaná databáze proádí se zdrojem dat. Federoané datoé prky sledoané přepínačem Časoá značka jsou: čas odezy při ytoření přezdíky, čas odezy při odstranění, čas odezy při ložení, čas průchodu, čas odezy pro dotaz, čas zdáleného zámku, čas odezy při aktualizaci. Výchozí nastaení pro přepínač monitoru Časoá značka je Zapnuto. Doporučení: Změnou nastaení přepínače monitoru Časoá značka na hodnotu Vypnuto u šech aplikací můžete zýšit ýkon. Pokud má jedna aplikace přepínač Časoá značka nastaený na hodnotu Zapnuto, bude systém pokračoat e shromažďoání časů odezy. Výkon tedy nezýšíte ypnutím přepínače Časoá značka pouze u některých aplikací. Z ypnutí přepínače yplýají další okolnosti. Vypnutí přepínače monitoru Časoá značka u šech aplikací yžaduje zastaení a opakoané spuštění instance produktu DB2, aby se tato změna implementoala. Vypnutí přepínače monitoru Časoá značka zakáže shromažďoání informací časoých značek u federoaných i nefederoaných aplikací. Informace časoých značek neobdrží ani lokální databáze. Potřebujete-li informace časoých značek pro lokální nefederoané aplikace, neměli byste přepínač monitoru Časoá značka ypínat. Přepínač Časoá značka můžete nastait na hodnotu Vypnuto u šech aplikací použitím tohoto příkazu: update dbm cfg using dft_mon_timestamp off Potom zadejte: db2stop db2start Zastaením a spuštěním produktu DB2 UDB zajistíte, že přepínač bude ypnut u šech aplikací. Specifické informace o každém z prků sledoaných přepínačem Časoá značka jsou uedeny samostatném tématu. Souisející odkazy: Kapitola 31, Prky monitoru federoaných databázoých systémů, na stránce 287 Kapitola 11. Ladění ýkonu federoaného systému 145

158 146 Příručka pro federoané systémy

159 Kapitola 12. Paralelní zpracoání s dotazy, které odkazují na přezdíky Tato kapitola ukazuje, jak paralelní zpracoání pracuje s dotazy, které odkazují na přezdíky. Obsah této kapitoly: Paralelní zpracoání dotazů s odkazy na přezdíky Paralelní zpracoání rámci oblasti pro dotazy s odkazy na přezdíky na stránce 148 Poolení paralelního zpracoání rámci oblasti pro dotazy s odkazy na přezdíky na stránce 148 Paralelní zpracoání mezi oblastmi pro dotazy s odkazy na přezdíky na stránce 149 Poolení paralelního zpracoání mezi oblastmi pro dotazy s odkazy na přezdíky na stránce 151 Výpočtoé skupiny oblastí na stránce 152 Definoání ýpočtoé skupiny oblastí na stránce 152 Paralelní zpracoání mezi oblastmi pro dotazy s odkazy na přezdíky - očekáaný ýkon na stránce 153 Smíšené paralelní zpracoání pro dotazy s odkazy na přezdíky na stránce 154 Poolení smíšeného paralelního zpracoání pro dotazy s odkazy na přezdíky na stránce 154 Paralelní přístupoé plány dotazů s odkazy na přezdíky na stránce 155 Paralelní zpracoání rámci oblasti pro dotazy s odkazy na přezdíky - příklady přístupoých plánů na stránce 155 Paralelní zpracoání pro dotazy s odkazy na přezdíky mezi oblastmi - příklady přístupoých plánů na stránce 157 Smíšené paralelní zpracoání pro dotazy s odkazy na přezdíky - příklady přístupoých plánů na stránce 159 Paralelní zpracoání dotazů s odkazy na přezdíky Pro dotazy obsahující přezdíky mohou být použity tři typy paralelního zpracoání rámci dotazů: Paralelní zpracoání dotazů rámci jedné oblasti, konfigurace s íce procesory Paralelní zpracoání dotazů mezi oblastmi, konfigurace s íce oblastmi Smíšené paralelní zpracoání dotazů sestáající z paralelního zpracoání rámci jedné oblasti i mezi oblastmi, kde každá oblast je spuštěna počítači SMP Souisející koncepce: Parallelism příručce Administration Guide: Planning Partition and processor enironments příručce Administration Guide: Planning The DB2 Process Model příručce Administration Guide: Performance Výpočtoé skupiny oblastí na stránce 152 Paralelní přístupoé plány dotazů s odkazy na přezdíky na stránce 155 Paralelní zpracoání rámci oblasti pro dotazy s odkazy na přezdíky na stránce 148 Paralelní zpracoání mezi oblastmi pro dotazy s odkazy na přezdíky na stránce 149 Smíšené paralelní zpracoání pro dotazy s odkazy na přezdíky na stránce 154 Copyright IBM Corp. 1998,

160 Souisející odkazy: Kapitola 20, Volby modulu wrapper pro federoané systémy, na stránce 209 Paralelní zpracoání rámci oblasti pro dotazy s odkazy na přezdíky Termínem paralelní zpracoání rámci oblasti je označoán proces rozdělení dotazu na íce souběžných částí, které jsou spuštěny paralelně e íce procesorech jedné oblasti databáze. Ve federoaných dotazech lze část obsahující lokální data spustit paralelně, zatímco část obsahující přezdíky je zpracoáána sérioě. Dotazy odkazující na lokální tabulky a přezdíky mohou být předchozích erzích produktu DB2 Information Integrator zpracoány rychleji, protože na lokálních částech dotazu může pracoat íce procesorů. Stupeň paralelního zpracoání rámci oblasti je řízen pomocí konfiguračního parametru DFT_DEGREE a speciálního registru CURRENT DEGREE. Souisející koncepce: Parallelism příručce Administration Guide: Planning Partition and processor enironments příručce Administration Guide: Planning Souisející úlohy: Enabling intra-partition parallelism for queries příručce Administration Guide: Implementation Poolení paralelního zpracoání rámci oblasti pro dotazy s odkazy na přezdíky na stránce 148 Souisející odkazy: Paralelní zpracoání rámci oblasti pro dotazy s odkazy na přezdíky - příklady přístupoých plánů na stránce 155 Poolení paralelního zpracoání rámci oblasti pro dotazy s odkazy na přezdíky Pro dotazy odkazující na lokální tabulky a přezdíky prostředí s íce procesory můžete poolit paralelní zpracoání rámci oblasti. Federoaný serer poté může proádět paralelní zpracoání lokálních tabulek. Omezení: Federoaný systém může paralelně zpracoat pouze lokální část dotazu. Všechny operace na zdálené části dotazu jsou oblastí koordinátora zpracoány sérioě. Postup: 1. Nastate konfigurační parametr databáze INTRA_PARALLEL na hodnotu YES. 2. Nastate konfigurační parametr databáze MAX_QUERYDEGREE na hodnotu ětší než Nastate konfigurační parametr databáze DFT_DEGREE na hodnotu ětší než 1 nebo nastate speciální registr CURRENT DEGREE. Zadáte-li pro parametr DFT_DEGREE hodnotu ANY, ýchozí úroeň paralelního zpracoání rámci oblasti se bude ronat počtu procesorů počítači. 148 Příručka pro federoané systémy

161 Souisející koncepce: Paralelní zpracoání dotazů s odkazy na přezdíky na stránce 147 Souisející odkazy: ALTER WRAPPER statement příručce SQL Reference, Volume 2 CREATE WRAPPER statement příručce SQL Reference, Volume 2 Paralelní zpracoání mezi oblastmi pro dotazy s odkazy na přezdíky Termínem paralelní zpracoání mezi oblastmi je označoán proces rozdělení jednoho dotazu na íce částí, které jsou poté zpracoány paralelně různých oblastech dělené databáze. V dotazech odkazujících na lokální i zdálená data může federoaný serer distribuoat zdálená data do jednotliých lokálních oblastí. Koncepce paralelního zpracoání mezi oblastmi, které zahrnuje lokální i zdálené zdroje dat, je uedena na obrázku Obrázek 7 na stránce 150. V horní části obrázku je uedeno, jakým způsobem byl tento typ dotazů zpracoáán předchozích ydáních produktu DB2 Information Integrator. Vzdálená data přezdíky i lokální dělená data byla zpracoáána sérioě jedné koordinační oblasti. V dolní části obrázku je uedeno, jakým způsobem zpracoáá tento typ dotazů toto ydání produktu DB2 Information Integrator. Databáze distribuuje data přezdíek za účelem paralelního zpracoání do oblastí lokálního systému. Kapitola 12. Paralelní zpracoání s dotazy, které odkazují na přezdíky 149

162 Obrázek 7. Paralelní zpracoání mezi oblastmi pro lokální a zdálené zdroje dat Koncepce paralelního zpracoání mezi oblastmi, které zahrnuje pouze zdálené zdroje dat, je uedena na obrázku Obrázek 8 na stránce 151. V horní části obrázku je znázorněno sérioé zpracoání dat přezdíek jedné koordinační oblasti. V dolní části obrázku je znázorněna distribuce dat koordinační oblasti do ýpočtoé skupiny oblastí. 150 Příručka pro federoané systémy

163 Obrázek 8. Paralelní zpracoání mezi oblastmi pouze pro zdálené zdroje dat Souisející koncepce: Paralelní zpracoání dotazů s odkazy na přezdíky na stránce 147 Výpočtoé skupiny oblastí na stránce 152 Souisející úlohy: Poolení paralelního zpracoání mezi oblastmi pro dotazy s odkazy na přezdíky na stránce 151 Poolení paralelního zpracoání mezi oblastmi pro dotazy s odkazy na přezdíky Dotazy odkazující na přezdíky, které mohou být spuštěny paralelně přes íce oblastí, mohou pracoat rychleji. V prostředí dělené databáze mohou být federoané dotazy spuštěny paralelně za následujících podmínek: Kapitola 12. Paralelní zpracoání s dotazy, které odkazují na přezdíky 151

164 Zahrnují kombinaci přezdíek a lokálních dělených tabulek. Zahrnují pouze přezdíky, které použíají ýpočtoou skupinu oblastí. Chcete-li zajistit paralelní zpracoání mezi oblastmi, není nutné nastaoat žádné parametry databáze ani konfigurační parametry databáze. Omezení: Paralelně mohou být spuštěny pouze části dotazu, které odkazují na přezdíky použíající chráněné moduly wrapper. Paralelně nelze spustit žádné části dotazu, které odkazují na přezdíky použíající důěryhodné moduly wrapper. Postup: 1. Vytořte ýpočtoou skupinu oblastí. 2. Zadejte příkaz CREATE WRAPPER či ALTER WRAPPER s olbou DB2_FENCED nastaenou na hodnotu Y. Souisející koncepce: Výpočtoé skupiny oblastí Výpočtoé skupiny oblastí na stránce 152 Paralelní zpracoání mezi oblastmi pro dotazy s odkazy na přezdíky na stránce 149 Výpočtoá skupina oblastí definuje sadu oblastí pro optimalizátor s cílem proádět operace dynamické redistribuce pro operace spojení. Výpočtoá skupina oblastí je skupina oblastí databáze (jiná než IBMCATNODEGROUP), která je specifikoána katalogu systému SYSCAT.DBPARTITIONGROUPS. Výpočtoé skupiny oblastí lze yužít při federoaném paralelním zpracoání dotazů mezi oblastmi. Při použití ýpočtoé skupiny oblastí můžete spustit části dotazů s přezdíkami paralelně. V plánu dotazu zahrnujícím ýpočtoou skupinu oblastí je federoaným sererem proedena redistribuce dat přezdíek přes tyto oblasti s cílem ytořit paralelní spojení. Tento typ plánu umožňuje rychlejší spuštění dotazů i tehdy, když jsou data přezdíek obsažených e spojení poměrně rozsáhlá. Výpočtoou skupinu oblastí lze specifikoat pomocí proměnné registru DB2_COMPPARTITIONGROUP. Souisející koncepce: Paralelní zpracoání dotazů s odkazy na přezdíky na stránce 147 Souisející úlohy: Definoání ýpočtoé skupiny oblastí na stránce 152 Definoání ýpočtoé skupiny oblastí Definoání ýpočtoé skupiny oblastí umožňuje optimalizátoru použít plán, který distribuuje data přezdíek do oblastí z ýpočtoé skupiny oblastí. Výpočtoou skupinu oblastí definujete s cílem poolit paralelní zpracoání rámci oblasti pro dotazy nebo části dotazů, které odkazují pouze na přezdíky. Předpoklady: 152 Příručka pro federoané systémy

165 Všechny skupiny oblastí použité k reprezentaci ýpočtoé skupiny oblastí e šech databázích dané instanci musí mít stejné jméno. Tyto skupiny oblastí můžete každé databázi definoat odlišně, ašak musí mít shodné jméno. Omezení: Optimalizátor použije ýpočtoé skupiny oblastí pouze pro ty části dotazu, které odkazují na přezdíky a přitom neodkazují na lokální data. Postup: Chcete-li definoat ýpočtoou skupinu oblastí, zadejte na příkazoém řádku DB2 následující příkaz: db2set DB2_COMPPARTITIONGROUP=jméno_skupiny_oblastí jméno_skupiny_oblastí je jméno skupiny oblastí, kterou chcete definoat jako ýpočtoou skupinu oblastí. Následující příklad ukazuje definici ýpočtoé skupiny FINANCE3 s použitím proměnné registru DB2_COMPPARTITIONGROUP. db2set DB2_COMPPARTITIONGROUP=FINANCE3 Souisející koncepce: Výpočtoé skupiny oblastí na stránce 152 Souisející odkazy: db2set - DB2 Profile Registry Command příručce Command Reference Paralelní zpracoání mezi oblastmi pro dotazy s odkazy na přezdíky - očekáaný ýkon Pro dotazy odkazující na kombinaci lokálních dělených tabulek a přezdíek může optimalizátor zolit plán proedení, který přerozděluje data přezdíky mezi příslušné oblasti. Díky plánům pro přerozdělení mohou být dotazy zpracoáány rychleji případech, kdy objem dat přezdíky e spojení je menší než objem lokálních dělených dat. Pokud je objem dat přezdíky e spojení ýrazně ětší než objem lokálních dat, nebude paralelní plán s přerozdělením dat přezdíky praděpodobně použit. Pokud optimalizátor nezolí paralelní plán, federoaný serer proede spojení mezi přezdíkami a lokálními tabulkami koordinační oblasti sérioě. Při spojení mezi děma přezdíkami může být plán proedení zahrnující distribuci dat mezi šechny oblasti ýpočtoé skupiny oblastí prospěšný tehdy, pokud operace zahrnuje elký objem dat. Výhoda paralelního zpracoání při spojení s elkým objemem dat kompenzuje dodatečné náklady na přerozdělení dat mezi íce oblastí. Je-li objem dat přezdíek poměrně malý, nebudou náklady spojení dostatečně elké na to, aby se dodatečné náklady na přerozdělení dat mezi oblasti yplatily. Obecně řečeno, optimalizátor bude ybírat plány s použitím ýpočtoé skupiny oblastí případech, kdy přezdíky zahrnuté do operace jsou rozměrné; opačném případě proede federoaný serer spojení přezdíek sérioě koordinační oblasti. Souisející koncepce: Výpočtoé skupiny oblastí na stránce 152 Paralelní zpracoání mezi oblastmi pro dotazy s odkazy na přezdíky na stránce 149 Kapitola 12. Paralelní zpracoání s dotazy, které odkazují na přezdíky 153

166 Souisející odkazy: Paralelní zpracoání pro dotazy s odkazy na přezdíky mezi oblastmi - příklady přístupoých plánů na stránce 157 Smíšené paralelní zpracoání pro dotazy s odkazy na přezdíky Pro dotazy obsahující lokální tabulky a přezdíky děleném prostředí můžete použít paralelní zpracoání rámci jedné oblasti i paralelní zpracoání mezi oblastmi. Federoaný serer může distribuoat zdálená data mezi oblastmi a rámci každé oblasti může data zpracoáat paralelně. Souisející koncepce: Paralelní zpracoání dotazů s odkazy na přezdíky na stránce 147 Souisející úlohy: Poolení smíšeného paralelního zpracoání pro dotazy s odkazy na přezdíky na stránce 154 Poolení smíšeného paralelního zpracoání pro dotazy s odkazy na přezdíky Federoané dotazy spuštěné paralelně mohu být zpracoány rychleji. Výkon dotazů s odkazy na lokální i zdálená data lze zlepšit s použitím paralelního zpracoání rámci jedné oblasti či paralelního zpracoání mezi oblastmi. Federoané dotazy obsahují kombinaci odkazů na přezdíky a lokální dělené tabulky. Postup: 1. Nastate konfigurační parametr databáze MAX_QUERYDEGREE na hodnotu ětší než Nastate konfigurační parametr databáze DFT_DEGREE na hodnotu ětší než 1 nebo je nutné nastait speciální registr CURRENT DEGREE. Zadáte-li pro parametr DFT_DEGREE hodnotu ANY, ýchozí úroeň paralelního zpracoání rámci oblasti se bude ronat počtu procesorů SMP počítači. 3. Vytořte ýpočtoou skupinu oblastí. 4. Zadejte příkaz CREATE WRAPPER či ALTER WRAPPER s olbou DB2_FENCED nastaenou na hodnotu Y. Souisející koncepce: Výpočtoé skupiny oblastí na stránce 152 Smíšené paralelní zpracoání pro dotazy s odkazy na přezdíky na stránce 154 Souisející úlohy: Trusted and fenced mode process enironments příručce IBM DB2 Information Integrator Wrapper Deeloper s Guide Souisející odkazy: Smíšené paralelní zpracoání pro dotazy s odkazy na přezdíky - příklady přístupoých plánů na stránce Příručka pro federoané systémy

167 Paralelní přístupoé plány dotazů s odkazy na přezdíky Prostředek SQL Explain slouží k zachycoání informací o přístupoých plánech použíaných optimalizátorem při zpracoání dotazů. Souisející koncepce: SQL explain facility příručce Administration Guide: Performance Explain tools příručce Administration Guide: Performance SQL explain tools příručce Administration Guide: Performance Souisející odkazy: Paralelní zpracoání rámci oblasti pro dotazy s odkazy na přezdíky - příklady přístupoých plánů na stránce 155 Paralelní zpracoání pro dotazy s odkazy na přezdíky mezi oblastmi - příklady přístupoých plánů na stránce 157 Smíšené paralelní zpracoání pro dotazy s odkazy na přezdíky - příklady přístupoých plánů na stránce 159 Paralelní zpracoání rámci oblasti pro dotazy s odkazy na přezdíky - příklady přístupoých plánů Pomocí prostředku DB2 UDB Explain lze generoat přístupoý plán, který bude optimalizátor použíat při zpracoání dotazu. Následující příklady ukazují, jakým způsobem optimalizátor přistupuje k datům přezdíek prostředí paralelního zpracoání rámci oblasti. Příklad 1: Bez použití podpory paralelního zpracoání DB2 Information Integrator erze 8.2 V tomto příkladu federoaný serer zpracoáá spojení lokální tabulky ORDERS a přezdíky ITEMS sérioě. Není použito žádné paralelní zpracoání rámci oblasti. SELECT * FROM ORDERS A, ITEMS B WHERE A.ID1 = B.ID1 AND B.ITEM = 3 RETURN ( 1) HSJOIN ( 2) / \ TBSCAN SHIP ( 3) ( 4) TABLE: NEWTON NICKNM: NEWTON ORDERS ITEMS Příklad 2: S použitím podpory paralelního zpracoání DB2 Information Integrator erze 8.2 V tomto příkladu spojení může dotaz pracoat rychleji díky paralelnímu načtení lokální tabulky před zpracoáním sérioého spojení s přezdíkou. Kapitola 12. Paralelní zpracoání s dotazy, které odkazují na přezdíky 155

168 SELECT * FROM ORDERS A, ITEMS B WHERE A.ID1 = B.ID1 AND B.ITEM = 3 RETURN ( 1) HSJOIN ( 2) / \ LTQ SHIP ( 3) ( 5) TBSCAN NICKNM: NEWTON ( 4) ITEMS TABLE: NEWTON ORDERS Příklad 3: Paralelní zpracoání rámci oblasti s agregací V tomto příkladu databáze agreguje data lokální tabulky rámci oblasti paralelně, což zajistí zlepšené proedení agregace. Spojení lokální tabulky a přezdíky bude proedeno sérioě na uzlu koordinátora. SELECT * FROM ITEMS A WHERE ID = (SELECT MAX(ID) FROM ORDERS WHERE NUMBER = 10) RETURN ( 1) NLJOIN ( 2) / \ GRPBY SHIP ( 3) ( 7) LTQ NICKNM: NEWTON ( 4) ITEMS 1 GRPBY ( 5) TBSCAN ( 6) TABLE: NEWTON ORDERS Souisející koncepce: Example two: single-partition plan with intra-partition parallelism příručce Administration Guide: Performance Paralelní přístupoé plány dotazů s odkazy na přezdíky na stránce 155 Souisející úlohy: Poolení paralelního zpracoání rámci oblasti pro dotazy s odkazy na přezdíky na stránce Příručka pro federoané systémy

169 Paralelní zpracoání pro dotazy s odkazy na přezdíky mezi oblastmi - příklady přístupoých plánů Pomocí prostředku DB2 UDB Explain lze generoat přístupoý plán, který bude optimalizátor použíat při zpracoání dotazu. Následující příklady ukazují, jakým způsobem optimalizátor přistupuje k datům přezdíek prostředí paralelního zpracoání mezi oblastmi. Příklad 1: Důěryhodný režim V tomto příkladu použíá přezdíka důěryhodný modul wrapper. Databáze proede spojení mezi lokální tabulkou a přezdíkou koordinačním uzlu sérioě. Databáze přeede do koordinační oblasti lokální data, která jsou distribuoána do dou oblastí. Federoaný serer poté spojí lokální data s daty přezdíky. Databáze sérioě spojí přezdíky definoané s použitím důěryhodného modulu wrapper koordinační oblasti. Databáze nemůže distribuoat data do íce oblastí s cílem ytoření paralelního spojení. SELECT * FROM ORDERS A, ITEMS B WHERE A.ID1 = B.ID1 AND B.ITEM = 3 RETURN ( 1) HSJOIN ( 2) / \ DTQ SHIP ( 3) ( 5) TBSCAN NICKNM: NEWTON ( 4) ITEMS TABLE: NEWTON ORDERS Příklad 2: Chráněný režim V tomto příkladu přezdíka použíá chráněný modul wrapper. Federoaný serer distribuuje data přezdíky do ostatních oblastí a proede spojení s lokálními daty paralelně. SELECT * FROM ORDERS A, ITEMS B WHERE A.ID1 = B.ID1 AND B.ITEM = 3 RETURN ( 1) DTQ ( 2) MSJOIN ( 3) / \ TBSCAN FILTER ( 4) ( 7) SORT TBSCAN ( 5) ( 8) TBSCAN SORT ( 6) ( 9) Kapitola 12. Paralelní zpracoání s dotazy, které odkazují na přezdíky 157

170 TABLE: NEWTON DTQ ORDERS ( 10) SHIP ( 11) NICKNM: NEWTON ITEMS Příklad 3: Chráněný režim bez ýpočtoé skupiny oblastí V tomto příkladu použíají dě přezdíky chráněný modul wrapper a ýpočtoá skupina oblastí není definoána. Federoaný serer proede spojení koordinační oblasti. Federoaný serer nedistribuuje data do ostatních oblastí za účelem zpracoání. SELECT * FROM ITEMS A, LOCATIONS B WHERE A.ID1 = B.ID1 RETURN ( 1) MSJOIN ( 2) / \ TBSCAN FILTER ( 3) ( 7) SORT TBSCAN ( 4) ( 8) SHIP SORT ( 5) ( 9) NICKNM: NEWTON SHIP LOCATIONS ( 10) NICKNM: NEWTON ITEMS Příklad 4: Chráněný režim s ýpočtoou skupinou oblastí V tomto příkladu přezdíky použíají chráněné moduly wrapper a je definoána ýpočtoá skupina oblastí. V tomto případě optimalizátor ybere plán, který distribuuje data z koordinační oblasti do ostatních oblastí e ýpočtoé skupině oblastí. SELECT * FROM ITEMS A, LOCATIONS B WHERE A.ID = B.ID RETURN ( 1) DTQ ( 2) MSJOIN ( 3) / \ TBSCAN FILTER ( 4) ( 9) 158 Příručka pro federoané systémy

171 SORT TBSCAN ( 5) ( 10) DTQ SORT ( 6) ( 11) SHIP DTQ ( 7) ( 12) NICKNM: NEWTON SHIP LOCATIONS ( 13) NICKNM: NEWTON ITEMS Souisející koncepce: Example three: multipartition plan with inter-partition parallelism příručce Administration Guide: Performance Paralelní přístupoé plány dotazů s odkazy na přezdíky na stránce 155 Souisející úlohy: Trusted and fenced mode process enironments příručce IBM DB2 Information Integrator Wrapper Deeloper s Guide Poolení paralelního zpracoání mezi oblastmi pro dotazy s odkazy na přezdíky na stránce 151 Smíšené paralelní zpracoání pro dotazy s odkazy na přezdíky - příklady přístupoých plánů Pomocí prostředku DB2 UDB Explain lze ytořit přístupoý plán, který bude optimalizátor použíat při zpracoání dotazu. Následující příklady ukazují, jakým způsobem optimalizátor přistupuje k datům přezdíek prostředí yužíajícím paralelního zpracoání rámci jedné oblasti i paralelního zpracoání mezi oblastmi. Příklad 1: Důěryhodný režim Následující příklad ukazuje spojení mezi lokální tabulkou a přezdíkou důěryhodném režimu. Před spojením lokálních dat s daty přezdíky koordinační oblasti zpracuje federoaný serer lokální data paralelně každé oblasti. Data přezdíky oblastech či pro procesory jednotliých oblastech federoaným sererem paralelně zpracoány nejsou. SELECT * FROM ORDERS A, ITEMS B WHERE A.ID1 = B.ID1 AND B.ITEM = 3 RETURN ( 1) HSJOIN ( 2) / \ DTQ SHIP ( 3) ( 6) LTQ NICKNM: NEWTON ( 4) ITEMS TBSCAN Kapitola 12. Paralelní zpracoání s dotazy, které odkazují na přezdíky 159

172 ( 5) TABLE: NEWTON ORDERS Příklad 2: Chráněný režim Následující příklad ukazuje spojení mezi lokální tabulkou a přezdíkou chráněném režimu. Federoaný serer distribuuje data přezdíek z koordinační oblasti do ostatních oblastí systému. Federoaný serer zpracoáá data lokální tabulky a data přezdíky mezi oblastmi a procesory paralelně. SELECT * FROM ORDERS A, ITEMS B WHERE A.ID1 = B.ID1 AND B.ITEM = 3 RETURN ( 1) DTQ ( 2) LTQ ( 3) MSJOIN ( 4) / \ TBSCAN FILTER ( 5) ( 8) SORT TBSCAN ( 6) ( 9) TBSCAN SORT ( 7) ( 10) TABLE: NEWTON DTQ ORDERS ( 11) SHIP ( 12) NICKNM: NEWTON ITEMS Souisející koncepce: Example four: multipartition plan with inter-partition and intra-partition parallelism příručce Administration Guide: Performance Paralelní přístupoé plány dotazů s odkazy na přezdíky na stránce 155 Souisející úlohy: Trusted and fenced mode process enironments příručce IBM DB2 Information Integrator Wrapper Deeloper s Guide Poolení smíšeného paralelního zpracoání pro dotazy s odkazy na přezdíky na stránce Příručka pro federoané systémy

173 Kapitola 13. Tabulky materializoaných dotazů a federoané systémy Tato kapitola popisuje, jak lze použít tabulky materializoaných dotazů, které odkazují na přezdíky, e federoaném systému. Obsah této kapitoly: Federoané systémy a tabulky materializoaných dotazů přehled Vytoření federoané tabulky materializoaného dotazu na stránce 162 Specifická omezení zdrojů dat pro tabulky materializoaných dotazů na stránce 162 Omezení při použití tabulek materializoaných dotazů s přezdíkami na stránce 164 Federoané systémy a tabulky materializoaných dotazů přehled Tabulka materializoaného dotazu je tabulka s uloženými ýsledky dotazu. Pokud je dotaz zadán znou, databázoý stroj může narátit data z tabulky materializoaného dotazu. Tabulky materializoaných dotazů lze spolu s přezdíkami yužít při optimalizaci ýkonu dotazů nebo pro zapouzdření částí logických ýrazů. Tabulky materializoaných dotazů lze též yužít při ytáření tabulek mezipaměti. Optimalizátor SQL určí, zda bude dotaz pracoat účinněji při použití tabulky materializoaného dotazu než při použití základních tabulek či přezdíek. Optimalizátor bere při ýběru tabulky materializoaného dotazu potaz následující faktory: Tabulka materializoaného dotazu musí odpoídat části dotazu nebo celému dotazu. Musí být splněno kritérium doby pro obnoení. Přístupoý plán yužíající tabulku materializoaného dotazu musí být lenější než přístupoý plán yužíající základní tabulky nebo přezdíky. Tabulky materializoaných dotazů jsou podporoány následujícími zdroji dat: Relační zdroje dat DRDA Informix ODBC Oracle Sybase MS SQL Serer Teradata Nerelační zdroje dat BioRS BLAST Documentum Entrez Excel HMMER IBM Lotus Extended Search Soubory s tabulkoou strukturou Weboé služby WebSphere Business Integration XML Copyright IBM Corp. 1998,

174 Souisející koncepce: Tabulky mezipaměti na stránce 167 Performance and tuning planning materialized query tables in a federated system příručce IBM DB2 Information Integrator Application Deeloper s Guide Souisející úlohy: Creating a materialized query table příručce Administration Guide: Implementation Altering materialized query table properties příručce Administration Guide: Implementation Vytoření federoané tabulky materializoaného dotazu na stránce 162 Souisející odkazy: Specifická omezení zdrojů dat pro tabulky materializoaných dotazů na stránce 162 Vytoření federoané tabulky materializoaného dotazu Pomocí tabulek materializoaných dotazů lze lokálně ukládat data a zlepšit činnost dotazů. Při ytáření tabulek materializoaných dotazů lze použíat přezdíky z relačních a nerelačních zdrojů dat. Omezení: Specifická omezení zdrojů dat pro tabulky materializoaných dotazů. Pokud je pro některý dotaz predikátu nebo seznamu ýběru obsažena šablona funkce, musí být tato šablona funkce součástí tabulky materializoaného dotazu. Postup: Chcete-li ytořit tabulku materializoaného dotazu, zadejte příkaz CREATE TABLE obsahující přezdíku, která reprezentuje objekt zdáleného zdroje dat. Souisející koncepce: Federoané systémy a tabulky materializoaných dotazů přehled na stránce 161 Souisející úlohy: Creating a materialized query table příručce Administration Guide: Implementation Přidání tabulky materializoaných dotazů do tabulky mezipaměti na stránce 170 Souisející odkazy: Specifická omezení zdrojů dat pro tabulky materializoaných dotazů na stránce 162 ALTER TABLE statement příručce SQL Reference, Volume 2 CREATE TABLE statement příručce SQL Reference, Volume 2 Specifická omezení zdrojů dat pro tabulky materializoaných dotazů V tomto tématu jsou popsána omezení při ytáření tabulek materializoaných dotazů pro následující zdroje dat: Bio-RS BLAST Entrez HMMER IBM Lotus Extended Search 162 Příručka pro federoané systémy

175 Soubory s tabulkoou strukturou Weboé služby XML Omezení pro zdroje dat Bio-RS, Entrez a IBM Lotus Extended Tyto moduly wrapper yžadují alespoň jeden predikát klauzuli WHERE. Je nutné ytořit tabulku materializoaného dotazu yhoující požadakům na predikáty pro moduly wrapper. Pokud neurčíte predikát, aktualizace tabulky materializoaného dotazu se nezdaří. Omezení zdrojů dat BLAST a HMMER Použíáte-li moduly wrapper BLAST či HMMER, zdroje dat budou yžadoat hodnoty pro některé predikáty. Modul wrapper poskytuje ýchozí hodnotu. Hodnotu pro další predikáty je nutné určit. Pokud neurčíte predikát, aktualizace tabulky materializoaného dotazu se nezdaří. V následujícím příkladu je tabulka materializoaného dotazu úspěšně ytořena, protože modul wrapper nepřistupoal ke zdroji dat. CREATE TABLE MY_MQT AS (SELECT * FROM BLAST_NICK) DATA INITIALLY DEFERRED REFRESH DEFERRED ENABLE QUERY OPTIMIZATION; Pokud šak aktualizujete tabulku, je kontaktoán zdroj dat BLAST za účelem načtení dat. Zdroj dat BLAST ohlásí chybu, protože yžaduje predikát pro sloupec blast_seq. Pokud případě olitelných predikátů zadáte dotaz s jinými než ýchozími hodnotami, je nutné při ytáření tabulky materializoaného dotazu zadat hodnoty. Pokud neurčíte predikát, aktualizace tabulky materializoaného dotazu se nezdaří. V následujícím příkladu poskytuje modul wrapper ýchozí hodnoty pro olitelné parametry při ytáření tabulky materializoaného dotazu. Tyto olitelné parametry jsou in_arg1 = 2 a in_arg2 < 30. CREATE TABLE MY_MQT AS (SELECT * FROM BLAST_NICK WHERE BLAST_SEQ = ) DATA INITIALLY DEFERRED REFRESH DEFERRED ENABLE QUERY OPTIMIZATION; Při zadání následujícího dotazu optimalizátor spáruje dotaz s tabulkou materializoaného dotazu. Pokud optimalizátor ybere plán tabulky materializoaného dotazu, narátí tento dotaz nespráné ýsledky. Dotaz narátí nespráné ýsledky, protože tabulka materializoaného dotazu obsahuje data parametru in_arg1 = 2, ašak dotaz požadoal data parametru in_arg1 = 3. SELECT * FROM BLAST_NICK WHERE BLAST_SEQ = AND IN_ARG1 = 3; Při ytáření tabulky materializoaného dotazu je nutné explicitně určit hodnoty pro některé predikáty i tehdy, když modul wrapper poskytne ýchozí hodnoty. V opačném případě by mohlo dojít k tomu, že optimalizátor nenasměruje dotaz na odpoídající tabulku materializoaného dotazu. K tomu může dojít zhledem k tomu, že při ytáření tabulky materializoaných dotazů nebyly explicitně určeny hodnoty těchto predikátů. V následujícím příkladu je přededen nezdařený ýběr tabulky materializoaného dotazu optimalizátorem při shodě dotazu a tabulky materializoaného dotazu. Pokud tabulka materializoaného dotazu explicitně obsahuje pený stupní sloupec s ýchozí hodnotou a pro dotaz není tento predikát určen, dotaz nebude směroán na tabulku materializoaného dotazu. Kapitola 13. Tabulky materializoaných dotazů a federoané systémy 163

176 CREATE TABLE K55ADMIN.BLAST_NICK1_M1 AS ( SELECT SCORE, E_VALUE, QUERYSTRANDS FROM K55ADMIN.BLAST_NICK1 WHERE BLASTSEQ= ATGATCGGATCGAATTCGAT AND E_VALUE < 10) DATA INITIALLY DEFERRED REFRESH DEFERRED; Při zadání následujícího dotazu není dotaz směroán na tabulku materializoaného dotazu. Dotaz není směroán, protože optimalizátor určí, že tabulce materializoaného dotazu nebyla specifikoána hodnota E_VALUE < 10. SELECT SCORE, E_VALUE, QUERYSTRANDS FROM K55ADMIN.BLAST_NICK1 WHERE BLASTSEQ= ATGATCGGATCGAATTCGAT ; Omezení pro soubory s tabulkoou strukturou Definujete-li přezdíku pro soubor s tabulkoou strukturou s olbou DOCUMENT, musí mít tabulka materializoaného dotazu predikát určující cestu k souboru. Pokud není predikát určen, aktualizace tabulky materializoaného dotazu se nezdaří. Omezení weboých služeb Tabulku materializoaných dotazů lze ytořit pouze prostřednictím plochého pohledu hierarchie přezdíek. Tabulku materializoaného dotazu nelze ytořit pro každou přezdíku hierarchie. Omezení jazyka XML Materializoanou tabulku nelze ytořit pro podřízenou tabulku. Definujete-li přezdíku pro tabulku XML s olbou DOCUMENT, tabulka materializoaného dotazu yžaduje predikát určující cestu k souboru. Pokud není predikát určen, aktualizace tabulky materializoaného dotazu se nezdaří. Souisející úlohy: Vytoření federoané tabulky materializoaného dotazu na stránce 162 Souisející odkazy: Omezení při použití tabulek materializoaných dotazů s přezdíkami na stránce 164 Omezení při použití tabulek materializoaných dotazů s přezdíkami Produkt DB2 Information Integrator nepodporuje tabulky materializoaných dotazů spraoané systémem, které odkazují na přezdíky prostředí dělené databáze. Chcete-li toto omezení obejít, můžete použít tabulky materializoaných dotazů spraoané užiatelem. Pro nerelační přezdíku se jménem DEPART můžete například zadat následující příkazy s cílem simuloat tabulku materializoaného dotazu spraoanou systémem. SET CURRENT MAINTAINED TABLE TYPES FOR OPTIMIZATION ALL; CREATE TABLE AST1(C1, C2) AS (SELECT EMPNO, FIRSTNME FROM DEPART WHERE EMPNO> ) DATA INITIALLY DEFERRED REFRESH DEFERRED ENABLE QUERY OPTIMIZATION MAINTAINED BY USER; SET INTEGRITY FOR AST1 ALL IMMEDIATE UNCHECKED; 164 Příručka pro federoané systémy

