Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Rozměr: px
Začít zobrazení ze stránky:

Download "Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové"

Transkript

1 Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové

2 Johann Gregor Mendel * Hynčice na Moravě Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením hrachu, v roce 1862 meteorologická pozorování pro Meteorologický ústav ve Vídni Mendelismus základ jeho učení, předběhl svou dobu Vytvořil jej 23 let před objevem termínu chromozom, 22 let před objevem redukčního dělení a 31 let před první zmínkou o chromozomové teorii dědičnosti

3 Základy genetiky (1) Gen = místo, kde je zakotvena genetická informace zakódována přímo na DNA Genotyp = soubor všech genů. Společný dědičný základ jednoho druhu organismu Fenotyp = vnější znaky jednoho organismu Zevní projev genotypu Barva očí, vlasů...

4 Základy genetiky (2) Alela, alelový pár = v diploidních buňkách existuje gen na dvou alelách od otce a od matky. Označují se velkými a malými písmeny Vyvolávají fenotypické rozdíly Existenci prokazuje křížení hybridizace Homozygot na obou chromozomech má stejné alely pro danou vlastnost (barva vlasů) Heterozygot na každém chromozomu je jiná alela

5 Základy genetiky (3) Dominantnost nadřazená alela se projeví zevně Recesivnost podřízená alela se zevně neprojeví, případně dominantní zjemňuje a může se projevit v další generaci Přenos genetické informace: Podmínkou repliky mateřské DNA jsou vždy stejné geny Realizace je složitý děj pomocí RNA a enzymů 1.stupeň přepis do informační RNA (transkripce) 2.stupeň vlastní přenos genetické informace (translace) za účasti r-rna a pomoci t-rna

6 Základy genetiky (4) Projev genetických informací ve fenotypu záleží na vztahu dominance a recesivity alel téhož genového páru Homozygot obě alely stejné (dominantní nebo recesivní) genotyp se ve fenotypu vždy projeví Heterozygot jedna dominantní a jedna recesivní: Úplná dominance vyjádří se jen dominantní alela Neúplná dominance dominantní alelu zjemní recesivní, která se ve fenotypu lehce projeví např: brachydaktilie normální vzrůst prstů je recesivní (a), pro brachydaktilii je dominantní (A) alely aa (homozygot) prsty normální délky; alely Aa (heterozygot) krátké prsty; alely AA těžké poškození plodu s úplným chyběním prstů na DKK, HKK

7 Základy genetiky (5) Kodominance obě alely, recesivní i dominantní se projevují ve fenotypu stejně např. krevní skupina AB Monofaktoriální dědičnost u lidí ojedinělá jeden gen = jeden znak (krevní skupiny, fenylketonurie) Polyfaktoriální dědičnost nejčastější typ. Jeden gen = vznik několika fenotypových znaků Např. Rh faktor přítomnost 3 párů alel C, D, E (c, d, e) Rh+ určuje pouze dominantní alela D Důl. u některých dědičných chorob Marfanův syndrom

8 Dědičnost krevních skupin AB0 (1) 3 druhy alel, kombinují se po 2 a výsledná skupina (fenotyp) je dána vztahem obou alel A a B dominantní (A 1 -A 10 ; B 1 -B 4 - A 1 dominantnější než A 2 ; A 2 než A 3...) 0 recesivní Vztah mezi A a B = vztah kodominance A alely AA nebo A0 B BB nebo B0 AB - AB 0 00

9 Dědičnost krevních skupin AB0 (2) Prostředí na ně nemá vliv, proto nezastupitelná role ve sporech paternity, identifikaci jedince Např: AA AA A0 AA AA AA AA AA AA AA A0 A0 A0 A0 A0 00 AA A0 A0 00 A0 A

10 Dědičnost krevních skupin AB0 (3) Krevní skupina rodičů Krevní skupina dětí A x A A, 0 A x 0 A, 0 A x B A, B, AB, 0 A x AB A, B, AB B x B B, 0 B x 0 B, 0 B x AB A, B, AB AB x AB A, B, AB AB x 0 A, B 0 x 0 0

