BIO: Genetika. Mgr. Zbyněk Houdek

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "BIO: Genetika. Mgr. Zbyněk Houdek"


1 BIO: Genetika Mgr. Zbyněk Houdek

2 Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky. Nukleotidy se skládají z pětiuhlíkatého cukru (pentózy), zbytku kyseliny fosforečné a dusíkatých bází. Vzniká polynukleotidové vlákno. Pořadí nukleotidů = genetický kód.

3 DNA-deoxyribonukleová kys. Skládá ze 4 typů deoxyribonukleotidů (adenin A, guanin G, thymin T, cytosin C). DNA je tvořena 2 vlákny, která jsou spojena ve dvoušroubovici, tak že proti A je navázáno (vodíkové můstky) T a proti G C. V páteři DNA jsou deoxyribózy, na kterou jsou navázány 2 fosfátové zbytky (1. na 3 C a 2. na 5 C). 1 řetězec DNA má tedy 2 konce, kde 1. začíná 3 C hydroxylem a 2. končí 5 C fosfátem: 3 CTTAAG 5 5 GAATTC 3 V buněčném jádře. C - G A - T

4 Prostorová struktura DNA

5 RNA-ribonukleová kys. RNA-ribonukleová kys., která obsahuje A, G, C a U (uracil je chemicky podobný T v DNA). RNA se v b. vyskytuje jako malý polynukleotidovýřetězec. V jadérku, což je neohraničenáčást jádra a v ribosomech. Vyskytují se 3 základní typy RNA: mrna: přenáší informaci o pořadí aminokyselin (stavebních kamenů bílkovin) z jádra k místu syntézy bílkovin. trna: přináší aminokyseliny k místu tvorby bílkovin rrna: tvoří stavební složku ribozomů kde probíhá syntéza bílkovin

6 Replikace DNA Replikace (obecně) tvorba kopií molekul NK zajišťující přenos GI z DNA do DNA a z RNA do RNA. K existujícímu řetězci DNA se na základě komplementarity bází přikládají odpovídající nukleotidy a postupně se spojují v nový řetězec, který je komplementární k původnímu. Vznikají tedy podle staré dvoušroubovice dvě zcela identické dvoušroubovice, z nichž žádná není celá nová, ale obsahuje 1 nový a 1 starý řetězec (semikonzervativní). Tuto reakci katalyzuje enzymový komplex DNA-polymeráza.

7 Transkripce Přepisování GI z DNA do RNA jako primárního transkriptu. Dochází při ní k syntéze RNA, která je komplementární k DNA (gen). Tento přepis je katalyzován enzymovým komplexem RNA-polymerázou. Přepisem vzniká mrna, která je jednovláknová.

8 Translace Syntéza molekuly bílkoviny využívající informace obsažené v molekule mrna. Probíhá na ribozomech. Přenos genetického kódu mrna (dán pořadím bází A G C U) do pořadí aminokyselin v bílkovině. Syntéza bílkovin na ribozómech. Kromě mrna vzniklých transkripcí jsou zapotřebí i trna z cytoplazmy. Na sekvence mrna nasedají trna přinášející aminokyseliny. Mezi aminokyselinami vznikají peptidové vazby a postupně je vytvářen polypeptidový řetězec.

9 Schéma buňky: transkripce a translace

10 Buněčný cyklus Fáze b. cyklu: G 1, S, G 2 a M. Interfáze období mezi dvěma M-fázemi (G 1, S, G 2 ). G 1 fáze (30-40 % cyklu) b. roste, syntéza RNA, bílkovin a tvorba organel (hlavní kontrolní bod b.c.). S fáze (50 % cyklu) replikace DNA. G 2 fáze růst b., tvorba sloučenin a organel ve dvojnásobném množství přípravná fáze (2. kontrolní bod b.c.). M fáze (mitóza+cytokineze-5-10 % cyklu) dělení jádra a b.- rychlý průběh.

11 Mitóza Rozdělení replikovaných chromozomů a dokončení dělení jádra na 2 dceřinné. Přesné rozdělení chromozomů se uskutečňuje mitotickým aparátem centrioly (centrosomy) a dělící (mitotické) vřeténko. 4 fáze mitózy: profáze, metafáze, anafáze a telofáze.

12 Meióza U vyšších rostlin a živočichů mají somatické bb. v jádře 2 kopie homologních ch. (podobné) dipliodie (2n). Předpoklad pro pohlavní rozmnožování splynutí 2 pohlavních bb. (gamet), u nichž je počet ch. redukován na polovinu (1n) haploidní stav, což se děje při redukčním dělení meióza. Zahrnuje vždy po sobě následující dělení heterotypické (redukční d. rozdílné od mitózy) a shodné s mitózou (homeotypické).