177 INSERT INTO AST1 (SELECT EMPNO, FIRSTNME FROM DEPART WHERE EMPNO> ); SET CURRENT REFRESH AGE ANY; Odezou následujícího příkazu SELECT může být předchozí definoaná tabulka materializoaného dotazu: SELECT EMPNO, FIRSTNME FROM DEPART WHERE EMPNO > AND FIRSTNME LIKE AN% ; Kapitola 13. Tabulky materializoaných dotazů a federoané systémy 165

178 166 Příručka pro federoané systémy

179 Kapitola 14. Uložení tabulek do mezipaměti e federoaném systému Tabulky mezipaměti Tato kapitola popisuje, co je tabulka mezipaměti a jak ji lze použít e federoaném systému. Obsah této kapitoly: Tabulky mezipaměti Vytoření tabulky mezipaměti na stránce 169 Poolení mezipaměti na stránce 170 Přidání tabulky materializoaných dotazů do tabulky mezipaměti na stránce 170 Zrušení tabulky materializoaných dotazů z tabulky mezipaměti na stránce 171 Zrušení tabulky mezipaměti na stránce 172 Tabulka mezipaměti může ylepšit ýkon dotazu prostřednictím přístupu k místní podmnožině dat místo přímého přístupu k datům ze zdáleného relačního zdroje dat. Tabulka mezipaměti sestáá z následujících součástí: Přezdíka federoaného databázoého systému se stejnými definicemi sloupců a stejným přístupem k datům, jako má zdálená relační tabulka zdroje dat. Jedna nebo íce užiatelem spraoaných tabulek materializoaných dotazů, kterou definujete přezdíce. Přezdíka může obsahoat podmnožinu často použíaných dat ze zdáleného zdroje dat. Časoý plán replikace definoaný užiatelem, který je spojen s každou tabulkou materializoaných dotazů k uchoání aktuálnosti místních tabulek materializoaných dotazů se zdáleným zdrojem dat. Oddíl Obrázek 9 na stránce 168 popisuje koncept tabulky mezipaměti. Copyright IBM Corp. 1998,

180 Obrázek 9. Tabulky mezipaměti sestáají z přezdíky tabulek materializoaných dotazů a časoého plánu replikace. Má stejné jméno jako komponenta replikace. Tabulku mezipaměti můžete spojit pouze s jednou zdálenou tabulkou. Může se jednat o úplnou repliku nebo částečnou podmnožinu řádků ze zdáleného zdroje dat. Tabulka mezipaměti obsahuje místní data, která jsou definoána tabulkami materializoaných dotazů s ní souisejícími. Základní rozdíl mezi tabulkou mezipaměti a tabulkou materializoaného dotazu je ten, že tabulka mezipaměti je konfiguroána z Řídicího centra DB2. Aplikace, které zadáají dotaz do zdáleného zdroje dat, mohou zadat dotaz do tabulky mezipaměti s minimální změnou aplikace. Během procesu dotazoání nasměruje optimalizátor dotaz do tabulky mezipaměti nebo do zdálené relační tabulky zdroje dat. Souisející koncepce: Replicated materialized query tables příručce Administration Guide: Planning Federoané systémy a tabulky materializoaných dotazů přehled na stránce Příručka pro federoané systémy

181 Souisející úlohy: Vytoření tabulky mezipaměti Vytoření tabulky mezipaměti na stránce 169 Vytoření federoané tabulky materializoaného dotazu na stránce 162 Tabulka mezipaměti slouží k ukládání dat, se kterými často pracujete, ale která se často nemění. Použíáním tabulek mezipaměti můžete ylepšit ýkon dotazu. Do mezipaměti můžete uložit data z datoých zdrojů, ze kterých produkt DB2 UDB podporuje heterogenní replikaci. Jedná se o datoé zdroje z následujících systémů: řada produktů DB2 Informix, Microsoft SQL Serer, Oracle a Sybase. Předpoklady: Nastate parametr konfigurace spráce databáze FEDERATED sereru DB2 UDB na hodnotu YES. Chcete-li získat přístup k datům systému Informix, nainstalujte a nakonfigurujte software Informix Client SDK na federoaném sereru. Chcete-li do mezipaměti načíst data z tabulek produktu DB2 UDB for Linux, UNIX, and Windows, je třeba nakonfiguroat pro databázi, e které je tato tabulka uložena, protokoloání se zachoáním žurnálu. Protokoloání se zachoáním žurnálu je typem archiního protokoloání. Chcete-li nakonfiguroat pro databázi protokoloání se zachoáním žurnálu, nastate hodnotu LOGRETAIN na RECOVER. Federoaná nebo zdrojoá databáze musí být počítači, e kterém ytáříte tabulky mezipaměti. Pokud není federoaná nebo zdrojoá databáze místní, je třeba databáze místním počítači katalogizoat. Jméno aliasu použité při katalogizaci databáze musí být stejné jako jméno databáze. Jméno užiatele mapoání užiatele mezi databázemi musí mít opránění ytářet tabulky e zdrojoé databázi. Postup: Chcete-li ytořit tabulku mezipaměti, postupujte takto: 1. V Řídicím centru DB2 rozbalte složku Objekty mezipaměti. 2. Praým tlačítkem myši klepněte na složku Tabulky mezipaměti a klepněte na příkaz Vytořit. Oteře se průodce uložením tabulky do mezipaměti. 3. Dokončete kroky průodce. Při ytoření tabulky mezipaměti průodce uložením tabulky do mezipaměti ytoří jednu tabulku materializoaného dotazu. Chcete-li uložit další data z téhož zdroje dat, je možné ytořit další tabulky materializoaných dotazů. Souisející koncepce: Tabulky mezipaměti na stránce 167 Souisející úlohy: Poolení mezipaměti na stránce 170 Přidání tabulky materializoaných dotazů do tabulky mezipaměti na stránce 170 Souisející odkazy: logretain - Log retain enable configuration parameter příručce Administration Guide: Performance Kapitola 14. Uložení tabulek do mezipaměti e federoaném systému 169

182 Poolení mezipaměti Jakmile poolíte použití mezipaměti, aktiujete programy Apply a Capture. Tyto programy replikují data z datoého zdroje do tabulky materializoaných dotazů. Obecně použití mezipaměti poolíte při ytoření tabulky mezipaměti. V následujících případech šak může být nutné použití mezipaměti pro replikaci poolit ručně: Při ytoření tabulky mezipaměti a pokud platí obě následující podmínky, databáze nepoolila použití mezipaměti pro replikaci: Zdroj dat je tabulka produktu DB2 UDB for Linux, UNIX, and Windows. Nekonfiguroali jste pro databázi, e které je tabulka uložena, protokoloání se zachoáním žurnálu. Po ytoření tabulky mezipaměti je použití mezipaměti zakázáno případě ukončení programu Capture nebo Apply replikace. Pokud Replikačním centru DB2 program Capture nebo Apply restartujete, je třeba použití mezipaměti poolit, aby se zahájila replikace dat. V Řídicím centru DB2 je někdy pojem protokoloání se zachoáním žurnálu označoán jako archiní protokoloání. Předpoklady: Pokud se mezipaměť použíá pro tabulku produktu DB2 UDB for Linux, UNIX, and Windows, platí následující předpoklady: Pro databázi, e které je tabulka uložena, je třeba nakonfiguroat protokoloání se zachoáním žurnálu. Musí být spuštěn administrační serer DB2 (DAS). Postup: Chcete-li poolit použití mezipaměti, postupujte takto: 1. V Řídicím centru DB2 rozbalte e stromu objektů složky Objekty mezipaměti a Tabulky mezipaměti. 2. Klepněte praým tlačítkem myši na tabulku mezipaměti obsahující mezipaměť, kterou chcete poolit, a yberte příkaz Poolit. Oteře se okno Poolit ukládání mezipaměti. 3. Vyberte mezipaměť, kterou chcete poolit, a klepněte na tlačítko OK. Souisející koncepce: Tabulky mezipaměti na stránce 167 Souisející úlohy: Přidání tabulky materializoaných dotazů do tabulky mezipaměti na stránce 170 Přidání tabulky materializoaných dotazů do tabulky mezipaměti Po ytoření tabulky mezipaměti ukládá federoaný serer data místně ze zdroje dat do tabulky materializoaných dotazů. Kritéria, která zadáte do průodce tabulkou mezipaměti, určují, která data budou uložena tabulce materializoaných dotazů. Můžete ytořit další tabulky materializoaných dotazů pro stejnou tabulku mezipaměti, kde budou uložena další data ze stejného objektu zdroje dat. 170 Příručka pro federoané systémy

183 Předpoklady: Tabulka mezipaměti pro zdroj dat musí existoat. Postup: Chcete-li přidat tabulku materializoaných dotazů do stáající tabulky mezipaměti, postupujte takto: 1. V Řídicím centru DB2 rozbalte e stromu objektů složky Objekty mezipaměti a Tabulky mezipaměti. 2. Klepněte praým tlačítkem myši na tabulku mezipaměti, ke které chcete přidat tabulku materializoaných dotazů, a klepněte na příkaz Vlastnosti. Oteře se okno Vlastnosti tabulky mezipaměti. 3. Klepněte na olbu Přidat. Oteře se průodce uložením tabulky do mezipaměti. 4. Proeďte šechny kroky průodce. Souisející koncepce: Tabulky mezipaměti na stránce 167 Federoané systémy a tabulky materializoaných dotazů přehled na stránce 161 Souisející úlohy: Poolení mezipaměti na stránce 170 Zrušení tabulky materializoaných dotazů z tabulky mezipaměti na stránce 171 Zrušení tabulky materializoaných dotazů z tabulky mezipaměti Jakmile již nechcete ukládat data místně do tabulky materializoaných dotazů, můžete tabulku materializoaných dotazů zrušit z tabulky mezipaměti. Jestliže tabulka mezipaměti obsahuje pouze jednu tabulku materializoaných dotazů, bude při zrušení tabulky materializoaných dotazů zrušena také tabulka mezipaměti. Omezení: Chcete-li zajistit úplné zrušení tabulky materializoaných dotazů systému, zrušte tabulku materializoaných dotazů z tabulky mezipaměti pomocí Řídicího centra DB2. Postup: Chcete-li zrušit tabulku materializoaných dotazů ze stáající tabulky mezipaměti, postupujte takto: 1. V Řídicím centru DB2 rozbalte e stromu objektů složky Objekty mezipaměti a Tabulky mezipaměti. 2. Klepněte praým tlačítkem myši na tabulku mezipaměti, ze které chcete zrušit tabulku materializoaných dotazů, a klepněte na příkaz Vlastnosti. Oteře se okno Vlastnosti tabulky mezipaměti. 3. Vyberte tabulku materializoaných dotazů, kterou chcete zrušit, a klepněte na tlačítko Odebrat. Souisející úlohy: Přidání tabulky materializoaných dotazů do tabulky mezipaměti na stránce 170 Zrušení tabulky mezipaměti na stránce 172 Kapitola 14. Uložení tabulek do mezipaměti e federoaném systému 171

184 Zrušení tabulky mezipaměti Jakmile již nechcete ukládat data místně do tabulky mezipaměti, můžete ji zrušit. Výsledkem ymazání tabulky materializoaných dotazů jsou následující akce: Tabulky materializoaných dotazů, které byly ytořeny pro tabulku mezipaměti, budou zrušeny. Bude odebrán časoý plán replikace mezi zdroji dat a tabulkou materializoaných dotazů. Pokud byla při ytoření tabulky mezipaměti ytořena přezdíka zdroje dat, bude tato přezdíka zrušena. Pokud jste při ytoření tabulky mezipaměti použili stáající přezdíku, federoaný serer přezdíku nezruší. Postup: Chcete-li zrušit tabulku mezipaměti, postupujte takto: 1. V Řídicím centru DB2 rozbalte e stromu objektů složky Objekty mezipaměti a Tabulky mezipaměti. 2. Klepněte praým tlačítkem myši na tabulku mezipaměti, kterou chcete zrušit, a klepněte na příkaz Odebrat. Souisející úlohy: Vytoření tabulky mezipaměti na stránce 169 Zrušení tabulky materializoaných dotazů z tabulky mezipaměti na stránce Příručka pro federoané systémy

185 Kapitola 15. Informační podmínky pro přezdíky e federoaném systému Tato kapitola popisuje, jak se mají použíat informační podmínky pro přezdíky. Obsah této kapitoly: Informační podmínky přezdíkách Zadání informačních podmínek přezdíkách Zadání informačních podmínek přezdíkách - příklady na stránce 174 Informační podmínky přezdíkách Informační podmínky jsou praidla, která může optimalizátor použít ke zlepšení ýkonu, ale která nejsou ynucena sprácem databáze. Informační podmínky můžete použít přezdíkách za účelem ylepšení ýkonu dotazů na zdálené zdroje dat. Pro přezdíky lze definoat následující typy informačních podmínek: Referenční podmínky Kontrolní podmínky Podmínky funkční záislosti Podmínky primárního klíče Podmínky jedinečnosti Souisející koncepce: Constraints příručce SQL Reference, Volume 1 Souisející úlohy: Zadání informačních podmínek přezdíkách na stránce 173 Souisející odkazy: Zadání informačních podmínek přezdíkách - příklady na stránce 174 Zadání informačních podmínek přezdíkách Chcete-li ylepšit ýkon některých dotazů na zdálené zdroje dat, můžete k přezdíkám přidat informační podmínky. Federoaný serer šak podmínky neynucuje ani nekontroluje. U relačních zdrojů dat můžete zadat informační podmínky při změně přezdíky. U nerelačních zdrojů dat můžete zadat informační podmínky při ytáření nebo změně přezdíky. Omezení: Po definoání informačních podmínek přezdíce nelze měnit jména sloupců pro danou přezdíku, pokud neodeberete informační podmínky. Postup: Copyright IBM Corp. 1998,

186 Informační podmínky pro přezdíku můžete zadat Řídicím centru DB2 nebo z příkazoého řádku DB2. Chcete-li proést tuto úlohu pomocí Řídicího centra DB2, postupujte takto: 1. Vyberte složku Přezdíky: Pokud ytáříte přezdíku, podokně podrobností Řídicího centra DB2 klepněte seznamu akcí na položku Vytořit přezdíky. Oteře se průodce přezdíkami. Z okna průodce přezdíkami oteřete zápisník Přidat přezdíku nebo Vlastnosti pro danou přezdíku: Pokud plánujete ytoření jedné přezdíky, klepněte na tlačítko Přidat. Oteře se zápisník Přidat přezdíku. Pokud jste seznam přezdíek ygeneroali pomocí funkce zjišťoání, yberte přezdíku, ke které chcete přidat informační podmínky. Potom klepněte na tlačítko Vlastnosti. Oteře se zápisník Vlastnosti. Pokud měníte přezdíku, klepněte na přezdíku, kterou chcete změnit. V podokně podrobností objektů Řídicího centra DB2 klepněte seznamu akcí na položku Změnit. Oteře se okno Změnit přezdíku. 2. Na stránce Klíče nastate pro přezdíku podmínky referenční integrity. Nastait lze podmínku primárního klíče, jedinečného klíče nebo cizího klíče. 3. Na stránce Kontrolní podmínky nastate kontrolní podmínky nebo podmínky funkční záislosti pro přezdíku. 4. Klepnutím na tlačítko OK nastate informační podmínky a zařete zápisník. Chcete-li proést tuto úlohu z příkazoého řádku DB2, postupujte takto: Zadejte příkaz CREATE NICKNAME nebo ALTER NICKNAME s příslušnou sadou atributů podmínky. Souisející koncepce: Primary keys příručce Administration Guide: Planning Informační podmínky přezdíkách na stránce 173 Souisející odkazy: Zadání informačních podmínek přezdíkách - příklady na stránce 174 Zadání informačních podmínek přezdíkách - příklady Následující příklady uádějí použití informačních podmínek přezdíkách. Informační kontrolní podmínka V následující zdálené tabulce mají data e sloupci Plat ždy yšší hodnotu než CREATE TABLE account.salary ( empno INTEGER NOT NULL PRIMARY KEY, salary INTEGER NOT NULL ); Vytořte přezdíku pro tuto tabulku: CREATE NICKNAME account.salary FOR myser.account.salary; Potom přidejte informační kontrolní podmínku pro přezdíku zadáním následujícího příkazu: 174 Příručka pro federoané systémy

187 ALTER NICKNAME account.salary ADD CONSTRAINT cons1 CHECK( salary > ) NOT ENFORCED ENABLE QUERY OPTIMIZATION; Informační referenční podmínka: přezdíka - přezdíka V tomto příkladu se pracuje se děma přezdíkami: N1 a N2. Sloupec F1 přezdíky N2 obsahuje hodnotu klíče e sloupci P1 přezdíky N1. Zadáním následujícího příkazu můžete definoat referenční podmínku přezdíce N2: ALTER NICKNAME SCHEMA1.N2 ADD CONSTRAINT ref1 FOREIGN KEY (F1) REFERENCES SCHEMA1.N1 (P1) NOT ENFORCED; Informační referenční podmínka: přezdíka - tabulka V tomto příkladu obsahuje přezdíka N3 se sloupcem F1 hodnotu klíče e sloupci P1 tabulky T1. Zadáním následujícího příkazu můžete definoat referenční podmínku přezdíce N3: ALTER NICKNAME SCHEMA1.N3 ADD CONSTRAINT ref1 FOREIGN KEY (F1) REFERENCES SCHEMA1.T1 (P1) NOT ENFORCED; Informační referenční podmínka: tabulka - přezdíka V tomto příkladu obsahuje tabulka T2 se sloupcem F1 hodnotu klíče e sloupci P1 přezdíky N4. Zadáním následujícího příkazu můžete definoat referenční podmínku tabulce T2: ALTER TABLE SCHEMA1.T2 ADD CONSTRAINT ref1 FOREIGN KEY (F1) REFERENCES SCHEMA1.N4 (P1) NOT ENFORCED; Funkční záislost V tomto příkladu dojice sloupců C1 a C2 jedinečně určuje hodnotu e sloupci P1. Zadáním následujícího příkazu můžete definoat funkční záislost: ALTER NICKNAME SCHEMA1.NICK1 ADD CONSTRAINT FD1 CHECK( P1 DETERMINED BY (C1,C2) ) NOT ENFORCED ENABLE QUERY OPTIMIZATION; Tabulkoý soubor Tento příklad uádí, jak se má definoat primární klíč pro soubor s tabulkoou strukturou. CREATE NICKNAME MY_FILE ( X INTEGER NOT NULL, Y INTEGER, PRIMARY KEY (X) NOT ENFORCED ) FOR SERVER MY_SERVER OPTIONS(FILE_PATH /usr/pat/drugdata1.txt ); Hězdicoá schémata Následující příklad uádí čtyři tabulky dimenzí a jednu tabulku faktů. CREATE TABLE SCHEMA.FACT ( LOCATION_CODE INTEGER NOT NULL, PRODUCT_CODE INTEGER NOT NULL, CUSTOMER_CODE INTEGER NOT NULL, SDATE DATE NOT NULL, SALES INTEGER NOT NULL ); CREATE TABLE SCHEMA.LOCATION ( LOCATION_CODE INTEGER NOT NULL PRIMARY KEY, STATE CHAR(2) NOT NULL, Kapitola 15. Informační podmínky pro přezdíky e federoaném systému 175

188 ); SHOP_ID... INTEGER NOT NULL, CREATE TABLE SCHEMA.PRODUCT ( PRODUCT_CODE INTEGER NOT NULL PRIMARY KEY, PRODUCT_CAT INTEGER NOT NULL, PRODUCT_NAME VARCHAR(20) NOT NULL,... ); CREATE TABLE SCHEMA.CUSTOMER ( CUSTOMER_CODE INTEGER NOT NULL PRIMARY KEY, NAME VARCHAR(20) NOT NULL, TEL VARCHAR(10) NOT NULL,... ); CREATE TABLE SCHEMA.TIMEDIM ( SDATE DATE NOT NULL UNIQUE, YEAR INTEGER NOT NULL, QUARTER INTEGER NOT NULL,... ); Federoaný serer ytoří následující přezdíky pro tabulku faktů a čtyři tabulky dimenzí: CREATE NICKNAME SCHEMA.FACT FOR SERVER.SCHEMA.FACT; CREATE NICKNAME SCHEMA.LOCATION FOR SERVER.SCHEMA.LOCATION; CREATE NICKNAME SCHEMA.PRODUCT FOR SERVER.SCHEMA.PRODUCT; CREATE NICKNAME SCHEMA.CUSTOMER FOR SERVER.SCHEMA.CUSTOMER; CREATE NICKNAME SCHEMA.TIMEDIM FOR SERVER.SCHEMA.TIMEDIM; Můžete definoat následující ztah cizího klíče: ALTER NICKNAME SCHEMA.FACT ADD CONSTRAINT L1 FOREIGN KEY (LOCATION_CODE) REFERENCES SCHEMA.LOCATION(LOCATION_CODE) NOT ENFORCED ENABLE QUERY OPTIMIZATION; ALTER NICKNAME SCHEMA.FACT ADD CONSTRAINT P1 FOREIGN KEY (PRODUCT_CODE) REFERENCES SCHEMA.PRODUCT(PRODUCT_CODE) NOT ENFORCED ENABLE QUERY OPTIMIZATION; ALTER NICKNAME SCHEMA.FACT ADD CONSTRAINT C1 FOREIGN KEY (CUSTOMER_CODE) REFERENCES SCHEMA.CUSTOMER(CUSTOMER_CODE) NOT ENFORCED ENABLE QUERY OPTIMIZATION; ALTER NICKNAME SCHEMA.FACT ADD CONSTRAINT S1 FOREIGN KEY (SDATE) REFERENCES SCHEMA.TIMEDIM(SDATE) NOT ENFORCED ENABLE QUERY OPTIMIZATION; Pokud je hodnota sloupce TEL přezdíce CUSTOMER jedinečná, můžete přidat následující informační podmínku jedinečnosti: ALTER NICKNAME SCHEMA.CUSTOMER ADD CONSTRAINT U1 UNIQUE( TEL ) NOT ENFORCED ENABLE QUERY OPTIMIZATION; Pokud hodnota sloupce SHOP_ID přezdíce LOCATION jednoznačně určuje hodnotu sloupce LOCATION_ID, můžete definoat následující funkční záislost: ALTER NICKNAME SCHEMA.LOCATION ADD CONSTRAINT F1 CHECK( LOCATION_ID DETERMINED BY SHOP_ID ) NOT ENFORCED ENABLE QUERY OPTIMIZATION; Protože hodnota sloupce QUARTER přezdíce TIMEDIM spadá mezi hodnoty 1 a 4, můžete definoat následující informační kontrolní podmínku: 176 Příručka pro federoané systémy

189 ALTER NICKNAME SCHEMA.TIMEDIM ADD CONSTRAINT Q1 CHECK( QUARTER BETWEEN 1 AND 4 ) NOT ENFORCED ENABLE QUERY OPTIMIZATION; Příkazy tomto příkladu ytářejí přezdíky pro zdálené tabulky. Přezdíky mají primární klíče, pokud je mají také zdálené tabulky. Pokud ytoříte přezdíky pro pohledy, nebudou přezdíky mít primární klíče. V takoém případě můžete změnit přezdíku tak, aby přidáala informační podmínku primárního klíče. Příklad: CREATE NICKNAME SCHEMA.LOCATION FOR SERVER.SH.V_LOCATION; ALTER NICKNAME SCHEMA.LOCATION ADD CONSTRAINT P1 PRIMARY KEY ( LOCATION_CODE ) NOT ENFORCED; Souisející úlohy: Zadání informačních podmínek přezdíkách na stránce 173 Kapitola 15. Informační podmínky pro přezdíky e federoaném systému 177

190 178 Příručka pro federoané systémy

191 Kapitola 16. Statistika přezdíek Tato kapitola popisuje, jak lze získat statistiku přezdíek. Obsah této kapitoly: Prostředek pro aktualizaci statistiky přezdíek - přehled Načítání statistiky přezdíek na stránce 180 Načítání statistiky přezdíek z příkazoého řádku - příklady na stránce 182 Vytoření katalogu nástrojů DB2 na stránce 182 Zobrazení stau aktualizací statistických údajů o přezdíce na stránce 183 Prostředek pro aktualizaci statistiky přezdíek - přehled Zaregistrujete-li přezdíku pro objekt zdroje dat, federoaný serer přidá informace o daném objektu zdroje dat do systémoého katalogu e federoané databázi. Optimalizátor dotazů DB2 UDB použíá tyto informace k plánoání způsobu, jakým budou data načtena z objektu zdroje dat. Ve federoané databázi nejsou automaticky detekoány změny objektů zdrojů dat, informace systémoém katalogu proto mohou být neaktuální. Načtení statistiky pro přezdíku zajišťuje, aby optimalizátor dotazů při generoání plánů pro přístup k dotazu použíal aktuální informace o přezdíce. Můžete načíst aktuálně dostupné statistiky pro přezdíky databází, sloupce a indexy ze zdáleného zdroje dat. Lze načíst statistiku jedné přezdíky nebo šech přezdíek e schématu DB2 e specifické definici sereru DB2. Pokud jakákoli část načtení selže, databáze odolá změny. U relačních zdrojů dat a zdrojů dat ODBC, kde statistika není nastaena na ýchozí nastaení, můžete načíst následující statistiky, pokud jsou k dispozici e zdáleném zdroji: CARD FPAGES NPAGES OVERFLOW COLCARD HIGH2KEY LOW2KEY NLEAF NLEVELS CLUSTERFACTOR CLUSTERRATIO FULLKEYCARD FIRSTKEYCARD U nerelačních zdrojů dat a zdrojů dat ODBC, kde statistika není nastaena na ýchozí nastaení, můžete načíst následující statistiky, pokud jsou k dispozici e zdáleném zdroji: CARD COLCARD Copyright IBM Corp. 1998,

192 HIGH2KEY LOW2KEY FULLKEYCARD FIRSTKEYCARD Statistiku přezdíek můžete načíst pomocí Řídicího centra DB2 nebo příkazoého procesoru DB2. Statistiku přezdíek můžete načíst pro následující zdroje dat: BioRS Skupina produktů DB2 (DRDA) Documentum (kromě pseudosloupců) Informix Microsoft SQL Serer ODBC Oracle (NET8) Sybase (CTLIB) Soubory s tabulkoou strukturou Teradata XML ( kořenoé přezdíce) Statistiku přezdíek můžete načíst na federoaných sererech použíajících operační systémy Microsoft Windows 2000 a Windows NT, AIX, Solaris, HP-UX a Linux. Souisející úlohy: Načítání statistiky přezdíek na stránce 180 Zobrazení stau aktualizací statistických údajů o přezdíce na stránce 183 Souisející odkazy: Načítání statistiky přezdíek Načítání statistiky přezdíek z příkazoého řádku - příklady na stránce 182 Kapitola 32, Uložená procedura SYSPROC.NNSTAT, na stránce 289 Načtení statistiky pro přezdíku zajišťuje, aby optimalizátor dotazů použíal informace o přezdíce, které jsou aktuálně k dispozici e zdroji dat. Tím, že budete udržoat statistické informace o přezdíce aktuální, můžete zýšit ýkon dotazu. Statistika je šak pouze tak přesná a aktuální jako informace, které se aktuálně nacházejí e zdáleném zdroji. Předpoklady: Pokud pro aktualizaci statistiky použijete příkazoý řádek, je třeba splnit následující předpoklady: Federoaný serer ytáří soubor žurnálu na sereru. Adresáře, které uedete cestě, musejí existoat. V systému Windows zadejte cestu žurnálu pomocí dou zpětných lomítek. Například: c:\\temp\\nnstat.log. Omezení: 180 Příručka pro federoané systémy

193 Pokud se jméno nebo typ lokálního sloupce liší od jména nebo typu zdáleného sloupce, nenačte obslužný program pro aktualizaci statistiky přezdíek statistiku sloupců. Jméno užiatele, které použíáte pro připojení k federoané databázi, musí být mapoáno k tabulce zdáleného zdroje dat. Postup: Statistiku přezdíek můžete aktualizoat z Řídicího centra DB2 nebo z příkazoého řádku DB2. Chcete-li proést tuto úlohu pomocí Řídicího centra DB2, postupujte takto: 1. Vyberte přezdíky, pro které chcete načíst aktuální statistiku: Chcete-li aktualizoat statistiku pro šechny přezdíky asocioané s definicí sereru, postupujte takto: a. Rozbalte složku Federoané databázoé objekty. b. Rozbalte složku Definice sereru obsahující přezdíky, které chcete aktualizoat. c. Klepněte praým tlačítkem myši na jméno definice sereru a yberte příkaz Statistika. d. Vyberte olbu Aktualizoat. Oteře se zápisník Statistika - Aktualizoat. Chcete-li statistiku aktualizoat pro jednu přezdíku, rozbalte složku Přezdíky. a. Klepněte praým tlačítkem myši na přezdíku, kterou chcete aktualizoat, a pak klepněte na příkaz Statistika. b. Vyberte olbu Aktualizoat. Oteře se okno Statistika - Aktualizoat. 2. Pokud neexistuje katalog nástrojů DB2, zobrazí se okno, ze kterého lze katalog nástrojů DB2 ytořit. 3. Zadejte nastaení pro aktualizaci: Při aktualizaci statistiky pro šechny přezdíky asocioané s definicí sereru: a. Na stránce Přezdíky: Vyberte schéma asocioané s přezdíkami, pro které chcete aktualizoat statistiku. Neyberete-li schéma, federoaný serer aktualizuje statistiku pro šechny přezdíky asocioané s lokálním schématem. Vyberte existující soubor žurnálu nebo zadejte úplnou cestu pro noý soubor žurnálu. b. Na stránce Naplánoat zadejte, kdy se má aktualizace statistiky přezdíek spustit. Při aktualizaci statistiky pro jednu přezdíku zadejte, kdy se má aktualizace statistiky přezdíek spustit. Chcete-li proést tuto úlohu z příkazoého řádku nebo aplikaci, yolejte uloženou proceduru SYSPROC.NNSTAT. Souisející koncepce: Prostředek pro aktualizaci statistiky přezdíek - přehled na stránce 179 Souisející úlohy: Zobrazení stau aktualizací statistických údajů o přezdíce na stránce 183 Souisející odkazy: Načítání statistiky přezdíek z příkazoého řádku - příklady na stránce 182 Kapitola 32, Uložená procedura SYSPROC.NNSTAT, na stránce 289 Kapitola 16. Statistika přezdíek 181

194 Načítání statistiky přezdíek z příkazoého řádku - příklady V tomto příkladu načte federoaný serer statistiku pro šechny přezdíky na sereru DB2SERV a neytoří žurnál. CALL SYSPROC.NNSTAT( DB2SERV, NULL, NULL, NULL,?,?) V tomto příkladu načte federoaný serer statistiku pro přezdíku STAFF e schématu ADMIN. Federoaný serer zapíše žurnál do souboru /home/iiuser/reportlogs/log1.txt. CALL SYSPROC.NNSTAT( NULL, ADMIN, STAFF, /home/iiuser/reportlogs/log1.txt,?,?) V tomto příkladu načte federoaný serer statistiku pro šechny přezdíky na sereru DB2Ser e schématu ADMIN. Federoaný serer zapíše žurnál do souboru /home/iiuser/stats/recent.log. CALL SYSPROC.NNSTAT( DB2Ser, admin, NULL, /home/iiuser/stats/recent.log,?,?) Souisející koncepce: Prostředek pro aktualizaci statistiky přezdíek - přehled na stránce 179 Souisející úlohy: Načítání statistiky přezdíek na stránce 180 Vytoření katalogu nástrojů DB2 Při aktualizaci statistiky pro přezdíku můžete pomocí katalogu nástrojů DB2 aktualizaci naplánoat. Plánoání aktualizace je k dispozici pouze pomocí Řídicího centra DB2. Nemáte-li katalog nástrojů DB2, budete k jeho ytoření yzáni. Předpoklady: Musí být nainstaloán DB2 Administration Serer. Postup: Katalog nástrojů DB2 můžete ytořit z Řídicího centra DB2 nebo z příkazoého řádku. Chcete-li proést tuto úlohu pomocí Řídicího centra DB2, postupujte takto: 1. Při aktualizaci statistiky přezdíek se zobrazí okno Statistika - Aktualizoat. 2. Vyberte systém, e kterém chcete ytořit databázi pro katalog nástrojů DB2. Databáze musí být umístěna katalogizoaném systému, který aktuálně nemá žádné úložiště metadat. Není-li požadoaný systém katalogizoán, je nutné jej před ytořením databáze pro katalog nástrojů DB2 katalogizoat. Souisející úlohy: Načítání statistiky přezdíek na stránce 180 Tools catalog database and DAS scheduler setup and configuration příručce Administration Guide: Implementation Souisející odkazy: CREATE TOOLS CATALOG Command příručce Command Reference 182 Příručka pro federoané systémy

195 Zobrazení stau aktualizací statistických údajů o přezdíce Po yžádání aktualizace statistických údajů o přezdíce můžete zobrazit sta aktualizace. Tyto informace lze yužít k yhodnocení ýkonu dotazů. Postup: Sta aktualizací statistiky přezdíek můžete zobrazit z Řídicího centra DB2 nebo z příkazoého řádku DB2. Chcete-li proést tuto úlohu pomocí Řídicího centra DB2, postupujte takto: 1. Vyberte přezdíky, pro které chcete zobrazit sta aktualizací: Chcete-li zobrazit sta aktualizací pro šechny přezdíky asocioané se specifickou definicí sereru, postupujte takto: a. Rozbalte složku Federoané databázoé objekty. b. Rozbalte složku Definice sereru obsahující přezdíky, které chcete aktualizoat. c. Klepněte praým tlačítkem myši na jméno definice sereru a yberte příkaz Statistika. Chcete-li zobrazit sta aktualizací pro specifickou přezdíku, rozbalte složku Přezdíky. a. Vyberte přezdíku, kterou chcete aktualizoat. b. Klepněte praým tlačítkem myši na tuto přezdíku a yberte příkaz Statistika. 2. Vyberte olbu Zobrazit ýsledky. Oteře se okno Statistika - Zobrazit ýsledky. Chcete-li proést tuto úlohu z příkazoého řádku, yhledejte historii aktualizací tabulce SYSPROC.FED_STATS. Souisející koncepce: Prostředek pro aktualizaci statistiky přezdíek - přehled na stránce 179 Souisející úlohy: Načítání statistiky přezdíek na stránce 180 Souisející odkazy: Načítání statistiky přezdíek z příkazoého řádku - příklady na stránce 182 Kapitola 16. Statistika přezdíek 183

196 184 Příručka pro federoané systémy

197 Část 4. Programoání aplikací Copyright IBM Corp. 1998,

198 186 Příručka pro federoané systémy

199 Kapitola 17. Scénář programoání aplikací Z následujících referenčních příruček se dozíte, jak použíat produkt DB2 Information Integrator s portálem IBM Websphere Portal k ýoji aplikací: IBM Websphere Portal and DB2 Information Integrator na weboé adrese Sample code from the scenario (Ukázkoý kód ze scénáře) na weboé adrese ftp://www.redbooks.ibm.com/redbooks/sg246433/ Copyright IBM Corp. 1998,