11 Dědičnost pohlaví Gamety = poloviční počet chromozomů (23) 22 somatických + 1 sex-chromatin (X nebo Y) Všechny oocyty = X chromozom Spermie = polovina s X (tato spermie určuje ženské pohlaví) a polovina s Y XX XY XX XY XX XY

12 Chromozomální aberace (1) = odchylka v počtu nebo tvaru chromozomů Narušují vzájemný vztah alel a harmonické působení genů velký zásah do fenotypu Chromozomální změny vznikají při vytváření pohlavních buněk Druhy chromozomálních aberací: Trizomie = zmnožení 2 chromozomů na 3 např. trizomie 21. chromozomu karyotyp 47, XX nebo 47, XY

13 Chromozomální aberace (2) Monozomie = ztráta jednoho z dvojice chromozomů Delece = ztráta části chromozomu ten se zkrátí Translokace = přemístění celého nebo části chromozomu na jiný chromozom

14 Odchylky počtu pohlavních chromozomů (1) Narušují tělesný vývoj jedince, zejména sexuální vývoj, změny v počtu X jsou spojené s mentálním postižením (MR) je ale mírnější než u aberací autozomů Turnerův syndrom (45, X0) chybí jeden X chromozom. Častý důvod spontánních potratů Nanismus, nápadné kožní řasy po stranách krku, nevývin sekundárních pohl. znaků, chybí pohlavní žlázy, mírná MR

15 Odchylky počtu pohlavních chromozomů (2) Klinefelterův syndrom (47, XXY; 48 XXXY; 48 XXYY; 49 XXXXY) muži, nadpočetný X, častější než Turnerův syndrom Vada vývoje varlat neprodukují spermie ani hormony do 10 let vývoj normální, pak nevytváření sekundárních pohl. znaků, MR Syndrom superfemale (47, XXX) ženy s + X Slabě vyvinuté sekundární pohl. Znaky Mohou mít děti buď normální nebo XXX Syndrom supermale (47, XYY) muži s + Y Vyšší tělesný vzrůst, agresivita, někdy nižší inteligence

16 Odchylky počtu pohlavních chromozomů (3) Turnerův sy

17 Odchylky počtu a struktury autozomů (1) Vždy tělesný defekt + MR čím větší chromozomální postižení, tím větší defekt Vada velkých chromozomů intrauterinní odúmrť plodu Stav těchto nemocných bývá vážný, většinou není možnost reprodukce Trizomie 21 Downův syndrom (47, XX; 47, XY) Translokační forma = nadbytečný chromozom se přemístí k jinému nejčastěji 13., 14., 15 Tato forma je dědičná

18 Odchylky počtu a struktury autozomů (2)

19 Odchylky počtu a struktury autozomů (3) Trizomie 13 Patauův syndrom Mikrocefalus, mozek není rozdělen do hemisfér, mikroftalmie nebo anoftalmie nebo kyklopie (jediné centrální oko), rozštěp rtu a patra, malá mandibula Na dlaních opičí rýha, polydaktylie Kryptorchismus, srdeční vada Přežití cca 2 měsíce, polovina umírá do jednoho měsíce

20 Odchylky počtu a struktury autozomů (4) Trizomie 13. chromozomu

21 Odchylky počtu a struktury autozomů (5) Trizomie 18 Edwardsův syndrom Výskyt stoupá s věkem matky Často intrauterinní odúmrť plodu Nízká porodní váha, porucha růstu, vady srdce, ledvin, CNS, rozštěp rtu, patra, hypotonie Malá hlava, abnormálního tvaru, malá čelist a ústa Sevřené prsty, malíček a ukazovák překrývají ostatní prsty, opičí rýha Přežití cca 2 měsíce, 10% více jak rok

22 Odchylky počtu a struktury autozomů (6) Trizomie 18. chromozomu

23 Odchylky počtu a struktury autozomů (7) Delece krátkých ramének 5. chromozomu (= syndrom kočičího křiku syndrom Cri du chat) Delece celého raménka = těžké postižení Anomálie hrtanu = typický zvuk kočičí mňoukání Mikrocefalie, MR, poruchy motoriky, růstová retardace, vrozené vady srdce

