Geny ovlivňující zbarvení u domestikovaných psů 1 základní barvy

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "Geny ovlivňující zbarvení u domestikovaných psů 1 základní barvy"


1 Geny ovlivňující zbarvení u domestikovaných psů 1 základní barvy doc. Ing. Tomáš Urban, Ph.D. Ústav morfologie, fyziologie a gentiky zvířat AF MZLU v Brně, Psi byli selektováni do více variant velikostí a typů těla než většina ostatních druhů a domestikovaných zvířat. Tato velká diverzita se také projevila ve velké rozmanitosti zbarvení srsti. Genetika zbarvení srsti u psů, stejně jako u ostatních savců, je studovaná již mnoho let. Už v padesátých letech minulého století byly napsány knihy o potenciálních genech, které by mohly vysvětlovat dědičnost zbarvení v rodinách Little (1957) a Winge (1950). Oba autoři použili písmena k označení lokusů a alel (dvou i více) předpokládaných genů, které se objevovaly v rodinách. Jejich výsledky se velmi podobaly. U většiny plemen je povolen relativně úzké rozpětí v barevnosti standardu a u některých plemen mají všichni jedinci stejné barvené vzory. Určité barvy byly znakem pro vyřazení z chovu, protože byla např. spojena s nežádoucími efekty (zdraví, ). V posledních několika letech bylo odhaleno a identifikováno několik genů, které jsou zodpovědné za pigmentaci u psů. K tomu přispěla zejména srovnávací (komparativní) genomika. Bylo identifikováno sedm genů, které určují specifickou barvu kůže a nebo různé vzory u psů: melanocortin 1 receptor, tyrosinase related protein 1, agouti signal peptide, melanophilin, SILV (dříve PMEL17), microphthalmia-associated transcription factor a beta-defensin 103. I když ještě nebyly určeny všechny alely na každém lokusu, jsou vyvinuty příslušné DNA testy. Identifikace těchto alel poskytuje zejména informace o interakcích v tomto komplexu genů, které jsou zodpovědné jak za vývoj pigmentace tak za vývoj neurologický (pleiotropní efekt kdy jeden gen ovlivňuje více vlastností zde zbarvení a neurologické onemocnění). Oba tyto komplexy vlastností jsou spolu vývojově propojené. Alely zjištěné u různých plemen umožňují potenciálně vyhodnocovat historii šlechtění a fylogenetické vztahy. Tyto informace jsou hodnotné zejména pro šlechtěné plemena psů, která byla selektována na základě specifických barevných standardů od konce 18. století. Protože je zbarvení srsti viditelný znak, je tato informace vhodná i pro výuku základních genetických principů. Přístup molekulární genetiky umožňuje šlechtitelům vysvětlit např. proč v určitých vrzích u potomků se neobjeví očekávané zbarvení. Hlavní lokusy zbarvení srsti Gen melanocortin 1 receptor Melanocortin 1 receptor (MC1R) byl prvním genem studovaným molekulárně genetickými metodami psů. MC1R byl zmapován na 5. chromozomu (Schmutz et al. 2001a). Byla popsána mutace způsobující ztrátu funkce, 914C > T (Newton et al., 2000 a Everts et al., 2000), která zapříčiňuje jasně červené zbarvení srsti (Obr. 1 - e, h, l). Tato mutace, která způsobuje záměnu stop kodonu za arginin (R306ter), je přítomna u mnoha plemen psů. Little (1957) nazval tento lokus E neboli extension a tato alela je označena e a původní (divoká) dominantní alela E (Tab. 1). Třetí alela E M vznikla jednonukleotidovou substitucí (799 A > G), která dává vznik záměny aminokyselin M264V (Schmutz et al. 2003a). Melanistické překrytí způsobené jednou kopií této alely je viditelné u psů, kteří jsou zesvětlení (plaví) nebo skvrnití (Obr. 1 - d). Psi celoplášťově černí, hnědí nebo modří nemají to překrytí, které je neodlišitelné od barvy jejich těla. U psů, kteří blednou do šedé s věkem, se objeví jejich maskování v čase (Obr. 1 - k). Podobně psi, kteří mají 1