200 188 Příručka pro federoané systémy

201 Kapitola 18. Programoání aplikací pro federoané systémy Tato kapitola pojednáá o problémech, které musejí programátoři zážit při ýoji aplikací pro federoané systémy. Podrobné informace o programoání aplikací uádějí příručky: IBM DB2 Uniersal Database Application Deelopment Guide: Building and Running Applications Version 8 IBM DB2 Uniersal Database Application Deelopment Guide: Programming Client Applications Version 8 Interakce klientských aplikací se zdroji dat Klientským aplikacím se zdroje dat e federoaném systému jeí jako jediná souhrnná databáze. Za účelem získání dat ze zdrojů dat odesílají aplikace dotazy jazyce DB2 SQL do federoané databáze. Systém DB2 UDB poté dotazy distribuuje do příslušných zdrojů dat a poté narátí tato data aplikacím nebo proede požadoanou akci. Ve federoané databázi mohou být spojena data z lokálních tabulek i ze zdálených zdrojů, jako kdyby šechna data byla lokální. V rámci jediného příkazu SQL můžete například spojit data umístěná lokální tabulce DB2 pro systém Windows, tabulce Informix a pohledu Sybase. Při zpracoání příkazů SQL stejným způsobem, jako kdyby zdroje dat byly běžnými relačními tabulkami nebo pohledy rámci federoané databáze, může federoaný systém spojit relační data s daty nerelačních formátech. Ve federoaném systému je přístup k datoým zdrojům získáán pomocí přezdíek. Přezdíka je identifikátor použíaný aplikací k odkazům na objekt zdroje dat (například na tabulku nebo pohled). Při zápisu do zdroje dat, například při aktualizaci tabulky zdroje dat, může aplikace použíat jazyk DB2 SQL (s přezdíkami). Aplikace mohou také použíat dialekt jazyka SQL zdroje dat (bez přezdíek) pro přímý přístup ke zdrojům dat e speciální relaci, nazýané průchozí. Aplikace použíající jazyk DB2 SQL s přezdíkami mohou získat přístup ke šem datoým typům, které systém DB2 UDB rozpoznáá. Systémoý katalog federoané databáze obsahuje informace o objektech e federoané databázi a informace o objektech e zdrojích dat. Vzhledem k tomu, že katalog obsahuje údaje o celém federoaném systému, je označoán jako globální katalog. Souisející koncepce: Odesílání dotazů do zdrojů dat přímo prostřednictím průchozí relace na stránce 200 Souisející úlohy: Odkazoání na objekty datoých zdrojů příkazech SQL pomocí přezdíek na stránce 190 Přezdíky příkazech DDL na stránce 190 Aplikace s liem na statistické údaje o zdrojích dat na stránce 191 Přezdíky s možností yolání uložených procedur na stránce 192 Definoání oleb sloupce pro přezdíky na stránce 192 Přístup ke zdrojům dat pomocí průchozích relací na stránce 100 Copyright IBM Corp. 1998,

202 Práce s přezdíkami aplikacích Odkazoání na objekty datoých zdrojů příkazech SQL pomocí přezdíek Ve federoaném systému není nutné příkazech SQL identifikoat serer, schéma a objekt zdroje dat. Namísto toho se lze na objekty zdrojů dat příkazech SQL dotazoat pomocí přezdíek, které jsou pro objekty zdrojů dat definoány. Přezdíky pro objekty zdrojů dat musí být před zařazením do dotazů registroány e federoané databázi. Použití přezdíek příkazech SELECT, INSERT, UPDATE a DELETE: Předpokládejme, že definujete přezdíku NFXDEPT reprezentující tabulku tabulce Informix se jménem PERSON.DEPT, kde: PERSON je schéma zdroje dat, DEPT je jméno tabulky zdroje dat. Pro federoaný serer je poolen příkaz SELECT * FROM NFXDEPT. Příkaz SELECT * FROM PERSON.DEPT šak poolen není (s ýjimkou průchozí relace). Přezdíka PERSON.DEPT není pro federoaný serer registroána. Použití přezdíek příkazu CREATE TABLE: Předpokládejme, že chcete ytořit lokální tabulku materializoaného dotazu (MQT) založenou na tabulce, pro kterou byla definoána přezdíka. Příklad příkazu CREATE TABLE: CREATE TABLE jméno_tabulky LIKE přezdíka Souisející koncepce: Odesílání dotazů do zdrojů dat přímo prostřednictím průchozí relace na stránce 200 Souisející úlohy: Federoaná průchozí relace - některé aspekty a omezení na stránce 201 Průchozí relace pro zdroje dat Oracle na stránce 201 Přezdíky příkazech DDL Přezdíky pro objekty zdrojů dat musí být před ložením do příkazů DDL zaregistroány e federoané databázi. Několik příkladů příkazů DDL pro použití e federoaných systémech: Použití přezdíek příkazu COMMENT ON: Příkaz COMMENT ON umožňuje přidat nebo nahradit komentáře globálním katalogu federoané databáze. Příkaz COMMENT ON je platný pro přezdíky a pro sloupce definoané pro přezdíky. Tento příkaz neaktualizuje katalogy zdrojů dat. Použití přezdíek příkazech GRANT a REVOKE: Příkazy GRANT a REVOKE jsou platné s přezdíkou pro určitá opránění a pro šechny užiatele a skupiny. Systém DB2 UDB šak neydá odpoídající příkaz GRANT či REVOKE pro objekt e zdroji dat, na který přezdíka odkazuje. 190 Příručka pro federoané systémy

203 Předpokládejme například, že užiatel JON ytoří přezdíku pro tabulku Oracle, která nemá žádný index. Přezdíka je ORAREM1. Později definuje administrátor databáze Oracle pro tuto tabulku index. Užiatelka EILEEN nyní chce zajistit, aby federoaná databáze DB2 obsahoala informaci o existenci tohoto indexu a aby optimalizátor dotazů mohl následně narhnout strategii pro efektinější přístup k tabulce. EILEEN může informoat federoanou databázi o existenci noého indexu ytořením specifikace indexu pro tabulku s přezdíkou ORAREM1. Informace o indexu jsou uloženy pohledu katalogu SYSSTAT.INDEXES. Pomocí příkazu GRANT můžete užiatelce EILEEN udělit opránění pro indexy pro tuto přezdíku, což jí umožní ytářet specifikace indexů. GRANT INDEX ON NICKNAME ORAREM1 TO USER EILEEN Chcete-li užiatelce EILEEN odebrat opránění pro ytáření specifikací indexů pro přezdíku ORAREM1, použijte příkaz REVOKE: REVOKE INDEX ON ORAREM1 FROM USER EILEEN Souisející úlohy: Vytoření specifikací indexu pro objekty zdroje dat na stránce 68 Příkazy SQL, které lze použít s přezdíkami na stránce 94 Souisející odkazy: COMMENT statement příručce SQL Reference, Volume 2 GRANT (Table, View, or Nickname Priileges) statement příručce SQL Reference, Volume 2 REVOKE (Table, View, or Nickname Priileges) statement příručce SQL Reference, Volume 2 Aplikace s liem na statistické údaje o zdrojích dat Je-li pro některý objekt zdroje dat ytořena přezdíka, bude globální katalog federoané databáze aktualizoán s použitím informací o tomto objektu. Optimalizátor dotazů DB2 yužije tyto informace při plánoání postupu pro načítání dat z objektu. Je proto důležité zajistit aktuálnost informací o zdroji dat. Federoaná databáze automaticky nedetekuje změny objektech zdroje dat. Statistické údaje katalogu uložené globálním katalogu: Údaje o objektu zdroje dat uložené globálním katalogu záisí na typu daného objektu. Pro tabulky a pohledy databáze je globálním katalogu uloženo jméno objektu a jména a atributy sloupců. V případě tabulky tyto údaje obsahují další informace: Statistické informace. Mezi ně patří například počet řádků a počet stránek, na nichž se tyto řádky nacházejí. Zajistěte, aby produkt DB2 UDB obdržel ždy aktuální statistické údaje. Před ytořením přezdíky spusťte pro danou tabulku příkaz zdroje dat ekialentní příkazu RUNSTATS. Popisy indexů. Pokud nemá tabulka žádné indexy, můžete do katalogu ložit metadata, která jsou definici indexu obykle obsažena. Můžete do katalogu zadat například informace o tom, které sloupce tabulce mají jedinečné hodnoty a zda jsou jedinečné některé řádky. Tato metadata, souhrnně označoaná jako specifikace indexu, lze generoat pomocí příkazu CREATE INDEX s odkazem na přezdíku pro danou tabulku. Chcete-li ytořit pouze specifikaci indexu, zadejte příkazu CREATE INDEX klauzuli SPECIFICATION ONLY. V takoém případě nechcete ytořit skutečný index. Kapitola 18. Programoání aplikací pro federoané systémy 191

204 Chcete-li určit, jaké údaje o zdroji dat jsou uloženy globálním katalogu, zadejte dotaz pro pohledy katalogu SYSCAT.TABLES a SYSCAT.COLUMNS. Chcete-li určit, jaké údaje o indexu jsou uloženy katalogu nebo jaké specigické specifikace indexu jsou zde obsaženy, zadejte dotaz pro pohled katalogu SYSCAT.INDEXES. Úpraa aplikací a změna odkazů z pohledu SYSCAT na pohled SYSSTAT: Pohledy SYSCAT DB2 erze 8 jsou nyní určeny pouze pro čtení. Pokud zadáte pro pohled e schématu SYSCAT příkaz UPDATE nebo INSERT, dojde k selhání. Doporučeným způsobem aktualizace systémoého katalogu je použití pohledů SYSSTAT. Uprate aplikace tak, aby namísto odkazů na pohled SYSCAT odkazoaly na pohled SYSSTAT. Souisející koncepce: Catalog statistics příručce Administration Guide: Performance Catalog statistics tables příručce Administration Guide: Performance Federoaná databáze na stránce 7 Souisející úlohy: Vytoření specifikací indexu pro objekty zdroje dat na stránce 68 Charakteristika přezdíek oliňující globální optimalizaci na stránce 140 Souisející odkazy: SYSCAT.COLUMNS catalog iew příručce SQL Reference, Volume 1 SYSCAT.INDEXES catalog iew příručce SQL Reference, Volume 1 SYSCAT.TABLES catalog iew příručce SQL Reference, Volume 1 Kapitola 19, Pohledy globální tabulce katalogu obsahující federoané informace, na stránce 205 Přezdíky s možností yolání uložených procedur Pokud migrujete z produktu DataJoiner aplikace, které yoláají uložené procedury pomocí přezdíek, bude nutné tyto aplikace uprait. Produkt DB2 Information Integrator aktuálně nepodporuje možnost yolání uložených procedur pomocí přezdíek. Definoání oleb sloupce pro přezdíky Volby sloupce jsou parametry zadáané příkazech CREATE NICKNAME a ALTER NICKNAME. Volby sloupce lze zadat při počátečním ytoření přezdíky nebo úpraou existující přezdíky. Údaje zadáané pomocí oleb sloupce jsou ukládány globálním katalogu. Nerelační zdroje dat Volby sloupce jsou pro každý nerelační modul wrapper jedinečné. Tyto olby jsou obykle nastaeny při zadání příkazu CREATE NICKNAME. Relační zdroje dat Pro relační zdroje dat lze použít dě olby sloupce: NUMERIC_STRING a VARCHAR_NO_TRAILING_BLANKS. Nastaení olby sloupce NUMERIC_STRING Pokud sloupec numerického řetězce e zdroji dat obsahuje pouze numerické číslice a neobsahuje žádné jiné znaky ani mezery, nastate olbu sloupce NUMERIC_STRING na 192 Příručka pro federoané systémy

205 hodnotu Y. Tímto způsobem je umožněna optimalizace dotazů, které použíají tento sloupec, pro operace řazení a operace poronáání. Příklad: ALTER NICKNAME přezdíka ALTER COLUMN jméno_lokálního_sloupce OPTIONS (SET NUMERIC_STRING Y ) Nastaení olby sloupce VARCHAR_NO_TRAILING_BLANKS Některé zdroje dat (například Oracle) nepoužíají stejnou logiku pro poronáání řetězců doplněných mezerami, jaká je použita produktu DB2 for Linux, UNIX, and Windows. To se týká datoých typů, jako je například VARCHAR a VARCHAR2. V důsledku toho musí být predikáty zahrnující tyto datoé typy přepsány optimalizátorem dotazů za účelem zajištění konzistentních ýsledků dotazů. Přepsání příkazů pro dotazy může mít li na ýkon. Nastaení této olby pro určitý sloupec poskytuje údaje o daných sloupcích optimalizátoru dotazů, který na jejich základě může generoat efektinější příkazy SQL. Příklad: ALTER NICKNAME přezdíka ALTER COLUMN jméno_lokálního_sloupce OPTIONS (SET VARCHAR_NO_TRAILING_BLANKS Y ) Souisející odkazy: Kapitola 24, Volby sloupců přezdíek pro federoané systémy, na stránce 235 Vytáření a použití federoaných pohledů Pohled e federoané databázi, jehož základní tabulky jsou umístěny e zdálených zdrojích dat, je označoán jako federoaný pohled. Na základní tabulky je e federoaném pohledu odkazoáno pomocí přezdíek, namísto použití jmen tabulek zdroje dat. Výhody použití federoaných pohledů jsou obdobné jako ýhody při použití pohledů definoaných na základě íce lokálních tabulek centralizoaném spráci relačních databází: Pohledy poskytují integroanou reprezentaci dat. Z pohledu lze yloučit sloupce, které obsahují citliá nebo důěrná data. Omezení: Federoané pohledy ytořené na základě íce objektů zdroje dat jsou pohledy určené pouze pro čtení a nelze je aktualizoat. Federoané pohledy ytořené na základě pouze jednoho objektu zdroje dat mohou a nemusí být pohledy určené pouze pro čtení. Federoaný pohled ytořený na základě jediného nerelačního zdroje dat je určen pouze pro čtení. Federoaný pohled ytořený na základě jednoho relačního zdroje dat umožňuje aktualizace záislosti na údajích zahrnutých příkazu CREATE VIEW. Postup: Federoaný pohled je ytořen z objektů zdroje dat, které mají přezdíky. Akce ytoření pohledu federoané databáze na základě dat ze zdroje dat se někdy nazýá také ytoření pohledu na přezdíce. Tato fráze odráží fakt, že aby bylo možné daný federoaný pohled ytořit, musí plný ýběr příkazu CREATE VIEW odkazoat na přezdíku každé tabulky a pohledu zdroje dat, které mají být e federoaném pohledu obsaženy. Kapitola 18. Programoání aplikací pro federoané systémy 193

206 Příklad: Vytoření federoaného pohledu, který slučuje obdobná data z několika objektů zdroje dat: Předpokládejme, že máte data o zákaznících uložena na třech samostatných sererech: jednom Eropě, jednom Asii a jednom Jižní Americe. Data o eropských zákaznících jsou uložena tabulce Oracle. Přezdíka pro tuto tabulku je ORA_EU_CUST. Data o asijských zákaznících jsou uložena tabulce Sybase. Přezdíka pro tuto tabulku je SYB_AS_CUST. Data o zákaznících Jižní Americe jsou uložena tabulce Informix. Přezdíka pro tuto tabulku je INFMX_SA_CUST. Každá tabulka má sloupce obsahující číslo zákazníka (CUST_NO), jméno zákazníka (CUST_NAME), číslo produktu (PROD_NO) a objednané množstí (QUANTITY). Syntaxe příkazu pro ytoření pohledu z těchto tří přezdíek, který sloučí data o zákaznících, bude ypadat následoně: CREATE VIEW FV1 AS SELECT * FROM ORA_EU_CUST UNION SELECT * FROM SYB_AS_CUST UNION SELECT * FROM INFMX_SA_CUST Příklad: Spojení dat za účelem ytoření federoaného pohledu: Předpokládejme, že máte data o zákaznících uložena na jednom sereru a data o prodeji na jiném sereru. Data o zákaznících jsou uložena tabulce Oracle. Přezdíka pro tuto tabulku je ORA_EU_CUST. Data o prodeji jsou uložena tabulce Sybase. Přezdíka pro tuto tabulku je SYB_SALES. Nyní chcete spároat údaje o zákaznících s údaji o nákupech proedených těmito zákazníky. Každá tabulka má sloupec obsahující číslo zákazníka (CUST_NO). Syntaxe příkazu pro ytoření federoaného pohledu z těchto dou přezdíek, který spojí uedená data, bude ypadat následoně: CREATE VIEW FV4 AS SELECT A.CUST_NO, A.CUST_NAME, B.PROD_NO, B.QUANTITY FROM ORA_EU_CUST A, SYB_SALES B WHERE A.CUST_NO=B.CUST_NO Souisející úlohy: Přístup k heterogenním datům prostřednictím federoaných pohledů na stránce 101 Souisející odkazy: CREATE VIEW statement příručce SQL Reference, Volume 2 Použití úroně oddělení pro zachoání integrity dat Úroeň oddělení asocioaná s procesem aplikace definuje stupeň oddělení tohoto procesu aplikace od další souběžně spuštěných procesů aplikací. Úroeň oddělení je specifikoána jako atribut balíku, který se týká procesů aplikací yužíajících tento balík. Úroně oddělení jsou použíány při přípraě aplikací nebo při ytáření azby aplikací. Pro řádek základní tabulky je je aktioán zámek. Spráce databáze šak může nahradit íce zámků řádků jedním zámkem tabulky. Tento postup se označuje jako eskalace zámku. Procesu aplikace je zajištěna alespoň minimální požadoaná úroeň uzamknutí. Integritu dat pro tabulku zdroje dat lze zajistit požadakem, aby řádky tabulky byly uzamknuty na specifické úroni oddělení. Chcete-li si například zajistit ýhradní přístup k některému řádku, určete pro tento řádek úroeň oddělení Opakoatelné čtení (RR). Federoaný serer mapuje požadoanou úroeň oddělení na odpoídající úroeň e zdroji dat. Při každém připojení ke zdroji dat určuje modul wrapper úroeň oddělení produktu DB2 194 Příručka pro federoané systémy

207 for Linux, UNIX, and Windows. Úroeň oddělení e zdáleném zdroji dat je nastaena na ekialentní úroeň. Pokud není k dispozici přesný ekialent, federoaný serer nastaí úroeň oddělení na následující přísnější úroeň. Jakmile je ytořeno připojení ke zdroji dat, nelze po dobu trání připojení úroeň oddělení změnit. Úroně oddělení jsou následující: CS RR RS UR Postup: Stabilita kurzoru Opakoatelné čtení Stabilita čtení Nepotrzené čtení V následující tabulce jsou uedeny úroně oddělení, které lze podporoaných zdrojích dat požadoat. Tabulka 17. Sronatelné úroně oddělení mezi federoaným sererem a podporoanými zdroji dat. Federoaný serer DB2 Skupina produktů DB2 Stabilita kurzoru Opakoatelné čtení Stabilita čtení Nepotrzené čtení Stabilita kurzoru Opakoatelné čtení Stabilita čtení Nepotrzené čtení Informix Stabilita kurzoru Opakoatelné čtení Opakoatelné čtení Nečisté čtení Microsoft SQL Serer Read commited Serializable Repeatable read Read Uncommited ODBC Read commited Serializable Repeatable read Read Uncommited Oracle Read commited Serializable Serializable Read commited Sybase Leel 1 Leel 3 Leel 3 Leel 0 Zdroje dat OLE DB, Teradata a nerelační zdroje dat nemají koncept podobný úroním oddělení, jak jsou použíány produktu DB2 for Linux, UNIX, and Windows. Mezi úroněmi oddělení produktu DB2 a zdroji dat OLE DB, Teradata či nerelačními zdroji dat neexistuje žádné mapoání. Souisející koncepce: Isolation leels příručce SQL Reference, Volume 1 Applications in Host or iseries Enironments příručce Application Deelopment Guide: Programming Client Applications Interakce klientských aplikací se zdroji dat na stránce 189 Federoaná podpora objektů LOB Ve federoaných databázoých systémech můžete přistupoat k objektům LOB umístěným e zdálených zdrojích dat a manipuloat s nimi. Vzhledem k tomu, že objekty LOB mohou být elmi rozsáhlé, může být jejich přenos ze zdálených zdrojů dat časoě elmi náročný. Federoaná databáze DB2 se pokouší minimalizoat přenosy dat LOB ze zdrojů dat a také se pokouší přenést data LOB přímo ze zdroje dat do žádající aplikace bez jejich materializace systému DB2 UDB. Kapitola 18. Programoání aplikací pro federoané systémy 195

208 Federoaný systém podporuje operace SELECT na objektech LOB e zdrojích dat DRDA, Informix, Microsoft SQL Serer, Oracle a Sybase. Příklad: SELECT jméno_zam, obr FROM tab_zam_infmx WHERE č_zam = kde obr reprezentuje sloupec objektu LOB a tab_zam_infmx reprezentuje přezdíku odkazující na tabulku Informix s údaji o zaměstnancích. Federoaný systém podporuje operace SELECT, INSERT, UPDATE a DELETE na objektech LOB e zdrojích dat Oracle (erze 8 nebo yšší). V následující tabulce jsou uedeny operace čtení a zápisu podporoané produktem DB2 for Linux, UNIX, and Windows erze 8: Tabulka 18. Podpora čtení a zápisu pro objekty LOB Zdroj dat Skupina produktů DB2 1 BioRS BLAST Entrez HMMER Informix Microsoft SQL Serer Oracle (modul wrapper NET8) ODBC Sybase Teradata Weboé služby WebSphere Business Integration XML Poznámky: Typ operace pouze pro čtení pouze pro čtení čtení a nitřní azba pouze pro čtení čtení a nitřní azba pouze pro čtení pouze pro čtení čtení a zápis pouze pro čtení pouze pro čtení pouze pro čtení pouze pro čtení a nější azba pouze pro objekty CLOB pouze pro čtení a nější azba pouze pro objekty CLOB pouze pro čtení 1. Pro podoru objektů LOB je yžadoán produkt DB2 UDB for iseries erze 5 (nebo yšší). V produktu DB2 Information Integrator erze 8 nelze přistupoat k datům LOB produktu DB2 UDB for Linux, UNIX, and Windows erze 7. Objekty LOB systému Teradata Objekty LOB systému Teradata se mírně liší od objektů LOB systému DB2. V systému Teradata neexistují žádné datoé typy tak rozměrné jako objekty LOB podporoané systému DB2 UDB. Existují zde šak některé datoé typy Teradata, které mohou být až bajtů dlouhé. Těmito datoými typy jsou: CHAR, VARCHAR, BYTE, VARBYTE, GRAPHIC a VARGRAPHIC. Tyto datoé typy systému Teradata jsou případech, kdy délka datoého typu Terradata překračuje omezení odpoídajícího datoého typu systému DB2, mapoány na datoé typy LOB systému DB2. Délky objektů LOB V některých zdrojích dat (například Oracle či Informix) nejsou příslušných systémoých katalozích uloženy délky sloupců LOB. Vytoříte-li pro tabulku přezdíku, jsou ze systémoého katalogu zdroje dat načteny příslušné informace, 196 Příručka pro federoané systémy

209 četně délky sloupce. Vzhledem k tomu, že pro sloupce LOB neexistuje žádný údaj o délce, bude federoaná databáze předpokládat hodnotu maximální délky sloupce LOB produktu DB2 for Linux, UNIX, and Windows. Federoaná databáze uloží do katalogu federoané databáze jako délku sloupce přezdíky hodnotu maximální délky produktu DB2 UDB for Linux, UNIX, and Windows. Souisející koncepce: Lokátory LOB na stránce 197 Omezení pro objekty LOB na stránce 197 Souisející odkazy: Kapitola 27, Výchozí dopředné mapoání datoých typů, na stránce 249 Federoaná podpora objektů LOB - podrobné informace Lokátory LOB Aplikace mohou pro objekty LOB uložené e zdálených zdrojích dat požadoat lokátory LOB. Lokátor LOB je čtyřbajtoá hodnota uložená proměnné hostitele. Aplikace mohou pomocí lokátorů LOB odkazoat na hodnoty LOB (nebo ýrazy LOB) uložené databázoém systému. Pomocí lokátorů LOB mohou aplikace manipuloat s hodnotami LOB, jako kdyby tyto hodnoty LOB byly uloženy běžné proměnné hostitele. Při použití lokátorů LOB není nutné transportoat hodnoty LOB ze sereru zdroje dat do aplikace (a poté případně zpět). Produkt DB2 UDB může načíst objekty LOB ze zdálených zdrojů dat, uložit je na federoaném sereru a poté pro uložené objekty LOB ydat lokátor LOB. K uolnění lokátorů LOB dojde následujících situacích: Aplikace zadají příkaz FREE LOCATOR SQL. Aplikace zadají příkaz COMMIT. Federoaná instance DB2 je restartoána. Souisející koncepce: Large object locators příručce Application Deelopment Guide: Programming Serer Applications Federoaná podpora objektů LOB na stránce 195 Omezení pro objekty LOB na stránce 197 Omezení pro objekty LOB Ve federoaných systémech platí následující omezení pro objekty LOB: Federoaná databáze nemůže ytořit azbu zdálených objektů LOB na referenční proměnnou souboru. Objekty LOB nejsou podporoány průchozích relacích. Souisející koncepce: Federoaná podpora objektů LOB na stránce 195 Lokátory LOB na stránce 197 Kapitola 18. Programoání aplikací pro federoané systémy 197

210 Distribuoané požadaky na dotazy pro zdroje dat Dotazy odesílané do federoané databáze mohou požadoat ýsledky z jediného zdroje dat, ašak obykle tyto dotazy zahrnují íce zdrojů dat. Vzhledem k tomu, že dotaz je obykle distribuoán do íce zdrojů dat, nazýá se distribuoaný požadaek. Obecně řečeno, distribuoaný požadaek použíá jednu či íce z následujících tří konencí SQL pro určení umístění, odkud mají být data načtena: dílčí dotazy, množinoé operátory a dílčí ýběry spojení. Předpokládejme, že máte federoaný serer konfiguroaný pro přístup k následujícím třem zdrojům dat: DB2 for OS/390, DB2 for iseries a Oracle. V každém z těchto zdrojů dat je uložena tabulka obsahující údaje o zaměstnancích. Federoaný serer odkazuje na tyto tabulky pomocí přezdíek, které ukazují umístění tabulek. UDB390_EMPLOYEES Přezdíka pro tabulku obsahující údaje o zaměstnancích e zdroji dat DB2 for OS/390. iseries_employees Přezdíka pro tabulku obsahující údaje o zaměstnancích e zdroji dat DB2 for iseries. ORA_EMPLOYEES Přezdíka pro tabulku obsahující údaje o zaměstnancích e zdroji dat Oracle. ORA_REGIONS Přezdíka pro tabulku e zdroji dat Oracle obsahující údaje o tom, e kterém regionu zaměstnanci žijí. Následující příklad ukazuje tři konence SQL použíané pro distribuoané dotazy, s použitím přezdíek definoaných pro každou z těchto tabulek. Příklad: Distribuoaný dotaz s dílčím dotazem: Tabulka iseries_employees obsahuje telefonní čísla zaměstnanců žijících Asii. Obsahuje také kódy regionů asocioané s těmito telefonními čísly, ašak neuádí regiony, které tyto kódy reprezentují. Tabulka ORA_REGIONS obsahuje ýpis kódů i regionů. Následující dotaz použíá dílčí dotaz pro nalezení kódu regionu pro Čínu. Poté je za použití kódu regionu narácen seznam těch zaměstnanců z tabulky iseries_employees, jejichž telefonní číslo spadá do regionu Čína. SELECT jméno, telefon FROM db2admin.iseries_employees WHERE kód_regionu IN (SELECT kód_regionu FROM dbadmin.ora_regions WHERE jméno_regionu = CHINA ) Příklad: Distribuoaný požadaek s množinoými operátory: Federoaný serer podporuje tři množinoé operátory: UNION, EXCEPT a INTERSECT. Pomocí množinoého operátoru UNION lze načíst kombinaci řádků yhoujících kterémukoli ze dou či íce příkazů SELECT. Pomocí množinoého operátoru EXCEPT lze načíst řádky, které yhoují prnímu příkazu SELECT, ašak nikoli druhému. Pomocí množinoého operátoru INTERSECT lze načíst řádky, které yhoují oběma příkazům SELECT. Pro šechny tyto tři množinoé operátory lze pomocí operandu ALL určit, že z ýsledku nemají být odebrány duplicitní řádky. Tak je odstraněna nutnost dodatečného řazení. 198 Příručka pro federoané systémy

211 Pro následující dotaz budou načtena šechna jména zaměstnanců a kódy regionů, které se nacházejí obou tabulkách iseries_employees a UDB390_EMPLOYEES, i když je každá z těchto tabulek umístěna jiném zdroji dat. SELECT jméno, kód_regionu FROM as400_employees INTERSECT SELECT jméno, kód_regionu FROM udb390_employees Příklad: Distribuoaný požadaek na spojení: Relační spojení ytoří ýslednou sadu obsahující kombinaci sloupců načtených ze dou či íce tabulek. Je třeba zadat podmínky pro omezení elikosti řádků e ýsledné sadě. Níže uedený dotaz kombinuje jména zaměstnanců s příslušnými názy regionů díky poronání kódů regionů uedených e dou tabulkách. Každá tabulka je umístěna jiném zdroji dat. SELECT t1.jméno, t2.jméno_regionu FROM dbadmin.iseries_employees t1, dbadmin.ora_regions t2 WHERE t1.kód_regionu = t2.kód_regionu Optimalizace distribuoaných požadaků pomocí oleb sereru Ve federoaném systému lze pomocí parametrů nazýaných olby sereru zadat do globálního katalogu informace, které se týkají zdroje dat jako celku, a také určit způsob interakce produktu DB2 UDB se zdrojem dat. Můžete například proést následující operace: Katalogizoat identifikátor instance přiřazením tohoto identifikátoru jako hodnoty k olbě sereru NODE Pomocí olby sereru VARCHAR_NO_TRAILING_BLANKS můžete informoat optimalizátor o tom, že sloupec VARCHAR umístěný na sereru zdroje dat neobsahuje koncoé mezery. Tuto olbu sereru lze použít pouze pro zdroje dat Oracle. Tuto olbu použijte pouze případě, kdy jste si jisti, že žádný sloupec VARCHAR2 pro žádný objekt, na který odkazuje přezdíka na sereru, neobsahuje koncoé mezery. V opačném případě určete pomocí olby sloupce ty sloupce pro jednotlié objekty na sereru, které neobsahují koncoé mezery. Tato olba sloupce je také označoána jako VARCHAR_NO_TRAILING_BLANKS. Nastait olbu sereru PLAN_HINTS na hodnotu, která umožňuje produktu DB2 poskytoat zdrojům dat Oracle fragmenty příkazů nazýané pokyny plánu. Pokyny plánu usnadňují optimalizátoru zdroje dat rozhodnout o tom, který index má být použit pro přístup k tabulce a která posloupnost spojení tabulky má být použita při načítání dat pro ýslednou sadu. Volby sereru pro federoaný systém obykle nastauje administrátor databáze. Také programátor šak může dobře yužít olby sereru, které napomáhají při optimalizaci dotazů. Předpokládejme například, že pro zdroje dat ORACLE1 a ORACLE2 je olba sereru PLAN_HINTS nastaena na ýchozí hodnotu N (ne, neposkytoat pokyny plánu tomuto zdroji dat). Poté ytoříte distribuoaný požadaek pro ýběr dat ze zdrojů ORACLE1 a ORACLE2. Přitom očekááte, že určité pokyny plánu by mohly optimalizátorům usnadnit ytoření strategií pro přístup k datům těchto zdrojích dat. Během připojení použíané aplikace k federoané databázi můžete přepsat ýchozí nastaení hodnotou Y (ano, poskytoat pokyny plánu). Po ukončení připojení ke zdrojům dat bude nastaení automaticky přeedeno zpět na hodnotu N. Postup: Kapitola 18. Programoání aplikací pro federoané systémy 199

212 Volby sereru lze nastait nebo změnit pomocí příkazu SET SERVER OPTION. Chcete-li zajistit účinnost nastaení požadoané hodnoty, zadejte příkaz SET SERVER OPTION hned za příkazem CONNECT. Zadaná olba sereru bude platná po dobu připojení k federoané databázi. Doporučení: Připrate příkaz dynamicky. Příkaz SET SERVER OPTION bude mít li pouze na dynamické příkazy SQL. Souisející odkazy: SET SERVER OPTION statement příručce SQL Reference, Volume 2 Kapitola 21, Volby sereru pro federoané systémy, na stránce 211 Použití průchozích relací aplikacích Průchozí relace umožňují aplikacím přímou komunikaci se sererem prostřednictím metody přístupu natiního klienta sereru a natiního dialektu jazyka SQL. Odesílání dotazů do zdrojů dat přímo prostřednictím průchozí relace Průchozí relace jsou užitečné následujících případech: Aplikace musí e zdroji dat ytářet objekty nebo proádět operace INSERT, UPDATE či DELETE. Produkt DB2 UDB nepodporuje e zdrojích dat jedinečné operace. Postup: Pomocí příkazu SET PASSTHRU spusťte průchozí relaci a získejte přímý přístup k sereru. Příkaz lze zadat dynamicky. Příklad tohoto příkazu: SET PASSTHRU ORACLE1 Tento příkaz SET PASSTHRU oteře průchozí relaci ke zdroji dat s použitím jména sereru ORACLE1. Jméno ORACLE1 bylo pro serer zdroje dat registroáno při ytoření definice sereru. Po oteření průchozí relace zkontrolujte, zda při odkazoání na objekty průchozí relaci použíáte lastní jména objektů, a nikoli přezdíky. Pokud není zdrojem dat, na který je odkazoáno, systém DB2 UDB, je nutné použít dialekt jazyka SQL příslušného zdroje dat. Je-li průchozí relaci zadán statický příkaz, je odeslán ke zpracoání do federoaného sereru. Chcete-li odeslat do zdroje dat ke zpracoání příkaz SQL, je nutné jej dynamicky připrait průchozí relaci a poté jej proést, dokud je relace stále oteřena. Postup při dynamické přípraě příkazů průchozí relaci: Chcete-li zadat příkaz SELECT, použijte pro něj nejpre příkaz PREPARE. Poté můžete získat přístup k ýsledkům dotazu pomocí příkazů OPEN, FETCH a CLOSE. V případě jiných podporoaných příkazů než SELECT máte k dispozici dě možnosti. Můžete podporoaný příkaz připrait pomocí příkazu PREPARE a poté jej proést pomocí příkazu EXECUTE. Jinou možností je přípraa a proedení pomocí příkazu EXECUTE IMMEDIATE. Pokud během průchozí relace zadáte příkaz COMMIT nebo ROLLBACK, bude tímto příkazem dokončena aktuální transakce, ašak průchozí relace nebude ukončena. 200 Příručka pro federoané systémy

213 Federoaná průchozí relace - některé aspekty a omezení Při použití průchozích relací je třeba mít na paměti některá fakta a omezení. Následující fakta a omezení se týkají šech zdrojů dat: Příkazy připraené rámci průchozí relace musí být proedeny během stejné průchozí relace. Příkazy připraené rámci průchozí relace, ašak proedené mimo tuto relaci, se nezdaří a poedou k chybě SQLSTATE V aplikaci může být zadáno íce příkazů SET PASSTHRU, ašak aktiní je pouze poslední relace. Při zadání příkazu SET PASSTHRU bude ukončeno zpracoání předchozího příkazu SET PASSTHRU. V rámci jedné průchozí relace nelze procházet íce než jeden zdroj dat. Pokud je aplikaci použito íce průchozích relací, nezapomeňte před oteřením další průchozí relace zadat příkaz COMMIT. Tak lze ukončit transakci pro aktuální relaci. Značky parametrů nejsou průchozích relacích podporoány. Namísto značek parametrů použijte hostitelské proměnné. Pro kurzor definoaný průchozí relaci můžete použít sémantiku WITH HOLD. Pokud se šak pokusíte použít tuto sémantiku (spolu s příkazem COMMIT) a zdroj dat přitom sémantiku WITH HOLD nepodporuje, bude narácena chyba. Hostitelské proměnné příkazech SQL rámci průchozí relace musí mít tar :Hn, kde H je elké písmeno a n je jedinečné celé číslo. Hodnoty n musí být čísloány postupně (od hodnoty 0). Průchozí relace nepodporují objekty LOB. Průchozí relace nepodporují olání uložených procedur. Průchozí relace nepodporují příkaz SELECT INTO. Souisející koncepce: Průchozí relace na stránce 10 Odesílání dotazů do zdrojů dat přímo prostřednictím průchozí relace na stránce 200 Souisející úlohy: Průchozí relace pro zdroje dat Oracle na stránce 201 Přístup ke zdrojům dat pomocí průchozích relací na stránce 100 Souisející odkazy: SET PASSTHRU statement příručce SQL Reference, Volume 2 Průchozí relace pro zdroje dat Oracle Před zadáním příkazů SQL pro zdroje dat Oracle průchozí relaci zažte následující aspekty: Pokud zdálený klient zadá průchozím režimu z příkazoého řádku příkaz SELECT a kódem klienta je produkt SDK odpoídající nižší erzi produktu DB2 Uniersal Database než erze 5, příkaz SELECT yolá chybu SQLCODE s kódem příčiny 11. Chcete-li se této chybě yhnout, musí klienti použíat produkt SDK odpoídající erzi 5 nebo yšší. Všechny příkazy DDL zadané na sereru Oracle jsou proáděny během syntaktické analýzy a nepodléhají sémantice transakcí. Operace je po dokončení systému Oracle automaticky potrzena. Dojde-li k odolání transakce, příkaz DDL odolán není. Pokud zadááte příkaz SELECT s použitím nezpracoaných datoých typů, můžete pomocí funkce RAWTOHEX získat hexadecimální hodnoty. Při proádění příkazu INSERT pro nezpracoané datoé typy použíejte hexadecimální reprezentaci. Kapitola 18. Programoání aplikací pro federoané systémy 201

