Genetika na úrovni mnohobuněčného organizmu

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Genetika na úrovni mnohobuněčného organizmu"

Transkript

1 Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského organizmu => je přímým pokračovatelem rodičovského organizmu - potomek je geneticky shodný s rodičem (získává a udržuje si beze změny obě jeho chromozómové sady tedy i alely) - soubor potomstva vzniklého nepohlavním rozmnožováním = klon jedinci téhož klonu jsou genotypově jednotní klon mohou tvořit homozygoti i heterozygoti - při vzniku rozdílů ve znacích jedinců se uplatňuje vnější prostředí Praktické využití: v zemědělství udržení určitých, pro člověka výhodných, znaků daného organizmu (okrasné rostliny, ovocné dřeviny, zelenina, obilí ) Pohlavní rozmnožování: - nový jedinec vzniká splynutím samčí a samičí gamety (haploidní) - potomek získává vlohy od obou rodičů => dochází k nové kombinaci alel - potomek se od rodičů liší genotypově i fenotypově - čistá linie homozygotní soubor potomků vzniklý pohlavním rozmnožováním Praktické využití: šlechtitelství jedinci s novými vlastnostmi Křížení = hybridizace - cílené pohlavní rozmnožování organizmů za účelem získat a sledovat určité znaky u potomků - sledujeme výskyt forem určitého znaku nebo více znaků u všech jejich potomků = analýza hybridů - je to základní metoda genetického výzkumu a základní metoda šlechtitelství - vytváření užitkových organizmů s novými kombinacemi žádaných znaků genetická forma = kultivar = odrůda (př. určitá odrůda rostliny je výnosná, ale málo odolná vůči chorobám, jiná opak => vhodným křížením u části potomstva dosáhneme kombinace obou vhodných znaků tyto jedince možno křížit mezi sebou příbuzenské křížení) Příbuzenské křížení = inbreeding: - pro zachování získaných vlastností - opakováním po několik generací je možné vyšlechtit inbrední linii o tj. souvislý generační sled jedinců, kteří, jestliže je křížíme mezi sebou navzájem, trvale udržují novou kombinaci žádoucích znaků o příslušníci čisté linie jsou shodní fenotypově i genotypově (u většiny rostlin lze nové znaky udržovat jednodušeji a jistěji nepohlavním rozmnožováním) Reciproční křížení vzájemné křížení dvou organizmů AA x aa aa x AA Genetické modely organizmy používané ke genetickým výzkumům. Univerzálnost genetického kódu => přenos genetické informace a její realizace probíhá u všech organizmů stejným způsobem. Modelové organizmy musí splňovat následující požadavky: 1. malé rozměry => snadné pěstování, křížení a manipulace 2. velká plodnost 3. krátká doba vývinu 4. malý počet chromozómů

2 5. snadná rozlišitelnost pohlaví 6. výrazné a rozdílně geneticky podložené znaky Octomilka obecná (Drosophila melanogaster) velikost 2 3 mm samička odlišná od samečka schopná oplození již 1. den života, vajíčka klade 2. den, za 10 dní naklade 300 vajíček životní cyklus vývinu 2 týdny, ročně možno získat až 25 generací v buňkách 4 páry lehce rozlišitelných chromozómů Kukuřice (Zea mays) Neurospora crassa vřeckovýtrusá houba biochemická genetika Escherichia coli molekulární genetika bakteriofágy, viry virus tabákové mozaiky myš imunogenetika (po člověku geneticky nejprozkoumanější savec) křeček čínský méně chromozómů než myš huseníček Thalův vyšší rostlina, kvantitativní znaky, až 5 generací za rok trepka, kvasinky I. DĚDIČNOST MONOGENNÍCH ZNAKŮ monogenní znak: - znak určený jedním genem - gen velkého účinku = majorgen = oligogen - znaky kvalitativní dědí se poměrně jednoduše a jejich fenotypový projev je jen málo ovlivnitelný prostředím Dědičnost těchto znaků studoval Johann Gregor Mendel * Hynčice okres Nový Jičín Brno studia gymnázium v Opavě, filosofie v Olomouci 1843 vstupuje do kláštera jméno Gregor, vyučuje na středních školách, sám se zabývá studiem přírodních věd (meteorologie, zemědělství, včelařství) a kombinatorikou studium na universitě ve Vídni fyzika, přírodopis, chemie mnich augustiniánského kláštera v Brně pokusy s kříženci hrachu setého pokusy zvolen opatem V letech objevil základní obecné zákonitosti přenosu znaků na potomky. Výsledky pokusů shrnul v článku Pokusy s rostlinnými hybridy (psáno německy) a publikoval v roce 1865 v málo známém odborném časopise. Ve své době zapadly bez ohlasu, nebyly pochopeny. Až roku 1900 tři vědci nezávisle na sobě došli ke stejným výsledkům a prvenství přiznali Mendelovi Hugo de Vries, Carl Correns, Erich Tschermark. Mendelův přínos: - autor myšlenky o materiální podstatě dědičnosti předpokládal, že v pohlavních buňkách existují hmotné struktury, které nazval faktory ( dnes geny) tyto struktury získává potomek od obou rodičů struktury odpovídají za tvorbu znaků - objevil princip kombinace a segregace genů - formuloval tři obecně platná pravidla tzv. Mendelovy zákony pokusy na zcela nové úrovni velké nároky na přesnost pokusu