13 Co to jsou chromozomy, kde je najdeme a kdy je můžeme pozorovat? Chromozómy - útvary známé z jádra eukaryotních buněk, viditelné při jaderném dělení (mitóze-metafáze). Spiralizací DNA za účasti bílkovin vznikají chromatinová vlákna a další spiralizací těchto vláken vznikají již celé chromozómy.

14 Jaké máme chromozomy? Submetacentrický chromozóm: 1. chromatida, 2. centromera, 3. krátké rameno chromatidy, 4. dlouhé rameno chromatidy Jejich velikost a tvar jsou rozmanité, ale druhově shodné a stálé. Délka chromozómových pentlic se pohybuje od desetin až po desítky µm, ale během b. cyklu se mění. Skládají se ze 2 ramen (chromatid) spojených centromerou. Tvarově se odlišují na základě umístění centromery (zúžení). Koncové oblasti chromozómů se nazývají telomery.

15 Autozomy a gonozomy Chromozómy somatické - autozomy Tvoří homologní (= rovnocenné) páry, určují vlastnosti organismu mimo pohlaví Chromozómy pohlavní gonozomy Určují pohlaví jedince (ale nesou i jiné geny), jsou heterologní (označení X a Y). U člověka 22 párů autozomů a 1 pár gonozomů (X, Y).

16 Genetika: Čím se genetika zabývá? Věda zabývající se dědičností a proměnlivostí živých soustav. Sleduje variabilitu a přenos druhových a dědičných znaků mezi rodiči a potomky i mezi potomky navzájem. Počátky genetiky v 19. století. Za zakladatele genetiky je považován Johann Gregor Mendel ( ) - augustiniánský mnich z brněnského kláštera, zabýval se pokusy s rostlinami. Velký rozvoj ve druhé polovině 20. století.

17 Dědičnost, proměnlivost a znak (základní pojmy) Dědičnost a proměnlivost patří mezi základní vlastnosti živé hmoty. Dědičnost je schopnost předávat soubor informací (v buňce nebo v mnohobuň. org.) do dalších generací. Proměnlivost (variabilita) je naopak schopnost org. reagovat různě na různé podmínky prostředí. Znaky jsou jednotlivé vlastnosti org. (morfologické, fyziologické, funkční i psychické).

18 Kvalitativní a kvantitativní znaky a fenotyp Kvalitativní znaky se vyskytují u jedinců v různých formách, variantách a kvalitách: barva květů, očí, vlasů, krevní skupina, nemoc způsobená určitou odchylkou atd. Kvantitativní znaky se u jedinců liší stupněm, mírou svého vyjádření: výška, hmotnost jedince, délka rozmnožování atd. (vyjadřujeme je v měrných jednotkách). Fenotyp: soubor všech kvalitativních a kvantitativních znaků daného org.

19 Gen a genotyp Gen je genetická informace přenesená z rodičů na potomky a je základem pro vznik určitého znaku. Geny rozlišujeme na strukturní (syntéza bílkovin), RNA geny (pořadí nukleotidů v t,rrna) a regulační geny (regulují expresi strukturních genů). Genotyp je soubor všech genů živého org. Praktický výsledek genotypu je fenotyp. Genom je soubor všech genů v 1 buňce.

20 Alela, genový lokus a karyotyp Alela: Konkrétní forma genu. Existují různé formy téhož genu - různé projevy. V rámci 1 organismu jsou 2 alely pro 1 gen (kromě pohlavních buněk). Genový lokus: Místo na chromozómu, kde je umístěn určitý gen. Karyotyp je soubor chromozómů (např. člověk - 23 párů chromozómů).

21 Kdo je homozygot a heterozygot? Heterozygot je org., jehož alely zkoumaného genu jsou navzájem různé. Homozygot je org., jehož obě alely zkoumaného genu jsou stejné.

22 Dominance a recesivita Dominance a recesivita kdy funkce jedné alely převládá (dominuje) a ve fenotypu tak překrývá účinek druhé alely, která je recesivní. Úplná dominance fenotypový projev dominantní alely u org. s homozygotně dominantním genotypem (AA dominantní fenotyp) nebo fenotypový projev recesivní alely u org. s homozygotně recesivním genotypem (aa recesivní fenotyp). Neúplná dominance kdy funkce dominantní alely nestačí u heterozygota (Aa) zajistit fenotyp dané vlastnosti ve stejné míře jako u dominantního homozygota (AA).

23 Křížení, rodičovská generace a generace potomků, hybrid Při pohlavním rozmnožování dochází ke křížení prostřednictvím gamet (1n) rodičů, tím dochází k přenosu 1 mateřské a 1 otcovské alely na potomka. Jedince vznikající křížením nazýváme hybridy. Rodičovskou generaci označujeme symbolem P (parentální). Generaci potomků značíme F (filiální), kde 1. generace potomků je F1 a 2. F2.