214 202 Příručka pro federoané systémy

215 Část 5. Referenční příručky Copyright IBM Corp. 1998,

216 204 Příručka pro federoané systémy

217 Kapitola 19. Pohledy globální tabulce katalogu obsahující federoané informace Většina pohledů katalogu e federoané databázi je stejných jako pohledy katalogu jakékoli jiné databázi produktu DB2 for Linux, UNIX, and Windows. Existuje ale několik jedinečných pohledů, které obsahují informace souisející s federoaným systémem, jako například pohled SYSCAT.WRAPPERS. Jak je uedeno referenčních příručkách SQL k produktu DB2 for Linux, UNIX, and Windows erze 6 a erze 7, pohledy SYSCAT produktu DB2 erze 8 jsou nyní přístupné pouze pro čtení. Proedete-li operaci UPDATE nebo INSERT pohledu e schématu SYSCAT, dojde k selhání této operace. Po aktualizaci systémoého katalogu se doporučuje použít pohledů SYSSTAT. Změňte aplikace, které odkazují na pohled SYSCAT, aby odkazoaly namísto toho na pohled SYSSTAT, který lze aktualizoat. Následující tabulka uádí pohledy SYSCAT, které obsahují federoané informace. Jedná se o pohledy pouze pro čtení. Tabulka 19. Pohledy katalogu typicky užíané s federoaným systémem Pohledy katalogu SYSCAT.CHECKS SYSCAT.COLCHECKS SYSCAT.COLUMNS SYSCAT.COLOPTIONS SYSCAT.CONSTDEP SYSCAT.DATATYPES SYSCAT.DBAUTH SYSCAT.FUNCMAPOPTIONS SYSCAT.FUNCMAPPINGS SYSCAT.INDEXCOLUSE SYSCAT.INDEXES SYSCAT.KEYCOLUSE SYSCAT.REFERENCES Popis Obsahuje ámi definoané informace o kontrolní podmínce. Obsahuje sloupce, na které se odkazuje kontrolní podmínka. Obsahuje informace o sloupcích objektů (tabulek a pohledů) datoého zdroje, pro které jste ytořili přezdíky. Obsahuje informace o hodnotách olby sloupce, které jste nastaili pro přezdíku. Obsahuje záislost definoané informační podmínky. Obsahuje informace o lokálních estaěných a užiatelských datoých typech produktu DB2. Obsahuje opránění pro databáze, která jsou e lastnictí jednotliých užiatelů a skupin. Obsahuje informace o hodnotách olby, které jste nastaili pro mapoání funkce. Obsahuje mapoání funkcí mezi federoanou databází a objekty zdroje dat. Obsahuje sloupce, které se podílejí na indexu. Obsahuje specifikace indexu pro objekty zdroje dat. Obsahuje sloupce, které se podílejí na klíči definoaném pomocí jedinečného klíče, primárního klíče nebo podmínky cizího klíče. Obsahuje informace o ámi definoaných referenčních podmínkách. Copyright IBM Corp. 1998,

218 Tabulka 19. Pohledy katalogu typicky užíané s federoaným systémem (pokračoání) Pohledy katalogu SYSCAT.ROUTINES SYSCAT.REVTYPEMAPPINGS SYSCAT.SERVEROPTIONS SYSCAT.SERVERS SYSCAT.TABCONST SYSCAT.TABLES SYSCAT.TYPEMAPPINGS SYSCAT.USEROPTIONS SYSCAT.VIEWS SYSCAT.WRAPOPTIONS SYSCAT.WRAPPERS Popis Obsahuje lokální užiatelské funkce produktu DB2, nebo šablony funkcí. Šablony funkcí se použíají k mapoání na funkci zdroje dat. Tento pohled se nepoužíá. Všechna mapoání datoého typu jsou zaznamenána pohledu SYSCAT.TYPEMAPPINGS. Obsahuje informace o hodnotách olby sereru, které jste nastaili s definicí sereru. Obsahuje definice sererů, které jste ytořili pro serery zdroje dat. Každý řádek předstauje tabulku a podmínku přezdíky typu CHECK, UNIQUE, PRIMARY KEY nebo FOREIGN KEY. Obsahuje informace o šech lokálních tabulkách DB2, federoaných pohledech a přezdíkách, které jste ytořili. Obsahuje dopředná a zpětná zobrazení datoého typu. Zobrazení je z datoých typů zdroje dat na lokální datoé typy DB2. Tato zobrazení se použíají při ytáření přezdíky objektu zdroje dat. Obsahuje informace o autorizaci užiatele, které jste nastaili při ytáření mapoání užiatelů mezi federoanou databází a serery zdroje dat. Obsahuje informace o ámi ytořených lokálních federoaných pohledech. Obsahuje informace o hodnotách olby, které jste nastaili pro modul wrapper. Obsahuje jméno modulu wrapper a soubor knihony pro šechny zdroje dat, pro než jste modul wrapper ytořili. Následující tabulka uádí pohledy SYSSTAT, které obsahují federoané informace. Jedná se o pohledy pouze pro čtení, které obsahují statistiku, již lze aktualizoat. Tabulka 20. Federoané aktualizoatelné pohledy globálního katalogu Pohledy katalogu SYSSTAT.COLUMNS SYSSTAT.INDEXES SYSSTAT.ROUTINES Popis Obsahuje statistické informace o šech sloupcích objektů (tabulek a pohledů) datoého zdroje, pro které jste ytořili přezdíky. U zděděných sloupců typoaných tabulek nejsou statistiky zaznamenáány. Obsahuje statistické informace o každé specifikaci indexu pro objekty zdroje dat. Obsahuje statistické informace o šech užiatelských funkcích. Neobsahuje estaěné funkce. U zděděných sloupců typoaných tabulek nejsou statistiky zaznamenáány. 206 Příručka pro federoané systémy

219 Tabulka 20. Federoané aktualizoatelné pohledy globálního katalogu (pokračoání) Pohledy katalogu SYSSTAT.TABLES Popis Obsahuje informace o šech základních tabulkách. Informace o pohledu, synonymu ani aliasu nejsou tomto pohledu obsaženy. Co se týče typoaných tabulek, je pohledu zahrnuta pouze kořenoá tabulka hierarchie tabulek. U zděděných sloupců typoaných tabulek nejsou statistiky zaznamenáány. Kapitola 19. Pohledy globální tabulce katalogu obsahující federoané informace 207

220 208 Příručka pro federoané systémy

221 Kapitola 20. Volby modulu wrapper pro federoané systémy Volby modulu wrapper se použíají ke konfiguraci modulu wrapper nebo k definoání, jak má federoaný serer modul wrapper použíat. Volby modulu wrapper lze nastait během ytáření nebo změn modulu wrapper. Všechny relační i nerelační zdroje dat použíají olbu modulu wrapper DB2_FENCED. Zdroj dat ODBC použíá olbu modulu wrapper MODULE. Zdroj dat Entrez použíá olbu modulu wrapper . Tabulka 21. Volby modulu wrapper a jejich nastaení Volba Platná nastaení Výchozí nastaení DB2_FENCED MODULE Určuje, zda má být modul wrapper spuštěn chráněném nebo důěryhodném režimu. Y N Modul wrapper bude spuštěn chráněném režimu. Modul wrapper bude spuštěn důěryhodném režimu. Určuje oou pro registraci modulu wrapper pro Entrez. Tato oá adresa je zahrnuta do šech dotazů a umožňuje modulu NCBI ás kontaktoat případě potíží, například když příliš mnoho dotazů přetíží serery NCBI. Tato olba je poinná. Určuje úplnou cestu ke knihoně obsahující implementaci spráce ODBC Drier Manager nebo implementaci SQL/CLI. Poinné pro modul wrapper pro ODBC na federoaných sererech UNIX. Relační moduly wrapper: N. Nerelační moduly wrapper společnosti IBM: N. Nerelační moduly wrapper jiných dodaatelů: Y. V systému Windows je ýchozí hodnota odbc32.dll. Souisející koncepce: Paralelní zpracoání dotazů s odkazy na přezdíky na stránce 147 Souisející úlohy: Trusted and fenced mode process enironments příručce IBM DB2 Information Integrator Wrapper Deeloper s Guide Úpraa modulu wrapper na stránce 25 Registering wrappers for a data source příručce IBM DB2 Information Integrator Data Source Configuration Guide Copyright IBM Corp. 1998,

222 210 Příručka pro federoané systémy

223 Kapitola 21. Volby sereru pro federoané systémy Tabulka 22. Volby sereru pro relační zdroje dat. Volby sereru se použíají pro popis sereru zdroje dat. Volby sereru určují informace o integritě dat, umístění, zabezpečení a ýkonu. Některé olby sereru jsou dostupné pro šechny zdroje dat, jiné olby sereru jsou pro jednotlié zdroje dat specifické. Běžné olby federoaného sereru pro relační zdroje dat jsou následující: Volby kompatibility. COLLATING_SEQUENCE, IGNORE_UDT Volby integrity dat. IUD_APP_SVPT_ENFORCE Volby data a času. DATEFORMAT, TIMEFORMAT, TIMESTAMPFORMAT Volby umístění. CONNECTSTRING, DBNAME, IFILE Volby zabezpečení. FOLD_ID, FOLD_PW, INFORMIX_LOCK_MODE Volby ýkonu. COMM_RATE, CPU_RATIO, DB2_MAXIMAL_PUSHDOWN, IO_RATIO, LOGIN_TIMEOUT, PACKET_SIZE, PLAN_HINTS, PUSHDOWN, TIMEOUT, VARCHAR_NO_TRAILING_BLANKS Následující tabulka uádí olby sereru definice sereru, které lze použít pro šechny relační zdroje dat. Zdroj dat CODEPAGE COLLATING_SEQUENCE COMM_RATE CONNECTSTRING CPU_RATIO DATEFORMAT DB2_MAXIMAL_PUSHDOWN DBNAME FOLD_ID FOLD_PW IFILE INFORMIX_LOCK_MODE IO_RATIO IUD_APP_SVPT_ENFORCE LOGIN_TIMEOUT NODE PACKET_SIZE PASSWORD PLAN_HINTS PUSHDOWN TIMEOUT TIMEFORMAT TIMESTAMPFORMAT VARCHAR_NO_TRAILING_BLANKS DB2 UDB for X X X X X X X X X X X X iseries DB2 UDB for X X X X X X X X X X X X z/os and OS/390 DB2 for VM X X X X X X X X X X X X and VSE DB2 UDB for X X X X X X X X X X X X Linux, UNIX, and Windows Informix X X X X X X X X X X X X X Microsoft X X X X X X X X X X X X X SQL Serer ODBC X X X X X X X X X X X X X X X X X OLE DB X X Copyright IBM Corp. 1998,

224 Tabulka 22. Volby sereru pro relační zdroje dat. (pokračoání) Zdroj dat CODEPAGE COLLATING_SEQUENCE COMM_RATE CONNECTSTRING CPU_RATIO DATEFORMAT DB2_MAXIMAL_PUSHDOWN DBNAME FOLD_ID FOLD_PW IFILE INFORMIX_LOCK_MODE IO_RATIO IUD_APP_SVPT_ENFORCE LOGIN_TIMEOUT NODE PACKET_SIZE PASSWORD PLAN_HINTS PUSHDOWN TIMEOUT TIMEFORMAT TIMESTAMPFORMAT VARCHAR_NO_TRAILING_BLANKS Oracle X X X X X X X X X X X X Sybase X X X X X X X X X X X X X X X X Teradata X X X X X X X X Následující tabulka uádí olby sereru definice sereru, které lze použít pro šechny nerelační zdroje dat, kromě produktu WebSphere Business Integration. Volby sereru definice sereru pro produkt WebSphere Business Integration jsou uedeny části Tabulka 24 na stránce 213. Tabulka 23. Volby sereru pro nerelační zdroje dat. Zdroj dat CASE_SENSITIVE CONTENT_DIR DAEMON_PORT ES_HOST ES_PORT ES_TRACING ES_TRACELEVEL ES_TRACEFILENAME HMMPFAM_OPTIONS HMMSEARCH_OPTIONS BioRS X X X X MAX_ROWS BLAST X X X Documentum X X X X X Entrez X X X X X X X Excel Extended Search X X X X X HMMER X X X X X X Soubory s tabulkoou strukturou Weboé služby XML X X X X X X NODE OS_TYPE PORT PROCESSORS PROXU_AUTHID PROXY_PASSWORD PROXY_SERVER_NAME PROXY_SERVER_PORT PROXY_TYPE RDBMS_TYPE SOCKET_TIMEOUT TIMEOUT TRANSACTIONS USE_CLOB_SEQUENCE 212 Příručka pro federoané systémy

225 Následující tabulka uádí olby sereru definice sereru, které lze použít zdroje dat produktu WebSphere Business Integration. Tabulka 24. Volby sereru pro zdroje dat WebSphere Business Integration. Zdroj dat APP_TYPE FAULT_QUEUE MQ_CONN_NAME MQ_MANAGER MQ_RESPONSE_TIMEOUT MQ_SVRCONN_CHANNELNAME REQUEST_QUEUE RESPONSE_QUEUE WebSphere Business Integration X X X X X X X X Tabulka 25. Volby sereru a jejich nastaení Následující tabulka popisuje šechny olby sereru a uádí seznam platných a ýchozích nastaení. Volba Popis a platná nastaení Výchozí nastaení APP_TYPE Typ zdálené aplikace. Platné hodnoty jsou PSOFT, SAP a SIEBEL. Tato olba je poinná. Žádné. Kapitola 21. Volby sereru pro federoané systémy 213

226 Tabulka 25. Volby sereru a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení CASE_SENSITIVE Určuje, zda serer BioRS rozlišuje e jménech elká Y a malá písmena. Platné hodnoty jsou Y a N. Y N Serer BioRS rozlišuje e jménech elká a malá písmena. Serer BioRS nerozlišuje e jménech elká a malá písmena. V produktu BioRS řídí rozlišoání elkých a malých písmen datech uložených na sereru BioRS konfigurační parametr. Analogií tohoto konfiguračního parametru systému BioRS produktu DB2 Information Integrator je olba CASE_SENSITIVE. Nastaení konfigurace pro rozlišoání elkých a malých písmen na sereru BioRS serer systému BioRS je třeba synchronizoat s produktem DB2 Information Integrator. Pokud se ám nepodaří synchronizoat nastaení konfigurace pro rozlišoání elkých a malých písmen mezi produktem BioRS a DB2 Information Integrator, dojde při pokusu o přístup k datům BioRS prostřednictím produktu DB2 Information Integrator k chybám. Po ytoření noého sereru BioRS produktu DB2 Information Integrator nelze již olbu CASE_SENSITIVE změnit ani odstranit. Potřebujete-li olbu CASE_SENSITIVE změnit, musíte celý serer zrušit a znou ytořit. Pokud serer BioRS zrušíte, musíte také znou ytořit šechny odpoídající přezdíky BioRS. Produkt DB2 Information Integrator totiž automaticky zruší šechny přezdíky odpoídající zrušenému sereru. CODEPAGE Určuje identifikátor kódoé stránky DB2 odpoídající kódoané znakoé sadě konfigurace klienta zdroje dat. Pokud kódoá stránka klienta nesouhlasí s kódoou stránkou federoaného sereru, musíte zadat kódoou stránku klienta. U zdrojů dat podporujících kódoání Unicode lze olbu CODEPAGE nastait na identifikátor kódoé stránky DB2 odpoídající podporoanému kódoání Unicode klienta zdroje dat. V systémech UNIX nebo Windows s federoanou databází bez podpory Unicode: Kódoá stránka federoané databáze. V systémech UNIX s federoanou databází Unicode: 1208 V systémech Windows s federoanou databází Unicode: Příručka pro federoané systémy

227 Tabulka 25. Volby sereru a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení COLLATING_ SEQUENCE COMM_RATE Určuje, zda zdroj dat použíá stejnou ýchozí posloupnost řazení jako federoaná databáze, a to na základě kódoé sady NLS a informací o zemi/oblasti. Y N I Zdroj dat má stejnou posloupnost řazení jako federoaná databáze DB2. Zdroj dat má jinou posloupnost řazení, než je posloupnost řazení federoané databáze DB2. Zdroj dat má jinou posloupnost řazení, než je posloupnost řazení federoané databáze DB2, a posloupnost řazení zdroje dat nerozlišuje elká a malá písmena (například sloa STEWART a StewART jsou poažoána za stejná). Udáá rychlost komunikace mezi federoaným sererem a sererem zdroje dat. Udáá se megabajtech za sekundu. N 2 Platné hodnoty jsou ětší než 0 a menší než 1x Hodnoty lze yjádřit jakékoli platné notaci typu REAL. CONTENT_DIR CONNECTSTRING CPU_RATIO Určuje jméno lokálně přístupného kořenoého adresáře pro ukládání souborů obsahu načtených pseudosloupci GET_FILE, GET_FILE_DEL, GET_RENDITION, a GET_RENDITION_DEL. Zápis do něj musí být umožněn šem užiatelům, kteří mohou užíat tyto pseudosloupce. Určuje lastnosti inicializace potřebné pro připojení k poskytoateli rozhraní OLE DB. Označuje, kolikrát procesor zdroje dat pracuje rychleji nebo pomaleji než procesor federoaného sereru. V systémech UNIX: /tmp V systémech Windows: C:\temp Žádné. 1.0 Platné hodnoty jsou ětší než 0 a menší než 1x Hodnoty lze yjádřit jakékoli platné notaci typu REAL. Nastaení 1 označuje, že federoaný procesor DB2 a procesor zdroje dat mají stejnou rychlost procesoru, poměr je 1:1. Nastaení 0.5 označuje, že rychlost federoaného procesoru DB2 je o 50% nižší než rychlost procesoru zdroje dat. Nastaení 2 označuje, že rychlost federoaného procesoru DB2 je dojnásobná oproti rychlosti procesoru zdroje dat. DATEFORMAT DAEMON_PORT Formát data použíaný zdrojem dat. Formát zadejte pomocí parametrů DD, MM a YY, nebo YYYY, aby reprezentoal numerickou formu data. Měli byste také zadat odděloač, například mezeru nebo čárku. Chcete-li například yjádřit formát data , použijte tar YYYY-MM-DD. U tohoto pole je poolena hodnota Null. Určuje číslo portu, na kterém naslouchá démon požadakům úloh BLAST nebo HMMER. Číslo portu musí být totéž číslo, které je zadáno e olbě DAEMON_PORT konfiguračním souboru démona. Žádné. BLAST: 4007 ; HMMER: 4098 Kapitola 21. Volby sereru pro federoané systémy 215

228 Tabulka 25. Volby sereru a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení DB2_MAXIMAL_ PUSHDOWN DBNAME ES_HOST ES_PORT ES_TRACING Určuje primární kritéria, které použíá optimalizátor dotazu při ýběru přístupoého plánu. Optimalizátor dotazu může olit přístupoé plány na základě nákladů, nebo na základě požadaku užiatele, že má být zdálenými zdroji dat proedeno maximální možné zpracoání dotazů. Y N Optimalizátor dotazu zolí přístupoý plán, který přesune na zdroj dat íce operací dotazu než jiné plány. Pokud několik přístupoých plánů nabízí stejné množstí přesunu zpracoání, ybere optimalizátor dotazu plán s nejnižšími náklady. Pokud je tabulka materializoaného dotazu (MQT) na federoaném sereru schopná zpracoat část nebo celý dotaz, může být použit přístupoý plán obsahující tabulku materializoaného dotazu. Federoaná databáze nepřesouá dotazy, jejichž ýsledkem je kartézský součin. Optimalizátor dotazu zolí přístupoý plán podle nákladů. Jméno databáze zdroje dat, ke které má mít federoaný serer přístup. U databáze DB2 tato hodnota odpoídá specifické databázi pro počáteční připojení zdálené databáze DB2. Specifickou databází je alias databáze pro zdálenou databázi DB2, která je katalogizoána na federoaném sereru pomocí příkazu CATALOG DATABASE nebo Asistenta pro konfiguraci DB2. Neplatí pro zdroje dat systému Oracle, protože instance Oracle obsahují pouze jednu databázi. Určuje úplné jméno hostitele nebo adresu IP sereru Extended Search, e kterém chcete yhledáat. Tato olba je poinná. Určuje číslo portu, kde tento serer Extended Search naslouchá požadakům. Tato olba je nepoinná. Určuje, zda má být pro chyboé zpráy, zpráy s aroáním a informační zpráy ydané zdáleným sererem Extended Search pooleno trasoání. Platné hodnoty: OFF Nebudou protokoloány žádné zpráy trasoání. ON Zpráy trasoání budou protokoloány. Tato olba je nepoinná. N Žádné. Žádné OFF 216 Příručka pro federoané systémy

229 Tabulka 25. Volby sereru a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení ES_TRACELEVEL Je-li pooleno trasoání, určuje tato olba typ zprá, které budou zapsány do souboru žurnálu. Následující úroně trasoání lze nezáisle poolit či zakázat: C N W Kritické chyboé zpráy. Jiné než kritické chyboé zpráy. Zpráy s aroáním. I Informatiní zpráy. Příklad: ES_TRACELEVEL W ES_TRACELEVEL CN C Tato olba je nepoinná. ES_TRACEFILENAME Je-li pooleno trasoání, určuje tato olba jméno adresáře a souboru, kam budou zpráy zapsány. Tato olba je nepoinná. Pro operační systémy UNIX: $INSTHOME/sqllib/log/ ESWrapper.log. FAULT_QUEUE FOLD_ID (Viz poznámky 1 a 4 na konci této tabulky.) Jméno fronty poruch, která doručuje chyboé zpráy z adaptéru do modulu wrapper. Jméno musí odpoídat specifikacím pro jména front produktu WebSphere MQ. Tato olba je poinná. Použíá se pro jméno užiatele, které federoaný serer odešle sereru zdroje dat k oěření. Platné hodnoty: U N L Federoaný serer přeede jméno užiatele před odesláním do zdroje dat na elká písmena. Tato olba je logická pro zdroje dat skupiny produktů DB2 a Oracle. (Viz poznámka 2 na konci této tabulky.) Federoaný serer neproede se jménem užiatele před odesláním do zdroje dat nic. (Viz poznámka 2 na konci této tabulky.) Federoaný serer přeede jméno užiatele před odesláním do zdroje dat na malá písmena. Není-li použito žádné z těchto nastaení, pokusí se federoaný serer odeslat zdroji dat jméno užiatele elkými písmeny. Pokud dojde k selhání, pokusí se serer o odeslání jména užiatele malými písmeny. Pro operační systémy Windows: %DB2TEMPDIR%\ ESWrapper.log. Žádné. Žádné. Kapitola 21. Volby sereru pro federoané systémy 217

230 Tabulka 25. Volby sereru a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení FOLD_PW Použíá se pro heslo, které federoaný serer odesílá Žádné. zdrojům dat k oěření. Platné hodnoty: (Viz poznámky 1, 3 a 4 na konci této tabulky.) U N L Federoaný serer přeede heslo před odesláním do zdroje dat na elká písmena. Tato olba je logická pro zdroje dat skupiny produktů DB2 a Oracle. Federoaný serer neproede s heslem před odesláním do zdroje dat nic. Federoaný serer přeede heslo před odesláním do zdroje dat na malá písmena. Není-li použito žádné z těchto nastaení, pokusí se federoaný serer odeslat zdroji dat heslo elkými písmeny. Pokud dojde k selhání, pokusí se serer o odeslání hesla malými písmeny. HMMPFAM_OPTIONS Určuje olby hmmpfam, jako například --null2, --pm a --xnu, které nemají odpoídající jméno sloupce tabulce odkazů, která mapuje olby na jména sloupců. Příklad: HMMPFAM_OPTIONS --xnu --pm Vtomto příkladu démon spustí program HMMPFAM s olbami z klauzule WHERE dotazu, a naíc další olby --xnu --pm. HMMSEARCH_ OPTIONS IFILE INFORMIX_LOCK_MODE Umožňuje užiateli poskytnout další olby příkazoého řádku pro příkaz hmmsearch. Platné pouze s typem SEARCH. Další informace naleznete příručce HMMER User s Guide. Určuje cestu a jméno souboru rozhraní klienta Sybase Open Client. Na federoaných sererech Windows NT je ýchozí hodnotou %DB2PATH%\interfaces. Na federoaných sererech UNIX je ýchozí hodnotou jména a cesty $DB2INSTANCE/sqllib/interfaces. Určuje režim zámků, který má být nastaen pro zdroj dat systému Informix. Modul wrapper pro Informix zadá příkaz SET LOCK MODE okamžitě po naázání spojení se zdrojem dat Informix. Platné hodnoty: Žádné. Žádné. W W Nastaí režim zámků Informix na hodnotu WAIT. Pokud se modul wrapper pokusí o přístup k zamčené tabulce nebo řádku, systém Informix počká, dokud nebude zámek odemčen. N Nastaí režim zámků Informix na hodnotu NOWAIT. Pokud se modul wrapper pokusí o přístup k zamčené tabulce nebo řádku, systém Informix rátí chybu. n Nastaí režim zámků Informix na hodnotu WAIT po dobu n sekund. Pokud se modul wrapper pokusí o přístup k zamčené tabulce nebo řádku, a zámek nebude během zadané doby odemčen, systém Informix rátí chybu. 218 Příručka pro federoané systémy

231 Tabulka 25. Volby sereru a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení IO_RATIO Označuje, kolikrát stupně-ýstupní systém zdroje dat pracuje rychleji nebo pomaleji než stupně-ýstupní systém federoaného sereru. Platné hodnoty jsou ětší než 0 a menší než 1x Hodnoty lze yjádřit jakékoli platné notaci typu REAL. 1.0 IUD_APP_SVPT_ENFORCE LOGIN_TIMEOUT MAX_ROWS Nastaení 1 označuje, že federoaný stupně-ýstupní systém DB2 a stupně-ýstupní systém zdroje dat mají stejnou rychlost, poměr je 1:1. Nastaení 0.5 označuje, že rychlost federoaného stupně-ýstupního systému DB2 je o 50% nižší než rychlost stupně-ýstupního systému zdroje dat. Nastaení 2 označuje, že rychlost federoaného stupně-ýstupního systému DB2 je dojnásobná oproti rychlosti stupně-ýstupního systému zdroje dat. Určuje, zda má federoaný systém DB2 ynutit detekci nebo sestaení příkazů bodu uložení aplikace. Pokud byla hodnota nastaena pomocí příkazu SET SERVER OPTION, nebude mít tato olba žádný li na statické příkazy SQL. Y N Federoaný serer odolá transakce ložení, aktualizace nebo odstranění, pokud dojde během operace ložení, aktualizace nebo odstranění k chybě a zdroj dat neynutí příkazy bodu uložení aplikace. Bude rácen kód chyby SQL1476N. Federoaný serer při chybě transakce neodolá. Vaše aplikace se musí postarat o zotaení z chyb. Určuje počet sekund, po který bude federoaný serer DB2 čekat na odezu z klienta Sybase Open Client na požadaek přihlášení. Výchozí hodnoty jsou stejné jako pro olbu TIMEOUT. Určuje počet řádků, které federoaný serer rátí pro dotaz použíající modul wrapper pro Entrez. Y 0 Operační systémy Microsoft Windows: 2000 řádků. Můžete zadat pouze kladná čísla nebo nulu. Nastaíte-li olbu na nuloou hodnotu, poolíte dotazům načítat neomezený počet řádků z weboé stránky NCBI. Nastaení olby MAX_ROWS na nulu nebo na elmi elké číslo může ošem olinit ýkon dotazu. Operační systémy na bázi UNIX: 5000 řádků. Volba sereru MAX_ROWS není poinná. MQ_CONN_NAME Jméno hostitele nebo síťoá adresa počítače, kde je spuštěn serer Websphere MQ. Příkladem jména připojení je (1420), kde 1420 je číslo portu. Pokud je číslo portu ynecháno, bude použita ýchozí hodnota Tato olba je nepoinná. Je-li ynechána, bude po ýběr definice kanálu použita proměnná prostředí MQSERVER (pokud je souboru db2dj.ini zadána). Pokud není proměnná MQSERVER nastaena, použije se tabulka kanálu klienta. Modul wrapper použíá proměnnou prostředí MQSERVER, pokud je souboru db2dj.ini zadána, pro ýběr definice kanálu. Pokud proměnná prostředí MQSERVER zadána není, použije modul wrapper tabulku kanálu klienta. Kapitola 21. Volby sereru pro federoané systémy 219

232 Tabulka 25. Volby sereru a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení MQ_MANAGER MQ_RESPONSE_ TIMEOUT MQ_SVRCONN_ CHANNELNAME NODE Jméno spráce systému WebSphere MQ. Liboolné platné jméno spráce systému WebSphere MQ. Tato olba je poinná. Množstí času, po které má modul wrapper čekat na zpráu odezy z fronty odezy. Hodnota se udáá milisekundách. Lze také zadat speciální hodnotu -1, která označuje, že žádný časoý limit neexistuje. Tato olba je nepoinná. Jména kanálu připojení sereru e spráci systému Webspehere MQ, ke kterému se má modul wrapper pokusit připojit. Tento parametr lze zadat pouze za předpokladu, že je zadána olba sereru MQ_CONN_NAME. Pokud je tato olba ynechána, použije se ýchozí kanál připojení sereru - SYSTEM.DEF.SVRCONN. Relační zdroje dat: Jméno, podle něhož je zdroj dat definoán jako instance systému RDBMS. Documentum: Určuje aktuální jméno produktu Documentum Docbase. Tato olba je poinná. BLAST: Určuje jméno hostitele systému, na němž je spuštěno zpracoání démona BLAST. Tato olba je poinná. HMMER: Určuje jméno hostitele sereru, na němž je spuštěno zpracoání démona HMMER. Tato olba je poinná. Žádné SYSTEM.DEF.SVRCONN BioRS: localhost BioRS: Určuje jméno hostitele systému, na němž je k dispozici nástroj fronty BioRS. Tato olba je nepoinná. OS_TYPE PACKET_SIZE PASSWORD Určuje operační systém sereru Docbase. Platné hodnoty jsou AIX, SOLARIS a WINDOWS. Tato olba je poinná. Určuje elikost paketu souboru rozhraní Sybase bajtech. Pokud zdroj dat nepodporuje zadanou elikost paketu, dojde k selhání připojení. Zětšení elikosti paketu, jsou-li jednotlié záznamy elmi elké (například při přidáání řádků do rozsáhlých tabulek), ýrazně zýší ýkon. Velikost bajtech je číselná hodnota. Určuje, zda jsou hesla odesílána do zdroje dat. Žádné. Y Y Hesla jsou odesílána do zdroje dat a oěřoána. N Hesla nejsou odesílána do zdroje dat ani oěřoána. 220 Příručka pro federoané systémy

233 Tabulka 25. Volby sereru a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení PLAN_HINTS Určuje, zda se mají zpřístupnit pokyny k plánu. Pokyny k plánu jsou fragmenty příkazů, které poskytují další informace pro optimalizátory zdroje dat. Tyto informace mohou u jistých typů dotazů zýšit ýkon dotazu. Pokyny k plánu mohou optimalizátoru datoého zdroje pomoci rozhodnout, zda použít index, který index použít, případně jaké pořadí spojení tabulek použít. N Y N Pokyny k plánu mají být pooleny na zdroji dat, pokud tento pokyny k plánu podporuje. Pokyny k plánu nemají být na zdroji dat pooleny. Tato olba je dostupná pouze pro zdroje dat Oracle a Sybase. PORT Určuje číslo portu, který modul wrapper použíá pro připojení k sereru BioRS. Tato olba je nepoinná PROCESSORS PROXY_AUTHID PROXY_PASSWORD PROXY_SERVER_ NAME PROXY_SERVER_PORT PROXY_TYPE Určuje počet procesorů použíaných programem HMMER. Tato olba je ekialentní s olbou --cpu příkazu hmmpfam. Určuje jméno užiatele, které se má použít případě, že je hodnota parametru PROXY_TYPE SOCKS5. Je-li hodnota parametru PROXY_TYPE SOCKS5, je toto pole nepoinné. Na jméno užiatele, které se má použít, se zeptejte administrátora sítě. Není-li hodnota parametru PROXY_TYPE SOCKS5, je tato olba neplatná. Určuje heslo, které se má použít případě, že je hodnota parametru PROXY_TYPE SOCKS5. Je-li hodnota parametru PROXY_TYPE SOCKS5, je toto pole nepoinné. Na heslo, které se má použít, se zeptejte administrátora sítě. Není-li hodnota parametru PROXY_TYPE SOCKS5, je tato olba neplatná. Určuje jméno sereru proxy nebo adresu IP. Toto pole je poinné, je-li hodnota parametru PROXY_TYPE HTTP, SOCKS4 nebo SOCKS5. Na jméno sereru proxy nebo adresu IP se zeptejte administrátora sítě. Určuje číslo portu sereru proxy. Toto pole je poinné, je-li hodnota parametru PROXY_TYPE HTTP, SOCKS4 nebo SOCKS5. Na číslo portu sereru proxy, které se má použít, se zeptejte administrátora sítě. Určuje typ sereru proxy, který se použíá pro přístup k síti Internet za ochrannou bariérou. Platné hodnoty jsou NONE, HTTP, SOCKS4 nebo SOCKS5. Výchozí hodnotou je NONE. Na typ použitého sereru proxy se zeptejte administrátora sítě. Žádné. Žádné. Žádné. Žádné. Žádné. NONE Kapitola 21. Volby sereru pro federoané systémy 221

234 Tabulka 25. Volby sereru a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení PUSHDOWN RDBMS_TYPE RESPONSE_QUEUE REQUEST_QUEUE SOCKET_TIMEOUT TIMEFORMAT TIMESTAMPFORMAT TIMEOUT Y N Produkt DB2 UDB rozhodne o ponechání yhodnocení operací zdroji dat. Produkt DB2 UDB odešle příkazy SQL zdroje dat obsahující pouze příkaz SELECT se jmény sloupců. Sloupce predikátů (např. WHERE=) a skalární funkce (např. MAX nebo MIN), řazení (např. ORDER BY nebo GROUP BY) a spojení nebudou obsaženy žádném kódu SQL odeslaném zdroji dat. Určuje systém RDBMS použíaný systémem Docbase. Platné hodnoty jsou DB2, INFORMIX, ORACLE, SQLSERVER a SYBASE. Tato olba je poinná. Jméno fronty odeze, která doručuje ýsledky dotazu z adaptéru do modulu wrapper. Jméno musí odpoídat specifikacím pro jména front produktu WebSphere MQ. Tato olba je poinná. Jméno fronty požadaků, která doručuje požadaky dotazu z modulu wrapper do adaptéru. Jméno musí odpoídat specifikacím pro jména front produktu WebSphere MQ. Tato olba je poinná. Určuje maximální čas minutách, po který bude federoaný serer DB2 čekat na ýsledky ze sereru proxy. Platnou hodnotou je jakékoli číslo ětší nebo roné nule. Výchozí hodnotou je 0. Nuloá hodnota označuje čekání po neomezenou dobu. Formát času použíaný zdrojem dat. Zadejte formát pomocí parametrů hh12, hh24, mm, ss, AM, nebo A.M.. Chcete-li například yjádřit formát času 16:00:00, použijte tar hh24:mm:ss. Chcete-li yjádřit formát času 8:00:00 AM, použijte tar hh12:mm:ss AM. U tohoto pole je poolena hodnota Null. Formát časoé značky použíaný zdrojem dat. Formát odpoídá formátu data a času, přidáá naíc parametr n pro desetiny sekundy, nn pro setiny sekundy, nnn pro milisekundy atd. až k parametru nnnnnn pro mikrosekundy. Chcete-li například yjádřit formát časoé značky :00: , použijte tar YYYY-MM-DD-hh24:mm:ss.nnnnnn. U tohoto pole je poolena hodnota Null. Sybase: Určuje počet sekund, po který bude federoaný serer DB2 čekat na odezu z klienta Sybase Open Client pro liboolný příkaz SQL. Hodnota sekundách je kladné celé číslo rozsahu celých čísel produktu DB2 Uniersal Database. Hodnota časoého limitu, kterou jste zadali, záisí na ámi použíaném modulu wrapper. Výchozí hodnota olby TIMEOUT pro moduly wrapper pro Sybase je 0, což znamená, že produkt DB2 UDB bude na odezu čekat stále. BioRS: určuje dobu minutách, po kterou má modul wrapper pro BioRS čekat na odezu ze sereru BioRS. Výchozí hodnota je 10. Tato olba je nepoinná. Y Žádné. Žádné. Žádné. 0 Žádné. Žádné. 0 ; BioRS: Příručka pro federoané systémy