2 bílé čumáky, neprodukují melanin v těchto oblastech těla a neprojeví se u nich překrytí, dokonce ani když mají tuto alelu (Obr. 1 - j). Obr. 1: Fotografie a vybrané genotypy různých plemen psů, které zobrazují varianty zbarvení srsti a interakcí genů. (a) světle hnědý French Brittany k y /k y, E/E, b/b, a t /a t ; (b) (vlevo) hnědý German Shorthaired Pointer K B /K B, E/E, b/b a (vpravo) černý Large Munsterlander K B /K B, E/E, B/b; (c) Landseer Newfoundland K B /K B, E/E, B/B, s/s; (d) světle maskovaný Chinese Shar-Pei k y /k y, E M /E, B/B, a y /a y ; (e) světlý French Bulldog k br /k y, e/e, B/B, a y /a y ; (f) skvrnitý Staffordshire Bull Terrier k br /k y, E/E, B/B, a y /a t ; (g) merle Australian Shepherd k y /k y, E/E, B/B, a t /a t, M/m; (h) (vlevo) jasně červený Miniature Dachshund k y /k y, e/e, B/B and (vpravo) černý světle hnědý Miniature Dachshund k y /k y, E/, B/B, a t /a t ; (i) modrý Great Dane K B /, E/E, B/B, a y /a y, d/d; (j) zředěně světlý Italian Greyhound k y /k y, E M /E, B/B, a y /a y, d/d; (k) mladý Kerry Blue Terrier K B /K B, E M /E, B/B, D/D, G/G; (l) zlatý maďarský ohař - Viszla K B /K B, e/e, b/b. 2

3 Gen tyrosinase related protein 1 Tyrosinase related protein 1 (TYRP1) je gen, zapříčiňující hnědou barvu srsti (Obr. 1 - a, b). TYRP1 byl zmapován na 11. chromozomu (Schmutz et al. 2002). Little (1957) jej označoval jako lokus B (Tabulka 1), kdy se hnědá barva dědí recesivně vůči černé. Byly detekovány tři alely, přičemž kombinace dvou zapříčiní hnědé zbarvení srsti. Jedna alela b s obsahuje stop kodon v exonu 5 (Q331ter) (c. 991 C > T), druhá alel b d obsahuje deleci prolinu také v exonu 5 (345delP) (c deleted) a třetí alela b c je substitucí v exonu 2, která způsobuje výměnu cysteinu za (S41C) (c. 121 T > A). Všechny tři alely byly detekovány u většiny 28 plemen, které byly genotypovány, ale u některých plemen neměli hnědými jedinci žádnou ze tří alel. Te možné, že je další mutace v genu TYRP1, která ještě nebyla odhalena, neboť je vzácná. U některých plemen jako je Doberman Pinschers a Australian Shepherds, jsou hnědí psi označováni jako červení. Tito psi však mají některou výše popsanou mutaci v TYRP1. Alely TYRP1 interagují s alelami MC1R. Pes genotypu e/e na lokusu MC1R má krémovou, žlutou nebo červenou barvu srsti, ale kůže čumáku, okolí oka a tlap jsou buď černá (Obr. 1 e, h vlevo) nebo hnědá (Obr. 1 - l), nebo zředěná, závisejících na genotypu TYRP1. Pravděpodobně genotyp e/e ovlivňuje melanocyty v keratinizované kůži odlišně od melanocytů v chlupových folikulech. Všichni psi, kteří mají barvu srsti černou, hnědou nebo šedou, ať už jednobarevný nebo skvrnitý vzor, ji zdědili dominantně, mají nejméně jednu alelu E nebo E M. Takoví psi mají také nejméně jednu alelu K B (Kerns et al. 2005, 2007; Candille et al. 2007). Gen agouti signal peptide Agouti signal peptide (ASIP) má několik alel, které jsou zahrnuty do zbarvení srsti u psů. ASIP byl zmapován na 24 chromozomu (Kerns et al. 2004). Čtyři alely jsou u psů v dominantní hierarchii a y > a w > a t > a. Divoký typ alely a w zapříčiňuje, že některé chlupy mají proužky střídání pigmentů eumelanin, phaeomelanin, eumelanin po jeho celé délce. Tyto proužkované chlupy se vyskytují typicky na hřbetu trupu. ASIP sekvence této alely má kompletní homologii se sekvencí vlka (Berryere et al. 2005) a také sekvence aminokyselin v proteinu je stejná jako u kojota (Schmutz et al. 2007). Recesivní alela tohoto genu způsobuje černé zbarvení srsti. Alela R96C (a) (c.288c>t) se vyskytuje hlavně, ale ne výhradně u chovaných plemen. Je přičinou černé barvy jen u German Shepherd Dog a Shetland Sheepdog (Kerns et al. 2004; Berryere et al. 2005), ale vyskytuje se také u černých jedinců plemen Schipperke, Groenendael a Puli. Alela byla také identifikována u plemen samojed a americký eskymácký pes, ale u obou se vyskytuje bílé zbarvení. Alela vyskytující se u většiny plemen psů je známá jako a y, děděná jako dominantní alela v jejich sérii. Alela kóduje dvě aminokyselinové změny v porovnání s divokou alelou, A82S a R83H (c. 246 G > T a c. 250 G > A) (Berryere et al. 2005). Zbarvení srsti se u většiny plemen nazývá plavá (fawn) (Obr. 1 - d, e, j), někdy jako sobolí. Tyto mutace nebyly zjištěny u vlka ani u kojota. DNA testy (PCR-RFLP test) jsou vyvinuty pro odhalení obou mutací. Je variabilita v počtu černých chlupů daných alelou a y, což je vysvětlováno genem Mahogunin, který ještě nebyl prokázán. U čtvrté alely a t se předpokládá, že způsobuje zbarvení černá-světle hnědá (Obr. 1 - a, h vpravo). V kódující sekvenci (exon 2 4) nebyl zjištěn rozdíl mezi psy s tímto fenotypem a psy s fenotypem aguti divokého typu. Tato předpokládaná alela se musí lišit v jedné z oblastí promotoru, ale v ASIP promotorech ještě nebyl identifikován u psů. Ačkoliv šlechtitelé popisují 3