3 velké nároky na čistotu výchozího materiálu promyšleně vybral pokusný materiál hrách setý samosprašný (2 roky prověřoval čistotu odrůd, se kterými později pracoval) jako první sledoval dědičnost jednotlivých znaků místo studia dědičnosti celkového vzhledu; studoval 7 párů výrazných znaků: 1. tvar semena kulatý hranatý 2. barva děloh semena žlutá zelená 3. barva osemení barevné bílé 4. tvar lusků klenuté zaškrcené 5. barva lusků zelené žluté 6. postavení květů úžlabní vrcholové 7. délka stonku dlouhý krátký začínal nejprve pokusy s rostlinami, které se lišily jedním párem znaků, postupně pak pokusy složitější všechny pokusy dělal s velkým počtem rostlin výsledky zpracovával a vyhodnocoval matematicky Alela konkrétní forma genu př.:gen pro tvorbu anthokyanu v buňkách hrachu setého a tím pro barvu květu: alela nese informaci pro tvorbu barviva => červené zbarvení květu alela nese informaci pro nevytvoření barviva => bílé zbarvení květu Značení alel a) velkými a malými písmeny (obvykle počáteční písmena anglických názvů vlastností w = white), jsou-li alely dvě = A,a ; je-li alel více = a 1, a 2, a 3 b) písmeny s indexem: w +, w -, a 1, a 2, a 3 Sestava alel a) homozygotní obě alely určitého genu stejné AA, aa jedinec zdědil po obou rodičích tutéž alelu => homozygot b) heterozygotní párové alely jsou rozdílné Aa jedinec zdědil po každém z rodičů jinou alelu téhož genu a je v daném znaku heterozygot Vztahy mezi alelami a) úplná dominance a recesivita: dominantní = převládající o dominantní alela úplně potlačí projev alely recesivní o fenotypově (navenek) se projevuje stejně v homozygotní i heterozygotní sestavě o označuje se velkým písmenem př.: A podmiňuje vznik barviva, a neumožňuje vznik barviva: AA tvorba anthokyanu => červené zbarvení - homozygot dominantní aa - barvivo nevzniká => bílé zbarvení - homozygot recesivní Aa barvivo vzniká => červená barva - heterozygot b) neúplná dominance a recesivita: o dominantní alela nepotlačuje zcela projev alely recesivní o alela recesivní se také částečně uplatní o fenotyp heterozygota a dominantního i recesivního homozygota se liší

4 Intermediarita - zvláštní typ neúplné dominance - obě alely se projevují stejnou měrou - př.: nocenka alela A => syntéza antoxantinu, alela a => barvivo se netvoří: => AA => tmavě žlutá barva aa => barvivo nevzniká => bílá barva Aa => barvivo vzniká, ale v menší míře než u dominantního homozygota => světle žlutá barva květu c) kodominance každá dominantní alela v heterozygotní kombinaci se projeví v plné míře a navzájem se neovlivňují př.: krevní skupiny člověka gen má 3 alely: I A podmiňuje tvorbu aglutinogenu A (bílkovina na povrchu erytrocytů) I B tvorba aglutinogenu B I 0 - neumožňuje tvorbu žádného aglutinogenu I A a I B navzájem kodominantní a vůči I 0 dominantní pak: krevní skupina 0 => I 0 I 0 krevní skupina A => I A I A nebo I A I 0 krevní skupina B => I B I B nebo I B I 0 krevní skupina AB => I A I B A. Dědičnost kvalitativních znaků: 1. Autozomální dědičnost - geny uloženy na autozomech a jejich projev nezávisí na pohlaví jedince - štěpné poměry recipročních křížení jsou stejné a) MONOHYBRIDISMUS křížení, při němž je sledována dědičnost jednoho genu = jednoho páru alel, sledovaný jedinec = monohybrid značení: - P rodičovská = parentální generace - G gamety - F 1 první dceřiná = filiální generace (tj. veškeré potomstvo jedněch rodičů P) - F 2 druhá dceřiná generace (potomstvo, kdy rodiči se stali jedinci F 1 generace) Kombinační čtverec slouží ke zjišťování možných genotypových kombinací, uvádíme v něm gamety rodičů. U monohybridismu jsou možné 4 typy křížení Monohybridismus s úplnou dominancí: (semena hrachu žlutá x zelená) a 1 ) dva stejní homozygoti: P: AA x AA P: aa x aa G: A A A A G: a a a a F 1 : AA AA AA AA F 1 aa aa aa aa