235 Tabulka 25. Volby sereru a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení TRANSACTIONS USE_CLOB_ SEQUENCE VARCHAR_NO_ TRAILING_BLANKS Určuje režim transakcí sereru. Platné hodnoty jsou následující: NONE Nejsou pooleny žádné transakce. QUERY Transakce jsou pooleny pouze pro metody Dctm_Query. ALL Transakce jsou pooleny pro metody Dctm_Query. Hodnota ALL má tomto ydání tentýž ýznam jako QUERY. Tato olby určuje typ dat, který federoaný serer použíá pro sloupec BlastSeq nebo HmmQSeq. Možné hodnoty jsou Y nebo N. Pomocí příkazu CREATE NICKNAME nebo ALTER NICKNAME můžete přepsat ýchozí datoý typ pro sloupec BlastSeq nebo HmmQSeq. Tato olba se použíá pro zdroje dat s proměnnými datoými typy znaků, které nepoužíají k yplnění délky během poronáání prázdné znaky. Některé zdroje dat, jako například systém Oracle, neobsahují sémantiku poronáání s yplňujícími prázdnými znaky, která by racela stejné ýsledky jako sémantika poronáání produktu DB2 for Linux, UNIX, and Windows. Tuto olbu nastate, chcete-li, aby platila pro šechny sloupce typu VARCHAR a VARCHAR2 objektech zdroje dat, ke kterým bude přístup z narhoaného sereru. To zahrnuje i pohledy. Y N Poznámky k této tabulce: Koncoé prázdné znaky těchto sloupcích VARCHAR chybějí, nebo zdroj dat obsahuje sémantiku poronáání s yplňujícími prázdnými znaky, která odpoídá sémantice na federoaném sereru. Federoaný serer předá operace poronání znaků ke zpracoání do zdroje dat. Koncoé prázdné znaky se těchto sloupcích VARCHAR yskytují a zdroj dat obsahuje sémantiku poronáání s yplňujícími prázdnými znaky, která se liší od sémantiky na federoaném sereru. Federoaný serer zpracuje operace poronání znaků, pokud není možné je kompenzoat ekialentní sémantikou. Například přepis predikátu. 1. Toto pole se použíá nezáisle na hodnotě zadané pro oěření. QUERY Y N pro dotčené zdroje dat 2. Vzhledem k tomu, že produkt DB2 UDB ukládá jména užiatelů elkými písmeny, jsou hodnoty N a U logicky ekialentní. 3. Nastaení parametru FOLD_PW nemá žádný li, je-li nastaení pro heslo N. Protože není odesláno žádné heslo, nemá elikost písmen žádný li. Kapitola 21. Volby sereru pro federoané systémy 223

236 4. U šech těchto oleb se yhněte nastaení na hodnotu Null. Nastaení Null může ypadat zajímaě, protože produkt DB2 UDB proede několik pokusů o získání jmen užiatelů a hesel. Výkon tím ošem může utrpět (je možné, že produkt DB2 UDB odešle jméno užiatele a heslo čtyřikrát, než se mu podaří úspěšné oěření zdroje dat). Souisející koncepce: Charakteristika sereru oliňující možnosti posunutí na nižší úroeň na stránce 128 Charakteristika sereru oliňující globální optimalizaci na stránce 138 Souisející úlohy: Registering serer definitions for a data source příručce IBM DB2 Information Integrator Data Source Configuration Guide Souisející odkazy: DROP statement příručce SQL Reference, Volume 2 ALTER SERVER statement příručce SQL Reference, Volume 2 CREATE SERVER statement příručce SQL Reference, Volume Příručka pro federoané systémy

237 Kapitola 22. Volby mapoání užiatelů pro federoaný systém Tyto olby jsou platné pro šechny relační zdroje dat. U nerelačních zdrojů dat jsou olby REMOTE_AUTHID a REMOTE_PASSWORD platné pouze pro následující zdroje dat: BioRS, Documentum, Extended Search a Weboé služby. Volby GUEST je platná pro zdroj dat BioRS. Tyto olby se použíají spolu s příkazy CREATE USER MAPPING a ALTER USER MAPPING. Tabulka 26. Volby mapoání užiatelů a jejich nastaení Volba Platná nastaení Výchozí nastaení ACCOUNTING GUEST DRDA: Použíá se pro určení účtoacího řetězce DRDA. Platná nastaení zahrnují liboolný řetězec o délce 255 znaků nebo kratší. Tato olba je yžadoána, pouze pokud je třeba předat účtoací informace.další informace naleznete užiatelské příručce produktu DB2 Connect. Určuje, zda má modul wrapper použít pro přístup k sereru BioRS režim přístupu hosta. Y N Modul wrapper použije pro přístup k sereru BioRS režim přístupu hosta. Modul wrapper nepoužije pro přístup k sereru BioRS režim přístupu hosta. Žádné N Pokud je nastaena hodnota Y, pak se tato olba zájemně ylučuje s olbami REMOTE_AUTHID a REMOTE_PASSWORD. REMOTE_AUTHID REMOTE_DOMAIN REMOTE_PASSWORD Označuje autorizační ID použíané e zdroji dat. Platná nastaení zahrnují liboolný řetězec o délce 255 znaků nebo kratší. Documentum: Označuje doménu Windows NT použíanou k oěření užiatelů připojených ke zdroji dat Documentum. Platná nastaení zahrnují jakékoli platné jméno domény Windows NT. Označuje heslo autorizace použíané e zdroji dat. Platná nastaení zahrnují liboolný řetězec o délce 32 znaků nebo kratší. Za následujících podmínek nemusíte tuto olbu zadáat: Konfigurační parametr spráce databází AUTHENTICATON je nastaen na hodnotu SERVER. Při připojení k databázi DB2 jste zadali autorizační ID a heslo. Autorizační ID použíané pro připojení k produktu DB2 Uniersal Database. Výchozí oěřoací doména databáze Documentum. Heslo použíané pro připojení k produktu DB2 Uniersal Database, jsou-li splněny obě podmínky uedené e sloupci platných nastaení. Pokud áš serer yžaduje heslo a y tuto olbu nezadáte, přesědčte se, že jsou splněny obě ýše uedené podmínky, jinak dojde k selhání připojení. Souisející koncepce: Produkt DB2 Connect a architektura DRDA příručce DB2 Connect User s Guide Architektura DRDA a přístup k datům příručce DB2 Connect User s Guide Copyright IBM Corp. 1998,

238 Souisející úlohy: Registering user mappings for a data source příručce IBM DB2 Information Integrator Data Source Configuration Guide 226 Příručka pro federoané systémy

239 Kapitola 23. Volby přezdíek pro federoané systémy Tabulka 27. Dostupné olby přezdíek A až P Oddíly Tabulka 27 a Tabulka 28 uádějí olby přezdíek pro šechny zdroje dat. Oddíl Tabulka 29 na stránce 228 popisuje šechny olby přezdíek a uádí seznam platných a ýchozích nastaení. BioRS Zdroj dat ALL_VERSIONS APPLICATIONID BUSOBJ_NAME CATEGORY COLUMN_DELIMITER DATASOURCE DIRECTORY_PATH BLAST X X Documentum X X X Entrez Excel Extended Search X X X X HMMER X X Soubory s tabulkoou strukturou Weboé služby WebSphere Business Integration X FILE_PATH X FOLDERS HMMTYPE INSTANCE_PARSE_TIME IS_REG_TABLE KEY_COLUMN X X X XML X X X X Tabulka 28. Dostupné olby přezdíek R až X Oddíl Tabulka 28 uádí olby přezdíek pro šechny zdroje dat od R do X. MAXHIT NAMESPACES X X NEXT_TIME PARENT X PROCESSORS Zdroj dat BioRS BLAST Documentum Entrez Excel RANGE X REMOTE_OBJECT X X X SOAPACTION SORTED SORTFIELD SORTORDER STREAMING TEMPLATE TOTALMAXHIT TIMEOUT X URL VALIDATE VALIDATE_DATA_FILE VERTICAL_TABLE XPATH XPATH_EVAL_TIME Copyright IBM Corp. 1998,

240 Tabulka 28. Dostupné olby přezdíek R až X (pokračoání) Zdroj dat RANGE REMOTE_OBJECT SOAPACTION SORTED SORTFIELD SORTORDER Extended Search X X X X X HMMER Soubory s tabulkoou strukturou X Weboé služby X X X X X WebSphere Business Integration STREAMING XML X X X X TEMPLATE X TOTALMAXHIT TIMEOUT X URL VALIDATE VALIDATE_DATA_FILE X VERTICAL_TABLE XPATH X XPATH_EVAL_TIME Tabulka 29. Volby přezdíek a jejich nastaení Oddíl Tabulka 29 popisuje šechny olby přezdíek a uádí seznam platných a ýchozích nastaení. Volba Popis a platná nastaení Výchozí nastaení ALL_VERSIONS APPLICATIONID BUSOBJ_NAME CATEGORY Určuje, zda budou yhledáány šechny erze objektu. Platné hodnoty jsou y, Y, n a N. Výchozí hodnota N znamená, že budou do zpracoání dotazu zahrnuty pouze aktuální erze objektu. Tato olba je platná pouze za podmínky IS_REG_TABLE = Y. Určuje jméno aplikace produktu Extended Search, kde chcete yhledáat. Toto jméno musí konfigurační databázi produktu Extended Search existoat. Tato olba je poinná. Jméno souboru definice schématu XML (.xsd), který předstauje obchodní objekt. Příklad: sap_bapi_customer_get_detail2. Tato olba musí být zadána kořenoé přezdíce. Určuje jednu nebo íce kategorií produktu Extended Search, e kterých chcete yhledáat. Pokud tuto olbu ynecháte, musíte zadat alespoň jedno jméno zdroje dat. Chcete-li zadat íce kategorií, oddělujte jejich jména středníkem. N 228 Příručka pro federoané systémy

241 Tabulka 29. Volby přezdíek a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení COLUMN_DELIMITER DATASOURCE Odděloač, který se použíá k odděloání sloupců souboru s tabulkoou strukturou, uzařený do apostrofů. Odděloač sloupců se může skládat z íce znaků. Není-li definoán žádný odděloač sloupců, je ýchozím odděloačem čárka. Apostrof nelze použít jako odděloač. Odděloač sloupců musí být celém souboru konzistentní. Hodnota Null je reprezentoána děma odděloači edle sebe, nebo odděloačem a znakem konce řádku, je-li pole Null posledním řádku. Odděloač sloupců nesmí být obsažen e sloupci jako platná data. Pro Extended Search: Určuje jeden nebo íce zdrojů dat produktu Extended Search, e kterých chcete yhledáat. Pokud tuto olbu ynecháte, musíte zadat alespoň jedno jméno kategorie. Chcete-li zadat íce zdrojů dat, oddělujte jejich jména středníky. Pro BLAST: Jméno zdroje dat, na kterém bude spuštěno yhledáání BLAST. Stejný řetězec, který se použíá zde, musí být ueden i konfiguračním souboru démona BLAST. Tato olba je poinná. Pro HMMER (typ PFAM): Jméno databáze profilu HMM, e které bude modul HMMPFAM yhledáat. Stejný řetězec, který se použíá zde, musí být ueden i konfiguračním souboru démona HMMER. Tato olba je poinná. Výchozím znakem odděloače je čárka. DIRECTORY_PATH Pro HMMER (typ SEARCH): Jméno souboru pořadí, e kterém bude modul HMMSEARCH yhledáat. Stejný řetězec, který se použíá zde, musí být ueden i konfiguračním souboru démona HMMER. Tato olba je poinná. Určuje cestu k adresáři obsahujícímu jeden nebo íce souborů XML. Tuto olbu použijte případě, že chcete ytořit jednu přezdíku pro íce zdrojoých souborů XML. Modul wrapper pro XML použíá pouze ty soubory umístěné zadaném adresáři, které mají příponu.xml. Všechny ostatní soubory tomto adresáři modul wrapper pro XML ignoruje. Pokud yberete tuto olbu přezdíky, neybírejte sloupec DOCUMENT. Tato olba je přijata pouze kořenoou přezdíkou (přezdíka, která identifikuje prky nejyšší úroni dokumentu XML). Kapitola 23. Volby přezdíek pro federoané systémy 229

242 Tabulka 29. Volby přezdíek a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení FILE_PATH Pro Microsoft Excel: Určuje úplnou cestu k adresáři a jméno souboru tabulky aplikace Excel, ke kterému chcete mít přístup. Tato olba je poinná. Pro soubory s tabulkoou strukturou: Úplná cesta k požadoanému souboru s tabulkoou strukturou, uzařená apostrofech. Datoý soubor musí být standardní soubor nebo symbolický odkaz, ne propojení procesů ani žádný jiný nestandardní typ soubory. Musí být zadána olba sloupce přezdíky FILE_PATH nebo DOCUMENT. Je-li zadána olba přezdíky FILE_PATH, není možné zadat žádnou olbu sloupce přezdíky DOCUMENT. Pro XML: Určuje cestu k souboru dokumentu e formátu XML. Pokud yberete tuto olbu přezdíky, neybírejte sloupec DOCUMENT. Tato olba je přijata pouze kořenoou přezdíkou (přezdíka, která identifikuje prky nejyšší úroni dokumentu XML). FOLDERS Určuje řetězec obsahující jeden nebo íce logicky kombinoaných a syntakticky spráných predikátů FOLDER produktu Documentum. Zadáním predikátů FOLDER omezíte sadu dokumentů reprezentoaných touto přezdíkou na dokumenty naržených adresářích. Pokud chcete tuto olbu zadat, uzařete celou hodnotu olby FOLDERS do apostrofů a unitř řetězce namísto apostrofů použijte uozoky. Tato olba není platná za podmínky IS_REG_TABLE = Y. HMMTYPE INSTANCE_PARSE_TIME IS_REG_TABLE Volitelné: Abeceda, která se použíá modelech i genoých sekencích. Hodnota může být buď NUCLEIC, nebo PROTEIN a nerozlišují se ní elká a malá písmena. Udáá čas ( milisekundách), který je potřebný pro analýzu dat jednom řádku zdrojoého dokumentu XML. Volby INSTANCE_PARSE_TIME, XPATH_EVAL_TIME a NEXT_TIME lze změnit a optimalizoat tak dotazy rozsáhlých a složitých struktur zdroje XML. Tato olba je přijata pouze u sloupců kořenoé přezdíky (přezdíka, která identifikuje prky nejyšší úroni dokumentu XML). Číslo, které zadáte, může být celé nebo desetinné. Určuje, zda je objekt určený olbou REMOTE_OBJECT registroaná tabulka produktu Documentum. Platné hodnoty jsou y, Y, n a N. PROTEIN 7 N Přezdíku nelze změnit z objektu Documentum na registroanou tabulku (ani naopak) změnou této olby pomocí příkazu ALTER NICKNAME. Místo toho budete muset přezdíku zrušit a znou ytořit. 230 Příručka pro federoané systémy

243 Tabulka 29. Volby přezdíek a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení KEY_COLUMN Jméno sloupce souboru, jenž toří klíč, podle kterého je soubor řazen, uzařené apostrofech. Tuto olbu použíejte pouze pro řazené soubory. Sloupec, který je naržen s olbou sloupce přezdíky DOCUMENT, nesmí být zadán jako sloupec klíče. Podporoány jsou pouze klíče s jedním sloupcem. Klíče s íce sloupci nejsou pooleny. Hodnota musí být jméno sloupce definoaného příkazu CREATE NICKNAME. Sloupec musí být seřazen zestupně. Sloupec klíče musí být naržen bez poolené hodnoty Null, což lze zařídit přidáním olby NOT NULL do jeho definice příkazu přezdíky. Pokud není zadána hodnota pro řazenou přezdíku, bude hodnotou jméno prního sloupce souboru s přezdíkou. V této olbě jsou rozlišoána elká a malá písmena. Produkt DB2 UDB ošem změní jména sloupců, pokud nejsou definoána uozokách, na elká písmena. MAXHIT Celé číslo určující maximální počet ýsledků, které mohou být ráceny z každého prohledáaného zdroje. 50 NAMESPACES Jmenné prostory, které jsou přidruženy k předponám jmenného prostoru použíaných olbami XPATH a TEMPLATE pro každý sloupec. Syntaxe je následující: NAMESPACES prefix1= "aktualní_jmenný_prostor1", prefix2="aktualní_jmenný_prostor2" Jednotlié jmenné prostory oddělujte čárkami. Příklad: NAMESPACES c="http://www.myweb.com/cust", i="http://www.myweb.com/cust/id", n="http://www.myweb.com/cust/name" NEXT_TIME PARENT PROCESSORS RANGE Určuje čas ( milisekundách), který je potřeba pro yhledání následných zdrojoých prků z ýrazu XPath. Volby NEXT_TIME, XPATH_EVAL_TIME a INSTANCE_PARSE_TIME lze uprait, a optimalizoat tak dotazy rozsáhlých a složitých zdrojoých struktur XML. Tato olba je přijímána kořenoými i ostatními přezdíkami. Určeno pouze pro podřízenou přezdíku, jejíž nadřazená přezdíka byla pomocí olby REMOTE_OBJECT přejmenoána. Volba PARENT přiřazuje k podřízenému prku nadřazený, jsou-li e schématu DB2 definoány rodiny s íce přezdíkami. V tomto jménu se rozlišují elká a malá písmena. Určuje počet procesorů, které se budou použíat při yhodnocoání dotazu BLAST. Tato olba odpoídá olbě blastall -a. Určuje rozsah buněk pro použití e zdroji dat. 1 1 Kapitola 23. Volby přezdíek pro federoané systémy 231

244 Tabulka 29. Volby přezdíek a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení REMOTE_OBJECT Pro BioRS: Určuje jméno databanky BioRS, která je přiřazená k této přezdíce. Toto jméno určuje schéma a databanku BioRS pro přezdíku. Dále toto jméno udáá ztah přezdíky k dalším přezdíkám. Citliost na malá a elká písmena tomto jménu záisí na citliosti sereru BioRS na malá a elká písmena a na olbě sereru CASE_SENSITIVE. Pro změnu a odstranění tohoto jména nelze použít příkaz ALTER NICKNAME. Pokud se jméno databanky použíané této olbě změní, musíte celou přezdíku odstranit a pak ji znou ytořit. Pro Documentum: Určuje jméno typu objektu Documentum, který je přiřazen k této přezdíce. Jménem může být liboolný typ objektu Documentum nebo registroaná tabulka. Jméno registroané tabulky musí mít jako předponu jméno lastníka tabulky. Pokud registroaná tabulka patří lastníkoi Docbase, může být jako jméno lastníka použita hodnota dm_dbo. Tato olba je poinná. Použití příkazu ALTER NICKNAME pro změnu hodnoty olby REMOTE_OBJECT poede k chybám, pokud struktura noého objektu neodpoídá struktuře objektu půodního. Pro Entrez: Určuje jméno typu objektu Entrez, který je přiřazen k této přezdíce. Toto jméno určuje schéma a databázi NCBI přezdíky a její ztah k ostatním přezdíkám. V tomto jménu se nerozlišují elká a malá písmena. SOAPACTION SORTED Atribut URI SOAPACTION z formátu WSDL (Web Serice Description Language). Tato olba je yžadoána pro kořenoou přezdíku. Pro ostatní přezdíky není tato olba poolena. Určuje, zda je soubor zdroje dat řazený nebo neřazený. Tato olba umožňuje hodnoty Y, y, n nebo N. N Řazené zdroje dat musí být řazeny zestupně podle řadicí poslouposti pro aktuální lokalitu, jak je definoáno kategorii LC_COLLATE národního prostředí. Pokud zadáte, že je zdroj dat řazen, nastate olbu VALIDATE_DATA_FILE na hodnotu Y. SORTFIELD SORTORDER Určuje jméno pole, kde se mají ukládat ýsledky yhledáání. Výchozí hodnota, DOC_RANK, předstauje pole, které produkt Extended Search použíá pro určení ýznamnosti dokumentu ýsledků. Pokud zadáte jiné jméno pole, musí toto jméno existoat e zdrojích, nichž yhledááte. Určuje pořadí řazení pro rácené ýsledky yhledáání, a to buď zestupné (A), nebo sestupné (D). DOC_RANK A 232 Příručka pro federoané systémy

245 Tabulka 29. Volby přezdíek a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení STREAMING Určuje, zda by měl být zdrojoý dokument XML rozdělen pro zpracoání na logické fragmenty. Fragmenty odpoídají uzlům, které se shodují s ýrazem XPath přezdíky. Modul wrapper pak proede analýzu a zpracuje zdrojoá data XML fragment po fragmentu. Tento typ analýzy minimalizuje použíání paměti. Tato olba je zadána pouze na kořenoé přezdíce. N Volbu STREAMING můžete zadat pro liboolný zdrojoý dokument XML (FILE, DIRECTORY, URI nebo COLUMN). Tato olba je přijata pouze u sloupců kořenoé přezdíky (přezdíka, která identifikuje prky horní úroni dokumentu XML). Platné hodnoty: Y N Dokumenty XML jsou analyzoány. Dokumenty XML nejsou analyzoány. Pokud nastaíte parametr VALIDATE na hodnotu YES, nenastaujte parametr STREAMING na hodnotu YES. Pokud nastaíte oba tyto parametry na hodnotu YES, obdržíte chyboou zpráu. TEMPLATE Pro WebSphere Business Integration: Fragment šablony přezdíky pro použití ke konstrukci stupního dokumentu XML. Fragment musí odpoídat dané syntaxi šablony. Pro Weboé služby: Fragment šablony přezdíky pro použití ke konstrukci požadaku SOAP. Fragment musí odpoídat dané syntaxi šablony. TOTALMAXHIT TIMEOUT Celé číslo určující maximální počet ýsledků, které mohou být ráceny ze šech prohledáaných zdrojů. Modul wrapper sloučí tyto ýsledky do jediné ýsledné sady. Pro Extended Search: Celé číslo určující počet sekund čekání na odezu ze sereru před ypršením časoého limitu požadaku. 50 Pro Extended Search: 30. Pro BLAST a HMMER: 60. Pro BLAST a HMMER: Maximální doba minutách, po kterou modul wrapper čeká na ýsledky z démona. URL Adresa URL pro koncoý bod weboé služby. Tato olba je yžadoána pro kořenoou přezdíku. Pro ostatní přezdíky není tato olba poolena. Podporoanými protokoly jsou HTTP a HTTPS. Kapitola 23. Volby přezdíek pro federoané systémy 233

246 Tabulka 29. Volby přezdíek a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení VALIDATE Určuje, zda by měl být zdrojoý dokument XML před extrakcí dat XML oěřen. Je-li tato olba nastaena na hodnotu YES, olba přezdíky oěří, že se struktura zdrojoého dokumentu řídí schématem XML nebo definicí typu dokumentu (DTD). Tato olba je přijata pouze u sloupců kořenoé přezdíky (přezdíka, která identifikuje prky nejyšší úroni dokumentu XML). Zdrojoý dokument XML není oěřoán, pokud modul wrapper pro XML nemůže yhledat soubor schématu XML ani soubor DTD (.xsd nebo.dtd). Produkt DB2 UDB neydá chyboou zpráu, pokud k oěření nedojde. Proto se přesědčte, že soubor schématu XML nebo soubor DTD umístění zadaném e zdrojoém dokumentu XML existuje. NO Pokud nastaíte parametr STREAMING na hodnotu YES, nenastaujte parametr VALIDATE na hodnotu YES. Pokud nastaíte oba tyto parametry na hodnotu YES, obdržíte chyboou zpráu. VALIDATE_DATA_FILE VERTICAL_TABLE XPATH U řazených souborů tato olba určuje, zda má modul wrapper oěřit, že je sloupec klíče řazen zestupně, a zkontroloat sloupce s hodnotou Null. Jediné platné hodnoty pro tuto olbu jsou Y nebo N. Kontrola se proádí jednou, během registrace. Tato olba není poolena případě, že se olba sloupce přezdíky DOCUMENT použíá pro cestu souboru. Určuje formát prezentace ýsledků yhledáání. Zadáte-li hodnotu YES, rátí produkt Extended Search kromě užiatelských sloupců šechna pole, která jsou konfiguroána jako náratoá. Modul wrapper ukládá ýsledky do tabulky přezdíek jako sislý seznam jmen sloupců. Určuje ýraz XPATH, který identifikuje prky reprezentující jednotlié n-tice. Volba přezdíky XPATH pro podřízenou přezdíku je yhodnocena kontextu cesty, která je zadána olbou přezdíky XPATH odpoídající nadřazené přezdíky. Tento ýraz XPATH se použíá jako kontext pro yhodnocení hodnot sloupců, které jsou identifikoány olbami sloupců přezdíek XPATH. N NO Pro XML: Ve ýrazu XPATH nezadáejte předponu jmenného prostoru. Modul wrapper pro XML nepodporuje jmenné prostory. XPATH_EVAL_TIME Udáá čas ( milisekundách), který je potřebný pro yhodnocení ýrazu XPath přezdíky a pro yhledání prního prku. Volby XPATH_EVAL_TIME, INSTANCE_PARSE_TIME a NEXT_TIME lze uprait, a optimalizoat tak dotazy rozsáhlých a složitých struktur zdroje XML. Tato olba je přijímána kořenoými i ostatními přezdíkami. Číslo, které zadáte, může být celé nebo desetinné Příručka pro federoané systémy

247 Kapitola 24. Volby sloupců přezdíek pro federoané systémy Tabulka 30. Dostupné olby sloupců přezdíek Informace o sloupcích lze příkazech CREATE NICKNAME a ALTER NICKNAME zadat pomoc parametrů jménem olby sloupců přezdíek. Následující tabulka uádí seznam oleb sloupců přezdíek pro šechny zdroje dat. Zdroj dat ALL_VALUES DEFAULT BLAST X X X DB2 Uniersal Database for iseries DB2 Uniersal Database for z/os and OS/390 DB2 Uniersal Database for VM and VSE DB2 Uniersal Database for Linux, UNIX, and Windows DELIMITER DOCUMENT Documentum X X X X Informix Microsoft SQL Serer ODBC OLE DB ESCAPE_INPUT FOREIGN_KEY Oracle X X Sybase Soubory s tabulkoou strukturou Teradata WebSphere Business Integration X INDEX IS_REPEATING NUMERIC_STRING X X X X X X X X X PRIMARY_KEY X X X X X Weboé služby X X X X X X X XML X X X X REMOTE_NAME SOAPACTIONCOLUMN TEMPLATE URLCOLUMN VARCHAR_NO_ TRAILING_BLANKS XPATH Copyright IBM Corp. 1998,

248 Tabulka 31. Volby sloupců a jejich nastaení Volba Popis a platná nastaení Výchozí nastaení ALL_VALUES DEFAULT Určuje, že šechny hodnoty opakoaného atributu budou ráceny, oddělené zadaným odděloačem. Pokud tato olba chybí nebo je nastaena na hodnotu N, bude rácena pouze poslední hodnota opakoaného atributu. Volbu ALL_VALUES lze zadat pouze pro sloupce VARCHAR, pro které je olba IS_REPEATING nastaena na hodnotu Y (neplatné případě IS_REG_TABLE = Y ). Určuje noou ýchozí hodnotu pro následující stupní pené sloupce: E_alue QueryStrands GapAlign NMisMatchPenalty NMatchReward Matrix FilterSequence NumberOfAlignments GapCost ExtendedGapCost WordSize ThresholdEx DELIMITER Tato noá hodnota přepíše předolenou ýchozí hodnotu. Noá ýchozí hodnota musí být stejného typu jako označená hodnota pro daný sloupec. Pro Documentum: Určuje řetězec odděloače, který se bude použíat případě, že je proedeno zřetězení několika hodnot opakoaného atributu. Odděloač může být tořen jedním nebo íce znaky. Tato olba je platná pouze pro atributy objektů s datoým typem VARCHAR, kde je olba IS_REPEATING nastaena na hodnotu Y. Pro BLAST: Znaky odděloače, které se použíají pro určení konce řádku definice sloupce, e kterém se tato olba zobrazí. Pokud se této hodnotě olby objeí íce než jeden znak, pak prní ýskyt kteréhokoli z těchto znaků signalizuje konec informace o poli. Výchozí hodnotou je konec řádku. Pokud nechcete, aby poslední zadaný sloupec obsahoal zbytek řádku definice, je tato olba yžadoána. Pro Documentum: Výchozím odděloačem je čárka. Pro BLAST: Výchozím odděloačem je konec řádku. 236 Příručka pro federoané systémy

249 Tabulka 31. Volby sloupců a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení DOCUMENT Pro soubory s tabulkoou strukturou: Určuje druh souboru s tabulkoou strukturou. Tento modul wrapper podporuje pro tuto olbu pouze hodnotu FILE. Pomocí olby DOCUMENT lze zadat jen jeden sloupec na přezdíku. Sloupec, který je asocioán s olbou DOCUMENT, musí být datoého typu VARCHAR nebo CHAR. Použíáte-li namísto olby přezdíky FILE_PATH olbu sloupce přezdíek DOCUMENT, bude po spuštění dotazu dodán soubor odpoídající této přezdíce. Pokud má olba DOCUMENT hodnotu FILE, je hodnota dodaná při spuštění dotazu úplnou cestou souboru, jehož schéma odpoídá definici přezdíky pro tuto přezdíku. Pro XML: Určuje, že tento sloupec je sloupcem DOCUMENT. Hodnota sloupce DOCUMENT označuje typ zdrojoých dat XML, který je při spuštění dotazu dodán přezdíce. Tato olba je přijata pouze u sloupců kořenoé přezdíky (přezdíka, která identifikuje prky nejyšší úroni dokumentu XML). Pomocí olby DOCUMENT lze zadat jen jeden sloupec na přezdíku. Sloupec, který je asocioán s olbou DOCUMENT, musí být datoého typu VARCHAR. Použíáte-li namísto olby přezdíky FILE_PATH nebo DIRECTORY_PATH olbu sloupce DOCUMENT, bude po spuštění dotazu dodán dokument odpoídající této přezdíce. ELEMENT_NAME Platné hodnoty olby DOCUMENT: FILE Určuje, že je hodnota sloupce přezdíky sázána s cestou k souboru. Při spuštění dotazu jsou dodána data z tohoto souboru. DIRECTORY Určuje, že je hodnota sloupce přezdíky sázána s cestou k adresáři obsahujícímu íce datoých souborů XML. Při spuštění dotazu jsou dodána data XML z íce souborů. Data jsou souborech XML adresáři zadaném cestou. Modul wrapper pro XML použíá pouze ty soubory umístěné zadaném adresáři, které mají příponu.xml. Všechny ostatní soubory tomto adresáři modul wrapper pro XML ignoruje. URI Určuje, že je hodnota sloupce přezdíky sázána s cestou ke zdálenému souboru XML, na nějž odkazuje identifikátor URI. Adresa URI označuje zdálené umístění tohoto souboru XML na webu. COLUMN Určuje, že dokument XML je uložen relačním sloupci. Určuje jméno prku BioRS. Citliost na malá a elká písmena tomto jménu záisí na citliosti sereru BioRS na malá a elká písmena a na olbě sereru CASE_SENSITIVE. Jméno prku BioRS je třeba zadat pouze případě, že se liší od jména sloupce. Kapitola 24. Volby sloupců přezdíek pro federoané systémy 237

250 Tabulka 31. Volby sloupců a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení ESCAPE_INPUT Určuje, zda jsou speciální znaky XML e stupních hodnotách XML nahrazeny či nikoli. Tuto olbu použijte, chcete-li zahrnout fragmenty XML, např. fragmenty XML s opakoanými prky, jako stup. Ve sloupcích použíajících olbu sloupce ESCAPE_INPUT musí být definoána olba sloupce TEMPLATE. Datoý typ sloupce musí být VARCHAR nebo CHAR. Y Platné hodnoty: Y Pokud stup e formátu XML obsahuje speciální znaky, budou nahrazeny odpoídajícími znaky, které jazyk XML použíá pro reprezentaci stupních znaků. N Vstupní znaky jsou zachoány přesně tak, jak se zobrazují. FOREIGN_KEY Označuje, že tato přezdíka je podřízenou přezdíkou, a určuje jméno odpoídající nadřazené přezdíky. Přezdíka může mít nejýše jednu olbu sloupce FOREIGN_KEY. U hodnoty této olby jsou rozlišoána malá a elká písmena. Tabulka, která je naržena s touto olbou, obsahuje klíč, který je generoán modulem wrapper. Pro tento sloupec nesmí být zadána olba XPATH. Sloupec lze použít pouze pro spojení nadřazených a podřízených přezdíek. Pokud má nadřazená přezdíka jiné jméno schématu, dojde k selhání příkazu CREATE NICKNAME s olbou FOREIGN_KEY. Pokud není přezdíka, na niž je odkaz klauzuli FOREIGN_KEY, explicitně definoána jako řetězec s malými nebo smíšenými písmeny, což lze zařídit jejím uzařením do uozoek odpoídajícím příkazu CREATE NICKNAME, musíte při odkazoání na ni klauzuli FOREIGN_KEY zadat přezdíku elkými písmeny. Pokud je tato olba e sloupci nastaena, nelze pro něj nastait žádnou další olbu. INDEX Pořadoé číslo sloupce, e kterém se tato olba zobrazí e skupině sloupců řádku definice. Tato olba je poinná. IS_INDEXED IS_REPEATING Označuje, zda je odpoídající sloupec indexoán (zda se lze na sloupec odkazoat predikátu). Platné hodnoty jsou Y a N. Hodnotu Y lze zadat pouze pro sloupce, jejichž odpoídající prek je indexoán sererem BioRS. Určuje, zda sloupec obsahuje íce hodnot. Platné hodnoty jsou Y a N. Když je přezdíka ytořena, bude tato olba automaticky přidána s hodnotou Y do šech sloupců, které odpoídají indexoanému prku BioRS. N Poslední uedená hodnota je rácena následujících případech: Opakoané atributy jiného typu než VARCHAR Sloupce jiného typu než VARCHAR, je-li parametr ALL_VALUES nastaen na hodnotu N Chcete-li toto omezení překonat, ytořte duální definici pro sloupec s opakoaným atributem. 238 Příručka pro federoané systémy