24 Odchylky počtu a struktury autozomů (8)

25 Mutace Náhlá, nevratná změna v počtu a struktuře chromozomů nebo jednotlivých genů Somatická mutace = nádorové bujení Gametické mutace = důležité pro dědičnost přenos z rodičů na potomky Příčin celá řada ionizující záření, léky, chemické látky (mutageny) pesticidy, insekticidy (hubení škůdců)

26 Typy dědičnosti Chromozomální aberace vzniká náhle, způsobí vady a choroby, nepřenáší se na děti Změny genů nejedná se o novou mutaci, přenáší se z generace na generaci, choroby nepostihující reprodukci 1) Autosomální dědičnost dominantní x recesivní 2) Pohlavně vázaná dědičnost x pohlavně ovlivněná

27 Autozomálně dominantní dědičnost Krátkoprstost viz. výše nejsou další tělesné ani duševní poruchy Polydaktilie (víceprstost) Syndaktylie (srůstání prstů) Marfanův syndrom dominantní alela jednoho autozomu Cheilognathopalatoschisis (rozštěp rtu a patra) někdy vyvoláno infekcí, často ale geneticky

28 Autozomálně dominantní dědičnost syndaktylie Marfanův syndrom

29 Autozomálně recesivní dědičnost Projeví se až tehdy, je-li dítě recesivní homozygot Levorukost Vrozená nedoslýchavost a hluchota Surdomutatis (hluchoněmost) MR lehčí případy dědičné, těžší vlivem chromozomálních aberací, poškozením mozku při porodu...

30 Pohlavně vázaná dědičnost Na pohlavních chromozomech jsou I znaky,které neurčují pohlaví Daltonismus (barvoslepost) porucha rozlišení červené a zelené nebo modré a žluté Vázaná na X, recesivní vyskytuje se zejména u mužů Žena může být homozygotní normální, homozygotní barvoslepá, heterozygotní přenašečka Hemofilie A Ichthyosis (šupinatost kůže)

31 Pohlavně ovlivněná dědičnost Některé poruchy autozomů se projevují více u jednoho pohlaví Luxatio coxae congenita (vrozená luxace kyčelního kloubu) Opožděný a neúplný vývoj kyčelního kloubu Častěji dívky

32 Obrázky Cheilognathoschisis - oboustranný jednostranný

33 Zdroje Dylevský, I., Trojan, S. Somatologie I. Praha: Avicenum, s. Holibková, A., Laichman, S. Přehled anatomie člověka. Olomouc: Vydavatelství Univerzity Palackého v Olomouci, s. ISBN Klementa, J. et al Somatologie a antropologie. Praha : SPN, s.

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly

Více

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto

Více

Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou

Více

Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace

Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace Mutace Klasifikace mutací Z hlediska lokalizace mutací v genotypu Genové mutace Chromozomální mutace Genomové mutace Vznik genových mutací Tranzice pyrim. za pyrim. C na T T na C purin za purin A na G

Více

NUMERICKÉ ABERACE ÚBLG 1.LF UK

NUMERICKÉ ABERACE ÚBLG 1.LF UK NUMERICKÉ ABERACE ÚBLG 1.LF UK CHROMOSOMÁLN LNÍ ABERACE NUMERICKÉ ANEUPLOIDIE POLYPLOIDIE MONOSOMIE TRISOMIE TRIPLOIDIE TETRAPLOIDIE STRUKTURÁLN LNÍ MIXOPLOIDIE MOZAICISMUS CHIMÉRISMUS ZÁKLADNÍ SYNDROMY

Více

MUTACE mutageny: typy mutací:

MUTACE mutageny: typy mutací: MUTACE charakteristika: náhodné změny v genotypu organismu oproti normálu jsou poměrně vzácné z hlediska klinické genetiky, jsou to právě mutace, které způsobují genetické choroby nebo nádorové bujení

Více

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

NUMERICKÉ ABERACE ÚBLG 1.LF UK

NUMERICKÉ ABERACE ÚBLG 1.LF UK NUMERICKÉ ABERACE ÚBLG 1.LF UK CHROMOSOMÁLNÍ ABERACE NUMERICKÉ ANEUPLOIDIE POLYPLOIDIE MONOSOMIE TRISOMIE TRIPLOIDIE TETRAPLOIDIE STRUKTURÁLNÍ MIXOPLOIDIE MOZAICISMUS CHIMÉRISMUS ZÁKLADNÍ SYNDROMY ODCHYLKA

Více

Vrozené vývojové vady. David Hepnar

Vrozené vývojové vady. David Hepnar Vrozené vývojové vady David Hepnar Vrozené vývojové vady (VVV) jsou defekty orgánů, ke kterým došlo během prenatálního vývoje plodu a jsou přítomny při narození jedince. Postihují v různém rozsahu okolo

Více

Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků

Více

GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních

Více

BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.