5 Homozygotní rodiče stejný typ gamet => všichni potomci homozygotní, stejného typu jako rodiče => uniformní hybridi stejné budou i další generace F 2, F 3.. Vzniká takto čistá linie nevyskytuje se jedinec s druhou (recesivní, dominantní) formou znaku, lze ji udržet inbreedingem nebo nepohlavním rozmnožováním. a 2 ) dva různí homozygoti: P: AA x aa G: A A a a F 1 : Aa Aa Aa Aa Každý z rodičů tvoří jeden typ gamet => jejich splynutím vznikají heterozygoti Aa. Veškeré potomstvo je stejné => uniformní hybridi, fenotypově jsou shodní s dominantním homozygotem. a 3 ) homozygot s heterozygotem: P: Aa x aa G: A a a a F 1 : Aa Aa aa aa heterozygotní rodič => dva typy gamet v poměru 1 : 1 homozygotní rodič => jeden typ gamet jejich splynutím vznikají jedinci shodní genotypově i fenotypově s rodiči v poměru 1 : 1 tj. tzv. štěpný poměr potomci nejsou uniformní Tohoto křížení se využívá k rozlišení heterozygota od dominantního homozygota metoda zpětného křížení B = back. Pokud by jedinec nebyl heterozygot, ale dominantní homozygot, pak potomci viz. křížení a 2. Křížení heterozygota s homozygotem dominantním: P: AA x Aa G: A A A a F 1 : AA AA Aa Aa a 4 ) křížení dvou heterozygotů: P: Aa x Aa G: A a A a F 1 : AA Aa Aa aa Každý z rodičů tvoří dva typy gamet v poměru 1 : 1 => tři kombinace genotypů v určitých štěpných poměrech: genotypový štěpný poměr: AA : 2Aa : aa 1 : 2 : 1=> 25% : 50% : 25% fenotypový štěpný poměr: 3 : 1 75% : 25% heterozygot je fenotypově shodný s dominantním homozygotem Štěpný poměr je poměr statistický, uplatní se jen při dostatečném počtu potomků (sta tisíce jedinců). Je-li potomků málo - štěpný poměr se od ideálních teoretických čísel liší. Všechny štěpné poměry v genetice jsou založeny na zákonech velkých čísel. Mendelův pokus: 5474 žlutých semen : 1850 zeleným semenům tj. 2,958 : 1

6 Monohybridismus s neúplnou dominancí - intermediarita: Platí stejná pravidla jako u úplné dominance genotypové štěpné poměry stejné 1 : 2 : 1 fenotypové štěpné poměry odlišnosti 1 : 2 : 1 P: Aa x Aa G: A a A a F 1 : AA Aa Aa aa (barva květů nocenky) Z uvedených typů křížení vyplývají první dva Mendelovy zákony: I. Mendelův zákon = zákon o uniformitě F 1 generace = zákon o uniformitě hybridů Při křížení dvou rozdílně homozygotních rodičů vznikají vždy genotypově i fenotypově shodní heterozygotní potomci = uniformní hybridi. II. Mendelův zákon = o nestejnorodosti F 2 generace = o čistotě vloh a jejich štěpení Při vzájemném křížení heterozygotů vznikají potomci s genotypovým štěpným poměrem 1:2:1 a fenotypovým štěpným poměrem 3:1 u úplné dominance a u neúplné dominance genotypově i fenotypově v poměru 1:2:1 b) DIHYBRIDISMUS křížení, při němž sledujeme dědičnost dvou genů současně, jedinec = dihybrid Geny leží na dvou různých chromozómech a tedy jsou volně kombinovatelné (pokud jsou sledované geny součástí jednoho chromozómu dědí se společně = vazba vloh). Každý pár alel se chová jako samostatný a řídí se týmiž pravidly jako u monohybridismu. Segregace alel jednoho páru do gamet nezávisí na segregaci alel druhého páru = tj. kombinace alel v gametách => třetí Mendelův zákon III. Mendelův zákon = zákon volné kombinovatelnosti vloh více formulací: - alely se rozcházejí do gamet nezávisle na sobě jsou volně kombinovatelné - dědí se vlohy, ne jejich kombinace - kříží-li se mezi sebou rodiče lišící se více znaky, dědí potomstvo gen ke každému znaku samostatně a nezávisle na vlohách dalších Dihybridismus s úplnou dominancí v obou znacích: (barva a tvar semen hrachu setého) žlutá barva semen A je dominantní nad zelenou barvou a; kulatý tvar semen B dominantní nad svraštělým tvarem b P: AABB x aabb G: AB AB ab ab F 1 : AaBb AaBb G: AB Ab ab ab AB Ab ab ab Dihybrid AaBb tvoří čtyři typy gamet. Jejich kombinace v F 2 generaci kombinační = mendelistický čtverec: G AB Ab ab ab AB AABB AABb AaBB AaBb Ab ab ab

