QTL u psů. Genetika zbarvení u psů

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "QTL u psů. Genetika zbarvení u psů"


1 QTL u psů Tomarktus pochází z doby před 20 mil. lety a je nejstarším známým prapředkem dnešních psovitých šelem. Nejstarší nálezy prapředků psů se známkami domestikace pocházejí z dnešního území Iráku a Íránu z doby před tis. lety. Pravděpodobní předkové dnešních plemen psů (asi 400): Canis familiaris palustris (teriéři, špicové, tažní psi) Canis familiaris intermedius (lovečtí psi) Canis familiaris Inostranzewi (dogy) Canis familiaris Leineri (chrti a dostihoví psi) Canis familiaris matris primae (pastevečtí a ovčáčtí psi) Genetika zbarvení u psů Normální pigmentace u psů je černá a žlutá. Základem zbarvení je melanin, při jehož tvorbě se uplatňuje tyrozin, který enzymatickou reakcí přechází na bezbarvý 3,4-dioxyfenylalanin. Kombinací s produkty jiných genů dochází k různému zbarvení (cc genotyp je albín). Lokus Agouti A standardní zbarvení (vlk, hasky) A S tmavý pigment (černý nebo hnědý) A y omezuje tvorbu tmavé pigmentace (žluté nebo černohnědé) a sa vysoce variabilní zbarvení a t dvojí zbarvení (dobrman, černý jezevčík) A S je dominantní k A y a a t ; A je recesivní k A S a A z Lokus Extension E tmavý pigment E br žíhaná černá a hnědá pigmentace e zamezuje tvorbě tmavého pigmentu ee bígl, dalmatin, anglický setr, zlatý retrívr, irský setr, pudl, pointr aj.

2 Kombinace alel Agouti a Extension (obecně platí recesivita ostatních barev k černé) A S - E- plášťově černá A y - E- žlutá a sa - E- tvorba zbarveného sedla a t a t E- pálené zbarvení A S - ee; A y - ee; a sa - ee; a t a t ee žluté či červené zbarvení (čau čau, kokršpaněl aj.) A S E br - černá A z - E br - žíhaná a sa - E br - tmavé žíhání a t a t E br - černé žíhání Hnědé zbarvení gen B B černý nos, pysky a černá pigmentace sliznice v mordě b játrově hnědá pigmentace Pudli B- černý bb červený Zesvětlení gen D D husté rozvrstvení granulí pigmentu v chlupech d zředěné rozvrstvení granulí pigmentu Kombinace alel Agouti, B, D a Extension (obecně platí recesivita ostatních barev k černé) A S - B- D- E- černá A S - bb D- E- tmavohnědá A S - bb dd E- stříbrošedá a t a t B- D- E- černá s pálením a t a t bb D- E- tmavohnědá s pálením a t a t bb dd E- stříbrošedá s pálením A y - B- D- E br - černá s žíháním A y - bb D- E br - tmavohnědá s žíháním A y - bb dd E br - tmavohnědá s žíháním A y - B- D- E- žluté osrstění, černá kůže, hnědá duhovka A y - bb D- ee žluté osrstění, hnědá kůže, světlehnědá duhovka

3 a t a t B- dd ee duhovka a t a t bb dd ee duhovka krémové osrstění, břidlicová kůže, světlehnědá krémové osrstění, světlehnědá kůže, světlehnědá Albinismus gen C C plné zbarvení c ch činčilové c b modrooký albín c úplný albín (červené oči) Gen kontrolující barvu oka P P normální pigmentace p růžové oko (pink) Grošování M (známé u kolií a jezevčíků) MM téměř bílé zbarvení Mm grošování mm plášťové jednotné zbarvení Kombinace alel Agouti a M A S - Mm černé grošování a t a t Mm modré pálení s grošováním A z - Mm žluté grošování Postupující šedivění G (časté u teriérů) GG nejrychlejší šedivění (je epistatický nad ostatními) Gg šediví za 3-5 let gg nešediví A S - B- D- E- GG šedivějící černá A S - bb D- E- GG šedivějící hnědá A S - B- dd E- GG šedivějící modrá A S - B- D- ee GG šedivějící krémová A S - B- dd ee GG šedivějící světle krémová Strakatost S (buldteriér, kolie, bernardýn, irský setr aj.) S jednotné zbarvení bez strakatosti

4 s i irská strakatost asi na 20% plochy kůže (kolie) s p menší pigmentové skvrny do 80% plochy kůže (foxteriér, pointr) s w extrémně bílé zbarvení s plochou nad 80% plochy kůže (buldteriér) platí:s je dominantní nad s i, ne však nad s p a s w Gen tečkování T T normální zbarvení t bílé zbarvení Interakce s ostatními alelami s p s p T-; s p s w T-; s w s w T- A S - B- D- E- s p - T- A S - bb D- E- s p - T- A z B- D- E- s p - T- a t a t B- D- E- s p - T- A S - B- D- E- s w s w T- bělouši černý bělouš hnědý bělouš žlutý bělouš černý bělouš s pálením dalmatin Příklady ostatních známých lokusů asociujících s barvou a kvalitou srsti a jinými znaky Břidlicově šedé zbarvení pp genotyp, s věkem tmavne barva Cn gen zesvětlení Postupující šedivění Rufismus (kolísání žluté pigmentace) Umbrous (modifikace intenzity zbarvení) Zbarvení nosu Zbarvení oka Dlouhé osrstění Hrubé osrstění Kadeřavé osrstění Vlnkované osrstění Nahost