24 Mendelovy zákony Johann Gregor Mendel při křížení hrachu sledoval 7 dědičných znaků (tvar a barva semen a lusků, barva květů, délka stonku a postavení květů). Vyslovil je v roce 1865: 1. Zákon o uniformitě hybridů F 1 generace a identitě reciprokých křížení: Při vzájemném křížení homozygotních rodičů (P) vzniká první filiální generace (F 1 ) potomků, kteří jsou genotypově i fenotypově jednotní. Pokud jde o 2 různé homozygoty jsou potomci vždy heterozygoti.

25 2. Mendelův zákon (křížení heterozygotů) Alelické páry se u heterozygotů vzájemně nesměšují. Potomstvo F 2 vzniklé křížením heterozygotních jedinců F 1 gen. je nestejnorodé a dochází tak k fenotypovému štěpení. Vzájemným křížením heterozygotů Aa vzniká potomstvo genotypově i fenotypově různorodé. S pravděpodobností 25% mohou vznikat potomci homozygotně dominantní, s pravděpodobností 50% potomci heterozygotní a s pravděpodobností 25% potomci homozygotně recesivní (viz. kombinační čtverec). Genotypový štěpný poměr je 1:2:1, fenotypový štěpný poměr je 3:1 při úplné dominanci nebo 1:2:1 při neúplné dominanci.

26 3. Zákon o volné kombinovatelnosti vloh Stejné zabarvení značí stejný genotyp. Mezi alelami genů, které leží v různých chromozomech, existuje vzájemná volná a nezávislá kombinovatelnost. V potomstvu F2 pak vznikne tolik zygotických genotypových kombinací, kolik je jich možných mezi na sobě matematicky nezávislými veličinami. Při zkoumání 2 alel současně dochází k téže pravidelné segregaci. Máme-li 2 dihybridy AaBb může každý tvořit 4 různé gamety (AB, Ab, ab, ab). Při vzájemném křížení tedy z těchto 2 gamet vzniká 16 různých zygotických kombinací. Některé kombinace se ovšem opakují, takže nakonec vzniká pouze 9 různých genotypů. V F2 generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

27 3. Mendelův zákon: Máme 2 dihybridy GgYy (rodiče heterozygotní ve 2 různých párech alel). Každý z nich může vytvořit pohlavní buňky - gamety obsahující se stejnou pravděpodobností 1 ze 4 možných kombinací mezi alelami těchto 2 alelových párů: GY, Gy, gy, gy.

28 Vazba genů Mendelův zákon o nezávislé kombinovatelnosti alel platí jen pro alely, které jsou uloženy na různých párech homologních chromozomů a mohou se tedy při meiotické segregaci nezávisle kombinovat. Soubor genů 1 chromozomu (neboli soubor parů alel 1 páru homolog. ch.) tvoří tzv. vazbovou skupinu genů. Základní poznatky o vazbě genů zformuloval na základě pokusů s drosofilou T.H. Morgan 2 Morganovy zákony.

29 1. Zákon o uložení genů: Morganovy zákony Geny v chromozomech jsou uspořádány lineárně v řadě za sebou ve zcela určitých chromozomových místech, genových lokusech. 2. Zákon o vazbě genů: Soubor genů umístěných v určitém chromozomu tvoří vazbovou skupinu. Všechny geny téhož ch. jsou vzájemně vázány. Nezávisle kombinovatelné jsou jen s geny jiných vazbových skupin. Počet vazbových skupin je dán počtem párů homologních ch.

30 Genetická rekombinace Změna v uspořádání alel vzájemně vázaných genů, která je možná jen náhodnou strukturní výměnou částí nesesterských chromatid mezi párovými ch. K těmto výměnám dochází v profázi 1. meiotického dělení (ve stádiu bivalentů). Tento proces se nazývá crossing-over. Rozlišujeme jednoduchý crossing-over (vzniká na základě jednoho překřížení a chromatidy si při něm prohodí konce) a vícenásobný crossing-over (několikanásobném překřížení).

31 Síla vazby genů Pravděpodobnost vzniku crossing overu mezi vzdálenými geny je větší než mezi geny blízkými. O síle vazby mezi geny nás informuje Morganovo číslo. Dá se zjistit pořadí a vzdálenost genů (cm - centimorgan) na chromozómu. Tak můžeme získat i genetickou mapu chromozomu.

32 Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto genech pak dochází k odchylkám vůči normální mendelovské dědičnosti a tato dědičnost se nazývá pohlavně vázaná nebo gonozomální.

33 Chromozomy X a Y Liší se tvarem a velikostí, kdy Y je mnohem menší. Velká heterologníčást chromozomu X tvoří zvláštní vazbovou skupinu. Naopak geny na malém homologním úseku obou chromozomů podléhají synapsi a může mezi nimi probíhat c.-o. (g. neúplně vázané na pohlaví).