Více

MENDELOVSKÁ DĚDIČNOST

MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp

Více

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika 1/6 3.2.11.18 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost

Více

Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny

Více

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.cz Mutace Mutace - náhodná změna v genomu organismu - spontánní

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.

Více

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010

Více

21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST

21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

Genetické příčiny sterility a infertility v ambulantní gynekologické praxi. Šantavý J., Čapková P., Šantavá A., Kolářová J., Adamová K., Vrtěl R.

Genetické příčiny sterility a infertility v ambulantní gynekologické praxi. Šantavý J., Čapková P., Šantavá A., Kolářová J., Adamová K., Vrtěl R. Genetické příčiny sterility a infertility v ambulantní gynekologické praxi Šantavý J., Čapková P., Šantavá A., Kolářová J., Adamová K., Vrtěl R. Infertilita Definice: Neschopnost otěhotnět v průběhu jednoho

Více

GENETIKA A JEJÍ ZÁKLADY

GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky

Více

Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Mutační změny genotypu

Mutační změny genotypu Mutační změny genotypu - změny genotypu: segregace, kombinace + MUTACE - náhodné změny Mutace - genové - spontánní - chromozómové - indukované (uměle vyvolané) - genomové A) Genové mutace - změna (ztráta)

Více

Dědičnost kvantitativních znaků. Proměnlivost a dědivost. Mutace

Dědičnost kvantitativních znaků. Proměnlivost a dědivost. Mutace Přehled GMH Seminář z biologie Genetika 3 Dědičnost kvantitativních znaků Kvantitativní znaky mají kontinuální proměnlivost a jsou polygenní. Za velikost znaku je většinou zodpovědný systém několika genů

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Typy chromosomů. A telocentrický B akrocentrický C submetacentrický D metacentrický. Člověk nemá typ telocentrický!

Typy chromosomů. A telocentrický B akrocentrický C submetacentrický D metacentrický. Člověk nemá typ telocentrický! Karyologie Typy chromosomů A telocentrický B akrocentrický C submetacentrický D metacentrický Člověk nemá typ telocentrický! Chromosom chromosom telomera jádro centomera telomera buňka histony dvoušroubovice

Více

- karyotyp: 47, XX, +18 nebo 47, XY, +18 = trizomie chromozomu 18 (po Downově syndromu druhou nejčatější trizomii)

- karyotyp: 47, XX, +18 nebo 47, XY, +18 = trizomie chromozomu 18 (po Downově syndromu druhou nejčatější trizomii) Edwardsův syndrom Edwardsův syndrom - karyotyp: 47, XX, +18 nebo 47, XY, +18 = trizomie chromozomu 18 (po Downově syndromu druhou nejčatější trizomii) - Prevalence v populaci: u narozených dětí cca 1:6500-1:8000,

Více

Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského

Více

CHROMOZOMÁLNÍ ABERACE

CHROMOZOMÁLNÍ ABERACE CHROMOZOMÁLNÍ ABERACE Chromosomální aberace numerické (změny v počtu chromosomů) polyploidie - změna v počtu celých chromosomových sad triploidie tetraploidie aneuploidie - změna v počtu jednotlivých chromosomů

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Vrodené vývojové vady srdca. skupina 4

Vrodené vývojové vady srdca. skupina 4 Vrodené vývojové vady srdca skupina 4 -Vrozené srdeční vady (VSV) patří mezi nejčastější vrozené vývojové vady. Obecně tvoří vrozené vady oběhové soustavy více než 40 % všech registrovaných vrozených vad