5 Genetika morfologických znaků u psů Velikost a postavení uší H H a polovzpřímené postavení ucha (teriéři) H klopené ucho Hh poloklopené ucho h vzpřímené postavení ucha platí: H a > H > h Skus s m zkrácení spodní čelisti (dominantní nad všemi ostatními) Délka ocasu St silně zkrácený ocas (dominantní nad všemi ostatními) Dědičnost chrupu (chudozubost) Mnohočetný alelismus u barvy a délky srsti B, L Jezevčíci B-L- hladký černý B-ll dlouhosrstý černý BbL- hladký červený bbll dlouhosrstý červený Plemena a jejich charakteristické genotypy Plemena charakteristické množstvím barevných variant: Anglický chrt Greyhound (základní zbarvení černé, hnědé, žluté v kombinaci s bílou a tečkováním) A s (A y ); B; C (c ch ); D (d); E (e, E br ); g; m; S (s i, s p, s w ); t Jezevčíci (základní zbarvení červené, červenožluté a žluté s příměsí černé; dvoubarevní) A s (A, A y, a t, a sa ); B (b); C (c ch ); D; E (e, E br ); g; L (l); M (m); S; t; Wh (wh)

6 Kokršpaněl (základní zbarvení černé a hnědé, mnoho jiných kombinací) A s (A y, a t,); B (b); C (c ch, c e ); D (d); E (e); g; l; m; S (s i, s p, s w );T (t) Německý ovčák (základní zbarvení černé, kombinace se žlutou a bílými chlupy ve srsti) A s (A y, a t, a sa ); B; C (c ch ); D; E (e); g; L; m; P; S; t Plemena charakteristické uniformností: Český fousek (bělouš s hnědými plotnami nebo bez nich; hnědák s prokvetlými znaky na končetinách a hrudi) A s ; b;c; D; E; g; L; m; P; S (s i, s p, s w ); T; Wh Knírač (základní zbarvení černé nebo barva pepř a sůl ) A s (a t ); B; C; D; E; g; m; S; t Slovenský kopov (základní zbarvení černé s pálením) a t ; B; C (c ch ); D; E; g; L; m; S; t Polygenně dědičné poruchy u psů Dermoid Sinus Na hřbetě rostou chlupy obráceným směrem, časté u Ridgebacků Lysivost Nejčastější u Českého fouska, je způsobena vyšší vnímavosti k bakteriím Staphylococcus aureus Poruchy zraku, sluchu, kloubů a krve Často se jedná o kombinaci recesivních a polygenních faktorů

7 Polymorfní znaky využívané pro ověřování původu Peptidáza D Dvoualelový kodominantní autozomální systém bez polymorfnosti u většiny čistokrevných plemen psů (v rovnovážné populaci p=0,76; q=0,24) Kyselá fosfatáza Dvoualelový kodominantní autozomální erytrocytální systém s různými frekvencemi u plemen psů (např. labrador p=0,13; q=0,87) Hemoglobin Dvoualelový kodominantní autozomální erytrocytální bez výrazné polymorfnosti Albumin Dvoualelový kodominantní autozomální sérový systém s výraznou polymorfností odlišnou prakticky u všech pelem psů Transferin Tříalelový kodominantní autozomální sérový systém s výraznou polymorfností odlišnou prakticky u všech plemen psů Metody plemenitby a selekční postupy praktikované u psů Metody plemenitby Čistokrevná plemenitba pářením dvou jedinců stejného plemene Křížení pářením různých plemen Metody čistokrevné plemenitby Náhodné připařování v panmiktické populaci bez preselekce (každý stejnou šanci křížení s každým)

8 Příbuzenská plemenitba tvorbou inbredních linií, hranice F byla stanovena až na 37,5% (častá degenerace, morfologické poruchy, praktická se již nevyužívá) Příbuzenská plemenitba liniová (genealogická nebo rodinná) je nevhodnější metodou čistokrevné plemenitby. Pro křížení se využívají jedinci vynikajících vlastností. Možnosti: - úzká plemenitba s žádnou volnou generací - blízká plemenitba na 1-2 volné generace - vzdálená plemenitba na 3-4 volné generace Selekční postupy Stabilizační - disruptivní - direkcionální Tandemová - selekce podle nezávislých výběrových úrovní - simultánní selekce podle selekčních indexů

Ohaři. a) angličtí = pointer = setři b) kontinentální. FCI skupina č. VII Ohaři

Ohaři. a) angličtí = pointer = setři b) kontinentální. FCI skupina č. VII Ohaři Ohaři a) angličtí = pointer = setři b) kontinentální FCI skupina č. VII Ohaři Pointer Původ: VB Výška orientační (61-69 cm) Srst: krátká, jemná, hladká jednobarevné, kombinace 2 barev, trikolórní (př.


QTL u koní. Kmen je skupina koní v rámci plemene, odlišných morfologických a užitkových vlastností (šlechtění na tažné a jezdecké využití).

QTL u koní. Kmen je skupina koní v rámci plemene, odlišných morfologických a užitkových vlastností (šlechtění na tažné a jezdecké využití). QTL u koní Dnešní plemena koní se odvozují od divokých předků, od: Equus przewalskii (kůň Převalského-kertaka) Equus gmelini (kůň západní) Equus gracilis (kůň severský) Pojmy plemenitby Plemeno je skupina


PSI Ročník: 7. Vzdělávací oblast.: Člověk a příroda Vzdělávací obor: Přírodopis

PSI Ročník: 7. Vzdělávací oblast.: Člověk a příroda Vzdělávací obor: Přírodopis VY_52_INOVACE_27 PSI Ročník: 7. Vzdělávací oblast.: Člověk a příroda Vzdělávací obor: Přírodopis Základní škola a Mateřská škola Nikolčice, příspěvková organizace Ing. Ladislav Straka VY_52_INOVACE_27


Nabídka pejsků z Jirkovského psího útulku

Nabídka pejsků z Jirkovského psího útulku Nabídka pejsků z Jirkovského psího útulku (k 31.08.2016) V případě, že máte zájem o některého z pejsků, můžete si ho vyzvednout v psím útulku v Jirkově v Novém Březenci, kde jsou psi umístěni, v následujících