34 Geny úplně vázané na pohlaví V genotypu muže je pouze 1 X ch. hemizygotní. Pseudodominance je fenotypový projev recesivní alely způsobený nepřítomností párové alely dominantní. U čl. jsou to např. recesivní alely pro hemofílii (poruchu srážlivosti), daltonismus (barvoslepost). Dědičnost pohlavím ovlivněná heterozygotní sestava páru alel autozomálního genu se projeví fenotypově jako dominantní u jednoho a recesivní u druhého pohlaví (např. předčasná plešatost, za kterou odpovídá alela P PP, Pp muži jsou plešatí a pp ne. U žen je to tak, že pouze PP ženy mají tuto vadu, Pp a pp mají vlasy normální).

35 Co jsou to mutace a čím jsou způsobené? Mutace jsou změny v genotypu organismu oproti normálu. Velká většina mutací je naprosto náhodných (spontánní mutace ), cílená mutageneze se používá pro vědecké účely. Pravděpodobnost vzniku mutace se zvyšuje působením některých fyzikálních nebo chemických činitelů (mutagenů záření, silná oxidačního činidla indukované mutace). Organismy jsou do jisté míry schopny mutace v DNA opravit.

36 Mutace genové TGT GTA ATA CCG GGT TTG TGT TTA TA ATA CCG GGT TTG substituce Genové mutace jsou změny v genetické informaci, které proběhly v jednom genu a nenarušily stavbu chromozómu (změna fenotypové vlastnosti). Substituce je náhrada báze původní sekvence bází jinou. U delece jde o ztrátu jednoho nebo více nukleotidů původní sekvence. Adice (inzerce) -zařazení jednoho nebo více nadbytečných nukleotidových párů. Mohou způsobovat nádorová onemocnění, pokud se týkají genů regulujících dělení bb. a jejich diferenciaci.

37 Chromozomální mutace Jsou to všechny úchylky chromozomů změna struktury a tvaru. Zjišťují se analýzou karyotypu, jako tvarové a strukturální odchylky od normálního karyotypu. Tyto změny na chromozomech nazýváme chromozomové aberace. Jedná se o velký počet genů a odráží se ve fenotypu jedince. Důležité je jaký chromozom byl zasažen a jakým typem aberace (zlom v určitém místě chromozomu fragment ztráta delece, inverze otočení fragmentu, duplikace zdvojení fragmentu atd.). Neplodnost, snížená životaschopnost a mortalita.

38 Genomové mutace Zvýšení nebo snížení počtu chromozomů od normálního stavu. Anenploidie jednotlivé chromozomy. Polyploidie znásobení celých ch. sad. Haploidie redukce celých ch. sad. Heteroploidie označení variability počtu chromozomů v jádrech a aneuploidní charakter (dlouhodobě lultivované bb. in vitro).

39 Chromozomální syndromy autozomů Downův syndrom trisomie chromozomu 21 (výskyt 1:700 a zvyšuje se s věkem matky). Klinické projevy: zešikmené oční štěrbiny, mentní retardace (IQ 25-50), vpadnutý kořen nosu, krátké a široké ruce, charakteristické papilární linie (dlaň, prsty), velká mezera mezi 1. a 2. prstem nohy, podprůměrná výška, časté vrozené vady srdce a leukemie.

40 Edwardsův syndrom Trisomie chromosomu 18. Většinou potraty, narození přežívají do 2 měs. (vyjímečně do 15 let ženy) mentální retardace, zpomalený vývoj, nízko posazené deformované uši, překřížené prsty v pěst, těžké srdeční vady. 1:3000 1:8000.

41 Paetau-syndrom Trisomie chromosomu 13. Těžké anomálie CNS, retardace růstu a těžká mentální retardace, plochéčelo, rozštěp rtu a patra, polydaktylie, abnormality vnitřních org., abnormality očí, nízká životnost (4 měs.). 1:4000 1:10000.

42 Anenploidie gonozomů Turnerův syndrom: monosomie chromosomu X incidence 1 : 2500 (novorozené dívky) sterilní ženy s malou postavou, absence nebo opoždění menstruačního cyklu, absence ovarií široký hrudník s nápadně oddálenými bradavkami srdeční vady nesoustředěnost a poněkud horší prostorová představivost

43 Klinefelterův syndrom 47, XXY incidence 1/700 (novorození chlapci) muži s vysokou postavou sterilita, poruchy spermatogeneze, omezený rozvoj mužských sekundárních pohlavních znaků typický klinický obraz se vyvíjí až v období puberty poruchy chování

44 Superfemale (nadsamice) 47, XXX (trisomie chromozomu X) incidence 1/1000 (novorozené dívky) fenotyp zpravidla bez nápadných změn opožděnířečového vývoje poruchy učení v některých případech snížená fertilita nebo sterilita

45 Supermale (nadsamec) 47, XYY incidence 1/1000 fenotyp zpravidla normální poruchy chování (zvýšená agresivita)

46 Genetika populací Populace je soubor genotypově různých, ale geneticky vzájemně příbuzných jedinců téhož druhu. Genový fond je společný fond gamet a zygot určité populace. Velká populace několik set až tisíce jedinců. Malá populace několik desítek jedinců. V panmiktické populace dochází k náhodnému a ničím neomezenému párování všech jedinců obou pohlaví v populaci.