4 pátou alelu, a s pro sedlové světlehnědé zbarvení, není pro takovou alelu v současné době žádný důkaz. Gen beta-defensin 103 Lokus K zapříčiňuje černé zbarvení srsti, která se dědí jako dominantní to si určili šlechtitelé, když písmeno K vybrali ze slova black. U většiny plemen psů, aby měli jednobarevnou eumelaninovou barvu srsti (černá, hnědá, šedá) (Obr. 1 a c, i, k), se musí vyskytovat nejméně jedna alela E nebo E M v lokusu MC1R a nejméně jedna dominantní alela v lokusu K. Gen K je beta-defensin 103, který je lokalizován na 16. chromozomu a má vztah k pigmentaci. Lokus K obsahuje také dvě další alely. Jedna kopie alely k br v přítomnosti alely k y je dostačující, aby zapříčinila u psů projev fenotypu známým jako skvrnitost (Brendle) (Kerns et al. 2007). Skvrnitost u psů představuje střídající pruhy phaeomelaninu a eumelaninu různých odstínů (Obr. 1 - f). U některých psů je taková převaha eumelaninu, že se pes jeví jako černý, zatímco u jiných jedinců jsou eumelaninové pruhy velmi úzké. Skvrnitost se projevuje po celém těle u psů s alelou a y (Obr. 1 - f), ale jen na břišní straně u psů s genotypem a t /a t (Berryere et al. 2005). Psi s genotypem k y /k y mají světlejší barvy (Obr. 1 - d, j), vlčí a sobolí zbarvení nebo eumelanin-a-světle hnědé zbarvení (Obr. 1 - a, h vpravo) závisející na genotypu lokusu ASIP. DNA testování je úspěšně předpovídána pigmentaci eumelanin vs. phaeomelanin u některých plemen, jako Labrador Retriever, s použitím jen genotypování lokusu MC1R. Důvodem je, že toto plemeno je vázáno na genotyp K B /K B a genotyp e/e je epistatický k alelám K B a k br (Obr. 1 - e). Ale u ostatních plemen, jako Great Danes (Obr. 1 - i), pigmentace eumelanin vs. phaeomelanin je kontrolován K B / vs. k y /k y, a jeví se, že toto plemeno je vázáno na genotyp a y /a y při přítomnosti E nebo E M. Tabulka 1: Geny a lokusy odhalené a předpovídané, které jsou zahrnuty do pigmentace u psů ZÁKLADNÍ BARVY A (aguti) = agouti signalling protein (ASIP) CFA24 plavá/sobolí (krémová k žluté a červené s tmavšími konečky chlupů) (celobarevné černé chlupy a y promíchány mezi načervenalými chlupy u některých plemen) a w Zbarvení vlka-sobola divoký typ barvy (mnoho pruhovaných chlupů černá-načervenalá-černá) a t Černá-a-světle hnědá nebo hnědá-a-světle hnědá A Recesivní blafl B (hnědá) = tyrosinase related protein 1 (TYRP1) CFA11 B Černý eumelanin b (b s, b d, b c ) Hnědý eumelanin E (extension) = melanocortin receptor 1 (MC1R) CFA5 E M Melanistická překrytí E Eumelanin (černá, hnědá, modrá) může být tvořen E Pouze phaeomelanin (červená, žlutá, krémová) je tvořen K (z dominantní černé - black ) = (CBD103) CFA16 K B Černá, hnědá nebo modrá (pouze pigmentace eumelanin) Strakatost (Brendle) (na určitých oblastech těla, které by mohly jinak být pigmentovány k br phaeomelaninem) k y Exprese alel aguti, že se může exprimovat phaeomelanin Alely jsou seřazeny podle předpokládané hierarchie dominance. Označené tlustě jsou potvrzené na úrovni DNA. Další článek bude pokračovat v popisu genů ředící barvu nebo tvořící různé vzory (strakatost ). 4