Barva oka a geny, které jej ovlivňují

Barva oka a geny, které jej ovlivňují Barva oka a geny, které jej ovlivňují Vlk, považujme jej za předka psa, má relativně světlé oči. A to i tmavé varianty. Mezi plemeny, člověkem vyšlechtěnými, se vyskytuje celá škála odstínů, od skoro opticky


Kruh č. 1 Rozhodčí Václavík Miroslav. Anglický setr Pes pracovní 025. Belgický ovčák - malinois Pes otevřená 041 Fena mladých 042

Kruh č. 1 Rozhodčí Václavík Miroslav. Anglický setr Pes pracovní 025. Belgický ovčák - malinois Pes otevřená 041 Fena mladých 042 Kruh č. 1 Rozhodčí Václavík Miroslav Třída Katalogové číslo Známka Poznámka Anglický setr Pes pracovní 025 Belgický ovčák - malinois Pes otevřená 041 Fena mladých 042 Belgický ovčák -tervueren Pes mezitřída


Národní program uchování a využívání genetických zdrojů zvířat

Národní program uchování a využívání genetických zdrojů zvířat METODIKA CHOVU GENETICKÝCH ZDROJŮ KRÁLÍKŮ První zmínky o chovu králíků na území Čech pocházejí ze 13. století, chovatelství jako takové se však začíná rozvíjet na počátku 19. století. V polovině 19. století


Přehled obsazení kruhů

Přehled obsazení kruhů Přehled obsazení kruhů 13. Brněnská krajská výstava psů - 24. 8. 2014 Den: neděle 24. srpna Celkem psů: 261 Kruh: 1 Rozhodčí: Jaroslav Matyáš Americký bezsrstý terier fena třída mladých 001 1 Americký



file:///run/user/1000/gvfs/ftp:host=ftp.interdogb... Rozhodčí: Kučerová M - německá doga - speciální výstava John E. Ryder, UK, Bill Asker, UK - klubová výstava SBT bez udílení KV Václavík Miroslav - I. a II. sk. FCI Tichá Vladimíra - III. sk. FCI Marušková


47. Krajská výstava Hradec Králové Statistika přihlášených psů ke dni

47. Krajská výstava Hradec Králové Statistika přihlášených psů ke dni FCI skupina plemeno třída počet 1 Australský honácký pes 3 1 Australský ovčák 8 Psi - třída štěňat 1 1 Bearded kolie 1 1 Belgický ovčák - Malinois 1 1 Bílý švýcarský ovčák 3 1 Border kolie 16 Psi - třída


S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef


PŘEHLED KRUHŮ. neděle - 12.7.2015

PŘEHLED KRUHŮ. neděle - 12.7.2015 PŘEHLED KRUHŮ neděle - 12.7.2015 KRUH ČÍSLO 1 84 Olga Dolejšová (CZ) Akita-Inu 1 Mezitřída 166 1 Aljašský malamut 4 Třída mladých 167 1 Třída vítězů 168 1 Třída veteránů 169 1 Třída otevřená 170 1 Basenji


Slouží jako pomůcka při vyplňování přihlášky vrhu barzojů.

Slouží jako pomůcka při vyplňování přihlášky vrhu barzojů. Slouží jako pomůcka při vyplňování přihlášky vrhu barzojů. béžová béžová se znaky béžová, maska bílá bílá, černý plášť bílá, černé znaky bílá, černé plotny bílá, červený plášť bílá, červené znaky bílá,



PŘEHLED KRUHŮ. sobota PŘEHLED KRUHŮ sobota - 23.8.2014 KRUH ČÍSLO 1 68 Josef Němec Airedale terier 2 Třída mladých 86 1 Třída dorostu 87 1 Irish Soft Coated Wheaten Terrier 1 Třída mladých 97 1 Jack Russell Teriér 5 Třída mladých


BARVY BORDER COLLIÍ. Na konci tohoto dokumentu naleznete schéma hlavních barev podle lokusů.

BARVY BORDER COLLIÍ. Na konci tohoto dokumentu naleznete schéma hlavních barev podle lokusů. BARVY BORDER COLLIÍ Barva psí srsti je dána geneticky. Pro všechny border collie (snad až na vzácné výjimky) platí, že ve své genetické výbavě nesou alelu Si, která determinuje irské zbarvení (bílé znaky)



PŘEHLED KRUHŮ. neděle PŘEHLED KRUHŮ neděle - 26.6.2016 KRUH ČÍSLO 1 75 Olga Dolejšová (CZ) Australský honácký 3 Třída mladých 2 1 Třída mladých 3 1 Třída vítězů 4 1 Australský ovčák 13 Třída dorostu 5-6 2 Třída mladých 7-8


Kruh č. 1 Rozhodčí Miroslav Václavík. americká akita Fena mladých 001. Americký bezsrstý terier Pes štěňat 002

Kruh č. 1 Rozhodčí Miroslav Václavík. americká akita Fena mladých 001. Americký bezsrstý terier Pes štěňat 002 Kruh č. 1 Rozhodčí Miroslav Václavík Třída Katalogové číslo Známka Poznámka americká akita Fena mladých 001 Americký bezsrstý terier Pes štěňat 002 anglický kokršpaněl vícebarevný Pes otevřená 005 Fena


Kruh č. 1 Rozhodčí Javorčík Vladimír (SK)

Kruh č. 1 Rozhodčí Javorčík Vladimír (SK) Kruh č. 1 Rozhodčí Javorčík Vladimír (SK) Třída Katalogové číslo Známka Poznámka Australský ovčák Pes mladých 065 Pes mladých 066 Pes mezitřída 067 Fena otevřená 068 Fena otevřená 069 Fena vítězů 070 Border


FEDERATION CYNOLOGIQUE INTERNATIONALE. Secretariat General: 13, Place Albert I B 6530 THUIN (Belgie) HOVAWART (Hovawart)