47 Genetická rovnováha v populaci Genetiku populací založili až 2 badatelé na počátku 20. st. G. H. Hardy a W. Weinberg. Hardyho-Weinbergův zákon: genetická struktura (frekvence genů a genotypů) se v panmiktické populaci nemění. Tato populace je v genetické rovnováze.

48 Krevní skupina Rh faktor a H.-W. zákon Přítomnost antigenu Rh+ (alela D), nepřítomnost Rh- (d). Četnost alely D = p a alely d = q. Součet četností v populaci je 100%, pak p+q = 1. Pravděpodobnost setkání 2 dominantních (DD) a recesivních alel (dd) je p x p = p 2 a q x q = q 2. Dále pak setkání recesivní a dominantní alely (Dd) je (p x q) + (q x p) = 2pq p 2 +2pq+ q 2 =1. V ČR jsou přibližněčtyři pětiny obyvatelstva Rh +. Aby H.-W. zákon platil nesměla by v populaci existovat selekce, mutace, migrace atd. (evoluční faktory).

49 Genetika člověka: Výzkum rodokmenů Proband vyšetřovaná osoba Muž Žena Nejčastější metodou studia lidské dědičnosti je metoda rodokmenová. Využívá sestavení rodokmenu několika generací pomocí mezinárodních symbolů: proband (osoba, která žádá o vyšetření) je označena šipkou, škrtnutý znak značí úmrtí, jednoducháčára značí rodovou linii a sňatek, dvojitá čára příbuzenský sňatek... Postižený jedinec Heterozygot - autozomální dědičnost Heterozygot - gonozomální dědičnost

50 Jednoduchý rodokmen

51 Výzkum dvojčat Zkoumají se dvouvaječná i jednovaječná dvojčata. Jednovaječná dvojčata = přírodní klony (vznikají z jedné zygoty - mají stejnou genetickou informaci - naprosto shodnou DNA). Tento shodný genotyp automaticky neznamená stejný fenotyp obou jedinců!!! Zaznamenávání takovýchto rozdílů pomáhá zjistit, co a do jaké míry ovlivňují geny a co závisí na podmínkách, ve kterých jedinec vyrůstá = podíl vlivu prostředí a genetické výbavy na vznik fenotypového projevu.

52 Normální karyotyp člověka Žena: 2n = 46, XX Muž: 2n = 46, XY Chromozomy jsou zcela kondenzovány v metafázi, kdy lze identifikovat až 400 proužků (proužky jsou detailněji kondenzovány ještě v prometafázi 550 proužků). Z molekulárně cytogenetických metod má největší význam hybridizace in situ. Využívá tzv. sond, což jsou malé uměle připravené úseky DNA (vzácněji RNA), které jsou komplementární k určitým partiím chromozomální DNA. Sondy jsou zpravidla značeny fluorescenčním barvivem. Hovoříme proto o metodě fluorescenční in situ hybridizace, zkráceně FISH.

53 Charakteristika chromozomu dle nomenklatury Velikost, poloha centromery, vzájemný poměr ramének (p=krátké raménko, q=dlouhé r.), rozmístění, počet a typ proužků, specifické znaky (nepárovost pohlavních chromozomů muže). Každý ch. má svéčíslo (gonozomy písmeno. Raménka jsou rozdělena do oblastí, které jsou takéčíslovány, podobně i proužky jsou číslovány. Idiogram lidských chromozomů G-proužky (barvení Giemsa-Romanowski) podle Denverské nomenklatury.

54 Karyotyp člověka (muže) Většina autozomů a pohlavní chromozom X jsou metacentrické (1, 2, 3, 19, 20, X), submetacentrické (4, 5, 10, 12, 18), akrocentrické (se satelitem-13, 14, 15, 21, 22 a bez s. Y). D F A G C E B

55 Výzkum lidských chromozomů V rámci klinické genetiky se karyotyp vyšetřuje relativněčasto. Toto vyšetření je u dospělého člověka (či dítěte) relativně nenáročné, neboť stačí odebrat krev (viz výše). Komplikovanější je vyšetření karyotypu plodu, neboť buněčný materiál je potřeba získat pomocí některé z invazivních metod prenatální diagnostiky (viz Genetické poradenství). Toto vyšetření je zcela dobrovolné a vázané na poučený souhlas. Vyšetření karyotypu indikujeme u: těhotných žen, u kterých je zvýšené riziko vrozené vývojové vady těhotných žen nad 35 let, u kterých je obecně zvýšené riziko Downova syndromu novorozenců a dětí, u kterých je důvodné podezření na některou chromosomální aberaci.