7 v F 2 generaci je 16 dihybridů někteří stejní počet různých genotypů 3 2 = 9 počet různých fenotypů 2 2 = 4 ve štěpném poměru 9 : 3 : 3 : 1 1. znak: dom : dom : rec : rec 2. znak: dom : rec : dom : rec V kombinačním čtverci je úhlopříčka homozygotů a úhlopříčka heterozygotů. Genotypy Aabb a aabb = nové homozygotní kombinace = šlechtitelské novinky - východisko pro vypěstování čistých linií OBECNĚ: při n stupni hybridismu v F 2 bude štěpit 2 n různých fenotypů a 3 n různých genotypů. Dihybridismus s neúplnou dominancí v jednom znaku: (ředkvička tvar a barva kořene) Kulovitý kořen K neúplně dominantní nad mrkvovitým tvarem k, červená barva B úplně dominantní bílou barvou b P: KKBB x kkbb G: KB KB kb kb F 1 : KkBb KkBb G: KB Kb kb kb KB Kb kb kb F 2 : G KB Kb kb kb KB KKBB KKBb KkBB KkBb Kb kb kb F 2 generace bude obsahovat 6 fenotypových projevů s genotypovým štěpným poměrem 3:1:6:2:3:1. I zde je možné najít základní štěpné poměry, budeme-li sledovat znaky odděleně: barva červená : barvě bílé 12 : 4 = 3 : 1 tvar kulatý : řepovitému : mrkvovitému 4 : 8 : 4 = 1 : 2 : 1 Dihybridismus s neúplnou dominancí v obou znacích: (délka klasu a barva klasu pšenice) Dlouhý klas pšenice D a hnědá barva B jsou neúplně dominantní nad krátkým klasem d a žlutou barvou b. P: DDBB x ddbb G: DB DB db db F 1 : DdBb DdBb G: F 2 : G DB Db db db DB DDBB DDBb DdBB DdBb Db db db V F 2 : generaci 16 možných kombinací fenotypově odlišných, 9 typů genotypů ve štěpném poměru 1:2:1:2:4:2:1:2:1

8 Vazba genů - geny v jednom chromozómu se dědí společně = vazbová skupina gen - počet vazbových skupin = počtu chromozómů v buňce - tuto problematiku studoval Thomas Hunt Morgan americký biolog, nositel Nobelovy ceny o hlavní zásluha o poznání této skutečnosti o vysvětlil projevy vazby a formuloval dvě pravidla: 1. geny jsou umístěny v chromozómech na přesných místech v řadě za sebou 2. geny téhož chromozomového páru tvoří společnou vazbovou skupinu. Počet vazbových skupin odpovídá počtu párů homologních chromozómů a nemůže jej převyšovat Uspořádání genů v chromozómu: a) cis - jeden chromozóm homologního páru nese dominantní alely AB, druhý nese recesivní alely ab b) trans - na jednom homologním chromozómu jsou alely Ab, na druhém alely ab Kombinace alel těchto genů je možná jen díky crossing-overu. Podle pravděpodobnosti crossing-overu vazbu genů dělíme: a) vazba úplná o geny ležící vedle sebe a velmi těsně spojené => velká síla vazby o nerekombinují o nemůže zde dojít ke crossing-overu b) vazba neúplná o vyznačuje se silnější nebo slabší vazbou o při meióze dochází ke crossing-overu a části chromozómů se rekombinují => tím se porušuje vazba o platí: čím větší je vzdálenost mezi geny, tím slabší je vazba a tím větší je pravděpodobnost crossig-overu a naopak o úplná vazba je v přírodě vzácností Síla vazby vyjadřuje relativní vzdálenost alel a současně i míru pravděpodobnosti crossingoveru. Morganovo číslo p - vyjadřuje sílu vazby - jednotkou je mapová jednotka = centimorgan cm - síla vazby mezi dvěma lokusy je 1cM, jestliže je 1% pravděpodobnost jejich rekombinace při meióze - cm jsou měřítkem vzdálenosti genů na chromozómu Chromozómová mapa Chromozómové určení pohlaví = dědičnost pohlaví - živočišné druhy s odděleným pohlavím a dvoudomé rostliny mají v každé chromozómové sadě jeden chromozóm, který určuje pohlaví = pohlavní chromozóm = heterochromozóm = gonozóm - značíme: X a Y o Y = allozóm, je malý a někdy i celý chybí - kombinace gonozómů určuje pohlaví: o XX jeden druh pohlaví = homozygot o XY druhý druh pohlaví = heterozygot