Kruh č. 1, Rozhodčí Tichá Vladimíra

Kruh č. 1, Rozhodčí Tichá Vladimíra Kruh č. 1, Rozhodčí Tichá Vladimíra Australský silky teriér Pes mladých 016 Pes vítězů 017 Fena mladých 018 Fena veteránů 019 Bedlingtonský teriér Pes otevřená 028 Pes vítězů 029 Pes veteránů 030 Fena


Přehled obsazení kruhů

Přehled obsazení kruhů Přehled obsazení kruhů plemeno třída Katalogová čísla počet kruh rozhodčí od do 1 Ubrová Libuše Shiba-Inu 172 196 25 psi třída štěňat 172 172 1 psi třída mladých 173 178 6 psi mezitřída 179 179 1 psi třída


Fena mezitřída 139 V1, Vítěz třídy, Krajský víěz. Fena otevřená 140 V1, Vítěz třídy, Krajský víěz. Pes mezitřída 142 V1, Vítěz třídy, Krajský víěz

Fena mezitřída 139 V1, Vítěz třídy, Krajský víěz. Fena otevřená 140 V1, Vítěz třídy, Krajský víěz. Pes mezitřída 142 V1, Vítěz třídy, Krajský víěz Kruh č. 1 Rozhodčí Gregorz Robak Třída Katalogové číslo Známka Poznámka Bostonský teriér Fena mladých 089 VD3 Fena mladých 090 V2 Fena mladých 091 V1, Vítěz třídy Brabantík Fena mladých 092 V1, Vítěz třídy


Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické


Myslivecká kynologie

Myslivecká kynologie Myslivecká kynologie Rozdělení do skupin a plemen dle FCI od r. 1990 Všechna plemena psů jsou rozdělena do 4 kategorií: 1. psi ovčáčtí, služební, hlídací 2. psi lovečtí 3. psi společenští 4. chrti Dále


CO JE VLASTNĚ PES? Plemena psů podle Kennel Clubu. Honiči. Plemena lovecká. Teriéři. Plemena užitková Plemena pracovní Plemena společenská.

CO JE VLASTNĚ PES? Plemena psů podle Kennel Clubu. Honiči. Plemena lovecká. Teriéři. Plemena užitková Plemena pracovní Plemena společenská. CO JE VLASTNĚ PES? Plemena psů podle FCI Primitivní plemena Ovčácká, honácká a pastevecká plemena Pinčové a knírači Mastifové Horští pastevečtí psi (molossi) Teriéři Jezevčíci, špicové Honiči Ohaři, přinášeči,



OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 Genetika a plemenné znaky u králíků Chov králíků, II. Kategorie Johana Vinšová *13. 8. 1997 Žabonosy 113, Kolín 2, 280 02 ZO ČSCH Kolín 1 Práce započata dne: 25. 11. 2014


BARZOJ RUSKÝ CHRT (Russkaya Psovaya Borzaya)

BARZOJ RUSKÝ CHRT (Russkaya Psovaya Borzaya) F E D E R A T I O N C Y N O L O G I Q U E I N T E R N A T I O N A L E Secretariat General: 13, Place Albert I B 6530 THUIN (Belgie) F.C.I.-Standard č. 193 / 22.11.2006 / D, GB BARZOJ RUSKÝ CHRT (Russkaya





Český teriér Pes Pracovní třída 120 V1, CAC, CC, VSV, BOB Fena Otevřená třída 121 V1, CAC, CC, VSV, BOS Fena Otevřená třída 122 -

Český teriér Pes Pracovní třída 120 V1, CAC, CC, VSV, BOB Fena Otevřená třída 121 V1, CAC, CC, VSV, BOS Fena Otevřená třída 122 - Kruh č. 1 Rozhodčí Štursová Gabriela Třída Katalogové číslo Známka Cairn teriér Pes Třída dorostu 097 VN1 Pes Třída mladých 098 V2 Pes Třída mladých 099 V1, CAJC, BOJ Pes Třída mladých 100 VD3 Pes Mezitřída


Přehled obsazení kruhů

Přehled obsazení kruhů Přehled obsazení kruhů 10. Brněnská krajská výstava psů - 21. 8. 2011 Den: neděle 21. srpna Celkem psů: 313 Kruh: 1 Rozhodčí: PhDr. Vladimír Mojžíš Aljašský malamut pes třída mladých 001 1 Aljašský malamut


Návrh nové bonitační karty

Návrh nové bonitační karty Návrh nové bonitační karty Bonitační karta je zkrácená a vychází ze standardu švýcarského honiče. Bude graficky upravená na jednu stránku. Bonitační kód bude uvádět u jedince se samými nulami (bez chyb)


Standard Nº. 15.01.2011 / SCHVÁLENÍ SKG CL. KONTINENTÁLNÍ BULDOK (Continental bulldog)

Standard Nº. 15.01.2011 / SCHVÁLENÍ SKG CL. KONTINENTÁLNÍ BULDOK (Continental bulldog) FEDERATION CYNOLOGIQUE INTERNATIONALE (AISBL) SECRETARIAT GENERAL: 13, Place Albert 1 er B 6530 Thuin (Belgique) Standard Nº. 15.01.2011 / SCHVÁLENÍ SKG CL Překlad: Kateřina Samková KONTINENTÁLNÍ BULDOK


Přehled obsazení kruhů

Přehled obsazení kruhů Přehled obsazení kruhů Den: neděle 15. srpna Celkem psů: 312 Kruh: 1 Rozhodčí: PhDr. Vladimír Mojžíš Afgánský chrt fena třída mladých 1 1 Australská kelpie fena třída otevřená 2 1 Australský honácký pes


Kruh č. 1 - Havelka T. k.č. Plemeno Pohlaví Třída 1 Jezevčík králičí hladkosrstý Fena třída mladých 2 Jezevčík králičí hladkosrstý Fena třída