56 Dědičnost krevních skupin Dědičnost je velmi jednoduchá. Alely podmiňující tvorbu aglutinogenu (buď A nebo B) jsou dominantní vůči alele, která nepodmiňuje tvorbu žádného aglutinogenu. Mezi sebou jsou kodominantní. Jak to tedy funguje? Fenotyp - krevní skupina A - Genotyp AA nebo A0 Fenotyp - krevní skupina B - Genotyp BB nebo B0 Fenotyp - krevní skupina AB - Genotyp AB Fenotyp - krevní skupina 0 - Genotyp 00

57 Dědičné choroby Fenylketonurie: (PKU, Hyperfenylalaninémie, Föllingova nemoc, fenylketonurická oligofrenie) Vrozená porucha metabolismu aminokyseliny fenylalaninu. Galaktosemie: Chybí enzym pro trávení galaktosy. Syndaktylie, polydaktylie: Srůst, respektive znásobení několika prstových článků. Arachnodaktylie: Hlavním projevem jsou nepřirozeně dlouhé a tenké prsty. Taktéž celé končetiny mohou být abnormálně dlouhé a tenké. Vyskytuje se i jako součást různých syndromů (viz Marfanův syndrom).

58 Projekt lidský genom Projekt HUGO (Human Genome Mapping Organization) zabývá se objasněním přesného složení lidského genomu, tj. souhrnné sekvence bází genomu, obsahujícího kolem 3 mld. párů bází, což mělo být asi genů. S postupujícím výzkumem se číslo neustále snižuje - současný počet genů se odhaduje na Projek byl zahájený na počátku 90. let 20. století, s předpokládaným ukončením v roce Přesto byl draft lidského genomu publikován již v únoru roku Mezinárodní tým vědců oznámil dokončení plné identifikace lidského genomu 14. dubna 2003 (k 50. výročí objevu dvoušoubovice DNA). Ve skutečnosti pouze asi 1,5% lidské DNA přímo kóduje proteiny. Až 97% celé sekvence DNA je tvořeno tzv. nekódující DNA (Junk DNA), jejíž význam - pokud nějaký vůbec je - není zatím známý.

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010


Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by - Ned?le, B?ezen 01, 2015 Otázka: Genetika I P?edm?t: Biologie P?idal(a):


Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela


Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00


Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto


V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865


Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou


Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 Mutace Mutace - náhodná změna v genomu organismu - spontánní


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Typy chromosomů. A telocentrický B akrocentrický C submetacentrický D metacentrický. Člověk nemá typ telocentrický!

Typy chromosomů. A telocentrický B akrocentrický C submetacentrický D metacentrický. Člověk nemá typ telocentrický! Karyologie Typy chromosomů A telocentrický B akrocentrický C submetacentrický D metacentrický Člověk nemá typ telocentrický! Chromosom chromosom telomera jádro centomera telomera buňka histony dvoušroubovice


Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny


Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u


GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu



GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina

Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina Přehled GMH Seminář z biologie GENETIKA Molekulární genetika Základní dogma molekulární biologie Základním nosičem genetické informace je molekula DNA. Tato molekula se může replikovat (kopírovat). Informace


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace

Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace Mutace Klasifikace mutací Z hlediska lokalizace mutací v genotypu Genové mutace Chromozomální mutace Genomové mutace Vznik genových mutací Tranzice pyrim. za pyrim. C na T T na C purin za purin A na G

Více Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u



21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců



ENZYMY A NUKLEOVÉ KYSELINY ENZYMY A NUKLEOVÉ KYSELINY Autor: Mgr. Stanislava Bubíková Datum (období) tvorby: 28. 3. 2013 Ročník: devátý Vzdělávací oblast: Člověk a příroda / Chemie / Organické sloučeniny 1 Anotace: Žáci se seznámí


Genetika člověka - reprodukce

Genetika člověka - reprodukce Gymnázium Václava Hraběte Školní rok 2015/2016 Genetika člověka - reprodukce Seminární práce z biologie autor práce: Andrea Jirásková; 8.A vedoucí práce: RNDr. Roman Slušný Prohlášení Prohlašuji tímto,


Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Genetika člověka / GCPSB. Radim Vrzal