9 Typy pohlaví: a) typ savčí = typ Drosophila 1. nejčastější 2. savci, člověk, některé ryby, někteří obojživelníci a plazi, většina hmyzu a většina dvoudomých rostlin samičí pohlaví = XX, homogametické => vajíčka pouze chromozóm X samčí pohlaví = XY, heterogametické => spermie buď s chromozómem X, nebo Y v poměru 1:1 => poměr pohlaví 1:1 P: XX x XY G: X X X Y F 1 : XX XX XY XY 50% 50% b) typ ptačí = Abraxas 1. ptáci, některé ryby, někteří obojživelníci a plazi, motýli, u rostlin ojediněle samičí pohlaví = XY = ZW samčí pohlaví = XX = ZZ c) typ Protenor 1. u některých druhů rovnokřídlého hmyzu a ploštic 2. neexistuje chromozóm Y => systém X0 o X0 = samčí pohlaví d) určení pohlaví podle počtu chromozómů - samičky z oplozených vajíček => diploidní - samečci vznikají partenogenetický a jsou haploidní Tento typ, kde se pohlavní chromozómy nevyskytují je u některých skupin sociálního hmyzu. Přítomnost pohlavních chromozómů = faktor určující pohlaví, ale uplatňují se i genové komplexy samičích = feminních faktorů F a genové komplexy samčích = maskulinních faktorů M, které mohou být uloženy jak v pohlavních chromozómech, tak v autozomech. 2. Gonozomální dědičnost = dědičnost pohlavně vázaná - geny leží na gonozómech => jejich dědičnost závisí na pohlaví jedinců - gonozómy: o ve všech buňkách organizmu o nesou geny pro tvorbu pohlavních znaků i jiné geny o liší se tvarem, strukturou a souborem genů o jsou navzájem homologní (shodují se) jen v malém úseku tzv. homologní část gonozómu heterologní části gonozómu tj. větší část gonozómu, obsahují jiné geny o dědičnost genů v homologních částech se řídí pravidly autozomální dědičnosti o dědičnost genů v heterologních částech je závislá na pohlaví rodičů při sestavě XY chybí druhá párová alela => projev i recesivní alely ve fenotypu - díky existenci dvou typů gonozómů, existují dvě možnosti gonozomální dědičnosti: 1. X chromozómová dědičnost: - dědičnost znaků podmíněných geny v heterologní části chromozómu X (u člověka přes 200 genů) - geny zde uložené jsou geneticky významné

10 - fenotypový projev alel nezávisí jen na jejich dominanci a recesivitě, ale i na pohlaví jejich nositele u jedinců XY se všechny takové alely projeví nezávisle na tom, zda jsou dominantní nebo recesivní u jedinců XX se alely chromozómu X chovají stejně jako alely autozomální, tvoří tři různé genotypové kombinace (XX, Xx, xx) a mezi nimi se uplatňují vztahy dominance, recesivity, příp. intermediarity - další odlišnost X chromozomální dědičnosti od dědičnosti autozomální je při recipročních kříženích o u autozomální dědičnosti nezávisí výsledek křížení na tom, který rodič nese danou formu znaku => výsledek křížení je stejný o u X-chromozomální dědičnosti výsledky recipročních křížení stejné nejsou Př.: barva očí octomilky: - gen je v heterologní části chromozómu X - červená barva dominantní = X, bílá barva recesivní = x a) křížení bělookého samečka s homozygotně červenookou samičkou: P: xy x XX G: x Y X X F 1 : Xx Xx XY XY Všichni potomci jsou červenoocí, samičky jsou všechny heterozygotní. b) reciproční křížení červenookého samečka s bělookou samičkou: P: XY x xx G: X Y x x F 1 : Xx Xx xy xy Všechny samičky červenooké a heterozygotní, všichni samečci běloocí. Jestliže samičky zdědily barvu očí po otci a samečci po matce = dědičnost křížem. c) křížení heterozygotní červenooké samičky s červenookým samečkem: P: Xx x XY G: X x X Y F 1 : XX Xx XY xy V potomstvu všechny samičky červenooké, samečci i běloocí ve štěpném poměru 1 : 1. d) křížení heterozygotní červenooké samičky s bělookým samečkem: P: Xx x xy G: X x x Y F 1 : Xx xx XY xy V potomstvu jsou samečci i samičky červenoocí i běloocí ve štěpném poměru 1:1. Další geny v heterologní části chromozómu X: hemofilie = chorobná nesrážlivost krve, chorobu podmiňuje recesivní alela. Nemocí trpí převážně muži. a) P: XX x xy => F 1 : Xx Xx XY XY Všichni synové zdraví, všechny dcery přenašečky nemoci, která se u nich fenotypově neprojevuje. b) P: xx x XY => F 1 : Xx Xx xy xy Všichni synové jsou nemocní, všechny dcery přenašečky bez fenotypového projevu => dědičnost křížem