5 Literatura: Berryere T.G., Kerns J.A., Barsh G.S. & Schmutz S.M. (2005) Association of an agouti allele with fawn or sable coat colour in domestic dogs. Mammalian Genome 16, Candille S.I., Van Raamsdonk C.D., Chen C., Kuijper S., Chen-Tsai Y., Russ A., Meijlink F. & Barsh G.S. (2004) Dorsoventral patterning of the mouse coat by Tbx15. PLoS Biology 2 Jan, E3. Everts R.E., Rothuizen J. & van Oost B.A. (2000) Identification of a premature stop codon in the melanocytestimulating hormone receptor gene (MC1R) in Labrador and Golden retrievers with yellow coat colour. Animal Genetics 31, Kerns J.A., Cargill E.J., Clark L.A., Candille S.I., Berryere T.G., Olivier M., Lust G., Schmutz S.M., Murphy K.E. & Barsh G.S. (2007) Linkage and segregation analysis of black and brindle coat color in domestic dogs. Genetics, 176: Kerns, J.A., Candille S.I, Berryere T.G., Cargill E.J., Murphy K.E., Schmutz S.M. & Barsh G.S. (2005) The Aaron B. Lerner Lecture: genetics of melanocortin signalling: barking up a new tree. Pigment Cell Research 18(Suppl. 1), 2. Little C.C. (1957) The Inheritance of Coat Colour in Dogs. Comstock, Ithaca, NY. Newton J.M., Wilkie A.L., He L., Jordan S.A., Metallinos D.L., Holme N.G., Jackson I.J. & Barsh G.S. (2000) Melanocortin 1 receptor variation in the domestic dog. Mammalian Genome 11, Schmutz S.M & Barsh G.S. (2004) Characterization of the dog Agouti gene and identification of a nonagouti mutation in German Shepherd Dogs. Mammalian Genome 15, Schmutz S.M. & Berryere T.G. (2007) The genetics of cream coat colour in dogs. Journal of Heredity, 98: Schmutz S.M., Berryere T.G. & Goldfinch A.D. (2002) TYRP1 and MC1R genotypes and their effects on coat colour in dogs. Mammalian Genome 13, Schmutz S.M., Berryere T.G., Ellinwood N.M., Kerns J.A. & Barsh G.S. (2003a) MC1R studies in dogs with melanistic mask or brindle patterns. Journal of Heredity 94, Winge O. (1950) Inheritance in Dogs with Special Reference to the Hunting Breeds. Comstock Publishing, Ithaca, NY. 5


GENETICS OF CAT S COLORS GENETIKA ZBARVENÍ KOČEK. Chaloupková L., Dvořák J. ABSTRACT ABSTRAKT ÚVOD GENETCS OF CAT S COLORS GENETKA ZBARVENÍ KOČEK Chaloupková L., Dvořák J. Ústav morfologie, fyziologie a genetiky zvířat, Agronomická fakulta, MZLU v Brně, Zemědělská 1, 613 00 Brno, ČR E-mail:,


BARVY BORDER COLLIÍ. Na konci tohoto dokumentu naleznete schéma hlavních barev podle lokusů.