Genetika člověka / GCPSB. Radim Vrzal Genetika člověka / GCPSB Radim Vrzal Analýza chromosomů a s nimi spojených nemocí (část I.) Genetický materiál: Chromosomy Série buněčných dělení Zygota + Úkoly genetického systému Jak každá buňka dostane


ANOTACE vytvořených/inovovaných materiálů

ANOTACE vytvořených/inovovaných materiálů ANOTACE vytvořených/inovovaných materiálů Číslo projektu Číslo a název šablony klíčové aktivity Tematická oblast Formát Druh učebního materiálu Druh interaktivity CZ.1.07/1.5.00/34.0722 III/2 Inovace a


Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Tradice šlechtění šlechtění zlepšování pěstitelsky, technologicky a spotřebitelsky významných vlastností





Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Chromozomová teorie dědičnosti KBI / GENE Mgr. Zbyněk Houdek Proč octomilka a T.H. Morgan? Drosophila melanogaster ideální objekt pro genetický výzkum : Rychlý reprodukční cyklus a snadný chov v laboratorních



GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností


RURGenetika zápočtový program Programování II

RURGenetika zápočtový program Programování II RURGenetika zápočtový program Programování II Rudolf Rosa cvičící: Doc. RNDr. Pavel Töpfer, CSc. Obsah Specifikace...1 Původní specifikace...1 Upravená specifikace...2 Program...3 třída Populace...4 Datové


Spermatogeneze saranče stěhovavé (Locusta migratoria)

Spermatogeneze saranče stěhovavé (Locusta migratoria) Spermatogeneze saranče stěhovavé (Locusta migratoria) Vývoj pohlavních buněk u živočichů zahrnuje několik dějů, které zajistí, že dojde k redukci a promíchání genetického materiálu a vzniklé buňky jsou


-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě Otázka: Genetika I Předmět: Biologie Přidal(a): Paris -věda, která se zabývá dědičností a proměnlivostí -zakladatelem je Johan Gregor Mendel (1822 1884), který se narodil v Hynčicích na Moravě 1. MOLEKULÁRNÍ





"Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT ". Základy Genetiky

Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT . Základy Genetiky "Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT ". Základy Genetiky ROSTLINNÁ BUŇKA aaaaaaaa jádro mitochondrie chromatin (DNA) aaaaaaaa aaaaaaa aaaaaaaa aaaaaaaa plastid


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat


1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická


UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku)

UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) B I O L O G I E 1. Definice a obory biologie. Obecné vlastnosti organismů. Základní klasifikace organismů.



TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


Mutageneze vznik chyby na DNA mutagen (chemická látka / záření)

Mutageneze vznik chyby na DNA mutagen (chemická látka / záření) Genotoxicita - úvod Genotoxicita: toxická látka ovlivňuje genetický materiál buňky (nukleové kyseliny) Při působení vyšších koncentrací genotoxických látek dochází k přímému úhynu buněk Nižší koncentrace


Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Dědičnost kvantitativních znaků. Proměnlivost a dědivost. Mutace

Dědičnost kvantitativních znaků. Proměnlivost a dědivost. Mutace Přehled GMH Seminář z biologie Genetika 3 Dědičnost kvantitativních znaků Kvantitativní znaky mají kontinuální proměnlivost a jsou polygenní. Za velikost znaku je většinou zodpovědný systém několika genů


6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního


Molekulární základy dědičnosti. Ústřední dogma molekulární biologie Struktura DNA a RNA

Molekulární základy dědičnosti. Ústřední dogma molekulární biologie Struktura DNA a RNA Molekulární základy dědičnosti Ústřední dogma molekulární biologie Struktura DNA a RNA Ústřední dogma molekulární genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace DNA RNA


Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto


- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil


Mutační změny genotypu

Mutační změny genotypu Mutační změny genotypu - změny genotypu: segregace, kombinace + MUTACE - náhodné změny Mutace - genové - spontánní - chromozómové - indukované (uměle vyvolané) - genomové A) Genové mutace - změna (ztráta)


Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je


Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním


Molekulární genetika: Základní stavební jednotkou nukleových kyselin jsou nukleotidy, které jsou tvořeny

Molekulární genetika: Základní stavební jednotkou nukleových kyselin jsou nukleotidy, které jsou tvořeny Otázka: Molekulární genetika, genetika buněk Předmět: Biologie Přidal(a): jeti52 Molekulární genetika: Do roku 1953 nebylo přesně známa podstata genetické informace, genů, dědičnosti,.. V roce 1953 Watson


Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti


Buňky, tkáně, orgány, soustavy

Buňky, tkáně, orgány, soustavy Lidská buňka buněčné organely a struktury: Jádro Endoplazmatické retikulum Goldiho aparát Mitochondrie Lysozomy Centrioly Cytoskelet Cytoplazma Cytoplazmatická membrána Buněčné jádro Jadérko Karyoplazma


Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v


Výukový materiál zpracovaný v rámci projektu Výuka modern

Výukový materiál zpracovaný v rámci projektu Výuka modern St ední pr myslová škola strojnická Olomouc, t. 17. listopadu 49 Výukový materiál zpracovaný v rámci projektu Výuka modern Registrační číslo projektu: CZ.1.07/1.5.00/34.0205 Šablona: III/2 P írodov dné


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


Deriváty karboxylových kyselin, aminokyseliny, estery

Deriváty karboxylových kyselin, aminokyseliny, estery Deriváty karboxylových kyselin, aminokyseliny, estery Zpracovala: Ing. Štěpánka Janstová 29.1.2012 Určeno pro 9. ročník ZŠ V/II,EU-OPVK,42/CH9/Ja Přehled a využití derivátů organických kyselin, jejich


REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce?

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce? REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince Co bylo dřív? Slepice nebo vejce? Rozmnožování Rozmnožování (reprodukce) může být nepohlavní (vegetativní, asexuální) pohlavní (sexuální;


EMBRYOLOGIE Učebnice pro studenty lékařství a oborů všeobecná sestra a porodní asistentka

EMBRYOLOGIE Učebnice pro studenty lékařství a oborů všeobecná sestra a porodní asistentka 6pt;font-style:normal;color:grey;font-family:Verdana,Geneva,Kalimati,sans-serif;text-decoration:none;text-align:center;font-variant:n = = < p s t y l e = " p a d d i n g : 0 ; b o r d e r : 0 ; t e x t


od eukaryotické se liší svou výrazně jednodušší stavbou a velikostí Dosahuje velikosti 1-10 µm. Prokaryotní buňku mají bakterie a sinice skládá se z :

od eukaryotické se liší svou výrazně jednodušší stavbou a velikostí Dosahuje velikosti 1-10 µm. Prokaryotní buňku mají bakterie a sinice skládá se z : Otázka: Buňka Předmět: Biologie Přidal(a): konca88 MO BI 01 Buňka je základní stavební jednotka živých organismů. Je to nejmenší živý útvar schopný samostatné existence a rozmnožování. Každá buňka má svůj


=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům

=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům Otázka: Genetika Předmět: Biologie Přidal(a): t.klodnerova REALIZACE GENETICKÉ INFORMACE, MUTACE, ZÁKLADNÍ GENETICKÉ POJMY: GEN, ZNAK, ALELA, GENOTYP, FENOTYP, HOMOZYGOT, HETEROZYGOT, HYBRIDIZACE, DOMINANCE,


GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných


GENETIKA. zkoumá dědičnost a proměnlivost organismů

GENETIKA. zkoumá dědičnost a proměnlivost organismů GENETIKA zkoumá dědičnost a proměnlivost organismů Dědičnost: schopnost organismů uchovávat informace o své struktuře a funkčních schopnostech a předávat je svým potomkům Proměnlivost (variabilita) je


Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k


Populační genetika II

Populační genetika II Populační genetika II 4. Mechanismy měnící frekvence alel v populaci Genetický draft (genetické svezení se) Genetický draft = zvýšení frekvence alely díky genetické vazbě s výhodnou mutací. Selekční vymetení


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI


Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým


Proč jsme podobní rodičům? A jak k tomu vlastně může dojít?

Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Základy genetiky Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Johann Gregor Mendel (1822 1884) O jeho životě byl mnich, zakladatel genetiky a opat augustiniánského kláštera v Brně studium


Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace


ANATOMIE A FYZIOLOGIE ÈLOVÌKA Pro humanitní obory. doc. MUDr. Alena Merkunová, CSc. MUDr. PhDr. Miroslav Orel

ANATOMIE A FYZIOLOGIE ÈLOVÌKA Pro humanitní obory. doc. MUDr. Alena Merkunová, CSc. MUDr. PhDr. Miroslav Orel doc. MUDr. Alena Merkunová, CSc. MUDr. PhDr. Miroslav Orel ANATOMIE A FYZIOLOGIE ÈLOVÌKA Pro humanitní obory Vydala Grada Publishing, a.s. U Prùhonu 22, 170 00 Praha 7 tel.: +420 220 386401, fax: +420


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více 3. cvičení Buněčný cyklus Mitóza Modifikace mitózy 1 DNA, chromosom genetická informace organismu chromosom = strukturní podoba DNA během dělení (mitózy) řetězec DNA (chromonema) histony další enzymatické


Masarykova univerzita v Brně, Fakulta lékařská

Masarykova univerzita v Brně, Fakulta lékařská Masarykova univerzita v Brně, Fakulta lékařská Obor: Všeobecné lékařství Biologie Testy předpokládají znalost středoškolské biologie. Hlavním podkladem při jejich přípravě byl "Přehled biologie" (Rosypal,