Více

Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI

Více

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00

Více

Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u

Více

Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým

Více

Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální

Více

Chromozomální aberace nalezené u párů s poruchou reprodukce v letech

Chromozomální aberace nalezené u párů s poruchou reprodukce v letech Chromozomální aberace nalezené u párů s poruchou reprodukce v letech 2000-2005 Jak přistupovat k nálezům minoritních gonozomálních mozaik? Šantavá A., Adamová, K.,Čapková P., Hyjánek J. Ústav lékařské

Více

14. 1. 2013. Popis využití: Výukový materiál s úkoly pro žáky s využitím dataprojektoru,

14. 1. 2013. Popis využití: Výukový materiál s úkoly pro žáky s využitím dataprojektoru, VY_32_INOVACE_PSYPS13260ZAP Výukový materiál v rámci projektu OPVK 1.5 Peníze středním školám Číslo projektu: CZ.1.07/1.5.00/34.0883 Název projektu: Rozvoj vzdělanosti Číslo šablony: III/2 Datum vytvoření:

Více

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika

Více

Incidence hypotrofických novorozenců v ČR

Incidence hypotrofických novorozenců v ČR Incidence hypotrofických novorozenců v ČR Antonín Šípek 1,2, Jitka Rychtaříková 3, Vladimír Gregor 1,4, Antonín Šípek jr. 5, Pavel Langhammer 6 OLG, Fakultní Thomayerova nemocnice, Praha 1 3. Lékařská

Více

12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat

Více

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela

Více

Proč jsme podobní rodičům? A jak k tomu vlastně může dojít?

Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Základy genetiky Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Johann Gregor Mendel (1822 1884) O jeho životě byl mnich, zakladatel genetiky a opat augustiniánského kláštera v Brně studium

Více

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Petr Lesný 1, Pavel Seeman 2, Daniel Groh 1 1 ORL klinika UK 2. LF a FN Motol Subkatedra dětské ORL IPVZ Přednosta doc. MUDr. Zdeněk Kabelka

Více

Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):

Více

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865

Více

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

TERATOGENEZA ONTOGENEZA

TERATOGENEZA ONTOGENEZA TERATOGENEZA ONTOGENEZA Vrozené vývojové vady (VVV) Jsou defekty orgánů, ke kterým došlo během prenatálního vývoje plodu a jsou přítomny při narození jedince. Postihují v různém rozsahu okolo 3-5 % novorozenců.

Více

Příčiny a projevy abnormálního vývoje

Příčiny a projevy abnormálního vývoje Příčiny a projevy abnormálního vývoje Ústav histologie a embryologie 1. LF UK v Praze MUDr. Filip Wagner Předmět: Obecná histologie a obecná embryologie (B02241) 1 Vrozené vývojové vady vývojové poruchy

Více

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické Gonozomáln lní dědičnost Mgr. Aleš RUDA Chromozomové určení pohlaví autozomy gonozomy člověk má 22 párůp autozomů a 1 pár p gonozomů označen ení pohlavních chromozomů: : X a Y. jsou možné celkem 3 kombinace:

Více

Význam genetického vyšetření u pacientů s mentální retardací

Význam genetického vyšetření u pacientů s mentální retardací Význam genetického vyšetření u pacientů s mentální retardací Šantavá, A., Hyjánek, J., Čapková, P., Adamová, K., Vrtěl, R. Ústav lékařské genetiky a fetální medicíny FN a LF UP Olomouc Mentální retardace

Více

Zeptejte se svého lékaře

Zeptejte se svého lékaře Jednoduchý a bezpečný krevní test, který nabízí vysokou citlivost stanovení Neinvazivní test, který vyhodnocuje riziko onemocnění chromozomálního původu, jako je např. Downův syndrom, a nabízí také možnost

Více

Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi

Více

Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem

Více

GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných

Více

Prenatální diagnostika v roce 2008 předběžné výsledky

Prenatální diagnostika v roce 2008 předběžné výsledky Prenatální diagnostika v roce 28 předběžné výsledky V. Gregor 1, A. Šípek 1, 2 1 Oddělení lékařské genetiky, Fakultní Thomayerova nemocnice, Praha 2 3.Lékařská fakulta Univerzity Karlovy, Praha Pracovní