11 c) P: Xx x XY => F 1 : XX Xx XY xy Dcery bez projevu nemoci, ale polovina z nich jsou přenašečky, synové polovina zdravá, polovina nemocná d) P: Xx x xy => F 1 : Xx xx XY xy Polovina dcer nemocná, polovina přenašečky, polovina synů zdravá, polovina nemocná barvoslepost daltonismus chybění potních žlázek => znaky se častěji vyskytují u jedinců typu XY než u jedinců typu XX - kur domácí dědičnost žíhaného a černého zbarvení peří 2. Y chromozomová dědičnost: - geny v heterologní části chromozómu Y - geny jsou vcelku nevýznamné a není jich mnoho - geny nemají svou párovou alelu => organizmus je pro ně hemizygotní - projevují se jen u toho pohlaví, které má chromozóm Y - geny jsou vždy dominantní - dědí se z otců na syny (u ptáků z matek na dcery) => holandrické geny (ander = muž) - vykazují přímou dědičnost dědí je po otcích vždy všichni synové př.: u člověka nadměrné ochlupení boltce v Indii, ojediněle v Evropě Dědičnost pohlavně ovlivněná: - geny pro tyto znaky uloženy v autozómech - jejich projev (manifestace) je odlišný v závislosti na pohlaví - jejich projev je vázán na přítomnost pohlavích hormonů - fenotypově se projeví jako AA, Aa, aa jen u jednoho pohlaví, u druhého je fenotyp vždy recesivní bez ohledu na genotypové založení znaku - př.: sekundární pohlavní znaky (vous u mužů, paroží u jelenů apod.) o jsou založeny u obou pohlaví o hormonálními vlivy dochází k jejich projevu pouze u jednoho z obou pohlaví (mezi počtem chlupů na jednotku plochy obličejových partií u mužů a žen není zásadní rozdíl; působením mužských hormonů za nepřítomnosti ženských pohlavních hormonů se u mužů vytvoří vous. Poruchy hormonálního systému znak se může projevit odchylně snížená tvorba vousů u mužů, nadměrná tvorba a zesílení chlupů v některých obličejových partiích u žen (svatá Starosta půvabná žena s úhledným plnovousem legenda?) plešatost o podmíněna alelou P dominantní u mužů a recesivní u žen PP plešatý muž i žena Pp plešatý pouze muž pp nikdo není plešatý Ayshirské plemeno o dva rázy červenostrakaté a s mahagonovými skvrnami, mahagonová barva - dominantní alela M, červené skvrny recesivní alela m MM mahagon. u samce i samice Mm + samčí pohlavní hormon => mahagon Mm samice červenostrakaté

Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat

Více

Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny

Více

Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem

Více

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865

Více

12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat

Více

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků

Více

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto

Více

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák MENDELISMUS Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák 1822-1884 In the ten years G. Mendel worked on his plants in the garden of the monastery, he made the greatest discovery in biology that

Více

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto

Více

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010

Více

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je

Více

GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

GENETIKA A JEJÍ ZÁKLADY

GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

MENDELOVSKÁ DĚDIČNOST

MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp

Více

13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu

Více

GENETIKA V MYSLIVOSTI

GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Tradice šlechtění šlechtění zlepšování pěstitelsky, technologicky a spotřebitelsky významných vlastností

Více

RURGenetika zápočtový program Programování II

RURGenetika zápočtový program Programování II RURGenetika zápočtový program Programování II Rudolf Rosa cvičící: Doc. RNDr. Pavel Töpfer, CSc. Obsah Specifikace...1 Původní specifikace...1 Upravená specifikace...2 Program...3 třída Populace...4 Datové

Více

BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.

Více

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce?

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce? REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince Co bylo dřív? Slepice nebo vejce? Rozmnožování Rozmnožování (reprodukce) může být nepohlavní (vegetativní, asexuální) pohlavní (sexuální;

Více

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické Gonozomáln lní dědičnost Mgr. Aleš RUDA Chromozomové určení pohlaví autozomy gonozomy člověk má 22 párůp autozomů a 1 pár p gonozomů označen ení pohlavních chromozomů: : X a Y. jsou možné celkem 3 kombinace:

Více

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil

Více

GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných

Více

Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus

Více

Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou

Více

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová

Více

Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový

Více

Zvyšování kvality výuky technických oborů

Zvyšování kvality výuky technických oborů Zvyšování kvality výuky technických oborů Klíčová aktivita V.2 Inovace a zkvalitnění výuky směřující k rozvoji odborných kompetencí žáků středních škol Téma V.2.18 Dřeviny Kapitola 2 Rozmnožování rostlin

Více

Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje

Více

Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým

Více

Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem

Více

Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina

Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina Přehled GMH Seminář z biologie GENETIKA Molekulární genetika Základní dogma molekulární biologie Základním nosičem genetické informace je molekula DNA. Tato molekula se může replikovat (kopírovat). Informace

Více

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef

Více

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou

Více

Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):

Více

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním

Více

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu

Více

ŠKOLNÍ VZDĚLÁVACÍ PROGRAM

ŠKOLNÍ VZDĚLÁVACÍ PROGRAM Vyučovací předmět : Období ročník : Učební texty : Přírodopis 3. období 9. ročník Danuše Kvasničková, Ekologický přírodopis pro 9. ročník ZŠ a nižší ročníky víceletých gymnázií, nakl. Fortuna Praha 1998

Více

ŠVP ZŠ Luštěnice, okres Mladá Boleslav verze 2012/2013

ŠVP ZŠ Luštěnice, okres Mladá Boleslav verze 2012/2013 5.6.3 Přírodopis Charakteristika vyučovacího předmětu PŘÍRODOPIS I. Obsahové vymezení Vyučovací předmět Přírodopis vychází z obsahu vzdělávacího oboru Člověk a příroda a je v některých ročnících částečně

Více

Genetika člověka - reprodukce

Genetika člověka - reprodukce Gymnázium Václava Hraběte Školní rok 2015/2016 Genetika člověka - reprodukce Seminární práce z biologie autor práce: Andrea Jirásková; 8.A vedoucí práce: RNDr. Roman Slušný Prohlášení Prohlašuji tímto,

Více

1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D.

GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D. GENETIKA Mendelistická dědičnost 2014 Doc. MVDr. Eva Bártová, Ph.D. Nauka o DĚDIČNOSTI (HEREDITA) a PROMĚNLIVOSTI (VARIABILITA) termín genetika poprvé použil v r. 1905 W. BATESON název genetika odvozen

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém

Více

OLYMPIÁDA MLADÝCH CHOVATELŮ 2015

OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 Genetika a plemenné znaky u králíků Chov králíků, II. Kategorie Johana Vinšová *13. 8. 1997 Žabonosy 113, Kolín 2, 280 02 ZO ČSCH Kolín 1 Práce započata dne: 25. 11. 2014

Více

Velká rodina života. mlha se zvedá

Velká rodina života. mlha se zvedá Úvod Jen málo národů a lidských pospolitostí na Zemi nemá svůj mýtus o stvoření. Američtí Irokézové věřili, že svět a všechno v něm stvořili nebeští lidé, podle starověkých Japonců byl svět výtvorem bohů,

Více

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.cz Mutace Mutace - náhodná změna v genomu organismu - spontánní

Více

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika

Více

PRAKTIKUM Z OBECNÉ GENETIKY

PRAKTIKUM Z OBECNÉ GENETIKY RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie lizal@sci.muni.cz 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin

Více

BARVY BORDER COLLIÍ. Na konci tohoto dokumentu naleznete schéma hlavních barev podle lokusů.

BARVY BORDER COLLIÍ. Na konci tohoto dokumentu naleznete schéma hlavních barev podle lokusů. BARVY BORDER COLLIÍ Barva psí srsti je dána geneticky. Pro všechny border collie (snad až na vzácné výjimky) platí, že ve své genetické výbavě nesou alelu Si, která determinuje irské zbarvení (bílé znaky)

Více

orientuje se v přehledu vývoje organismů a rozliší základní projevy a podmínky života

orientuje se v přehledu vývoje organismů a rozliší základní projevy a podmínky života Přírodopis ZŠ Heřmánek vnímá ztrátu zájmu o přírodopis na úkor pragmatického rozhodování o budoucí profesi. Náš názor je, že přírodopis je nedílnou součástí všeobecného vzdělání, především protože vytváří

Více

Druhová a mezidruhová hybridizace

Druhová a mezidruhová hybridizace Druhová a mezidruhová hybridizace Obsah Druhová a mezidruhová hybridizace... 1 Obsah... 1 Monohybridní křížení... 1 Dihybridní křížení... 2 Polyhybridní křížení... 3 Souhrn Mendelismus v dědičnosti kvalitativních

Více

Genová vazba. Obr. č. 1: Thomas Hunt Morgan

Genová vazba. Obr. č. 1: Thomas Hunt Morgan Genová vazba Jednou ze základních podmínek platnosti Mendelových zákonů je lokalizace genů, které podmiňují různé vlastnosti na různých chromozómech. Toto pravidlo umožňuje volnou kombinovatelnost genů

Více

Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci

Více

Gonosomální dědičnost

Gonosomální dědičnost Gonosomální dědičnost Praktické cvičení č.12 Jaro 2016 Aneta Kohutová aneta.baumeisterova@gmail.com Biologický ústav Lékařská fakulta Masarykova univerzita Kamenice 5, 625 00 Brno Cíle cvičení Student:

Více

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00

Více

Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových

Více

Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého

Více

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické

Více

ŠKOLNÍ VZDĚLÁVACÍ PROGRAM. D. Kvasničková a kol.: Ekologický přírodopis pro 7. ročník ZŠ a nižší ročníky víceletých gymnázií, 1. a 2.

ŠKOLNÍ VZDĚLÁVACÍ PROGRAM. D. Kvasničková a kol.: Ekologický přírodopis pro 7. ročník ZŠ a nižší ročníky víceletých gymnázií, 1. a 2. Vyučovací předmět : Období ročník : Učební texty : Přírodopis 3. období 7. ročník D. Kvasničková a kol.: Ekologický přírodopis pro 7. ročník ZŠ a nižší ročníky víceletých gymnázií, 1. a 2. část Očekávané

Více

Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským

Více

Lze HCM vyléčit? Jak dlouho žije kočka s HCM? Je možné předejít hypertrofické kardiomyopatii?