BARVY BORDER COLLIÍ. Na konci tohoto dokumentu naleznete schéma hlavních barev podle lokusů. BARVY BORDER COLLIÍ Barva psí srsti je dána geneticky. Pro všechny border collie (snad až na vzácné výjimky) platí, že ve své genetické výbavě nesou alelu Si, která determinuje irské zbarvení (bílé znaky)


Genetická determinace zbarvení vlasů u člověka. Genetická determinace zbarvení očí u člověka

Genetická determinace zbarvení vlasů u člověka. Genetická determinace zbarvení očí u člověka Genetická determinace zbarvení vlasů u člověka Genetická determinace zbarvení očí u člověka znaky polygenní, které však při studiu dědičnosti v rodinách vykazují zdánlivě jednoduchou dědičnost výzkumem


Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje


S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef





QTL u psů. Genetika zbarvení u psů

QTL u psů. Genetika zbarvení u psů QTL u psů Tomarktus pochází z doby před 20 mil. lety a je nejstarším známým prapředkem dnešních psovitých šelem. Nejstarší nálezy prapředků psů se známkami domestikace pocházejí z dnešního území Iráku


Bochov Dědičnost bílých znaků

Bochov Dědičnost bílých znaků 4.11.2011 Bochov Dědičnost bílých znaků Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou určeny ke komerčnímu


AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení


Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu Genetický olymorfizmus ois struktury oulací Tok GI v buňce Dr. Ing. Urban Tomáš ÚSTAV GEETIKY MZLU Brno htt:// Seminář doktorského grantu 53/03/H076 : Molekulárn





Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická


PhD. České Budějovice

PhD. České Budějovice PhD. České Budějovice Sledování a využívání poznatků o genetické biodiverzitě mezi populacemi hospodářských zvířat Dvořák Josef prof. Genetiky živočichů Ústavu genetiky MZLU v Brně Pro seminář doktorského


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


Základní barvy holuba domácího

Základní barvy holuba domácího Základní barvy holuba domácího Ing. Juraj Kafka Národní komise pro standardy holubů ČSCH 5 Popis původního zbarvení Columba livia, (L.) modré černopruhé 4 3 1 2 1. Krk část opeření s rozprostřenými pigmentovými


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem






MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


Genetická podstata fenotypové variability u domestikovaných živočichů

Genetická podstata fenotypové variability u domestikovaných živočichů Univerzita Karlova v Praze Přírodovědecká fakulta Katedra zoologie Genetická podstata fenotypové variability u domestikovaných živočichů Bakalářská práce Veronika Majerová Praha, 2010 Školitel: RNDr. Radka


Variabilita v pigmentaci

Variabilita v pigmentaci Variabilita v pigmentaci Proč zkoumat pigmentaci Spojitost s rakovinou kůže reakcí na UV záření výživou geografickým původem metabolismem vitamínu D. Oči Pigmentace Pokožka Vlasy Měření pigmentace Neinvazivní



OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 Genetika a plemenné znaky u králíků Chov králíků, II. Kategorie Johana Vinšová *13. 8. 1997 Žabonosy 113, Kolín 2, 280 02 ZO ČSCH Kolín 1 Práce započata dne: 25. 11. 2014


9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů

9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů 9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou


Slouží jako pomůcka při vyplňování přihlášky vrhu barzojů.