251 Tabulka 31. Volby sloupců a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení NUMERIC_STRING PRIMARY_KEY Určuje, zda sloupec obsahuje řetězce nebo numerické znaky. Y Tento sloupec obsahuje řetězce numerických znaků 0, 1, 2, Neobsahuje prázdné hodnoty. V případě, že by tento sloupec obsahoal pouze numerické řetězce následoané koncoými prázdnými znaky, nezadáejte hodnotu Y. N Pokud nastaíte pro sloupec olbu NUMERIC_STRING na hodnotu Y, informujete tak optimalizátor, že tento sloupec neobsahuje žádné prázdné znaky, které by mohly kolidoat s řazením dat sloupce. Tuto olbu použijte, pokud se posloupnost řazení zdroje dat liší od posloupnosti řazení použíané federoaným sererem. Sloupce s touto olbou nebudou kůli jiné posloupnosti řazení yloučeny ze zdáleného yhodnocení. Tento sloupec buď není sloupcem s numerickými řetězci, nebo je to sloupec s numerickými řetězci, který obsahuje prázdné hodnoty. Označuje, že tato přezdíka je nadřazenou přezdíkou. Datoý typ sloupce musí být VARCHAR(16). Přezdíka může mít nejýše jednu olbu sloupce PRIMARY_KEY. Jedinou platnou hodnotou je YES. Sloupec, který je naržen s touto olbou, obsahuje klíč, který je generoán modulem wrapper. Pro tento sloupec nesmí být zadána olba XPATH. Sloupec lze použít pouze pro spojení nadřazených a podřízených přezdíek. N Pokud je tato olba e sloupci nastaena, nelze pro něj nastait žádnou další olbu. REFERENCED_OBJECT REMOTE_NAME SOAPACTIONCOLUMN Tato olba je platná pouze pro sloupce, jejichž datoý typ BioRS je Reference. Tato olba určuje jméno databanky BioRS, na kterou se odkazuje aktuální sloupec. Citliost na malá a elká písmena tomto jménu záisí na citliosti sereru BioRS na malá a elká písmena a na olbě sereru CASE_SENSITIVE. Určuje jméno odpoídajícího sloupce nebo atributu Documentum. Tato olba mapuje jména zdáleného atributu nebo sloupce na lokální jméno sloupce DB2 UDB. Sloupec pro specifické zadáání atributu URI SOAPACTION z formátu WSDL (Web Serice Description Language). Tato olba je zadána pouze pro kořenoou přezdíku. Jméno sloupce DB2 UDB. Pokud je tato olba e sloupci nastaena, nelze pro něj nastait žádnou další olbu. TEMPLATE Fragment šablony sloupce pro použití ke konstrukci stupního dokumentu XML. Fragment musí odpoídat dané syntaxi šablony. URLCOLUMN Sloupec pro dynamické zadáání adresy URL pro koncoý bod weboé služby během spuštění dotazu. Tato olba je zadána pouze pro kořenoou přezdíku. Pokud je tato olba e sloupci nastaena, nelze pro něj nastait žádnou další olbu. Kapitola 24. Volby sloupců přezdíek pro federoané systémy 239

252 Tabulka 31. Volby sloupců a jejich nastaení (pokračoání) Volba Popis a platná nastaení Výchozí nastaení VARCHAR_NO_ TRAILING_BLANKS Tato olba se použíá pro zdroje dat s proměnnými datoými typy znaků, které nepoužíají k yplnění délky během poronáání prázdné znaky. N pro oliněné zdroje dat XPATH Některé zdroje dat, jako například systém Oracle, neobsahují sémantiku poronáání s yplňujícími prázdnými znaky, která by racela stejné ýsledky jako sémantika poronáání produktu DB2 UDB for Linux, UNIX, and Windows. Tuto olbu použijte případě, že ji chcete použít pouze pro specifický sloupec VARCHAR nebo VARCHAR2 objektu zdroje dat. Y N Koncoé prázdné znaky těchto sloupcích VARCHAR chybějí, nebo zdroj dat obsahuje sémantiku poronáání s yplňujícími prázdnými znaky, která odpoídá sémantice na federoaném sereru. Federoaný serer odešle operace poronání znaků ke zpracoání do zdroje dat. Koncoé prázdné znaky se těchto sloupcích VARCHAR yskytují a zdroj dat obsahuje sémantiku poronáání s yplňujícími prázdnými znaky, která se liší od sémantiky na federoaném sereru. Federoaný serer zpracuje operace poronání znaků, pokud není možné je kompenzoat ekialentní sémantikou. Například přepisem predikátu. Určuje ýraz XPath dokumentu XML, který obsahuje data odpoídající tomuto sloupci. Modul wrapper yhodnotí ýraz XPath poté, co příkaz CREATE NICKNAME použije tento ýraz XPath z této olby přezdíky XPATH. Souisející koncepce: Analýza posunu na nižší úroeň na stránce 127 Souisející úlohy: Globální optimalizace na stránce Příručka pro federoané systémy

253 Kapitola 25. Volby mapoání funkcí pro federoané systémy Produkt DB2 Information Integrator poskytuje ýchozí mapoání mezi existujícími estaěnými funkcemi zdroje dat a estaěnými funkcemi produktu DB2. Pro ětšinu zdrojů dat jsou ýchozí mapoání funkcí modulech wrapper. Chcete-li použít funkci zdroje dat, kterou federoaný serer nerozpoznáá, musíte ytořit mapoání funkcí mezi funkcí zdroje dat a odpoídající funkcí e federoané databázi. Primárním cílem oleb mapoání funkcí je poskytnout informace o možných nákladech na proedení funkce zdroje dat e zdroji dat. Analýza na nižší úroni určí, zda je funkce e zdroji dat schopná proést funkci dotazu. Optimalizátor dotazu rozhodne, zda přesunutí zpracoání funkce na nižší úroeň do zdroje dat je alternatiou s nejnižšími náklady. Statistické informace uedené definici mapoání funkce pomohou optimalizátoru dotazu poronat předpokládané náklady na proedení funkce zdroje dat s předpokládanými náklady na proedení funkce DB2. Tabulka 32. Volby mapoání funkcí a jejich nastaení Volba Platná nastaení Výchozí nastaení DISABLE INITIAL_INSTS INITIAL_IOS IOS_PER_ARGBYTE IOS_PER_INVOC INSTS_PER_ARGBYTE INSTS_PER_INVOC PERCENT_ARGBYTES Zákaz ýchozího mapoání funkcí. Platné hodnoty jsou Y a N. Předpokládaný počet instrukcí zpracoaných při prním a posledním yolání funkce zdroje dat. Předpokládaný počet stupů a ýstupů proedených při prním a posledním yolání funkce zdroje dat. Předpokládaný počet operací I/O ynaložených na každý bajt sady argumentů předaný funkci zdroje dat. Předpokládaný počet operací I/O na jedno yolání funkce zdroje dat. Předpokládaný počet instrukcí zpracoaných na každý bajt sady argumentů předaný funkci zdroje dat. Předpokládaný počet instrukcí zpracoaných během jednoho yolání funkce zdroje dat. Odhadoané průměrné procento bajtů stupního argumentu, které budou funkcí e skutečnosti načteny. N REMOTE_NAME Jméno funkce zdroje dat. lokální jméno Copyright IBM Corp. 1998,

254 242 Příručka pro federoané systémy

255 Kapitola 26. Platné typy sererů příkazech SQL Typy sereru označují typ zdroje dat, který reprezentuje definice sereru. Typy sereru se liší podle dodaatele, účelu a operačního systému. Podporoané hodnoty záisejí na použíaném modulu wrapper. Pro ětšinu zdrojů dat je třeba zadat platný typ sereru do příkazu CREATE SERVER. Modul wrapper pro BioRS Zdroje dat BioRS. Typ sereru Modul wrapper pro BLAST Není yžadoáno příkazu CREATE SERVER. Zdroj dat BioRS Zdroje dat BLAST podporoané démonem BLAST. Typ sereru BLASTN BLASTP BLASTX TBLASTN TBLASTX Modul wrapper pro CTLIB Zdroj dat Zdroje dat Sybase podporoané klientským softwarem CTLIB. BLAST poroná nukleotidoou sekenci s obsahem databáze nukleotidoých sekencí a nalezne sekence s oblastmi homologickými s oblastmi půodní sekence. BLAST poroná aminokyselinnou sekenci s obsahem databáze aminokyselinných sekencí a nalezne sekence s oblastmi homologickými s oblastmi půodní sekence. BLAST poroná nukleotidoou sekenci s obsahem databáze aminokyselinných sekencí a nalezne sekence s oblastmi homologickými s oblastmi půodní sekence. BLAST poroná aminokyselinnou sekenci s obsahem databáze nukleotidoých sekencí an nalezne sekence s oblastmi homologickými s oblastmi půodní sekence. BLAST poroná nukleotidoou sekenci s obsahem databáze nukleotidoých sekencí a nalezne sekence s oblastmi homologickými s oblastmi půodní sekence. Typ sereru SYBASE Zdroj dat Sybase Copyright IBM Corp. 1998,

256 Modul wrapper pro Documentum Zdroje dat Documentum podporoané knihonou či rozhraním klienta Documentum. Typ sereru DCTM Modul wrapper pro DRDA Zdroje dat skupiny produktů DB2 Zdroj dat Documentum Tabulka 33. DB2 for Linux, UNIX, and Windows Typ sereru Zdroj dat DB2/UDB DB2/6000 DB2/AIX DB2/HPUX DB2/HP DB2/NT DB2/EEE DB2/SUN DB2/PE DB2/2 DB2/LINUX DB2/PTX DB2/SCO IBM DB2 Uniersal Database IBM DB2 for AIX IBM DB2 for AIX IBM DB2 for HP-UX IBM DB2 for HP-UX IBM DB2 for Windows NT IBM DB2 Enterprise-Extended Edition IBM DB2 for Solaris IBM DB2 for Personal Edition IBM DB2 for OS/2 IBM DB2 for Linux IBM DB2 for NUMA-Q IBM DB2 for SCO Unixware Tabulka 34. DB2 for iseries (and AS/400) Typ sereru DB2/400 Zdroj dat IBM DB2 for iseries and AS/400 Tabulka 35. DB2 for z/os and OS/390 Typ sereru DB2/ZOS DB2/390 DB2/MVS Zdroj dat IBM DB2 for z/os IBM DB2 for OS/390 IBM DB2 for MVS Tabulka 36. DB2 Serer for VM and VSE Typ sereru DB2/VM DB2/VSE SQL/DS Zdroj dat IBM DB2 for VM IBM DB2 for VSE IBM SQL/DS 244 Příručka pro federoané systémy

257 Modul wrapper pro Entrez Modul wrapper pro Excel Zdroje dat Entrez. Typ sereru Zdroj dat NUCLEOTIDE Entrez PUBMED Entrez Zdroje dat Excel podporoané produktem Microsoft Excel 97, 2000 a Typ sereru Zdroj dat Není yžadoáno příkazu CREATE SERVER. Microsoft Excel Modul wrapper pro Extended Search Modul wrapper pro HMMER Modul wrapper pro Informix Zdroje dat Extended Search podporoané knihonou klienta Extended Search. Typ sereru Zdroj dat Není yžadoáno příkazu CREATE SERVER. IBM Lotus Extended Search Zdroje dat HMMER podporoané démonem HMMER. Typ sereru Zdroj dat PFAM HMMER SEARCH HMMER Zdroje dat Informix podporoané sadou SDK klienta Informix. Typ sereru INFORMIX Zdroj dat Informix Modul wrapper pro MSSQLODBC3 Zdroje dat Microsoft SQL Serer podporoané oladačem DataDirect Connect ODBC 3.6 nebo ODBC 3.0 (nebo yšším) Typ sereru MSSQLSERVER Zdroj dat Microsoft SQL Serer Kapitola 26. Platné typy sererů příkazech SQL 245

258 Modul wrapper pro NET8 Zdroje dat Oracle podporoané klientským softwarem Oracle NET8. Typ sereru ORACLE Zdroj dat Oracle erze 8.0. nebo yšší Modul wrapper pro ODBC Zdroje dat ODBC podporoané oladačem ODBC 3.x. Typ sereru ODBC Zdroj dat ODBC Modul wrapper pro OLE DB Poskytoatelé rozhraní OLE DB kompatibilní s produktem Microsoft OLE DB 2.0 nebo yšším. Typ sereru Není yžadoáno příkazu CREATE SERVER. Zdroj dat Liboolný poskytoatel rozhraní OLE DB Modul wrapper pro soubory s tabulkoou strukturou Modul wrapper pro Teradata Zdroje dat souborů s tabulkoou strukturou. Typ sereru Zdroj dat Není yžadoáno příkazu CREATE SERVER. Soubory s tabulkoou strukturou Zdroje dat Teradata podporoané klientským softwarem Teradata V2R3, V2R4 a V2R5. Typ sereru TERADATA Modul wrapper pro weboé služby Zdroje dat weboých služeb. Typ sereru Není yžadoáno příkazu CREATE SERVER. Zdroj dat Teradata Zdroj dat Liboolný zdroj dat weboých služeb. 246 Příručka pro federoané systémy

259 Modul wrapper pro WebSphere Business Integration Zdroje dat obchodních aplikací podporoané modulem wrapper pro WebSphere Business Integration. Typ sereru Modul wrapper pro XML Zdroj dat WBI WebSphere Business Integration 2.2 nebo 2.3 Zdroje dat XML. Typ sereru Není yžadoáno příkazu CREATE SERVER. Zdroj dat XML Kapitola 26. Platné typy sererů příkazech SQL 247

260 248 Příručka pro federoané systémy

261 Kapitola 27. Výchozí dopředné mapoání datoých typů Existují da druhy mapoání mezi datoými typy zdroje dat a datoými typy federoané databáze - dopředné a zpětné mapoání typů. V dopředném mapoání typů se jedná o mapoání ze zdáleného typu na sronatelný lokální typ. Výchozí mapoání typů lze přepsat, nebo je možné ytořit pomocí příkazu CREATE TYPE MAPPING noé mapoání typů. Tato mapoání jsou platná e šech podporoaných erzích, není-li řečeno jinak. Pro šechna ýchozí dopředná mapoání datoých typů ze zdroje dat do produktu DB2 for Linux, UNIX, and Windows je federoané schéma produktu DB2 SYSIBM. Následující tabulky zobrazují ýchozí dopředné mapoání mezi datoými typy produktu DB2 for Linux, UNIX, and Windows a datoými typy zdroje dat. Zdroje dat produktu DB2 for z/os and OS/390 Tabulka 37. Výchozí dopředné mapoání datoých typů produktu DB2 for z/os and OS/390 (Nejsou zobrazeny šechny sloupce) REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA BLOB BLOB CHAR CHAR - 0 N CHAR VARCHAR - 0 N CHAR Y - CHAR - 0 Y CHAR Y - VARCHAR - 0 Y CLOB CLOB DATE DATE DBCLOB DBCLOB DECIMAL DECIMAL FLOAT REAL FLOAT DOUBLE GRAPHIC GRAPHIC - 0 N INTEGER INTEGER ROWID Y - VARCHAR 40 - Y SMALLINT SMALLINT Copyright IBM Corp. 1998,

262 Tabulka 37. Výchozí dopředné mapoání datoých typů produktu DB2 for z/os and OS/390 (Nejsou zobrazeny šechny sloupce) (pokračoání) REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA TIME TIME TIMESTAMP TIMESTAMP TIMESTMP TIMESTAMP VARCHAR VARCHAR - 0 N VARCHAR Y - VARCHAR - 0 Y VARG VARGRAPHIC - 0 N VARGRAPHIC VARGRAPHIC - 0 N Zdroje dat produktu DB2 for iseries Tabulka 38. Výchozí dopředné mapoání datoých typů produktu DB2 for iseries (Nejsou zobrazeny šechny sloupce) REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA BLOB BLOB CHAR CHAR - 0 N CHAR VARCHAR - 0 N CHAR Y - CHAR - 0 Y CHAR Y - VARCHAR - 0 Y CLOB CLOB DATE DATE DBCLOB DBCLOB DECIMAL DECIMAL FLOAT REAL FLOAT DOUBLE Příručka pro federoané systémy

263 Tabulka 38. Výchozí dopředné mapoání datoých typů produktu DB2 for iseries (Nejsou zobrazeny šechny sloupce) (pokračoání) REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA GRAPHIC GRAPHIC - 0 N GRAPHIC VARGRAPHIC - 0 N INTEGER INTEGER NUMERIC DECIMAL SMALLINT SMALLINT TIME TIME TIMESTAMP TIMESTAMP TIMESTMP TIMESTAMP VARCHAR VARCHAR - 0 N VARCHAR Y - VARCHAR - 0 Y VARG VARGRAPHIC - 0 N VARGRAPHIC VARGRAPHIC - 0 N Zdroje dat produktu DB2 Serer for VM and VSE Tabulka 39. Výchozí dopředné mapoání datoých typů produktu DB2 Serer for VM and VSE (Nejsou zobrazeny šechny sloupce) REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA BLOB BLOB CHAR CHAR - 0 N CHAR Y - CHAR - 0 Y CLOB CLOB DATE DATE DBAHW SMALLINT Kapitola 27. Výchozí dopředné mapoání datoých typů 251

264 Tabulka 39. Výchozí dopředné mapoání datoých typů produktu DB2 Serer for VM and VSE (Nejsou zobrazeny šechny sloupce) (pokračoání) REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA DBAINT INTEGER DBCLOB DBCLOB DECIMAL DECIMAL FLOAT REAL FLOAT DOUBLE GRAPHIC GRAPHIC - 0 N INTEGER INTEGER SMALLINT SMALLINT TIME TIME TIMESTAMP TIMESTAMP TIMESTMP TIMESTAMP VARCHAR VARCHAR - 0 N VARCHAR Y - VARCHAR - 0 Y VARGRAPHIC VARGRAPHIC - 0 N VARGRAPH VARGRAPHIC - 0 N Zdroje dat produktu DB2 for Linux, UNIX, and Windows Tabulka 40. Výchozí dopředné mapoání datoých typů produktu DB2 for Linux, UNIX, and Windows (Nejsou zobrazeny šechny sloupce) REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA BIGINT BIGINT BLOB BLOB CHAR CHAR - 0 N 252 Příručka pro federoané systémy

265 Tabulka 40. Výchozí dopředné mapoání datoých typů produktu DB2 for Linux, UNIX, and Windows (Nejsou zobrazeny šechny sloupce) (pokračoání) REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA CHAR Y - CHAR - 0 Y CLOB CLOB DATE DATE DBCLOB DBCLOB DECIMAL DECIMAL DOUBLE DOUBLE FLOAT DOUBLE GRAPHIC GRAPHIC - 0 N INTEGER INTEGER LONGVAR N - CLOB LONGVAR Y - BLOB LONGVARG DBCLOB REAL REAL SMALLINT SMALLINT TIME TIME TIMESTAMP TIMESTAMP TIMESTMP TIMESTAMP VARCHAR VARCHAR - 0 N VARCHAR Y - VARCHAR - 0 Y VARGRAPH VARGRAPHIC - 0 N VARGRAPHIC VARGRAPHIC - 0 N Kapitola 27. Výchozí dopředné mapoání datoých typů 253

266 Zdroje dat Informix Tabulka 41. Výchozí dopředné mapoání datoých typů produktu Informix (Nejsou zobrazeny šechny sloupce) REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA BLOB BLOB BOOLEAN, CHARACTER BYTE BLOB CHAR CHARACTER CHAR VARCHAR CLOB CLOB DATE DATE DATETIME DATE DATETIME TIME DATETIME TIMESTAMP DATETIME TIMESTAMP DECIMAL DECIMAL DECIMAL DOUBLE FLOAT DOUBLE INTEGER INTEGER INTERVAL VARCHAR INT BIGINT LVARCHAR VARCHAR MONEY DECIMAL MONEY DOUBLE NCHAR CHARACTER NCHAR VARCHAR NVARCHAR VARCHAR REAL REAL SERIAL INTEGER SERIAL BIGINT SMALLFLOAT REAL SMALLINT SMALLINT TEXT CLOB VARCHAR VARCHAR Příručka pro federoané systémy

267 Tabulka 41. Výchozí dopředné mapoání datoých typů produktu Informix (Nejsou zobrazeny šechny sloupce) (pokračoání) REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA Poznámky: Pro datoý typ DATETIME systému Informix použíá federoaný serer produktu DB2 UNIX nebo Windows kalifikátor ysoké úroně systému Informix jako parametr REMOTE_LENGTH a kalifikátor nízké úroně systému Informix jako parametr REMOTE_SCALE. Kalifikátory Informix se rozumí konstanty TU_ definoané souboru datatime.h klienta SDK systému Informix. Konstanty jsou následující: 0 = YEAR 8 = MINUTE 13 = FRACTION(3) 2 = MONTH 10 = SECOND 14 = FRACTION(4) 4 = DAY 11 = FRACTION(1) 15 = FRACTION(5) 6 = HOUR 12 = FRACTION(2) Zdroje dat produktu Microsoft SQL Serer Tabulka 42. Výchozí dopředné mapoání datoých typů produktu Microsoft SQL Serer REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA bigint BIGINT binary CHARACTER - - Y binary VARCHAR - - Y bit SMALLINT char CHAR - - N char VARCHAR - - N datetime TIMESTAMP datetimen TIMESTAMP decimal DECIMAL decimal DOUBLE Kapitola 27. Výchozí dopředné mapoání datoých typů 255

268 Tabulka 42. Výchozí dopředné mapoání datoých typů produktu Microsoft SQL Serer (pokračoání) REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA decimaln DECIMAL decimaln DOUBLE DUMMY DOUBLE DUMMY DOUBLE float DOUBLE floatn DOUBLE float REAL floatn REAL image BLOB Y int INTEGER intn INTEGER money DECIMAL moneyn DECIMAL nchar CHAR - - N nchar VARCHAR - - N numeric DECIMAL numeric DOUBLE numericn DOUBLE numericn DECIMAL ntext CLOB Y narchar VARCHAR - - N real REAL smallint SMALLINT smalldatetime TIMESTAMP smallmoney DECIMAL smallmoneyn DECIMAL SQL_BIGINT DECIMAL SQL_BIGINT BIGINT SQL_BINARY CHARACTER - - Y SQL_BINARY VARCHAR - - Y SQL_BIT SMALLINT SQL_CHAR CHAR - - N 256 Příručka pro federoané systémy

269 Tabulka 42. Výchozí dopředné mapoání datoých typů produktu Microsoft SQL Serer (pokračoání) REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA SQL_CHAR VARCHAR - - N SQL_DATE DATE SQL_DECIMAL DECIMAL SQL_DECIMAL DOUBLE SQL_DECIMAL DOUBLE SQL_DOUBLE DOUBLE SQL_FLOAT DOUBLE SQL_GUID Y - VARCHAR 16 - Y SQL_INTEGER INTEGER SQL_LONGVARCHAR CLOB N SQL_LONGVARBINARY BLOB - - Y SQL_NUMERIC DECIMAL SQL_REAL DOUBLE SQL_SMALLINT SMALLINT SQL_TIME TIME SQL_TIMESTAMP TIMESTAMP SQL_TINYINT SMALLINT SQL_VARBINARY VARCHAR - - Y SQL_VARCHAR VARCHAR - - N text CLOB - - N timestamp VARCHAR 8 Y tinyint SMALLINT uniqueidentifier Y - VARCHAR 16 - Y arbinary VARCHAR - - Y archar VARCHAR - - N Poznámky: 1. Toto mapoání typů je platné pouze produktu Microsoft SQL Serer erze Toto mapoání typů je platné pouze produktu Microsoft SQL Serer erze Toto mapoání typů je platné pouze operačních systémech Windows Toto mapoání typů je platné pouze produktu Microsoft SQL Serer erze Kapitola 27. Výchozí dopředné mapoání datoých typů 257

270 Zdroje dat ODBC Tabulka 43. Výchozí dopředné mapoání datoých typů ODBC (Nejsou zobrazeny šechny sloupce) REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA SQL_BIGINT BIGINT SQL_BINARY CHARACTER - - Y SQL_BINARY VARCHAR - - Y SQL_BIT SMALLINT SQL_CHAR CHAR - - N SQL_CHAR VARCHAR - - N SQL_DECIMAL DECIMAL SQL_DECIMAL DOUBLE SQL_DOUBLE DOUBLE SQL_FLOAT DOUBLE SQL_INTEGER INTEGER SQL_LONGVARCHAR CLOB N SQL_LONGVARBINARY BLOB - - Y SQL_NUMERIC DECIMAL SQL_NUMERIC DOUBLE SQL_REAL REAL SQL_SMALLINT SMALLINT SQL_TYPE_DATE DATE SQL_TYPE_TIME TIME SQL_TYPE_TIMESTAMP TIMESTAMP SQL_TINYINT SMALLINT SQL_VARBINARY VARCHAR - - Y SQL_VARCHAR VARCHAR - - N SQL_WCHAR CHAR - - N SQL_WCHAR VARCHAR - - N SQL_WVARCHAR VARCHAR - - N SQL_WLONGVARCHAR CLOB N 258 Příručka pro federoané systémy

271 Zdroje dat produktu Oracle NET8 Tabulka 44. Výchozí dopředné mapoání datoých typů produktu Oracle NET8 REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA BLOB \0 BLOB Y CHAR \0 CHAR 0 0 N CHAR \0 VARCHAR 0 0 N CLOB \0 CLOB N DATE \0 TIMESTAMP 0 0 N FLOAT \0 DOUBLE 0 0 N LONG \0 CLOB N LONG RAW \0 BLOB Y MLSLABEL \0 VARCHAR N NUMBER \0 DOUBLE 0 0 N NUMBER >= DECIMAL 0 0 N NUMBER \0 SMALLINT 0 0 N NUMBER \0 INTEGER 0 0 N NUMBER \0 DECIMAL 0 0 N RAW \0 VARCHAR 0 0 Y ROWID NULL - \0 CHAR 18 0 N TIMESTAMP TIMESTAMP VARCHAR \0 VARCHAR 0 0 N Poznámky: 1. Toto mapoání typů je platné pouze pro konfiguraci klienta a sereru produktu Oracle 9i (nebo yšší). Kapitola 27. Výchozí dopředné mapoání datoých typů 259

272 Zdroje dat produktu Sybase Tabulka 45. Výchozí dopředné mapoání datoých typů produktu Sybase CTLIB REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA binary CHAR - - Y binary VARCHAR - - Y bit SMALLINT char CHAR - - N char VARCHAR - - N char null (iz archar) datetime TIMESTAMP datetimn TIMESTAMP decimal DECIMAL decimal DOUBLE decimaln DECIMAL decimaln DOUBLE float REAL float DOUBLE floatn REAL floatn DOUBLE image BLOB int INTEGER intn INTEGER money DECIMAL moneyn DECIMAL nchar CHAR - - N nchar VARCHAR - - N nchar null (iz narchar) numeric DECIMAL numeric DOUBLE numericn DECIMAL numericn DOUBLE narchar VARCHAR - - N real REAL Příručka pro federoané systémy

273 Tabulka 45. Výchozí dopředné mapoání datoých typů produktu Sybase CTLIB (pokračoání) REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE smalldatetime TIMESTAMP smallint SMALLINT smallmoney DECIMAL sysname CHAR - - N text CLOB timestamp VARCHAR 8 - Y tinyint SMALLINT unichar CHAR - - N unichar VARCHAR - - N unichar null (iz uniarchar) uniarchar VARCHAR - - N arbinary VARCHAR - - Y archar VARCHAR - - N REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA Poznámky: 1. Platné pro federoané databáze jiného typu než Unicode. Zdroje dat produktu Teradata Tabulka 46. Výchozí dopředné mapoání datoých typů produktu Teradata (Nejsou zobrazeny šechny sloupce) REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA BYTE CHAR - - Y BYTE VARCHAR - - Y BYTE BLOB BYTEINT SMALLINT Kapitola 27. Výchozí dopředné mapoání datoých typů 261

274 Tabulka 46. Výchozí dopředné mapoání datoých typů produktu Teradata (Nejsou zobrazeny šechny sloupce) (pokračoání) REMOTE_TYPENAME REMOTE_LOWER_LEN REMOTE_UPPER_LEN REMOTE_LOWER_SCALE REMOTE_UPPER_SCALE REMOTE_BIT_DATA CHAR CHARACTER CHAR VARCHAR CHAR CLOB DATE DATE DECIMAL DECIMAL DOUBLE PRECISION DOUBLE FLOAT DOUBLE GRAPHIC GRAPHIC GRAPHIC VARGRAPHIC GRAPHIC DBCLOB INTEGER INTEGER INTERVAL CHAR NUMERIC DECIMAL REAL DOUBLE SMALLINT SMALLINT TIMESTAMP TIMESTAMP VARBYTE VARCHAR - - Y VARBYTE BLOB VARCHAR VARCHAR VARCHAR CLOB VARGRAPHIC VARGRAPHIC VARGRAPHIC DBCLOB REMOTE_DATA_OPERATORS FEDERATED_TYPENAME FEDERATED_LENGTH FEDERATED_SCALE FEDERATED_BIT_DATA Souisející koncepce: Dopředná a zpětná mapoání datoých typů na stránce 46 Souisející odkazy: Změna dlouhých datoých typů na datoé typy archar na stránce 53 Výchozí dopředné mapoání datoých typů Unicode - modul wrapper NET8 na stránce 277 Výchozí dopředné mapoání datoých typů Unicode - modul wrapper Sybase na stránce Příručka pro federoané systémy

275 Výchozí dopředné mapoání datoých typů Unicode - modul wrapper ODBC na stránce 279 Výchozí dopředné mapoání datoých typů Unicode - modul wrapper Microsoft SQL Serer na stránce 280 Kapitola 27. Výchozí dopředné mapoání datoých typů 263

276 264 Příručka pro federoané systémy

277 Kapitola 28. Výchozí zpětné mapoání datoých typů Existují da druhy mapoání mezi datoými typy zdroje dat a datoými typy federoané databáze - dopředné a zpětné mapoání typů. V dopředném mapoání typů se jedná o mapoání ze zdáleného typu na sronatelný lokální typ. Jiným typem mapoání je zpětné mapoání typů, které se spolu s transparentními příkazy DDL použíá k ytáření a úpraě zdálených tabulek. Pro ětšinu zdrojů dat jsou ýchozí mapoání typů modulech wrapper. Výchozí mapoání typů pro zdroje dat skupiny produktů DB2 jsou modulu wrapper pro DRDA. Výchozí mapoání typů pro systém Informix jsou modulu wrapper pro INFORMIX atd. Pokud definujete zdálenou tabulku nebo pohled do federoané databáze DB2, bude definice obsahoat zpětné mapoání typů. Mapoání je z lokálního datoého typu produktu DB2 for Linux, UNIX, and Windows pro každý sloupec do odpoídajícího zdáleného datoého typu. Například existuje ýchozí zpětné mapoání typů, e kterém lokální typ REAL odkazuje na typ systému Informix SMALLFLOAT. Federoané serery produktu DB2 for Linux, UNIX, and Windows nepodporují mapoání pro typy LONG VARCHAR, LONG VARGRAPHIC, DATALINK a užiatelské typy. Pokud použíáte pro ytoření zdálené tabulky příkaz CREATE TABLE, zadáte lokální typy dat, které chcete do této zdálené tabulky zahrnout. Tato ýchozí zpětná mapoání typů přiřadí těmto sloupcům odpoídající zdálené typy. Předpokládejme například, že použíáte příkaz CREATE TABLE pro definici tabulky systému Informix se sloupcem C2. Do příkazu zadáte pro sloupec C2 datoý typ BIGINT. Výchozí zpětné mapoání typu BIGINT záisí na tom, e které erzi systému Informix tabulku ytáříte. Mapoání sloupce C2 tabulce systému Informix bude proedeno na typ DECIMAL systému Informix erze 8 a na typ INT8 systému Informix erze 9. Výchozí zpětné mapoání typů lze přepsat, nebo je možné ytořit pomocí příkazu CREATE TYPE MAPPING noé zpětné mapoání typů. Následující tabulky zobrazují ýchozí zpětné mapoání mezi lokálními datoými typy produktu DB2 for Linux, UNIX, and Windows a zdálenými datoými typy zdroje dat. Tato mapoání jsou platná e šech podporoaných erzích, není-li řečeno jinak. Copyright IBM Corp. 1998,

278 Zdroje dat produktu DB2 for z/os and OS/390 Tabulka 47. Výchozí zpětné mapoání datoých typů produktu DB2 for z/os and OS/390 (Nejsou zobrazeny šechny sloupce) FEDERATED_TYPENAME FEDERATED_LOWER_LEN FEDERATED_UPPER_LEN FEDERATED_LOWER_SCALE FEDERATED_UPPER_SCALE FEDERATED_BIT_DATA FEDERATED_DATA_OPERATORS REMOTE_TYPENAME REMOTE_LENGTH REMOTE_SCALE REMOTE_BIT_DATA BLOB BLOB CHARACTER CHAR - - N CHARACTER Y - CHAR - - Y CLOB CLOB DATE DATE DBCLOB DBCLOB DECIMAL DECIMAL DOUBLE DOUBLE - - FLOAT DOUBLE GRAPHIC GRAPHIC - - N INTEGER INTEGER REAL REAL SMALLINT SMALLINT TIME TIME TIMESTAMP TIMESTAMP VARCHAR VARCHAR - - N VARCHAR Y - VARCHAR - - Y VARGRAPHIC VARGRAPHIC - - N 266 Příručka pro federoané systémy

279 Zdroje dat produktu DB2 for iseries Tabulka 48. Výchozí zpětné mapoání datoých typů produktu DB2 for iseries (Nejsou zobrazeny šechny sloupce) FEDERATED_TYPENAME FEDERATED_LOWER_LEN FEDERATED_UPPER_LEN FEDERATED_LOWER_SCALE FEDERATED_UPPER_SCALE FEDERATED_BIT_DATA FEDERATED_DATA_OPERATORS REMOTE_TYPENAME REMOTE_LENGTH REMOTE_SCALE REMOTE_BIT_DATA BLOB BLOB CHARACTER CHARACTER - - N CHARACTER Y - CHARACTER - - Y CLOB CLOB DATE DATE DBCLOB DBCLOB DECIMAL NUMERIC DECIMAL DECIMAL DOUBLE FLOAT GRAPHIC GRAPHIC - - N INTEGER INTEGER REAL FLOAT SMALLINT SMALLINT TIME TIME TIMESTAMP TIMESTAMP VARCHAR VARCHAR - - N VARCHAR Y - VARCHAR - - Y VARGRAPHIC VARG - - N Kapitola 28. Výchozí zpětné mapoání datoých typů 267

280 Zdroje dat produktu DB2 for VM and VSE Tabulka 49. Výchozí zpětné mapoání datoých typů produktu DB2 for VM and VSE (Nejsou zobrazeny šechny sloupce) FEDERATED_TYPENAME FEDERATED_LOWER_LEN FEDERATED_UPPER_LEN FEDERATED_LOWER_SCALE FEDERATED_UPPER_SCALE FEDERATED_BIT_DATA FEDERATED_DATA_OPERATORS REMOTE_TYPENAME REMOTE_LENGTH REMOTE_SCALE REMOTE_BIT_DATA BLOB BLOB CHARACTER CHAR CHARACTER Y - CHAR - - Y CLOB CLOB DATE DATE DBCLOB DBCLOB DECIMAL DECIMAL DOUBLE FLOAT GRAPHIC GRAPHIC - - N INTEGER INTEGER REAL REAL SMALLINT SMALLINT TIME TIME TIMESTAMP TIMESTAMP VARCHAR VARCHAR VARCHAR Y - VARCHAR - - Y VARGRAPH VARGRAPH - - N 268 Příručka pro federoané systémy

281 Zdroje dat produktu DB2 for Linux, UNIX, and Windows Tabulka 50. Výchozí zpětné mapoání datoých typů produktu DB2 for Linux, UNIX, and Windows (Nejsou zobrazeny šechny sloupce) FEDERATED_TYPENAME FEDERATED_LOWER_LEN FEDERATED_UPPER_LEN FEDERATED_LOWER_SCALE FEDERATED_UPPER_SCALE FEDERATED_BIT_DATA FEDERATED_DATA_OPERATORS REMOTE_TYPENAME REMOTE_LENGTH REMOTE_SCALE FEDERATED_BIT_DATA BIGINT BIGINT BLOB BLOB CHARACTER CHAR - - N CHARACTER Y - CHAR - - Y CLOB CLOB DATE DATE DBCLOB DBCLOB DECIMAL DECIMAL DOUBLE DOUBLE FLOAT DOUBLE GRAPHIC GRAPHIC - - N INTEGER INTEGER REAL REAL SMALLINT SMALLINT TIME TIME TIMESTAMP TIMESTAMP VARCHAR VARCHAR - - N VARCHAR Y - VARCHAR - - Y VARGRAPH VARGRAPHIC - - N VARGRAPHIC VARGRAPHIC Kapitola 28. Výchozí zpětné mapoání datoých typů 269