Více

Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje

Více

Genetické aspekty vrozených vad metabolismu

Genetické aspekty vrozených vad metabolismu Genetické aspekty vrozených vad metabolismu Doc. MUDr. Alena Šantavá, CSc. Ústav lékařské genetiky a fetální medicíny FN a LF UP Olomouc Johann Gregor Mendel (1822-1884) Sir Archibald Garrod britský pediatr

Více

Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat

Více

genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace

Více

Rozštěpy rtu a patra Vrozená vývojová vada, kterou dnes již nemusíte (na první pohled) vidět Pohled genetika. Renata Gaillyová, OLG FN Brno

Rozštěpy rtu a patra Vrozená vývojová vada, kterou dnes již nemusíte (na první pohled) vidět Pohled genetika. Renata Gaillyová, OLG FN Brno Rozštěpy rtu a patra Vrozená vývojová vada, kterou dnes již nemusíte (na první pohled) vidět Pohled genetika Renata Gaillyová, OLG FN Brno Lékařská genetika Interdisciplinární spolupráce Preventivní medicína

Více

Praktická cvičení z biologie Letní semestr

Praktická cvičení z biologie Letní semestr Univerzita Palackého v Olomouci Ústav biologie, Lékařská fakulta Praktická cvičení z biologie Letní semestr Olomouc 2014 Podpořeno projektem EU: Implementace laboratorní medicíny do systému vzdělávání

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová

Více

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě Otázka: Genetika I Předmět: Biologie Přidal(a): Paris -věda, která se zabývá dědičností a proměnlivostí -zakladatelem je Johan Gregor Mendel (1822 1884), který se narodil v Hynčicích na Moravě 1. MOLEKULÁRNÍ

Více

Zvláš. áštnosti studia genetiky člověka: nelze z etických důvodd experimenty a selekci. ství potomků. ším m prostřed (sociáln ůže sledovat maximáln

Zvláš. áštnosti studia genetiky člověka: nelze z etických důvodd experimenty a selekci. ství potomků. ším m prostřed (sociáln ůže sledovat maximáln Genetika člověka Zvláš áštnosti studia genetiky člověka: Na člověku nelze z etických důvodd vodů provádět experimenty a selekci. Člověk k mám většinou za život velmi malé množstv ství potomků. Fenotyp

Více

Laboratorní vyšetření v těhotenství- screening vrozených vývojových vad RNDr. I. Klabenešová OKB FN BRNO Metodika screeningu Lékařský screening slouží k vyhledávání osob s významným rizikem výskytu určité

Více

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická

Více

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil

Více

Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u

Více

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol 20.5.2015 Popis klinických příznaků, možnosti léčby Muži: střední až těžká mentální

Více

Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus

Více

Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti

Více

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu Genealogie Monogenní dědičnost rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu onemocnění v rodině Genealogické

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

GENETIKA V MYSLIVOSTI

GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností

Více

Neinvazivní test nejčastějších chromosomálních vad plodu z volné DNA

Neinvazivní test nejčastějších chromosomálních vad plodu z volné DNA PRENATÁLN Í TEST PANORA M A TM Neinvazivní test nejčastějších chromosomálních vad plodu z volné DNA Panorama TM test TM test je vyšetření je vyšetření DNA, DNA, které které Vám Vám poskytne poskytne důležité

Více

CZ.1.07/1.5.00/

CZ.1.07/1.5.00/ Projekt: Příjemce: Digitální učební materiály ve škole, registrační číslo projektu CZ.1.07/1.5.00/34.0527 Střední zdravotnická škola a Vyšší odborná škola zdravotnická, Husova 3, 371 60 České Budějovice

Více

Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár

Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár schopen spontánní koncepce, ale žena není schopna donosit

Více

GENETIKA ČLOVĚKA. Monogenní znaky člověka krevní skupiny autozomální dominance, kodominance levorukost autozomální, recesivní

GENETIKA ČLOVĚKA. Monogenní znaky člověka krevní skupiny autozomální dominance, kodominance levorukost autozomální, recesivní GENETIKA ČLOVĚKA Pro dědičnost člověka platí stejné zákonitosti jako pro ostatní organizmy, odlišné jsou jen metody studia: - nelze provádět experimenty - nelze provádět selekci - dlouhá generační doba

Více