Slouží jako pomůcka při vyplňování přihlášky vrhu barzojů. Slouží jako pomůcka při vyplňování přihlášky vrhu barzojů. béžová béžová se znaky béžová, maska bílá bílá, černý plášť bílá, černé znaky bílá, černé plotny bílá, červený plášť bílá, červené znaky bílá,


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Genetické mapování. v přírodních populacích i v laboratoři

Genetické mapování. v přírodních populacích i v laboratoři Genetické mapování v přírodních populacích i v laboratoři Funkční genetika Cílem je propojit konkrétní mutace/geny s fenotypem Vzniklý v laboratoři pomocí mutageneze či vyskytující se v přírodě. Forward


Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


QTL u koní. Kmen je skupina koní v rámci plemene, odlišných morfologických a užitkových vlastností (šlechtění na tažné a jezdecké využití).

QTL u koní. Kmen je skupina koní v rámci plemene, odlišných morfologických a užitkových vlastností (šlechtění na tažné a jezdecké využití). QTL u koní Dnešní plemena koní se odvozují od divokých předků, od: Equus przewalskii (kůň Převalského-kertaka) Equus gmelini (kůň západní) Equus gracilis (kůň severský) Pojmy plemenitby Plemeno je skupina


Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


Analýza genů ovlivňující zbarvení srsti psů

Analýza genů ovlivňující zbarvení srsti psů Mendelova univerzita v Brně Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Analýza genů ovlivňující zbarvení srsti psů Diplomová práce Vedoucí diplomové práce: Prof. RNDr. Aleš Knoll,


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2



GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


Úvod do nonhla-dq genetiky celiakie

Úvod do nonhla-dq genetiky celiakie Úvod do nonhla-dq genetiky celiakie František Mrázek HLA laboratoř, Ústav Imunologie LF UP a FN Olomouc Celiakie - časté chronické zánětlivé onemocnění tenkého střeva s autoimunitní a systémovou složkou


Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi


Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků


Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


OPRAVNÝ LIST. Autorka: Marcela Kropáčková

OPRAVNÝ LIST. Autorka: Marcela Kropáčková Autorka: Marcela Kropáčková OPRAVNÝ LIST Strana 5, 1. odstavec Bakalářská práce Strana 8, 1 kapitola, 1. odstavec Genetika je biologická věda, která se neustále rozvíjí u všech organismů. Strana 8, 1 kapitola,





6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený


Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o.

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o. Genetické markery ve šlechtění skotu pro masnou produkci Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Genetické markery Polymorfní místa v DNA, které vykazují asociaci na sledované znaky Příčinné


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI


Evoluční genetika KBI/GENE Mgr. Zbyněk Houdek Evoluční teorie Evoluční teorii vyslovil Ch. Darwin v díle O původu druhů (1859), kde ukazoval, že druhy se postupně měnily v dlouhých časových periodách.


2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou


Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto


Středoškolská technika 2016. Genetic mechanisms causing light pigmentation. in people and rats. Jan Kindl

Středoškolská technika 2016. Genetic mechanisms causing light pigmentation. in people and rats. Jan Kindl Středoškolská technika 2016 Setkání a prezentace prací středoškolských studentů na ČVUT Genetické mechanismy způsobující světlé zbarvení u lidí a potkanů Genetic mechanisms causing light pigmentation in



GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou


Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae).

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). Populační studie Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). American Journal of Botany 87(8): 1128


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém


Kočka domácí. tělo, protáhlou klínovitou hlavu a dlouhé nohy. Extrémní štíhlý typ je znakem současných siamských koček či orientálních koček.

Kočka domácí. tělo, protáhlou klínovitou hlavu a dlouhé nohy. Extrémní štíhlý typ je znakem současných siamských koček či orientálních koček. Jan Kovalík 25.1. 2013 (Felis silvestris f. catus) je domestikovaná forma kočky divoké, která je již po tisíciletí průvodcem člověka. Stejně jako její divoká příbuzná patří do podčeledi malé kočky, a je



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika


Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií

Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Obecná genetika Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Ing. Roman Longauer, CSc. Ústav zakládání a pěstění lesů, LDF MENDELU Brno Tento projekt je spolufinancován Evropským





Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci


Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého


Interakce viru klíšťové encefalitidy s hostitelským organismem a patogeneze infekce

Interakce viru klíšťové encefalitidy s hostitelským organismem a patogeneze infekce Parazitologický ústav, Akademie věd České republiky Laboratoř interakcí vektor-hostitel České Budějovice Interakce viru klíšťové encefalitidy s hostitelským organismem a patogeneze infekce Daniel Růžek,


Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák

Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák KVANTITATIVNÍ GENETIKA dědičnost kvantitativních znaků ZNAKY KVALITATIVNÍ: gen znak barva hrachu: žlutá zelená (i komplikovaněji penetrace, epresivita,


Studie landseera. Studie landseera - zbarvení srsti

Studie landseera. Studie landseera - zbarvení srsti Studie landseera Při studiu landseera jsem se musela aspoň zlehýnka dotknout i genetického minima, jinak bych si nedovolila tvrdit, že jsem něco studovala. Tato studie se týká zbarvení srsti landseera.


Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)


Zápis z jednání Komise pro Chov a zdraví 30.01.2012

Zápis z jednání Komise pro Chov a zdraví 30.01.2012 Zápis z jednání Komise pro Chov a zdraví 30.01.2012 Přítomni: MUDr. V. Novotný, Ing. M. Přibáňová, R. Soukup, MVDr. O. Meloun, M. Fialová 1) Materiál zaslaný k zápisu z předchozího jednání ad 8) z 06.06.2011


GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných


Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). Orphanet - Volně přístupné webové stránky s informacemi


Barva oka a geny, které jej ovlivňují

Barva oka a geny, které jej ovlivňují Barva oka a geny, které jej ovlivňují Vlk, považujme jej za předka psa, má relativně světlé oči. A to i tmavé varianty. Mezi plemeny, člověkem vyšlechtěnými, se vyskytuje celá škála odstínů, od skoro opticky


Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21

Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21 Glosář - Cestina alely aneuploidie asistovaná reprodukce autozomálně dominantní autozomálně recesivní BRCA chromozom chromozomová aberace cytogenetický laborant de novo Různé formy genu, které se nacházejí


velké fragmenty střední fragmenty malé fragmenty

velké fragmenty střední fragmenty malé fragmenty velké fragmenty střední fragmenty malé fragmenty Southern 1975 Northern Western denaturace DNA hybridizace primerů (annealing) (mají délku kolem 20 bází) syntéza nové DNA termostabilní polymerázou vstup



STŘEDOŠKOLSKÁ ODBORNÁ ČINNOST STŘEDOŠKOLSKÁ ODBORNÁ ČINNOST Obor SOČ: 7. Zemědělství, potravinářství, lesní a vodní hospodářství Genetika kvalitativních znaků králíků Johana Vinšová Kraj: Praha Praha 2016 STŘEDOŠKOLSKÁ ODBORNÁ ČINNOST


Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


Opravný list diplomové práce ERRATA

Opravný list diplomové práce ERRATA Opravný list diplomové práce ERRATA OPRAVA ABSTRACT color, a these, shouldn t, by arise, is not discovered, Part of, was found one polymorfismus, sequencied, Two others polymorfisms was found, One of them


Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí,

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí, Využití molekulárních markerů v systematice a populační biologii rostlin 12. Shrnutí, Přehled molekulárních markerů 1. proteiny isozymy 2. DNA markery RFLP (Restriction Fragment Length Polymorphism) založené


Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right


CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder CADASIL analýza mutací v genu NOTCH3 H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder Ústav dědičných metabolických poruch 1. LF UK a VFN Oddělení patologie a nár. ref.


Nishikigoi. Luděk Štěch ml.

Nishikigoi. Luděk Štěch ml. Nishikigoi Luděk Štěch ml. ÚVOD Člověk dokázal vyšlechtit mnoho typů zbarvení u několika druhů ryb jako jsou barevné formy akvarijních ryb např.u živorodek duhových (gupek)


Národní program uchování a využívání genetických zdrojů zvířat

Národní program uchování a využívání genetických zdrojů zvířat METODIKA CHOVU GENETICKÝCH ZDROJŮ KRÁLÍKŮ První zmínky o chovu králíků na území Čech pocházejí ze 13. století, chovatelství jako takové se však začíná rozvíjet na počátku 19. století. V polovině 19. století


Kruh č. 1 - Havelka T. k.č. Plemeno Pohlaví Třída 1 Jezevčík králičí hladkosrstý Fena třída mladých 2 Jezevčík králičí hladkosrstý Fena třída