282 Zdroje dat Informix Tabulka 51. Výchozí zpětné mapoání datoých typů produktu Informix FEDERATED_TYPENAME FEDERATED_LOWER_LEN FEDERATED_UPPER_LEN FEDERATED_LOWER_SCALE FEDERATED_UPPER_SCALE FEDERATED_BIT_DATA FEDERATED_DATA_OPERATORS REMOTE_TYPENAME REMOTE_LENGTH REMOTE_SCALE REMOTE_BIT_DATA BIGINT DECIMAL BIGINT INT BLOB BYTE CHARACTER N - CHAR CHARACTER Y - BYTE CLOB TEXT DATE DATE DECIMAL DECIMAL DOUBLE FLOAT INTEGER INTEGER REAL SMALLFLOAT SMALLINT SMALLINT TIME DATETIME TIMESTAMP DATETIME VARCHAR N - VARCHAR VARCHAR N - TEXT VARCHAR Y - BYTE VARCHAR N - LVARCHAR VARCHAR N - TEXT Poznámky: 1. Toto mapoání typů je platné pouze pro serer Informix erze 8 (nebo nižší). 2. Toto mapoání typů je platné pouze pro serer Informix erze 9. Pro datoý typ DATETIME systému Informix použíá federoaný serer produktu DB2 UNIX nebo Windows kalifikátor ysoké úroně systému Informix jako parametr REMOTE_LENGTH a kalifikátor nízké úroně systému Informix jako parametr REMOTE_SCALE. Kalifikátory Informix se rozumí konstanty TU_ definoané souboru datatime.h klienta SDK systému Informix. Konstanty jsou následující: 0 = YEAR 8 = MINUTE 13 = FRACTION(3) 2 = MONTH 10 = SECOND 14 = FRACTION(4) 4 = DAY 11 = FRACTION(1) 15 = FRACTION(5) 270 Příručka pro federoané systémy

283 Tabulka 51. Výchozí zpětné mapoání datoých typů produktu Informix (pokračoání) FEDERATED_TYPENAME FEDERATED_LOWER_LEN FEDERATED_UPPER_LEN 6 = HOUR 12 = FRACTION(2) FEDERATED_LOWER_SCALE FEDERATED_UPPER_SCALE FEDERATED_BIT_DATA FEDERATED_DATA_OPERATORS REMOTE_TYPENAME REMOTE_LENGTH REMOTE_SCALE REMOTE_BIT_DATA Zdroje dat produktu Microsoft SQL Serer Tabulka 52. Výchozí zpětné mapoání datoých typů produktu Microsoft SQL Serer (Nejsou zobrazeny šechny sloupce) FEDERATED_TYPENAME FEDERATED_LOWER_LEN FEDERATED_UPPER_LEN FEDERATED_LOWER_SCALE FEDERATED_UPPER_SCALE FEDERATED_BIT_DATA FEDERATED_DATA_OPERATORS REMOTE_TYPENAME REMOTE_LENGTH REMOTE_SCALE REMOTE_BIT_DATA BIGINT bigint BLOB image CHARACTER Y - binary CHARACTER N - char CLOB text DATE datetime DECIMAL decimal DOUBLE float INTEGER int SMALLINT smallint REAL real TIME datetime TIMESTAMP datetime VARCHAR N - archar VARCHAR N - text VARCHAR Y - arbinary Kapitola 28. Výchozí zpětné mapoání datoých typů 271

284 Tabulka 52. Výchozí zpětné mapoání datoých typů produktu Microsoft SQL Serer (Nejsou zobrazeny šechny sloupce) (pokračoání) FEDERATED_TYPENAME FEDERATED_LOWER_LEN FEDERATED_UPPER_LEN FEDERATED_LOWER_SCALE FEDERATED_UPPER_SCALE FEDERATED_BIT_DATA FEDERATED_DATA_OPERATORS REMOTE_TYPENAME REMOTE_LENGTH REMOTE_SCALE REMOTE_BIT_DATA VARCHAR Y - image Poznámky: 1. Toto mapoání typů je platné pouze produktu Microsoft SQL Serer erze Zdroje dat produktu Oracle NET8 Tabulka 53. Výchozí zpětné mapoání datoých typů produktu Oracle NET8 FEDERATED_TYPENAME FEDERATED_LOWER_LEN FEDERATED_UPPER_LEN FEDERATED_LOWER_SCALE FEDERATED_UPPER_SCALE FEDERATED_BIT_DATA FEDERATED_DATA_OPERATORS REMOTE_TYPENAME REMOTE_LENGTH REMOTE_SCALE REMOTE_BIT_DATA BLOB Y \0 BLOB 0 0 Y CHARACTER N \0 CHAR 0 0 N CHARACTER Y \0 RAW 0 0 Y CLOB N \0 CLOB 0 0 N DATE N \0 DATE 0 0 N DECIMAL N \0 NUMBER 0 0 N DOUBLE N \0 FLOAT N FLOAT N \0 FLOAT N INTEGER N \0 NUMBER 9 0 N REAL N \0 FLOAT 63 0 N SMALLINT N \0 NUMBER 4 0 N TIME N \0 DATE 0 0 N TIMESTAMP N \0 DATE 0 0 N VARCHAR N \0 VARCHAR2 0 0 N 272 Příručka pro federoané systémy

285 Tabulka 53. Výchozí zpětné mapoání datoých typů produktu Oracle NET8 (pokračoání) FEDERATED_TYPENAME FEDERATED_LOWER_LEN FEDERATED_UPPER_LEN FEDERATED_LOWER_SCALE FEDERATED_UPPER_SCALE FEDERATED_BIT_DATA FEDERATED_DATA_OPERATORS REMOTE_TYPENAME REMOTE_LENGTH REMOTE_SCALE REMOTE_BIT_DATA VARCHAR Y \0 RAW 0 0 Y Poznámka: Datoý typ BIGINT produktu DB2 Uniersal Database for Linux, UNIX, and Windows není k dispozici pro transparentní příkazy DDL. Pokud ytáříte zdálenou tabulku systému Oracle, není možné zadat datoý typ BIGINT příkazu CREATE TABLE. Zdroje dat produktu Sybase Tabulka 54. Výchozí zpětné mapoání datoých typů produktu Sybase CTLIB FEDERATED_TYPENAME FEDERATED_LOWER_LEN FEDERATED_UPPER_LEN FEDERATED_LOWER_SCALE FEDERATED_UPPER_SCALE FEDERATED_BIT_DATA FEDERATED_DATA_OPERATORS REMOTE_TYPENAME REMOTE_LENGTH REMOTE_SCALE REMOTE_BIT_DATA BIGINT decimal BLOB image CHARACTER N - char CHARACTER Y - binary CLOB text DATE datetime DECIMAL decimal DOUBLE float GRAPHIC unichar VARGRAPHIC uniarchar INTEGER integer REAL real SMALLINT smallint TIME datetime Kapitola 28. Výchozí zpětné mapoání datoých typů 273

286 Tabulka 54. Výchozí zpětné mapoání datoých typů produktu Sybase CTLIB (pokračoání) FEDERATED_TYPENAME FEDERATED_LOWER_LEN FEDERATED_UPPER_LEN FEDERATED_LOWER_SCALE FEDERATED_UPPER_SCALE FEDERATED_BIT_DATA FEDERATED_DATA_OPERATORS REMOTE_TYPENAME REMOTE_LENGTH REMOTE_SCALE REMOTE_BIT_DATA TIMESTAMP datetime VARCHAR N - archar VARCHAR N - text VARCHAR N - archar VARCHAR N - text VARCHAR Y - arbinary VARCHAR Y - image VARCHAR Y - arbinary VARCHAR Y - image Poznámky: 1. Toto mapoání typů je platné pouze pro produkt CTLIB a serer Sybase erze 12.0 (nebo nižší). 2. Toto mapoání typů je platné pouze pro produkt CTLIB a serer Sybase erze 12.5 (nebo yšší). Zdroje dat produktu Teradata Tabulka 55. Výchozí zpětné mapoání datoých typů produktu Teradata (Nejsou zobrazeny šechny sloupce) FEDERATED_TYPENAME FEDERATED_LOWER_LEN FEDERATED_UPPER_LEN FEDERATED_LOWER_SCALE FEDERATED_UPPER_SCALE FEDERATED_BIT_DATA FEDERATED_DATA_OPERATORS REMOTE_TYPENAME REMOTE_LENGTH REMOTE_SCALE FEDERATED_BIT_DATA BLOB VARBYTE CHARACTER CHARACTER CHARACTER Y - BYTE CLOB VARCHAR DATE DATE Příručka pro federoané systémy

287 Tabulka 55. Výchozí zpětné mapoání datoých typů produktu Teradata (Nejsou zobrazeny šechny sloupce) (pokračoání) FEDERATED_TYPENAME FEDERATED_LOWER_LEN FEDERATED_UPPER_LEN FEDERATED_LOWER_SCALE FEDERATED_UPPER_SCALE FEDERATED_BIT_DATA FEDERATED_DATA_OPERATORS REMOTE_TYPENAME REMOTE_LENGTH REMOTE_SCALE FEDERATED_BIT_DATA DBCLOB VARGRAPHIC DECIMAL DECIMAL DECIMAL FLOAT DOUBLE FLOAT GRAPHIC GRAPHIC INTEGER INTEGER REAL FLOAT SMALLINT SMALLINT TIME TIME TIMESTAMP TIMESTAMP VARCHAR VARCHAR VARCHAR Y - VARBYTE VARGRAPHIC VARGRAPHIC Poznámky: 1. Datoý typ VARBYTE produktu Teradata může obsahoat datoý typ DB2 BLOB pouze o specifické délce (1 až 64000). 2. Datoý typ VARCHAR produktu Teradata může obsahoat datoý typ DB2 CLOB pouze o specifické délce (1 až 64000). 3. Datoý typ VARGRAPHIC produktu Teradata může obsahoat datoý typ DB2 DBCLOB pouze o specifické délce (1 až 32000). Souisející koncepce: Dopředná a zpětná mapoání datoých typů na stránce 46 Kapitola 28. Výchozí zpětné mapoání datoých typů 275

288 276 Příručka pro federoané systémy

289 Kapitola 29. Výchozí mapoání datoých typů Unicode Výchozí dopředné mapoání datoých typů Unicode - modul wrapper NET8 Následující tabulka uádí ýchozí dopředné mapoání datoých typů pro modul wrapper NET8, pokud federoaná databáze je e formátu Unicode. Tabulka 56. Výchozí dopředné mapoání datoých typů Unicode pro modul wrapper NET8 UTF-8 Oracle Datoý typ Datoý typ Délka CHAR CHAR 1 až 254 bajtů VARCHAR CHAR 255 až bajtů DBCLOB VARCHAR2 NCLOB 1 až bajtů GRAPHIC NCHAR 1 až 127 znaků VARGRAPHIC NCHAR 128 až znaků Souisející koncepce: NVARCHAR2 Podpora formátu Unicode pro federoané systémy na stránce až 2000 znaků Výchozí zpětné mapoání datoých typů Unicode - modul wrapper NET8 Následující tabulka uádí ýchozí zpětné mapoání datoých typů pro modul wrapper NET8, pokud federoaná databáze je e formátu Unicode. Tabulka 57. Výchozí zpětné mapoání datoých typů Unicode pro modul wrapper NET8 UTF-8 Oracle Datoý typ Délka Datoý typ CHAR 1 až 254 bajtů CHAR VARCHAR 1 až bajtů VARCHAR2 CLOB 1 až bajtů CLOB GRAPHIC 1 až 127 znaků NCHAR VARGRAPHIC 1 až znaků NVARCHAR2 DBCLOB 1 až znaků NCLOB Souisející koncepce: Podpora formátu Unicode pro federoané systémy na stránce 117 Copyright IBM Corp. 1998,

290 Výchozí dopředné mapoání datoých typů Unicode - modul wrapper Sybase Následující tabulka uádí ýchozí dopředné mapoání datoých typů pro modul wrapper CTLIB, pokud federoaná databáze je e formátu Unicode. Tabulka 58. Výchozí dopředné mapoání datoých typů Unicode pro modul wrapper Sybase CTLIB UTF-8 Sybase Datoý typ Datoý typ Délka CHAR char 1 až 254 bajtů nchar 1 až 127 znaků VARCHAR char 255 až bajtů CLOB archar nchar narchar text 1 až bajtů 128 až znaků 1 až znaků GRAPHIC unichar 1 až 127 znaků VARGRAPHIC unichar 128 až znaků Souisející koncepce: uniarchar Podpora formátu Unicode pro federoané systémy na stránce až znaků Výchozí zpětné mapoání datoých typů Unicode - modul wrapper Sybase Následující tabulka uádí ýchozí zpětné mapoání datoých typů pro modul wrapper CTLIB, pokud federoaná databáze je e formátu Unicode. Tabulka 59. Výchozí zpětné mapoání datoých typů Unicode pro modul wrapper Sybase CTLIB UTF-8 Sybase Datoý typ Délka Datoý typ CHAR 1 až 254 bajtů char VARCHAR 1 až bajtů archar CLOB 1 až bajtů text GRAPHIC 1 až 127 znaků unichar VARGRAPHIC 1 až znaků uniarchar Souisející koncepce: Podpora formátu Unicode pro federoané systémy na stránce Příručka pro federoané systémy

291 Výchozí dopředné mapoání datoých typů Unicode - modul wrapper ODBC Následující tabulka uádí ýchozí dopředné mapoání datoých typů pro modul wrapper ODBC, pokud federoaná databáze je e formátu Unicode. Tabulka 60. Výchozí dopředné mapoání datoých typů Unicode pro modul wrapper ODBC UTF-8 ODBC Datoý typ Datoý typ Délka CHAR SQL_CHAR 1 až 254 bajtů VARCHAR SQL_CHAR 255 až bajtů SQL_VARCHAR CLOB SQL_LONGVARCHAR - 1 až bajtů GRAPHIC SQL_WCHAR 1 až 127 znaků VARGRAPHIC SQL_WVARCHAR 128 až znaků SQL_WVARCHAR DBCLOB SQL_WLONGVARCHAR - Souisející koncepce: Podpora formátu Unicode pro federoané systémy na stránce až znaků Výchozí zpětné mapoání datoých typů Unicode - modul wrapper ODBC Následující tabulka uádí ýchozí zpětné mapoání datoých typů pro modul wrapper ODBC, pokud federoaná databáze je e formátu Unicode. Tabulka 61. Výchozí zpětné mapoání datoých typů Unicode pro modul wrapper ODBC UTF-8 ODBC Datoý typ Délka Datoý typ CHAR 1 až 254 bajtů SQL_CHAR VARCHAR 1 až bajtů SQL_VARCHAR CLOB 1 až bajtů SQL_LONGVARCHAR GRAPHIC 1 až 127 znaků SQL_WCHAR VARGRAPHIC 1 až znaků SQL_WVARCHAR DBCLOB 1 až znaků SQL_WLONGVARCHAR Souisející koncepce: Podpora formátu Unicode pro federoané systémy na stránce 117 Kapitola 29. Výchozí mapoání datoých typů Unicode 279

292 Výchozí dopředné mapoání datoých typů Unicode - modul wrapper Microsoft SQL Serer Následující tabulka uádí ýchozí dopředné mapoání datoých typů pro modul wrapper Microsoft SQL Serer, pokud federoaná databáze je e formátu Unicode. Tabulka 62. Výchozí dopředné mapoání datoých typů Unicode pro modul wrapper Microsoft SQL Serer UTF-8 Microsoft SQL Serer Datoý typ Datoý typ Délka CHAR CHAR 1 až 254 bajtů VARCHAR CHAR 255 až bajtů VARCHAR CLOB TEXT - 1 až bajtů GRAPHIC NCHAR 1 až 127 znaků VARGRAPHIC NCHAR 128 až znaků NVARCHAR DBCLOB NTEXT - Souisející koncepce: Podpora formátu Unicode pro federoané systémy na stránce až znaků Výchozí zpětné mapoání datoých typů Unicode - modul wrapper Microsoft SQL Serer Následující tabulka uádí ýchozí zpětné mapoání datoých typů pro modul wrapper Microsoft SQL Serer, pokud federoaná databáze je e formátu Unicode. Tabulka 63. Výchozí zpětné mapoání datoých typů Unicode pro modul wrapper Microsoft SQL Serer UTF-8 Datoý typ Délka Datoý typ CHAR 1 až 254 bajtů CHAR Microsoft SQL Serer VARCHAR 1 až bajtů VARCHAR CLOB 1 až bajtů TEXT GRAPHIC 1 až 127 znaků NCHAR VARGRAPHIC 1 až znaků NVARCHAR DBCLOB 1 až znaků NTEXT Souisející koncepce: Podpora formátu Unicode pro federoané systémy na stránce Příručka pro federoané systémy

293 Kapitola 30. Datoé typy podporoané pro nerelační zdroje dat U ětšiny nerelačních zdrojů dat je třeba při ytáření přezdíek pro přístup ke zdroji dat zadat informace o sloupcích, četně datoého typu. Některé nerelační moduly wrapper ytářejí šechny sloupce nutné pro přístup ke zdroji dat. Ty se nazýají pené sloupce. Jiné moduly wrapper umožňují zadat pro sloupce některé nebo šechny datoé typy příkazu CREATE NICKNAME. Následující sekce uádějí moduly wrapper, u kterých můžete zadat datoé typy, a datoé typy podporoané každým z nich. Datoé typy podporoané modulem wrapper BioRS Následující tabulka uádí datoé typy DB2 podporoané modulem wrapper BioRS. Tabulka 64. Datoé typy BioRS, které se mapují k datoým typům DB2 Datoé typy BioRS AUTHOR DATE NUMBER REFERENCE TEXT Datoé typy DB2 CHARACTER, CLOB, VARCHAR CHARACTER, CLOB, VARCHAR CHARACTER, CLOB, VARCHAR CHARACTER, CLOB, VARCHAR CHARACTER, CLOB, VARCHAR Maximální poolená délka pro datoý typ CLOB je 5 MB. Datoé typy podporoané modulem wrapper BLAST Některé datoé typy se automaticky nastaují pro pené sloupce, které modul wrapper BLAST ytoří. U polí řádku definice můžete přiřazení proést při ytáření přezdíky. Pokud data e sloupci řádku definice nejsou kompatibilní s datoým typem lokálního sloupce, obdržíte chybu. Pokud například definujete sloupec řádku definice typu INTEGER a přitom e sloupci existují hodnoty, které nejsou numerické, bude rácena chyba. Následující tabulka uádí datoé typy DB2 podporoané modulem wrapper BLAST. Tabulka 65. Datoé typy BLAST, které se mapují k datoým typům DB2 Datoé typy BLAST definiční řádek Datoé typy DB2 CLOB definiční řádek definiční řádek definiční řádek definiční řádek Maximální poolená délka pro datoý typ CLOB je 5 MB. DOUBLE FLOAT INTEGER VARCHAR Copyright IBM Corp. 1998,

294 Datoé typy podporoané modulem wrapper Documentum Následující tabulka uádí datoé typy DB2 podporoané modulem wrapper Documentum. Tabulka 66. Datoé typy Documentum, které se mapují k datoým typům DB2 Datoé typy Documentum Datoé typy DB2 DOUBLE DOUBLE, FLOAT, INTEGER, SMALLINT ID CHARACTER (16) INTEGER DOUBLE, FLOAT, INTEGER, SMALLINT STRING (do 255 znaků) CHAR, VARCHAR TIME CHAR, DATE, TIMESTAMP, VARCHAR Datoé typy podporoané modulem wrapper Entrez Následující tabulka uádí datoé typy DB2 podporoané modulem wrapper Entrez. Tabulka 67. Datoé typy Entrez, které se mapují k datoým typům DB2 Datoé typy Entrez Datoé typy DB2 character CHARACTER character CLOB Maximální poolená délka pro datoý typ CLOB je 5 MB. date DATE number DECIMAL number DOUBLE integer INTEGER number REAL integer SMALLINT time TIMESTAMP character VARCHAR Datoé typy podporoané modulem wrapper Excel Následující tabulka uádí datoé typy DB2 podporoané modulem wrapper Excel. Tabulka 68. Datoé typy Excel, které se mapují k datoým typům DB2 Datoé typy Excel Datoé typy DB2 date DATE number DOUBLE number FLOAT (n), kde n >= 25 a = 53 integer INTEGER character VARCHAR 282 Příručka pro federoané systémy

295 Datoé typy podporoané modulem wrapper Extended Search Následující tabulka uádí datoé typy DB2 podporoané modulem wrapper Extended Search. Tabulka 69. Datoé typy Extended Search, které se mapují k datoým typům DB2 Datoé typy Extended Search Date Double Integer String Datoé typy DB2 DATE DOUBLE INTEGER VARCHAR Datoé typy podporoané modulem wrapper HMMER Následující tabulka uádí datoé typy DB2 podporoané modulem wrapper HMMER. Tabulka 70. Datoé typy HMMER, které se mapují k datoým typům DB2 Datoé typy HMMER character character character character character Datoé typy DB2 CLOB Maximální poolená délka pro datoý typ CLOB je 5 MB. DOUBLE FLOAT INTEGER VARCHAR Datoé typy podporoané modulem wrapper souborů s tabulkoou strukturou Následující tabulka uádí datoé typy DB2 podporoané modulem wrapper souborů s tabulkoou strukturou. Tabulka 71. Datoé typy souborů s tabulkoou strukturou, které se mapují k datoým typům DB2 Datoé typy souborů s tabulkoou strukturou character character Datoé typy DB2 CHARACTER CLOB number number number integer number integer character Maximální poolená délka pro datoý typ CLOB je 5 MB. DECIMAL DOUBLE FLOAT INTEGER REAL SMALLINT VARCHAR Kapitola 30. Datoé typy podporoané pro nerelační zdroje dat 283

296 Datoé typy podporoané modulem wrapper weboých služeb Následující tabulka uádí datoé typy DB2 podporoané modulem wrapper weboých služeb. Modul wrapper weboých služeb použíá datoé typy XML. Tabulka 72. Datoé typy XML, které se mapují k datoým typům DB2, pro modul wrapper weboých služeb Datoé typy XML character character character date number number number integer number integer character character Datoé typy DB2 CHARACTER CHARACTER FOR BIT DATA CLOB DATE DECIMAL DOUBLE FLOAT INTEGER REAL SMALLINT VARCHAR VARCHAR FOR BIT DATA Datoé typy podporoané modulem wrapper WebSphere Business Integration Následující tabulka uádí datoé typy DB2 podporoané modulem wrapper WebSphere Business Integration. Modul wrapper WebSphere Business Integration použíá datoé typy XML. Tabulka 73. Datoé typy XML, které se mapují k datoým typům DB2, pro modul wrapper WebSphere Business Integration Datoé typy XML character character character date number number number integer number integer character character Datoé typy DB2 CHARACTER CHARACTER FOR BIT DATA CLOB DATE DECIMAL DOUBLE FLOAT INTEGER REAL SMALLINT VARCHAR VARCHAR FOR BIT DATA 284 Příručka pro federoané systémy

297 Datoé typy podporoané modulem wrapper XML Následující tabulka uádí datoé typy DB2 podporoané modulem wrapper XML. Tabulka 74. Datoé typy XML, které se mapují k datoým typům DB2, pro modul wrapper XML Datoé typy XML character character character Datoé typy DB2 CHARACTER CHARACTER FOR BIT DATA CLOB date number number number integer number integer character character Maximální poolená délka pro datoý typ CLOB je 5 MB. DATE DECIMAL DOUBLE FLOAT INTEGER REAL SMALLINT VARCHAR VARCHAR FOR BIT DATA Kapitola 30. Datoé typy podporoané pro nerelační zdroje dat 285

298 286 Příručka pro federoané systémy

299 Kapitola 31. Prky monitoru federoaných databázoých systémů Federoaný systém je serer s íce databázemi, který poskytuje přístup ke zdáleným datům. Umožňuje přístup klientů k různorodým zdrojům dat, které mohou být umístěny na různých platformách, a to společnosti IBM i jiných dodaatelů, relačních i nerelačních. Integruje přístup k distribuoaným datům a nabízí užiatelům jediný obraz databáze heterogenního prostředí. Následující prky uádějí informace o úplném přístupu ke zdroji dat pomocí aplikací spuštěných e federoaném systému DB2 a informace o přístupu ke zdroji dat pomocí dané aplikace spuštěné na instanci federoaného sereru. Prky obsahují následující: datasource_name - Data Source Name monitor element disconnects - Disconnects monitor element insert_sql_stmts - Inserts monitor element update_sql_stmts - Updates monitor element delete_sql_stmts - Deletes monitor element create_nickname - Create Nicknames monitor element passthrus - Pass-Through monitor element stored_procs - Stored Procedures monitor element remote_locks - Remote Locks monitor element sp_rows_selected - Rows Returned by Stored Procedures monitor element select_time - Query Response Time monitor element insert_time - Insert Response Time monitor element update_time - Update Response Time monitor element delete_time - Delete Response Time monitor element create_nickname_time - Create Nickname Response Time monitor element passthru_time - Pass-Through Time monitor element stored_proc_time - Stored Procedure Time monitor element remote_lock_time - Remote Lock Time monitor element Copyright IBM Corp. 1998,

300 288 Příručka pro federoané systémy

301 Kapitola 32. Uložená procedura SYSPROC.NNSTAT Slouží k načtení dostupných statistik pro jednu nebo íce přezdíek. Autorizace Žádná. Syntaxe CALL SYSPROC.NNSTAT( serer/null, schéma/null, přezdíka/null, cesta/null,?,?) Popis parametrů Serer Schéma Serer, na kterém federoaný serer shromažďuje statistiku přezdíek. Tento serer užiatel registruje při definoání zdroje dat e federoané databázi. Zadáte-li pouze jednu přezdíku, můžete pro tento parametr zadat hodnotu Null. Je-li zadána hodnota Null, načte federoaný serer šechny přezdíky na daném sereru. Má-li hodnotu Null parametr Serer, načte federoaný serer statistiku pro přezdíku daném schématu. Pokud mají parametr Schéma a parametr Přezdíka hodnotu Null a zadáte serer, načte federoaný serer statistiku pro daný serer. Přezdíka Jméno přezdíky. Zadáte-li přezdíku, musíte zadat i schéma. Cesta_souboru_žurnálu Cesta a jméno pro soubor žurnálu. Federoaný serer ytáří soubor žurnálu na sereru. Adresáře, které uedete cestě, musejí existoat. V systémech Windows zadejte cestu žurnálu pomocí dou zpětných lomítek. Například: c:\\temp\\nnstat.log. Zadáte-li hodnotu Null, federoaný serer neytáří protokol. Výstupní parametry out_sqlcode Chyba SQL jako ýsledek statistiky out_trace Trasoání Příklady CALL SYSPROC.NNSTAT( NULL, ADMIN, STAFF, /home/iiuser/reportlogs/log1.txt,?,?) CALL SYSPROC.NNSTAT( DB2SERV, ADMIN, NULL, c:\\reports\\log1.txt,?,?) CALL SYSPROC.NNSTAT( DB2SERV, NULL, NULL, NULL,?,?) Souisející koncepce: Prostředek pro aktualizaci statistiky přezdíek - přehled na stránce 179 Souisející úlohy: Načítání statistiky přezdíek na stránce 180 Souisející odkazy: Copyright IBM Corp. 1998,

302 290 Příručka pro federoané systémy Načítání statistiky přezdíek z příkazoého řádku - příklady na stránce 182

303 Kapitola 33. Zotaení HADR (High Aailability Disaster Recoery) s federoanými zdroji dat Při zotaení HADR (High Aailability Disaster Recoery) odesílá primární databáze žurnály rezerní databázi. Pokud bude primární databáze nedostupná, můžete přepnout na databázi rezerní. Požadaky pro relační moduly wrapper Chcete-li implementoat zotaení HADR, aby bylo funkční e federoané databázi použíající relační moduly wrapper, musí být splněny následující podmínky: Musíte definoat jména oblastí zdroje dat identická obou systémech. Pokud například systém s primární databází obsahuje oblast INF1, která odkazuje na instanci produktu Informix na hostiteli xyz, musí systému se sekundární databází oblast INF1 odkazoat na stejnou instanci produktu Informix na stejném hostiteli. Pro zdroje dat Oracle musí být klientská erze systému s primární databází stejná jako klientská erze systému s databází sekundární. U jiných zdrojů dat musí být klientské erze totožné. Následující proměnné prostředí e federoaném konfiguračním souboru musí být systémech primární i sekundární databáze stejné: Oracle: NLS_LANG Informix: CLIENT_LOCALE, DB_LOCALE, DBNLS Sybase: SYBASE_CHARSET Teradata: TERADATA_CHARSET Požadaky pro nerelační moduly wrapper U modulů wrapper pro prostý soubor s tabulkoou strukturou, soubor XML a soubor aplikace Excel musí být externí soubory přístupné obou systémech pomocí stejné cesty a jména. U modulů wrapper pro HMMER a BLAST musí mít každý systém přístup pomocí protokolu TCP/IP k odpoídajícímu démonu, pokud není démon spuštěn tomtéž počítači jako produkt DB2 Information Integrator. U modulu wrapper pro Documentum musí být klient Documentum sekundárním systému. Konfigurační soubory klienta musí být přímo připojeny ke stejnému modulu docbroker. Pro produkt WebSphere Business Integration: Pokud spráce WebSphere MQ není umístěn e stejném systému jako modul wrapper, musíte instaloat klienta WebSphere MQ sekundárním systému. Sekundární systém musí být schopen přístupu ke stejnému spráci WebSphere MQ jako systém primární. Pokud jsou spráce WebSphere MQ i modul wrapper umístěny e stejném systému, ale adaptér je jiném počítači, musí mít sekundární systém spuštěného spráce WebSphere MQ. Dojde-li k selhání primárního systému, musíte ukončit práci adaptéru a překonfiguroat jej tak, aby ukazoal na noého spráce WebSphere MQ. Noý spráce WebSphere MQ musí mít definoána stejná jména front jako primární systém. Pak musíte restartoat adaptér, aby se připojil k sekundárnímu spráci WebSphere. Pokud spráce WebSphere MQ, modul wrapper a adaptér jsou umístěny e stejném systému, musíte ytořit repliku tohoto nastaení sekundárním počítači. Copyright IBM Corp. 1998,

304 Souisející koncepce: High aailability disaster recoery oeriew příručce Data Recoery and High Aailability Guide and Reference 292 Příručka pro federoané systémy

305 Kapitola 34. Údaje sereru brány pro dotazy při chybě jádra Za účelem snazší diagnózy selhání jádra produktu DB2 UDB serisní službou společnosti IBM lze zapsat některé z údajů sereru brány pro dotazy do souboru. Chcete-li zapsat tyto údaje do souboru, postupujte následujícím způsobem: Nastate konfigurační parametr spráce databází FEDERATED na hodnotu YES. Vytořte alespoň jeden objekt sereru. Chcete-li do stejného souboru přidat údaje fondu paměti brány pro dotazy, nastate proměnnou registru DB2MEMDBG na hodnotu ON. Pokud dojde k selhání, nástroj protokoloání loží do souboru db2diag.log odpoídající zpráu. V této zpráě je uedena úplná cesta k souboru obsahujícímu údaje o sereru brány pro dotazy. Copyright IBM Corp. 1998,

306 294 Příručka pro federoané systémy

307 Dokumentace k produktu DB2 Information Integrator Toto téma uádí informace o dokumentaci, která je k dispozici k produktu DB2 Information Integrator. Tabulky tomto tématu udáají oficiální náze dokumentu, číslo formuláře a umístění jednotliých příruček e formátu PDF. Chcete-li si objednat tištěnou knihu, musíte znát buď její oficiální náze, nebo číslo formuláře dokumentu. V tématu jsou dále uedeny názy, jména souborů a umístění poznámek k erzi a požadaků na instalaci produktu DB2 Information Integrator. Téma obsahuje následující oddíly. Přístup k dokumentaci produktu DB2 Information Integrator Dokumentace pro funkci replikace systému z/os Dokumentace pro funkci publikoání událostí produktu DB2 Uniersal Database systému z/os Dokumentace pro funkci publikoání událostí pro systém IMS a VSAM systému z/os Dokumentace pro funkci publikoání událostí a funkci replikace systémech Linux, UNIX a Windows Dokumentace pro federoanou funkci systému z/os Dokumentace pro federoanou funkci systémech Linux, UNIX a Windows Dokumentace pro podnikoé yhledáání systémech Linux, UNIX a Windows Poznámky k erzi a požadaky na instalaci Přístup k dokumentaci produktu DB2 Information Integrator Všechny příručky produktu DB2 Information Integrator a poznámky k erzi jsou k dispozici souborech PDF na weboé stránce podpory produktu DB2 na adrese Chcete-li mít přístup k nejnoější dokumentaci produktu DB2 Information Integrator, klepněte na weboé stránce podpory produktu DB2 Information Integrator na odkaz Product Information (Informace o produktu), jak je uedeno části Obrázek 10 na stránce 296. Copyright IBM Corp. 1998,

308 Obrázek 10. Přístup k odkazu Product Information (Informace o produktu) na webu podpory produktu DB2 Information Integrator Prostřednictím odkazu Product Information (Informace o produktu) získáte přístup k nejnoější dokumentaci produktu DB2 Information Integrator e šech podporoaných jazycích: Dokumentace k produktu DB2 Information Integrator souborech PDF Dokumentace k opraám, četně poznámek k erzi Pokyny pro stažení a instalaci Informačního centra DB2 systémech Linux, UNIX a Windows Odkazy na Informační centrum DB2 online V seznamu yhledejte dokumentaci k té erzi produktu DB2 Information Integrator, kterou použíáte. 296 Příručka pro federoané systémy

Instalační příručka pro systémy Linux, UNIX a Windows

Instalační příručka pro systémy Linux, UNIX a Windows IBM DB2 Instalační příručka pro systémy Linux, UNIX a Windows Verze 8.2 GC09-31-01 IBM DB2 Instalační příručka pro systémy Linux, UNIX a Windows Verze 8.2 GC09-31-01 Než použijete tyto informace a odpoídající

Více

Upgrade na produkt DB2 verze 10.1

Upgrade na produkt DB2 verze 10.1 IBM DB2 10.1 for Linux, UNIX, and Windows Upgrade na produkt DB2 erze 10.1 Aktualizace: leden 2013 SC19-3527-01 IBM DB2 10.1 for Linux, UNIX, and Windows Upgrade na produkt DB2 erze 10.1 Aktualizace:

Více

IBM DB2 Warehouse Manager Standard Edition. Instalační příručka. Verze 8.2 GC09-3714-01

IBM DB2 Warehouse Manager Standard Edition. Instalační příručka. Verze 8.2 GC09-3714-01 IBM DB2 Warehouse Manager Standard Edition Instalační příručka Verze 8.2 GC09-3714-01 IBM DB2 Warehouse Manager Standard Edition Instalační příručka Verze 8.2 GC09-3714-01 Než použijete tyto informace

Více

IBM Tivoli Identity Manager: Příručka k funkci zajištění rychlého spuštění

IBM Tivoli Identity Manager: Příručka k funkci zajištění rychlého spuštění IBM Tioli Access Manager for e-business IBM Tioli Identity Manager: Příručka k funkci zajištění rychlého spuštění Verze 5.1 SC09-3713-00 IBM Tioli Access Manager for e-business IBM Tioli Identity Manager:

Více

Instalační a uživatelská příručka

Instalační a uživatelská příručka IBM DB2 Eeryplace Instalační a užiatelská příručka Verze 8.1.4 SC09-3684-01 IBM DB2 Eeryplace Instalační a užiatelská příručka Verze 8.1.4 SC09-3684-01 Poznámka: Před použitím těchto informací a popisoaných

Více

IBM DB2 9.7 for Linux, UNIX, and Windows

IBM DB2 9.7 for Linux, UNIX, and Windows IBM DB2 9.7 for Linux, UNIX, and Windows Instalace sererů DB2 GC09-3855-00 IBM DB2 9.7 for Linux, UNIX, and Windows Instalace sererů DB2 GC09-3855-00 Poznámka Než použijete tyto informace a odpoídající

Více

Instalační příručka k produktu IBM Business Monitor

Instalační příručka k produktu IBM Business Monitor IBM Business Monitor Instalační příručka k produktu IBM Business Monitor Verze 8, ydání 0 IBM Business Monitor Instalační příručka k produktu IBM Business Monitor Verze 8, ydání 0 ii Instalace Obsah Kapitola

Více

Base: Administrativní příručka

Base: Administrativní příručka IBM Tioli Access Manager Base: Administratiní příručka Verze 5.1 SC09-3708-00 IBM Tioli Access Manager Base: Administratiní příručka Verze 5.1 SC09-3708-00 Poznámka Než začnete použíat uedené informace

Více

Instalační příručka k produktu IBM Business Monitor

Instalační příručka k produktu IBM Business Monitor IBM Business Monitor Instalační příručka k produktu IBM Business Monitor Verze 7.5.0 IBM Business Monitor Instalační příručka k produktu IBM Business Monitor Verze 7.5.0 ii Instalace Obsah Kapitola 1.