Kruh č. 1 - Havelka T. k.č. Plemeno Pohlaví Třída 1 Jezevčík králičí hladkosrstý Fena třída mladých 2 Jezevčík králičí hladkosrstý Fena třída Kruh č. 1 - Havelka T. 1 Jezevčík králičí hladkosrstý Fena třída mladých 2 Jezevčík králičí hladkosrstý Fena třída veteránů 3 Jezevčík standard dlouhosrstý Pes třída mladých 4 Jezevčík trpasličí dlouhosrstý





Přehled obsazení kruhů

Přehled obsazení kruhů Přehled obsazení kruhů 14. Brněnská krajská výstava psů - 23. 8. 2015 Den: neděle 23. srpna Celkem psů: 248 Kruh: 1 Rozhodčí: RNDr. Jaroslava Ovesná CSc. Americká akita fena mezitřída 001 1 Americký stafordširský


Genetická determinace zbarvení vlasů u člověka. Genetická determinace zbarvení očí u člověka

Genetická determinace zbarvení vlasů u člověka. Genetická determinace zbarvení očí u člověka Genetická determinace zbarvení vlasů u člověka Genetická determinace zbarvení očí u člověka znaky polygenní, které však při studiu dědičnosti v rodinách vykazují zdánlivě jednoduchou dědičnost výzkumem



STANDARD PLEMEN A BAREVNÝCH RÁZŮ MORČAT. verze k 1. 1. 2011 STANDARD PLEMEN A BAREVNÝCH RÁZŮ MORČAT verze k 1. 1. 2011 ČESKÝ SVAZ CHOVATELŮ Ústřední odborná komise chovatelů morčat a jiných drobných hlodavců Česká republika Standard plemen a barevných rázů morčat


Kočka domácí. tělo, protáhlou klínovitou hlavu a dlouhé nohy. Extrémní štíhlý typ je znakem současných siamských koček či orientálních koček.

Kočka domácí. tělo, protáhlou klínovitou hlavu a dlouhé nohy. Extrémní štíhlý typ je znakem současných siamských koček či orientálních koček. Jan Kovalík 25.1. 2013 (Felis silvestris f. catus) je domestikovaná forma kočky divoké, která je již po tisíciletí průvodcem člověka. Stejně jako její divoká příbuzná patří do podčeledi malé kočky, a je





15 Bílý švýcarský ovčák Pes třída pracovní 16 Bílý švýcarský ovčák Fena třída dorostu 18 Bílý švýcarský ovčák Fena třída mladých

15 Bílý švýcarský ovčák Pes třída pracovní 16 Bílý švýcarský ovčák Fena třída dorostu 18 Bílý švýcarský ovčák Fena třída mladých Kruh č. 1 - Olga Dolejšová 1 Chodský pes Pes třída mladých 2 Chodský pes Pes mezitřída 369 Chodský pes Pes mezitřída 3 Chodský pes Pes třída otevřená 4 Chodský pes Pes třída vítězů 5 Chodský pes Fena třída


Přehled obsazení kruhů

Přehled obsazení kruhů Přehled obsazení kruhů Celkový počet : 246 neděle 19. srpna 2012 246 Kruh: 1 Rozhodč Havelka Tibor [SK] 94 Americký stafordširský terier 4 štěňat 1-1 1 mladých 2-3 2 mezitřída 4-4 1 Australský ovčák 2


Standard plemene tak, jak ho uvádí ČMKU. Rhodéský ridgeback (Rhodesian Ridgeback) PŘEKLAD: Jochen H.Eberhardt

Standard plemene tak, jak ho uvádí ČMKU. Rhodéský ridgeback (Rhodesian Ridgeback) PŘEKLAD: Jochen H.Eberhardt Standard plemene tak, jak ho uvádí ČMKU Rhodéský ridgeback (Rhodesian Ridgeback) PŘEKLAD: Jochen H.Eberhardt ZEMĚ PŮVODU: Jižní Afrika. Standard zpracovaly kynologické organizace Kennel Union of South


Studie landseera. Studie landseera - zbarvení srsti

Studie landseera. Studie landseera - zbarvení srsti Studie landseera Při studiu landseera jsem se musela aspoň zlehýnka dotknout i genetického minima, jinak bych si nedovolila tvrdit, že jsem něco studovala. Tato studie se týká zbarvení srsti landseera.


Secretariat General: 13, Place Albert I B 6530 THUIN (Belgie) DATUM PUBLIKACE ORIGINÁLNÍHO PLATNÉHO STANDARDU: 06.05.1988

Secretariat General: 13, Place Albert I B 6530 THUIN (Belgie) DATUM PUBLIKACE ORIGINÁLNÍHO PLATNÉHO STANDARDU: 06.05.1988 F E D E R AT I O N C Y N O L O G I Q U E I N T E R N AT I O N A L E Secretariat General: 13, Place Albert I B 6530 THUIN (Belgie) F.C.I.-Standard č. 113 / 01.12.1989 / D BRIARD (Berger de Brie) ZEMĚ PŮVODU:


RUSKÝ ČERNÝ TERIÉR (Russkiy Tchiorny Terrier)

RUSKÝ ČERNÝ TERIÉR (Russkiy Tchiorny Terrier) 10.01.2011/EN FEDERATION CYNOLOGIQUE INTERNATIONALE (AISBL) SECRETARIAT GENERAL: 13, Place Albert 1 er B 6530 Thuin (Belgique) FCI-Standard N 327 RUSKÝ ČERNÝ TERIÉR (Russkiy Tchiorny Terrier) PŘEKLAD FCI:


9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů

9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů 9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou


Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje


Bonitace psů a fen alpského brakýře jezevčíkovitého

Bonitace psů a fen alpského brakýře jezevčíkovitého Bonitace psů a fen alpského brakýře jezevčíkovitého I. Všeobecné Podkladem těchto hodnocení exteriéru jsou rasové znaky, uvedené ve standardu pro alpskou braku jezevčíkovitou. Hodnocení smí být prováděno


FEDERATION CYNOLOGIQUE INTERNATIONALE. Secretariat General: 13, Place Albert I B 6530 THUIN (Belgie) HOVAWART (Hovawart)



FEDERATION CYNOLOGIQUE INTERNATIONALE. SECRETARIAT GENERAL: 14, rue Léopold II, 6530 THUIN (Belgique) F.C.I. - Standard Nr. 166 / 30.08.