Kruh č. 1 - Havelka T. k.č. Plemeno Pohlaví Třída 1 Jezevčík králičí hladkosrstý Fena třída mladých 2 Jezevčík králičí hladkosrstý Fena třída Kruh č. 1 - Havelka T. 1 Jezevčík králičí hladkosrstý Fena třída mladých 2 Jezevčík králičí hladkosrstý Fena třída veteránů 3 Jezevčík standard dlouhosrstý Pes třída mladých 4 Jezevčík trpasličí dlouhosrstý


Registrační číslo projektu: CZ.1.07/1.5.00/ Název projektu: Moderní škola 21. století. Zařazení materiálu: Ověření materiálu ve výuce:

Registrační číslo projektu: CZ.1.07/1.5.00/ Název projektu: Moderní škola 21. století. Zařazení materiálu: Ověření materiálu ve výuce: STŘEDNÍ ODBORNÁ ŠKOLA A STŘEDNÍ ODBORNÉ UČILIŠTĚ NERATOVICE Školní 664, 277 11 Neratovice, tel.: 315 682 314, IČO: 683 834 95, IZO: 110 450 639 Ředitelství školy: Spojovací 632, 277 11 Neratovice tel.:


Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální


Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Petr Lesný 1, Pavel Seeman 2, Daniel Groh 1 1 ORL klinika UK 2. LF a FN Motol Subkatedra dětské ORL IPVZ Přednosta doc. MUDr. Zdeněk Kabelka


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA


Genetická "oblast nejasnosti" u HCH: co to znamená? Genetický základ

Genetická oblast nejasnosti u HCH: co to znamená? Genetický základ Novinky ve výzkumu Huntingtonovy nemoci. Ve srozumitelném jazyce. Napsáno vědci. Určeno široké huntingtonské veřejnosti. Genetická "oblast nejasnosti" u HCH: co to znamená? Přechodní alely a alely s redukovanou


Česká zemědělská univerzita v Praze. Fakulta agrobiologie, potravinových a přírodních zdrojů. Katedra obecné zootechniky a etologie

Česká zemědělská univerzita v Praze. Fakulta agrobiologie, potravinových a přírodních zdrojů. Katedra obecné zootechniky a etologie Česká zemědělská univerzita v Praze Fakulta agrobiologie, potravinových a přírodních zdrojů Katedra obecné zootechniky a etologie Dědičnost mutace Red-Eyed Devil u potkana v zájmovém chovu Diplomová práce


VY_32_INOVACE_11.18 1/6 Genetika Genetika

VY_32_INOVACE_11.18 1/6 Genetika Genetika 1/6 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost


GENETIKA. zkoumá dědičnost a proměnlivost organismů

GENETIKA. zkoumá dědičnost a proměnlivost organismů GENETIKA zkoumá dědičnost a proměnlivost organismů Dědičnost: schopnost organismů uchovávat informace o své struktuře a funkčních schopnostech a předávat je svým potomkům Proměnlivost (variabilita) je


FEDERATION CYNOLOGIQUE INTERNATIONALE. Secretariat General: 13, Place Albert I B 6530 THUIN (Belgie) HOVAWART (Hovawart)



Výskyt MHC molekul. RNDr. Ivana Fellnerová, Ph.D. ajor istocompatibility omplex. Funkce MHC glykoproteinů

Výskyt MHC molekul. RNDr. Ivana Fellnerová, Ph.D. ajor istocompatibility omplex. Funkce MHC glykoproteinů RNDr. Ivana Fellnerová, Ph.D. Katedra zoologie, PřF UP Olomouc = ajor istocompatibility omplex Skupina genů na 6. chromozomu (u člověka) Kódují membránové glykoproteiny, tzv. MHC molekuly, MHC molekuly


Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních


12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


27. 4. 2013 Praha Smíchov Něco málo o genetice potkanů

27. 4. 2013 Praha Smíchov Něco málo o genetice potkanů 27. 4. 2013 Praha Smíchov Něco málo o genetice potkanů Některé obrázky použité v prezentaci pochází z různých zdrojů na internetu a nejedná se o má díla. Byly použity k ilustraci a prezentace nejsou určeny