Více

Začínáme s produktem Servery DB2

Začínáme s produktem Servery DB2 IBM DB2 Uniersal Database Začínáme s produktem Serery DB2 erze 8.2 GC09-3704-01 IBM DB2 Uniersal Database Začínáme s produktem Serery DB2 erze 8.2 GC09-3704-01 Než použijete tyto informace a odpoídající

Více

IBM DB2 Universal Database. Slovníček. Verze 8.2

IBM DB2 Universal Database. Slovníček. Verze 8.2 IBM DB2 Uniersal Database Sloníček Verze 8.2 IBM DB2 Uniersal Database Sloníček Verze 8.2 Než použijete tyto informace a odpoídající produkt, nezapomeňte si přečíst šeobecné informace uedené sekci Upozornění.

Více

IBM DB2 9.7 for Linux, UNIX, and Windows

IBM DB2 9.7 for Linux, UNIX, and Windows IBM DB2 9.7 for Linux, UNIX, and Windows Verze 9, ydání 7 Instalace sererů DB2 Aktualizace: listopad 2009 GC09-3855-01 IBM DB2 9.7 for Linux, UNIX, and Windows Verze 9, ydání 7 Instalace sererů DB2 Aktualizace:

Více

Uživatelská příručka produktu DB2 Connect

Uživatelská příručka produktu DB2 Connect IBM DB2 Connect 10.5 Užiatelská příručka produktu DB2 Connect SC19-3563-00 IBM DB2 Connect 10.5 Užiatelská příručka produktu DB2 Connect SC19-3563-00 Poznámka Než použijete tyto informace a odpoídající

Více

IBM DB2 Universal Database. Novinky. Verze 8.2 SC09-3645-01

IBM DB2 Universal Database. Novinky. Verze 8.2 SC09-3645-01 IBM DB2 Uniersal Database Noinky Verze 8.2 SC09-3645-01 IBM DB2 Uniersal Database Noinky Verze 8.2 SC09-3645-01 Než použijete tyto informace a odpoídající produkt, nezapomeňte si přečíst šeobecné informace

Více

Uživatelská příručka produktu DB2 Connect

Uživatelská příručka produktu DB2 Connect IBM DB2 Connect 10.1 Užiatelská příručka produktu DB2 Connect Aktualizace: leden 2013 SC19-3531-01 IBM DB2 Connect 10.1 Užiatelská příručka produktu DB2 Connect Aktualizace: leden 2013 SC19-3531-01 Poznámka

Více

DB2 Connect verze 9.5

DB2 Connect verze 9.5 DB2 Connect verze 9.5 Uživatelská příručka produktu DB2 Connect Aktualizace: březen 2008 SC09-3803-01 DB2 Connect verze 9.5 Uživatelská příručka produktu DB2 Connect Aktualizace: březen 2008 SC09-3803-01

Více

Plug-in for Web Servers Integration Guide

Plug-in for Web Servers Integration Guide IBM Tioli Access Manager for e-business Plug-in for Web Serers Integration Guide Verze 5.1 SC09-3712-00 IBM Tioli Access Manager for e-business Plug-in for Web Serers Integration Guide Verze 5.1 SC09-3712-00

Více

IBM DB2 Universal Database Express Edition. Verze 8.2

IBM DB2 Universal Database Express Edition. Verze 8.2 IBM DB2 Uniersal Database Express Edition Poznámky k erzi produktu DB2 UDB Express Edition Verze 8.2 IBM DB2 Uniersal Database Express Edition Poznámky k erzi produktu DB2 UDB Express Edition Verze 8.2

Více

IBM DB2 Universal Database. Poznámky k verzi. Verze 8.1 FixPak 5

IBM DB2 Universal Database. Poznámky k verzi. Verze 8.1 FixPak 5 IBM DB Uniersal Database Poznámky k erzi Verze 8. FixPak IBM DB Uniersal Database Poznámky k erzi Verze 8. FixPak ii Poznámky k erzi Obsah Informace o poznámkách k erzi.... ii Noinky erze 8. FixPak.......

Více

BEA WebLogic Server: Integrační příručka

BEA WebLogic Server: Integrační příručka IBM Tioli Access Manager for e-business BEA WebLogic Serer: Integrační příručka Verze 5.1 SC09-3711-00 IBM Tioli Access Manager for e-business BEA WebLogic Serer: Integrační příručka Verze 5.1 SC09-3711-00

Více

IBM Cognos Express verze 10.1.0. Začínáme s produktem IBM Cognos Express

IBM Cognos Express verze 10.1.0. Začínáme s produktem IBM Cognos Express IBM Cognos Express erze 10.1.0 Začínáme s produktem IBM Cognos Express Poznámka Před použitím těchto informací a produktu, který podporují, si přečtěte informace tématu Upozornění na stránce 55. Informace

Více

Plánování, instalace a konfigurace produktu Host On-Demand

Plánování, instalace a konfigurace produktu Host On-Demand IBM Rational Host On-Demand erze 11.0 Plánoání, instalace a konfigurace produktu Host On-Demand SC09-3873-00 IBM Rational Host On-Demand erze 11.0 Plánoání, instalace a konfigurace produktu Host On-Demand

Více

IBM Directory Server (LDAP)

IBM Directory Server (LDAP) Systémy IBM - iseries IBM Directory Serer (LDAP) Verze 5, ydání 4 Systémy IBM - iseries IBM Directory Serer (LDAP) Verze 5, ydání 4 Poznámka Před použitím těchto informací a produktu, ke kterému se ztahují,

Více

ERserver. iseries Access for Web. iseries. Verze 5, vydání 3

ERserver. iseries Access for Web. iseries. Verze 5, vydání 3 ERserer iseries iseries Access for Web Verze 5, ydání 3 ERserer iseries iseries Access for Web Verze 5, ydání 3 Poznámka Dříe než začnete použíat tuto publikaci a produkt, který tato publikace popisuje,

Více

ERserver. iseries. Globalizace (vývoj globálních aplikací)

ERserver. iseries. Globalizace (vývoj globálních aplikací) ERserer iseries Globalizace (ýoj globálních aplikací) ERserer iseries Globalizace (ýoj globálních aplikací) Copyright International Business Machines Corporation 1998, 2002. Všechna práa yhrazena. Obsah

Více

ERserver. iseries. Globalizace (přehled)

ERserver. iseries. Globalizace (přehled) ERserer iseries Globalizace (přehled) ERserer iseries Globalizace (přehled) Copyright International Business Machines Corporation 1998, 2002. Všechna práa yhrazena. Obsah Globalizace operačního systému

Více

Průvodce kapacitnímplánováním

Průvodce kapacitnímplánováním IBM Tioli Access Manager Průodce kapacitnímplánoáním GC09-3668-00 IBM Tioli Access Manager Průodce kapacitnímplánoáním GC09-3668-00 Poznámka: Než začnete použíat uedené informace a produkt, o který se

Více

Relační databáze a povaha dat

Relační databáze a povaha dat Relační databáze a povaha dat Roman Bartoš Copyright istudium, 2005, http://www.istudium.cz Žádná část této publikace nesmí být publikována a šířena žádným způsobem a v žádné podobě bez výslovného svolení

Více

IBM DB2 Universal Database. Poznámky k verzi. Verze 8.2.2 (totožné s verzí 8.1 FixPak 9)

IBM DB2 Universal Database. Poznámky k verzi. Verze 8.2.2 (totožné s verzí 8.1 FixPak 9) IBM DB Universal Database Poznámky k verzi Verze.. (totožné s verzí.1 FixPak ) IBM DB Universal Database Poznámky k verzi Verze.. (totožné s verzí.1 FixPak ) Než použijete tyto informace a odpovídající

Více

Databáze II. 1. přednáška. Helena Palovská palovska@vse.cz

Databáze II. 1. přednáška. Helena Palovská palovska@vse.cz Databáze II 1. přednáška Helena Palovská palovska@vse.cz Program přednášky Úvod Třívrstvá architektura a O-R mapování Zabezpečení dat Role a přístupová práva Úvod Co je databáze Mnoho dat Organizovaných

Více

IBM Content Manager OnDemand for iseries. Instalační příručka. Verze 5 Vydání 3 SC09-3655-04

IBM Content Manager OnDemand for iseries. Instalační příručka. Verze 5 Vydání 3 SC09-3655-04 IBM Content Manager OnDemand for iseries Instalační příručka Verze 5 Vydání 3 SC09-3655-04 IBM Content Manager OnDemand for iseries Instalační příručka Verze 5 Vydání 3 SC09-3655-04 Poznámka Před použitím

Více

Základy databází. O autorech 17 PRVNÍ ČÁST. KAPITOLA 1 Začínáme 19

Základy databází. O autorech 17 PRVNÍ ČÁST. KAPITOLA 1 Začínáme 19 3 Obsah Novinky v tomto vydání 10 Význam základních principů 11 Výuka principů nezávisle na databázových produktech 12 Klíčové pojmy, kontrolní otázky, cvičení, případové studie a projekty 12 Software,

Více

8.2 Používání a tvorba databází

8.2 Používání a tvorba databází 8.2 Používání a tvorba databází Slide 1 8.2.1 Základní pojmy z oblasti relačních databází Slide 2 Databáze ~ Evidence lidí peněz věcí... výběry, výpisy, početní úkony Slide 3 Pojmy tabulka, pole, záznam

Více

7. Integrita a bezpečnost dat v DBS

7. Integrita a bezpečnost dat v DBS 7. Integrita a bezpečnost dat v DBS 7.1. Implementace integritních omezení... 2 7.1.1. Databázové triggery... 5 7.2. Zajištění bezpečnosti dat... 12 7.2.1. Bezpečnostní mechanismy poskytované SŘBD... 13

Více

7. Integrita a bezpečnost dat v DBS

7. Integrita a bezpečnost dat v DBS 7. Integrita a bezpečnost dat v DBS 7.1. Implementace integritních omezení... 2 7.1.1. Databázové triggery... 5 7.2. Zajištění bezpečnosti dat... 12 7.2.1. Bezpečnostní mechanismy poskytované SŘBD... 13

Více

DB2. Začínáme s produktem DB2 Connect Personal Edition. DB2 Connect verze 9 GC09-3781-00

DB2. Začínáme s produktem DB2 Connect Personal Edition. DB2 Connect verze 9 GC09-3781-00 DB2 DB2 Connect verze 9 Začínáme s produktem DB2 Connect Personal Edition GC09-3781-00 DB2 DB2 Connect verze 9 Začínáme s produktem DB2 Connect Personal Edition GC09-3781-00 Než použijete tyto informace

Více

Přehled systému Microsoft SQL Server. Komu je kniha určena Struktura knihy Nejvhodnější výchozí bod pro čtení knihy Konvence a struktura knihy

Přehled systému Microsoft SQL Server. Komu je kniha určena Struktura knihy Nejvhodnější výchozí bod pro čtení knihy Konvence a struktura knihy Komu je kniha určena Struktura knihy Nejvhodnější výchozí bod pro čtení knihy Konvence a struktura knihy Konvence Další prvky Požadavky na systém Ukázkové databáze Ukázky kódu Použití ukázek kódu Další

Více

Databázové systémy trocha teorie

Databázové systémy trocha teorie Databázové systémy trocha teorie Základní pojmy Historie vývoje zpracování dat: 50. Léta vše v programu nevýhody poměrně jasné Aplikace1 alg.1 Aplikace2 alg.2 typy1 data1 typy2 data2 vytvoření systémů

Více

Jak používat program P-touch Transfer Manager

Jak používat program P-touch Transfer Manager Jak používat program P-touch Transfer Manager Verze 0 CZE Úvod Důležité upozornění Obsah tohoto dokumentu a technické parametry příslušného výrobku podléhají změnám bez předchozího upozornění. Společnost

Více

Databázové systémy. Doc.Ing.Miloš Koch,CSc. koch@fbm.vutbr.cz

Databázové systémy. Doc.Ing.Miloš Koch,CSc. koch@fbm.vutbr.cz Databázové systémy Doc.Ing.Miloš Koch,CSc. koch@fbm.vutbr.cz Vývoj databázových systémů Ukládání dat Aktualizace dat Vyhledávání dat Třídění dat Výpočty a agregace 60.-70. léta Program Komunikace Výpočty

Více

Příloha 01. Deskriptory kvalifikačních úrovní Národní soustavy povolání

Příloha 01. Deskriptory kvalifikačních úrovní Národní soustavy povolání Příloha 01 Deskriptory kalifikačních úroní Národní soustay poolání Znalosti teoretické a faktické (aplikoatelné e ýkonu ) Doednosti kognitiní - použíání logického, intuitiního a tůrčího myšlení a doednosti

Více

Stručný obsah. K2118.indd 3 19.6.2013 9:15:27

Stručný obsah. K2118.indd 3 19.6.2013 9:15:27 Stručný obsah 1. Stručný obsah 3 2. Úvod 11 3. Seznamy a databáze v Excelu 13 4. Excel a externí data 45 5. Vytvoření kontingenční tabulky 65 6. Využití kontingenčních tabulek 81 7. Kontingenční grafy

Více

Návrh a tvorba WWW stránek 1/14. PHP a databáze

Návrh a tvorba WWW stránek 1/14. PHP a databáze Návrh a tvorba WWW stránek 1/14 PHP a databáze nejčastěji MySQL součástí balíčků PHP navíc podporuje standard ODBC PHP nemá žádné šablony pro práci s databází princip práce s databází je stále stejný opakované

Více

DB2 Connect verze 9.5

DB2 Connect verze 9.5 DB2 Connect verze 9.5 Začínáme s produktem DB2 Connect Personal Edition Aktualizace: březen 2008 GC09-3804-01 DB2 Connect verze 9.5 Začínáme s produktem DB2 Connect Personal Edition Aktualizace: březen

Více

Databázové systémy. Cvičení 6: SQL

Databázové systémy. Cvičení 6: SQL Databázové systémy Cvičení 6: SQL Co je SQL? SQL = Structured Query Language SQL je standardním (ANSI, ISO) textovým počítačovým jazykem SQL umožňuje jednoduchým způsobem přistupovat k datům v databázi

Více

Informační systémy 2008/2009. Radim Farana. Obsah. Jazyk SQL

Informační systémy 2008/2009. Radim Farana. Obsah. Jazyk SQL 4 Vysoká škola báňská Technická univerzita Ostrava Fakulta strojní, Katedra automatizační techniky a řízení 2008/2009 Radim Farana 1 Obsah Jazyk SQL, datové typy, klauzule SELECT, WHERE, a ORDER BY. Doporučená

Více

DB2. DB2 verze 9. Poznámky k verzi

DB2. DB2 verze 9. Poznámky k verzi DB2 DB2 verze 9 for Linux, UNIX, and Windows Poznámky k verzi DB2 DB2 verze 9 for Linux, UNIX, and Windows Poznámky k verzi Než použijete tyto informace a odpovídající produkt, nezapomeňte si přečíst

Více

O Apache Derby detailněji. Hynek Mlnařík

O Apache Derby detailněji. Hynek Mlnařík O Apache Derby detailněji Hynek Mlnařík Agenda Historie Vlastnosti Architektura Budoucnost Historie 1997 Cloudscape Inc. - JBMS 1999 Informix Software, Inc. odkoupila Cloudscape, Inc. 2001 IBM odkoupila

Více

DB2 verze 9.5 for Linux, UNIX, and Windows

DB2 verze 9.5 for Linux, UNIX, and Windows DB2 erze 9.5 for Linux, UNIX, and Windows Verze 9 ydání 5 Začínáme s instalací a administrací prostředí DB2 systémech Linux a Windows Aktualizace: prosinec 2010 GC09-3800-03 DB2 erze 9.5 for Linux, UNIX,

Více

Administrace Oracle Práva a role, audit. Kukhar Maria 29.10.2012

Administrace Oracle Práva a role, audit. Kukhar Maria 29.10.2012 Administrace Oracle Práva a role, audit Kukhar Maria 29.10.2012 Ve výchozím nastavení, uživatel Oracle nemůže nic dělat, ani připojit se k databázi. Aby uživatele měli přistup k DB, je třeba vytvořit uživatelské

Více

Inovace a zkvalitnění výuky prostřednictvím ICT. Základní seznámení s MySQL Ing. Kotásek Jaroslav

Inovace a zkvalitnění výuky prostřednictvím ICT. Základní seznámení s MySQL Ing. Kotásek Jaroslav Střední průmyslová škola a Vyšší odborná škola technická Brno, Sokolská 1 Šablona: Název: Téma: Autor: Číslo: Anotace: Inovace a zkvalitnění výuky prostřednictvím ICT Databáze Základní seznámení s MySQL

Více

IBM DB2 Universal Database. Poznámky k verzi. Verze 8.2 FixPak 3 (ekvivalent verze 8.1 Fixpak 10)

IBM DB2 Universal Database. Poznámky k verzi. Verze 8.2 FixPak 3 (ekvivalent verze 8.1 Fixpak 10) IBM DB2 Universal Database Poznámky k verzi Verze 8.2 FixPak 3 (ekvivalent verze 8.1 Fixpak 10) IBM DB2 Universal Database Poznámky k verzi Verze 8.2 FixPak 3 (ekvivalent verze 8.1 Fixpak 10) Než použijete

Více

Použití databází na Webu

Použití databází na Webu 4IZ228 tvorba webových stránek a aplikací Jirka Kosek Poslední modifikace: $Date: 2010/11/18 11:33:52 $ Obsah Co nás čeká... 3 Architektura webových databázových aplikací... 4 K čemu se používají databázové

Více

RELAČNÍ DATABÁZOVÉ SYSTÉMY

RELAČNÍ DATABÁZOVÉ SYSTÉMY RELAČNÍ DATABÁZOVÉ SYSTÉMY VÝPIS KONTROLNÍCH OTÁZEK S ODPOVĚDMI: Základní pojmy databázové technologie: 1. Uveďte základní aspekty pro vymezení jednotlivých přístupů ke zpracování hromadných dat: Pro vymezení

Více

APS Administrator.OP

APS Administrator.OP APS Administrator.OP Rozšiřující webový modul pro APS Administrator Přehled přítomnosti osob v oblastech a místnostech Instalační a uživatelská příručka 2004 2013,TECH FASS s.r.o., Věštínská 1611/19, Praha,

Více

Stručný obsah. část III Aktualizace dat Kapitola 10: Aktualizace databáze 257 Kapitola 11: Integrita dat 275 Kapitola 12: Zpracování transakcí 307

Stručný obsah. část III Aktualizace dat Kapitola 10: Aktualizace databáze 257 Kapitola 11: Integrita dat 275 Kapitola 12: Zpracování transakcí 307 Stručný obsah část I Přehled jazyka SQL Kapitola 1: Úvod 27 Kapitola 2: Stručný úvod do jazyka SQL 37 Kapitola 3: Jazyk SQL z širšího pohledu 45 Kapitola 4: Relační databáze 69 Část II Získávání dat Kapitola

Více

VYUŽITÍ REGIONÁLNÍCH FUNKCÍ A WWW ROZHRANÍ V INTEGROVANÉM KNIHOVNÍM SYSTÉMU KPWINSQL

VYUŽITÍ REGIONÁLNÍCH FUNKCÍ A WWW ROZHRANÍ V INTEGROVANÉM KNIHOVNÍM SYSTÉMU KPWINSQL VYUŽITÍ REGIONÁLNÍCH FUNKCÍ A WWW ROZHRANÍ V INTEGROVANÉM KNIHOVNÍM SYSTÉMU KPWINSQL Petr Štefan Václav Trunec, KP-sys, Čacké 155, Pardubice 1 Úvod Firma KP-SYS spol. s r. o. dodává na náš trh integrované

Více

2. blok část B Základní syntaxe příkazů SELECT, INSERT, UPDATE, DELETE

2. blok část B Základní syntaxe příkazů SELECT, INSERT, UPDATE, DELETE 2. blok část B Základní syntaxe příkazů SELECT, INSERT, UPDATE, DELETE Studijní cíl Tento blok je věnován základní syntaxi příkazu SELECT, pojmům projekce a restrikce. Stručně zde budou představeny příkazy

Více

Stěhování aplikací. Michal Tomek, Sales Manager

Stěhování aplikací. Michal Tomek, Sales Manager Stěhování aplikací Michal Tomek, Sales Manager Agenda Co míníme stěhováním Typické situace Role InterSystems Příležitosti Migrace Stěhování informačního systému Nová budova. HW a OS Získáme nové vlastnosti

Více

Kurz Databáze. Obsah. Dotazy. Zpracování dat. Doc. Ing. Radim Farana, CSc.

Kurz Databáze. Obsah. Dotazy. Zpracování dat. Doc. Ing. Radim Farana, CSc. 1 Kurz Databáze Zpracování dat Doc. Ing. Radim Farana, CSc. Obsah Druhy dotazů, tvorba dotazu, prostředí QBE (Query by Example). Realizace základních relačních operací selekce, projekce a spojení. Agregace

Více

Internetový obchod ES Pohoda Web Revolution

Internetový obchod ES Pohoda Web Revolution Internetový obchod ES Pohoda Web Revolution Uživatelský manuál propojení na ES Pohoda Verze 1.0 Web Revolution s.r.o. 2010 Internetový obchod ES Pohoda Uživatelský manuál na propojení na ES Pohoda Přehled

Více

Další informace o možnostech připojení

Další informace o možnostech připojení IBM Další informace o možnostech připojení Verze 8 SDB2-CONN-SU IBM Další informace o možnostech připojení Verze 8 SDB2-CONN-SU Než použijete tyto informace a odpoídající produkt, nezapomeňte si přečíst

Více

BALISTICKÝ MĚŘICÍ SYSTÉM

BALISTICKÝ MĚŘICÍ SYSTÉM BALISTICKÝ MĚŘICÍ SYSTÉM UŽIVATELSKÁ PŘÍRUČKA Verze 2.3 2007 OBSAH 1. ÚVOD... 5 2. HLAVNÍ OKNO... 6 3. MENU... 7 3.1 Soubor... 7 3.2 Měření...11 3.3 Zařízení...16 3.4 Graf...17 3.5 Pohled...17 1. ÚVOD

Více

Compatibility List. GORDIC spol. s r. o. Verze 3.60.5 8.4.2009

Compatibility List. GORDIC spol. s r. o. Verze 3.60.5 8.4.2009 Compatibility List Verze 3.60.5 8.4.2009 GORDIC spol. s r. o. Copyright 1993-2009 1 Obsah Obsah 1 2 3 4 5 6 7 8 9 3.1 3.2 Úvodní informace Podporované databázové systémy Klientské prostředí Tlustý klient...

Více

Správa podnikového vyhledávání

Správa podnikového vyhledávání IBM DB2 Information Integrator OmniFind Edition Správa podnikového vyhledávání Verze 8.2.2 SC09-3744-01 IBM DB2 Information Integrator OmniFind Edition Správa podnikového vyhledávání Verze 8.2.2 SC09-3744-01

Více

Business Intelligence

Business Intelligence Business Intelligence Josef Mlnařík ISSS Hradec Králové 7.4.2008 Obsah Co je Oracle Business Intelligence? Definice, Od dat k informacím, Nástroj pro operativní řízení, Integrace informací, Jednotná platforma

Více

Semináˇr Java X J2EE Semináˇr Java X p.1/23

Semináˇr Java X J2EE Semináˇr Java X p.1/23 Seminář Java X J2EE Seminář Java X p.1/23 J2EE Složitost obchodních aplikací robusní, distribuované, spolehlivé aplikace s transakcemi na straně serveru, klientské aplikace co nejjednodušší Snaha : Návrh,

Více

Jaký je rozdíl v definicicíh VARCHAR2(20 BYTE) a VARCHAR2(20 CHAR):

Jaký je rozdíl v definicicíh VARCHAR2(20 BYTE) a VARCHAR2(20 CHAR): Mezi příkazy pro manipulaci s daty (DML) patří : 1. SELECT 2. ALTER 3. DELETE 4. REVOKE Jaké vlastnosti má identifikující relace: 1. Je relace, která se využívá pouze v případě modelovaní odvozených entit

Více

Ukládání a vyhledávání XML dat

Ukládání a vyhledávání XML dat XML teorie a praxe značkovacích jazyků (4IZ238) Jirka Kosek Poslední modifikace: $Date: 2014/12/04 19:41:24 $ Obsah Ukládání XML dokumentů... 3 Ukládání XML do souborů... 4 Nativní XML databáze... 5 Ukládání

Více

TÉMATICKÝ OKRUH TZD, DIS a TIS

TÉMATICKÝ OKRUH TZD, DIS a TIS TÉMATICKÝ OKRUH TZD, DIS a TIS Číslo otázky : 20. Otázka : Datová vrstva informačního systému. Nezávislý přístup k datům - standardy ODBC/JDBC. Architektura a použití ADO.NET. Obsah : 1. ODBC 2. JDBC 2.1

Více

Úvod do databází. Modelování v řízení. Ing. Petr Kalčev

Úvod do databází. Modelování v řízení. Ing. Petr Kalčev Úvod do databází Modelování v řízení Ing. Petr Kalčev Co je databáze? Množina záznamů a souborů, které jsou organizovány za určitým účelem. Jaké má mít přínosy? Rychlost Spolehlivost Přesnost Bezpečnost

Více

Operátory ROLLUP a CUBE

Operátory ROLLUP a CUBE Operátory ROLLUP a CUBE Dotazovací jazyky, 2009 Marek Polák Martin Chytil Osnova přednášky o Analýza dat o Agregační funkce o GROUP BY a jeho problémy o Speciální hodnotový typ ALL o Operátor CUBE o Operátor

Více

Platební systém XPAY [www.xpay.cz]

Platební systém XPAY [www.xpay.cz] Platební systém XPAY [www.xpay.cz] implementace přenosu informace o doručení SMS verze 166 / 1.3.2012 1 Obsah 1 Implementace platebního systému 3 1.1 Nároky platebního systému na klienta 3 1.2 Komunikace

Více

GTL GENERATOR NÁSTROJ PRO GENEROVÁNÍ OBJEKTŮ OBJEKTY PRO INFORMATICA POWERCENTER. váš partner na cestě od dat k informacím

GTL GENERATOR NÁSTROJ PRO GENEROVÁNÍ OBJEKTŮ OBJEKTY PRO INFORMATICA POWERCENTER. váš partner na cestě od dat k informacím GTL GENERATOR NÁSTROJ PRO GENEROVÁNÍ OBJEKTŮ OBJEKTY PRO INFORMATICA POWERCENTER váš partner na cestě od dat k informacím globtech spol. s r.o. karlovo náměstí 17 c, praha 2 tel.: +420 221 986 390 info@globtech.cz

Více

Obsah. Základy práce s databází 13. Tabulky 43. Obsah. Úvod 9 Poděkování 12

Obsah. Základy práce s databází 13. Tabulky 43. Obsah. Úvod 9 Poděkování 12 Obsah Úvod 9 Poděkování 12 1 Základy práce s databází 13 Microsoft Access úvodní teoretické informace 14 Co je Microsoft Access 14 Kdy je vhodné použít Access 14 Jednoduché vysvětlení, co je databáze 15

Více

MATURITNÍ OTÁZKY ELEKTROTECHNIKA - POČÍTAČOVÉ SYSTÉMY 2003/2004 PROGRAMOVÉ VYBAVENÍ POČÍTAČŮ

MATURITNÍ OTÁZKY ELEKTROTECHNIKA - POČÍTAČOVÉ SYSTÉMY 2003/2004 PROGRAMOVÉ VYBAVENÍ POČÍTAČŮ MATURITNÍ OTÁZKY ELEKTROTECHNIKA - POČÍTAČOVÉ SYSTÉMY 2003/2004 PROGRAMOVÉ VYBAVENÍ POČÍTAČŮ 1) PROGRAM, ZDROJOVÝ KÓD, PŘEKLAD PROGRAMU 3 2) HISTORIE TVORBY PROGRAMŮ 3 3) SYNTAXE A SÉMANTIKA 3 4) SPECIFIKACE

Více

ProjectWise V8 XM Edition

ProjectWise V8 XM Edition . ProjectWise V8 XM Edition ProjectWise V8 XM Edition Evoluční rozšíření, nikoliv revoluce Hlavní témata XM Edition projekty podpora projektového přístupu, šablony projektů workspaces podpora pracovních

Více

UDS for ELO. Univerzální datové rozhraní. >> UDS - Universal Data Source

UDS for ELO. Univerzální datové rozhraní. >> UDS - Universal Data Source Univerzální datové rozhraní UDS for ELO UDS pro ELO je univerzální datové rozhraní, schopné napojit systém pro archivaci a správu dokumentů ELO na libovolný datový zdroj a to bez nutnosti programování.

Více

Korporátní identita - nejcennější aktivum

Korporátní identita - nejcennější aktivum Korporátní identita - nejcennější aktivum Luděk Šafář Services Team Leader lsafar@novell.cz 03/13/2006 Standardní prostředí IT prostředí je diverzifikované a komplexní Administrativní činnosti jsou manuální

Více

Příručka nastavení funkcí snímání

Příručka nastavení funkcí snímání Příručka nastavení funkcí snímání WorkCentre M123/M128 WorkCentre Pro 123/128 701P42171_CS 2004. Všechna práva vyhrazena. Uplatňovaná ochrana autorských práv se vztahuje na všechny formy a záležitosti

Více

Vladimír Mach. @vladimirmach 2. 1. 2013

Vladimír Mach. @vladimirmach 2. 1. 2013 Vladimír Mach @vladimirmach 2. 1. 2013 SQL Server Compact Edition Jednoduchá relační databáze Použití i v malých zařízeních s omezenými zdroji Dříve pod názvem SQL Server Mobile Časté využití při programování

Více

Kapitola 1: Co je Microsoft Access? 27 Kapitola 2: Mnoho tváří aplikace Microsoft Access 41 Kapitola 3: Návrh databázové aplikace 75

Kapitola 1: Co je Microsoft Access? 27 Kapitola 2: Mnoho tváří aplikace Microsoft Access 41 Kapitola 3: Návrh databázové aplikace 75 Stručný obsah Část 1 Základy aplikace Microsoft Access Kapitola 1: Co je Microsoft Access? 27 Kapitola 2: Mnoho tváří aplikace Microsoft Access 41 Kapitola 3: Návrh databázové aplikace 75 Část 2 Vytváření

Více

IBM DB2 Connect - Uživatelská příručka

IBM DB2 Connect - Uživatelská příručka IBM DB2 Connect IBM DB2 Connect - Uživatelská příručka verze 8 SC09-3646-00 Než použijete tyto informace a odpovídající produkt, nezapomeňte si přečíst všeobecné informace uvedené v sekci Upozornění. Tento

Více

Share online 3.1. 1. vydání

Share online 3.1. 1. vydání Share online 3.1 1. vydání 2008 Nokia. Všechna práva vyhrazena. Nokia, Nokia Connecting People a Nseries jsou ochranné známky nebo registrované ochranné známky společnosti Nokia Corporation. Nokia tune

Více

Integrace dat. MI-DSP 2013/14 RNDr. Ondřej Zýka, ondrej.zyka@profinit.eu

Integrace dat. MI-DSP 2013/14 RNDr. Ondřej Zýka, ondrej.zyka@profinit.eu Integrace dat MI-DSP 2013/14 RNDr. Ondřej Zýka, ondrej.zyka@profinit.eu Požadavky o Očekává se, že integrace nebude jenom spojením systémů, ale že přinese i přidanou hodnotu. o Změny se provádějí pouze

Více

Jádrem systému je modul GSFrameWork, který je poskytovatelem zejména těchto služeb:

Jádrem systému je modul GSFrameWork, který je poskytovatelem zejména těchto služeb: Technologie Marushka Základním konceptem technologie Marushka je použití jádra, které poskytuje přístup a jednotnou grafickou prezentaci geografických dat. Jádro je vyvíjeno na komponentním objektovém

Více

Univerzita pro obchodní partnery 10.03.2011. InfoSphere Guardium. Jan Musil jan_musil@cz.ibm.com. 2009 IBM Corporation

Univerzita pro obchodní partnery 10.03.2011. InfoSphere Guardium. Jan Musil jan_musil@cz.ibm.com. 2009 IBM Corporation Univerzita pro obchodní partnery 10.03.2011 InfoSphere Guardium Jan Musil jan_musil@cz.ibm.com Obsah prezentace Co je to InfoSpere Guardium a co poskytuje Přehled norem a jejich požadavků na databázovou

Více

Nástroj Setup. Uživatelská příručka

Nástroj Setup. Uživatelská příručka Nástroj Setup Uživatelská příručka Copyright 2007 Hewlett-Packard Development Company, L.P. Windows je registrovaná ochranná známka Microsoft Corporation v USA. Informace uvedené v této příručce se mohou

Více

Windows Server 2003 Active Directory

Windows Server 2003 Active Directory Windows Server 2003 Active Directory Active Directory ukládá informace o počítačích, uživatelích a ostatních objektech v síti. Zpřístupňuje tyto zdroje uživatelům. Poskytuje komplexní informace o organizaci,

Více

Microsoft SharePoint Portal Server 2003. Zvýšená týmová produktivita a úspora času při správě dokumentů ve společnosti Makro Cash & Carry ČR

Microsoft SharePoint Portal Server 2003. Zvýšená týmová produktivita a úspora času při správě dokumentů ve společnosti Makro Cash & Carry ČR Microsoft SharePoint Portal Server 2003 Zvýšená týmová produktivita a úspora času při správě dokumentů ve společnosti Makro Cash & Carry ČR Přehled Země: Česká republika Odvětví: Velkoobchod Profil zákazníka

Více

Share online 3.1. 1. vydání

Share online 3.1. 1. vydání Share online 3.1 1. vydání 2008 Nokia. Všechna práva vyhrazena. Nokia, Nokia Connecting People a Nseries jsou ochranné známky nebo registrované ochranné známky společnosti Nokia Corporation. Nokia tune

Více

Práva a role. Martin Polák. NDBI013 Administrace Oracle

Práva a role. Martin Polák. NDBI013 Administrace Oracle Práva a role Martin Polák NDBI013 Administrace Oracle Práva a role Práva slouží k omezení možností uživatele právě tak, aby mohl provádět úkoly jemu svěřené. Role jsou pojmenované skupiny práv a slouží

Více

Jednotka 48X/24X/48X Max CD-RW. Příručka uživatele

Jednotka 48X/24X/48X Max CD-RW. Příručka uživatele Jednotka 48X/24X/48X Max CD-RW Příručka užiatele Jednotka 48X/24X/48X Max CD-RW Příručka užiatele Poznámka: Před použitím tohoto dokumentu a produktu, který popisuje, si přečtěte informace přílohách.

Více

Programování v jazyku C# II. 5.kapitola

Programování v jazyku C# II. 5.kapitola Programování v jazyku C# II. 5.kapitola Obsah O ADO.NET Spojení s DB Příkazy Jednoduché čtení DataSet 2/28 ADO.NET ADO - ActiveX Data Object Orientováno na webové aplikace neexistence stavu v HTTP Obecný

Více

Marketingová komunikace. 2. soustředění. Mgr. Pavel Vávra 9103@mail.vsfs.cz. Kombinované studium Skupina N9KMK1aPH/N9KMK1bPH (um1a1ph/um1b1ph)

Marketingová komunikace. 2. soustředění. Mgr. Pavel Vávra 9103@mail.vsfs.cz. Kombinované studium Skupina N9KMK1aPH/N9KMK1bPH (um1a1ph/um1b1ph) Marketingová komunikace Kombinované studium Skupina N9KMK1aPH/N9KMK1bPH (um1a1ph/um1b1ph) 2. soustředění Mgr. Pavel Vávra 9103@mail.vsfs.cz http://vavra.webzdarma.cz/home/index.htm Minulé soustředění úvod

Více

Možnosti propojení Lotus Notes/Domino a jiných systémů. Ondřej Fuxa Your System spol. s r.o.

Možnosti propojení Lotus Notes/Domino a jiných systémů. Ondřej Fuxa Your System spol. s r.o. Možnosti propojení Lotus Notes/Domino a jiných systémů Ondřej Fuxa Your System spol. s r.o. Lotus Symposium 2010 Agenda Integrace proč o ní uvažujeme? Možnosti integrace Lotus Notes/Domino a jiných systémů

Více

Otevřený svět ICS. Radim Navrátil. aneb co svět oken a ICS? Vedoucí oddělení aplikační administrace a bezpečnosti, YOUR SYSTEM, spol. s r.o.

Otevřený svět ICS. Radim Navrátil. aneb co svět oken a ICS? Vedoucí oddělení aplikační administrace a bezpečnosti, YOUR SYSTEM, spol. s r.o. Otevřený svět ICS aneb co svět oken a ICS? Radim Navrátil Vedoucí oddělení aplikační administrace a bezpečnosti, YOUR SYSTEM, spol. s r.o. Téma přednášky Co a jak lze napojit ve světě oken? Využitím nativních

Více