FEDERATION CYNOLOGIQUE INTERNATIONALE. SECRETARIAT GENERAL: 14, rue Léopold II, 6530 THUIN (Belgique) F.C.I. - Standard Nr. 166 / 30.08. FEDERATION CYNOLOGIQUE INTERNATIONALE SECRETARIAT GENERAL: 14, rue Léopold II, 6530 THUIN (Belgique) F.C.I. - Standard Nr. 166 / 30.08.91 / D Aktualizováno: 9. 2. 2011 CELKOVÝ ZJEV: Německý ovčák je pes



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


(English setter) Sekce 2.2 britští a irští stavěcí psi S pracovní zkouškou. Je to středně velký pes, čistých linií, elegantního vzhledu i pohybu.

(English setter) Sekce 2.2 britští a irští stavěcí psi S pracovní zkouškou. Je to středně velký pes, čistých linií, elegantního vzhledu i pohybu. Standard FCI č. 2/07.09.98 / F ANGLICKÝ SETR (English setter) Překlad do francouzštiny : prof. R. Triquet Překlad do češtiny : Helena Dvořáková Původ : Velká Británie Datum zveřejnění platného standardu


SETTER ANGLAIS (English Setter)

SETTER ANGLAIS (English Setter) FEDERATION CYNOLOGIQUE INTERNATIONALE (AISBL) SECRETARIAT GENERAL: 13, Place Albert 1 er B 6530 Thuin (Belgique) Standard FCI N 2 / 23.11.2009 / F SETTER ANGLAIS (English Setter) 2 Překlad do francouzštiny


Rozhodčí Alena Auerbach Katalogové číslo Bedlingtonský teriér Pes Otevřená třída Pes Třída vítězů 039 Fena Otevřená třída

Rozhodčí Alena Auerbach Katalogové číslo Bedlingtonský teriér Pes Otevřená třída Pes Třída vítězů 039 Fena Otevřená třída Kruh č. 1 Rozhodčí Alena Auerbach Bedlingtonský teriér Pes Otevřená třída 037-038 Pes vítězů 039 Fena Otevřená třída 040-041 Irish Soft Coated Wheaten Teriér Pes vítězů 124 Pes veteránů 125 Fena štěňat


Počet psů: Rozhodčí: Kruh:

Počet psů: Rozhodčí: Kruh: Airedale terier 2 Matyáš Jaroslav,Ing. 3 Akita-Inu 2 Matyáš Jaroslav,Ing. 3 Americký kokršpaněl-čer.a čer.s pálením 2 Matyáš Jaroslav,Ing. 3 Americký kokršpaněl-ostatní 2 Matyáš Jaroslav,Ing. 3 Americký


Plemena prasat rozdělujeme podle

Plemena prasat rozdělujeme podle Plemena prasat Plemena prasat rozdělujeme podle 1. stupně prošlechtění primitivní vznikla působením přírodních podmínek s malým podílem umělého výběru, staročeský hřebenáč zušlechtěná vznikla z primitivních


12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat


FCI - Standard č. 309 / / D SHAR-PEI (ŠARPEJ)

FCI - Standard č. 309 / / D SHAR-PEI (ŠARPEJ) FCI - Standard č. 309 / 09. 08. 1999 / D SHAR-PEI (ŠARPEJ) PŘEKLAD DO NĚMČINY: Dr. J.-M. Paschoud, paní R. Binder. a paní E.Peper ZEMĚ PŮVODU: Čína PATRONÁT: F.C.I. 2 DATUM PUBLIKACE PLATNÉHO ORIGINÁLNÍHO


Standard FCI č. 129 / / F. SMÅLANDSKÝ HONIČ (Smålandsstövare)

Standard FCI č. 129 / / F. SMÅLANDSKÝ HONIČ (Smålandsstövare) Standard FCI č. 129 /07.08.1998 / F SMÅLANDSKÝ HONIČ (Smålandsstövare) PŘEKLAD DO FRANCOUZŠTINY : Dr. J.-M. Paschoud a kol. PŘEKLAD Z FRANCOUZŠTINY : Helena Dvořáková PŮVOD : Švédsko. 2 DATUM ZVEŘEJNĚNÍ


Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že



GENETICS OF CAT S COLORS GENETIKA ZBARVENÍ KOČEK. Chaloupková L., Dvořák J. ABSTRACT ABSTRAKT ÚVOD GENETCS OF CAT S COLORS GENETKA ZBARVENÍ KOČEK Chaloupková L., Dvořák J. Ústav morfologie, fyziologie a genetiky zvířat, Agronomická fakulta, MZLU v Brně, Zemědělská 1, 613 00 Brno, ČR E-mail: xchalou0@node.mendelu.cz,


Šlechtění mateřských plemen orientováno na

Šlechtění mateřských plemen orientováno na Plemena prasat Šlechtění mateřských plemen orientováno na vynikající reprodukční vlastnosti 15,5 živě narozených selat/vrh výbornou růstovou schopnost při nízké spotřebě KKS 1 300 g/kanečci UTVU příznivé


Datum popl. Plemeno psa Pohlaví Věk při

Datum popl. Plemeno psa Pohlaví Věk při Plemeno psa Pohlaví Věk při Datum popl. přihlášení povinnosti afgánský chrt Fena 31.12.2002 afgánský chrt Fena 31.12.2002 afgánský chrt Fena 31.12.2002 afgánský chrt Fena 5 m 1.9.2010 afgánský chrt Pes





Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Popisování koní Identifikace Evidence

Popisování koní Identifikace Evidence Popisování koní Identifikace Evidence EVIDENCE Ministerstvo zemědělství ČR Českomoravská společnost chovatelů a.s. (ČMSCH a.s.) (osoba pověřená MZe ČR vedením ústřední evidence všech druhů hospodářských


Přehled obsazení kruhů

Přehled obsazení kruhů Přehled obsazení kruhů 15. Brněnská krajská výstava psů - 28. 8. 2016 Den: neděle 28. srpna Celkem psů: 362 Kruh: 1 Rozhodčí: Ing. Radovan Lysák Aljašský malamut pes třída štěňat 001 1 pes třída otevřená


PRAŽSKÝ KRYSAŘÍK (Ratier de Prague) Standard země původu (ČMKU)

PRAŽSKÝ KRYSAŘÍK (Ratier de Prague) Standard země původu (ČMKU) PRAŽSKÝ KRYSAŘÍK (Ratier de Prague) Standard země původu (ČMKU) ZEMĚ PŮVODU: Česká republika. DATUM PUBLIKACE PLATNÉHO PŮVODNÍHO STANDARDU: 12. října. 1980 POUŽITÍ: Společenské plemeno KLASIFIKACE F.C.I.:



Schválený ZÁPIS ZE SETKÁNÍ MAJITELŮ KELPIÍ Schválený ZÁPIS ZE SETKÁNÍ MAJITELŮ KELPIÍ PÁVOV 10. 1. 2009 Na srazu kelpinek jsem nebyla, tak zde alespoň uveřejňuji zápis ze setkání tak, jak mi ho poslala Jana Š. Přítomní: cca 20 majitelů kelpií (prezenční



PŘEHLED KRUHŮ. sobota PŘEHLED KRUHŮ sobota - 12.9.2015 KRUH ČÍSLO 1 35 Robert Kubeš Bedlington terier 1 Mezitřída 90 1 Border terier 2 Třída mladých 91 1 Třída otevřená 92 1 Jack Russell Teriér 1 Třída štěňat 94 1 Parson Russell


Geny ovlivňující zbarvení u domestikovaných psů 1 základní barvy

Geny ovlivňující zbarvení u domestikovaných psů 1 základní barvy Geny ovlivňující zbarvení u domestikovaných psů 1 základní barvy doc. Ing. Tomáš Urban, Ph.D. Ústav morfologie, fyziologie a gentiky zvířat AF MZLU v Brně, urban@mendelu.cz Psi byli selektováni do více


FCI standard č.: 45 / / D. BERNER SENNENHUND (BERNSKÝ SALAŠNICKÝ PES) (Dürrbächler)

FCI standard č.: 45 / / D. BERNER SENNENHUND (BERNSKÝ SALAŠNICKÝ PES) (Dürrbächler) FCI standard č.: 45 / 5.5.2003 / D BERNER SENNENHUND (BERNSKÝ SALAŠNICKÝ PES) (Dürrbächler) 2 ZEMĚ PŮVODU: Švýcarsko DATUM PUBLIKACE PLATNÉHO ORIGINÁLNÍHO STANDARDU: 25. 03. 2003. POUŽITÍ: Původně hlídací,


Základní barvy holuba domácího

Základní barvy holuba domácího Základní barvy holuba domácího Ing. Juraj Kafka Národní komise pro standardy holubů ČSCH 5 Popis původního zbarvení Columba livia, (L.) modré černopruhé 4 3 1 2 1. Krk část opeření s rozprostřenými pigmentovými


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém


Jezevčík (Dachshund)

Jezevčík (Dachshund) F é d é r a t i o n Cyn o l o g i q u e I n t e r n a t i o n a le Secrétariat Général: 13, Place Albert I - B 6530 THUIN (Belg.) Standard FCI č. 148 / 09.05.2001 / D Jezevčík (Dachshund) ZEMĚ PŮVODU:






PŘEHLED KRUHŮ. neděle PŘEHLED KRUHŮ neděle - 4.9.2016 KRUH ČÍSLO 1 66 Zdeněk Kliment (CZ) Anglický buldok 1 Třída mladých 33 1 Papillon nad 2.5 kg 6 Třída mladých 65 1 Třída otevřená 66 1 Třída vítězů 67 1 Třída veteránů 68



Tématický celek: ORGANISMY ČLOVĚKEM CHOVANÉ. Téma: CHOVANÍ ŽIVOČICHOVÉ PLEMENA PSŮ A KOČEK Základní škola Jindřicha Matiegky Mělník, příspěvková organizace Pražská 2817, 276 01 Mělník www.zsjm-me.cz tel.: 315 623 015 EKOLOGICKÝ PŘÍRODOPIS Tématický celek: ORGANISMY ČLOVĚKEM CHOVANÉ Téma: CHOVANÍ


Standard FCI č. 51 / 14.11.2000 / F FINSKÝ HONIČ. (Suomenajokoira)

Standard FCI č. 51 / 14.11.2000 / F FINSKÝ HONIČ. (Suomenajokoira) Standard FCI č. 51 / 14.11.2000 / F FINSKÝ HONIČ (Suomenajokoira) 2 PŘEKLAD DO FRANCOUZŠTINY : Dr.J.-M. Paschoud a Prof. R. Triquet. PŘEKLAD DO ČEŠTINY : Helena Dvořáková PŮVOD : Finsko. DATUM ZVEŘEJNĚNÍ


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem





Přílohy. Příloha 1: Testovaní jedinci a ukázky z testu osobnosti psa s ohledem na poslušnost (Obr. P1 - P10)

Přílohy. Příloha 1: Testovaní jedinci a ukázky z testu osobnosti psa s ohledem na poslušnost (Obr. P1 - P10) Přílohy Příloha 1: Testovaní jedinci a ukázky z testu osobnosti psa s ohledem na poslušnost (Obr. P1 - P10) Příloha 2: Podrobné výsledky společné všem dětem ohledně znalostí a prekoncepcí (Graf P1 - P26)


Myslivecká kynologie - Plemena loveckých psů. Ing. Tomáš Kušta, Ph.D.