Lze HCM vyléčit? Jak dlouho žije kočka s HCM? Je možné předejít hypertrofické kardiomyopatii? Nemoci srdce jsou, stejně jako u člověka, vrozené nebo získané v průběhu života. Ze získaných chorob srdce tvoří velkou část kardiomyopatie, což je onemocnění srdečního svalu spojené s jeho dysfunkcí,

Více

genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace

Více

Spermatogeneze saranče stěhovavé (Locusta migratoria)

Spermatogeneze saranče stěhovavé (Locusta migratoria) Spermatogeneze saranče stěhovavé (Locusta migratoria) Vývoj pohlavních buněk u živočichů zahrnuje několik dějů, které zajistí, že dojde k redukci a promíchání genetického materiálu a vzniklé buňky jsou

Více

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením

Více

1. Poloopice obývají a) Jižní Ameriku b) Madagaskar c) Austrálii d) Tasmánii

1. Poloopice obývají a) Jižní Ameriku b) Madagaskar c) Austrálii d) Tasmánii 1. Poloopice obývají a) Jižní Ameriku b) Madagaskar c) Austrálii d) Tasmánii 2. Řád holobřiší je v našich vodách zastoupen a) mníkem jednovousým b) línem obecným c) úhořem říčním d) mihulí potoční 3. Skupina

Více

Rukověť genetiky pro chovatele potkanů

Rukověť genetiky pro chovatele potkanů Rukověť genetiky pro chovatele potkanů Příručka pro chovatele, kteří by se rádi dozvěděli, jak celá ta věc funguje Bc. Markéta Čacká Praha, 2013 Verze určená pro čtečky (optimalizováno na Kindle 3) OBSAH

Více

Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.

Více

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou

Více

Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

11.12.2011 Brno - Lužánky Základy genetiky pro chovatele potkanů

11.12.2011 Brno - Lužánky Základy genetiky pro chovatele potkanů 11.12.2011 Brno - Lužánky Základy genetiky pro chovatele potkanů Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou

Více

ZÁKLADNÍ ŠKOLA ÚPICE-LÁNY PALACKÉHO 793, 542 32 ÚPICE ABSOLVENTSKÁ PRÁCE ŠKOLNÍ ROK 2012-2013 RADIM ČÁP 9.B

ZÁKLADNÍ ŠKOLA ÚPICE-LÁNY PALACKÉHO 793, 542 32 ÚPICE ABSOLVENTSKÁ PRÁCE ŠKOLNÍ ROK 2012-2013 RADIM ČÁP 9.B ZÁKLADNÍ ŠKOLA ÚPICE-LÁNY PALACKÉHO 793, 542 32 ÚPICE ABSOLVENTSKÁ PRÁCE LÁSKA ZVÍŘAT ANEB JAK SE ZVÍŘATA ROZMNOŽUJÍ ŠKOLNÍ ROK 2012-2013 RADIM ČÁP 9.B OBSAH I Úvod II Teoretická část 1 Bezobratlí 1.1

Více

Země živá planeta Vznik Země. Vývoj Země. Organické a anorganické látky. Atmosféra Člověk mění složení atmosféry. Člověk mění podnebí planety

Země živá planeta Vznik Země. Vývoj Země. Organické a anorganické látky. Atmosféra Člověk mění složení atmosféry. Člověk mění podnebí planety Vyučovací předmět Přídopis Týdenní hodinová dotace 2 hodiny Ročník Prima Roční hodinová dotace 72 hodin Výstupy Učivo Průřezová témata, mezipředmětové vztahy Žák porozumí rozdělení nebeských těles ve vesmíru

Více

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika 1/6 3.2.11.18 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost

Více

Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů

Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů Imunogenetika Vědní odvětví zabývající se imunitním systémem obratlovců, který je výrazně odlišuje od nižších organizmů se nazývá imunologie. Její náplní je zejména studium imunity mechanizmů stálosti

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

Přírodopis - 6. ročník Vzdělávací obsah

Přírodopis - 6. ročník Vzdělávací obsah Přírodopis - 6. ročník Časový Téma Učivo Ročníkové výstupy žák podle svých schopností: Poznámka Září Příroda živá a neživá Úvod do předmětu Vysvětlí pojem příroda Příroda, přírodniny Rozliší přírodniny

Více

I. Sekaniny1804 Přírodopis

I. Sekaniny1804 Přírodopis Přírodopis Charakteristika vyučovacího předmětu Obsahové, organizační a časové vymezení Vyučovací předmět Přírodopis je součástí vzdělávací oblasti Člověk a příroda. Vzdělávání v předmětu Přírodopis směřuje

Více

8 Odhad plemenné hodnoty (OPH)

8 Odhad plemenné hodnoty (OPH) Genetika ve šlechtění zvířat TGU 006 část 7. (rough draft version) 8 Odhad plemenné hodnot (OPH) V populaci jedinců je genetická variabilita způsobená jedinci s různými genotp. U kvantitativních vlastností

Více

=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům

=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům Otázka: Genetika Předmět: Biologie Přidal(a): t.klodnerova REALIZACE GENETICKÉ INFORMACE, MUTACE, ZÁKLADNÍ GENETICKÉ POJMY: GEN, ZNAK, ALELA, GENOTYP, FENOTYP, HOMOZYGOT, HETEROZYGOT, HYBRIDIZACE, DOMINANCE,

Více