Myslivecká kynologie - Plemena loveckých psů. Ing. Tomáš Kušta, Ph.D. Myslivecká kynologie - Plemena loveckých psů Ing. Tomáš Kušta, Ph.D. CHOV LOVECKÝCH PSŮ V SOUČASNOSTI Rozdělení do skupin a plemen dle FCI od r. 1990 Všechna plemena psů jsou rozdělena do 4 kategorií:


PYRENEJSKÝ OVČÁK S DLOUHOU SRSTÍ V OBLIČEJI (Chien de berger des Pyrénées à poil long)

PYRENEJSKÝ OVČÁK S DLOUHOU SRSTÍ V OBLIČEJI (Chien de berger des Pyrénées à poil long) FEDERATION CYNOLOGIQUE INTERNATIONALE (AISBL) SECRETARIAT GENERAL: 13, Place Albert 1 er B 6530 Thuin (Belgique) FCI-Standard N 141 / 25.05.2009 / GB 10.11.2013/CZ Překlad: Kateřina Samková PYRENEJSKÝ



Lea Andrejsová KOZE FAPPZ EXTERIÉR ZVÍŘAT Lea Andrejsová KOZE FAPPZ EXTERIÉR ZVÍŘAT Roviny na těle Exteriér = zevnějšek soubor vnějších morfologických znaků vnější projev stavby a činnosti tkání, orgánů a partií těla zvířete zbarvení a pokryv





Najdete zde i základní výstavní hodnocení a výsledek RTG (rentgenu) kloubů.

Najdete zde i základní výstavní hodnocení a výsledek RTG (rentgenu) kloubů. 1 JAK ČÍST BONITAČNÍ KÓD Bonitačním kódem rozumíme zapsání předností, ale hlavně vad posuzovaného jedince pomocí předepsané tabulky. Pro úplného laika je to potom směs čísel a písmen na jednom řádku. V


Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním



TURECKÝ PASTEVECKÝ PES KANGAL - Plemenný standard (KIF) TURECKÝ PASTEVECKÝ PES KANGAL - Plemenný standard (KIF) Původ: Turecká republika Patronát: Turecko Datum zveřejnění platného originálního standardu: Využití: Hlídací a pastevecký pes KLASIFIKACE FCI: Skupina


VY_32_INOVACE_380_ PRACOVNÍ LISTY_. Pracovní listy Chov zvířat, 3. ročník, Zemědělec-farmář. sada č. 19 Chov zvířat. Samostatné vyhledávání informací

VY_32_INOVACE_380_ PRACOVNÍ LISTY_. Pracovní listy Chov zvířat, 3. ročník, Zemědělec-farmář. sada č. 19 Chov zvířat. Samostatné vyhledávání informací Název školy: Číslo a název projektu: Číslo a název šablony klíčové aktivity: Označení materiálu: Typ materiálu: Předmět, ročník, obor: Číslo a název sady: Téma: STŘEDNÍ ODBORNÁ ŠKOLA a STŘEDNÍ ODBORNÉ


Projekt: ŠKOLA RADOSTI, ŠKOLA KVALITY Registrační číslo projektu: CZ.1.07/1.4.00/ EU PENÍZE ŠKOLÁM

Projekt: ŠKOLA RADOSTI, ŠKOLA KVALITY Registrační číslo projektu: CZ.1.07/1.4.00/ EU PENÍZE ŠKOLÁM ZÁKLADNÍ ŠKOLA OLOMOUC příspěvková organizace MOZARTOVA 48, 779 00 OLOMOUC tel.: 585 427 142, 775 116 442; fax: 585 422 713 email: kundrum@centrum.cz; www.zs-mozartova.cz Projekt: ŠKOLA RADOSTI, ŠKOLA


[ Kapitola 6 ] Externí údržba

[ Kapitola 6 ] Externí údržba 117 [ Kapitola 6 ] Externí údržba 118 Externí údržba Náročnost na externí údržbu psů se velmi různí druh od druhu. Zatímco srsti krátkosrstých druhů jsou na údržbu relativně jednoduché, psi s delší srstí



F E D E R A T I O N C Y N O L O G I Q U E I N T E R N A T I O N A L E 1 F E D E R A T I O N C Y N O L O G I Q U E I N T E R N A T I O N A L E Secretariat General: 13, Place Albert I B 6530 THUIN (Belgie) FCI - Standard č. 61 / 21.1.2004 / D ST. BERNHARDSHUND (BERNHARDINER)



ŠLECHTITELSKÝ PROGRAM ŠLECHTITELSKÝ PROGRAM KLUB VELKÝCH VOLÁČŮ 1. Cíle pro stabilizaci 2. Plemenné znaky popis a návrhy na zlepšení 3. Stanovení vzácných a málo chovaných rázů 4. Evidence chovů a chovných jedinců 5. Propagace


Welsh Corgi Pembroke 364 371 8

Welsh Corgi Pembroke 364 371 8 MVP - IHA INTERCANIS BRNO 27.-28.6.2015 den kruh rozhodčí plemeno třída kat čísla od kat čísla do počet 27.06.2015 V1 Kochan Anna Kolie dlouhosrstá 248 282 35 psi třída dorostu / male puppy class 248 249


Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci





Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly



COLLIE (ROUGH) KOLIE DLOUHOSRSTÁ FEDERATION CYNOLOGIQUE INTERNATIONALE (AISBL) SECRETARIAT GENERAL: 13, Place Albert 1 er B 6530 Thuin (Belgique) 22.11.2012 /EN (poslední úpravy jsou vytučněny) FCI-Standard N 156 COLLIE (ROUGH) KOLIE
