Jihočeská univerzita v Českých Budějovicích Přírodovědecká fakulta

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "Jihočeská univerzita v Českých Budějovicích Přírodovědecká fakulta"


1 Jihočeská univerzita v Českých Budějovicích Přírodovědecká fakulta Diplomová práce Ekologie populací jednoletého poloparazitického druhu Melampyrum pratense Monika Průšová Školitel: Ing. Milan Štech, PhD. Konzultant: RNDr. Jakub Těšitel České Budějovice 2010

2 Diplomová práce v nezkrácené podobě. Průšová M. (2010): Ekologie populací jednoletého poloparazitického druhu Melampyrum pratense. [Population ecology of annual hemiparasitic species Melampyrum pratense, Mgr thesis, in Czech]. p. 47. Faculty of Science, The University of South Bohemia, České Budějovice, Czech Republic. Annotation: The thesis deals with the hemiparasitic species Melampyrum pratense. This species was monitored during the growing season 2009 and the relationship between morphological characteristics and reproductive success of plant individuals was assessed. The relationships between population density, the vegetative biomass and the investments in generative reproduction were investigated. Identity of the host species was determined using the DNA barcoding method. Prohlašuji, že jsem diplomovou práci vypracovala samostatně, pouze s použitím citované literatury. Prohlašuji, že v souladu s 47b zákona č. 111/1998 Sb. v platném znění souhlasím se zveřejněním své diplomové práce, a to v nezkrácené podobě elektronickou cestou ve veřejně přístupné části databáze STAG provozované Jihočeskou univerzitou v Českých Budějovicích na jejích internetových stránkách V Českých Budějovicích Monika Průšová

3 Poděkování Ráda bych poděkovala svému komzultantu Jakubovi Těšitelovi za vedení při této práci, velkou pomoc nejen se statistikou, za ohromný optimizmus a trpělivost. Moc děkuji také svému školiteli Milanovi Štechovi za cenné rady a připomínky, Šárce Svobodové děkuji za zasvěcování do tajů molekulární biologie a velkou pomoc v laboratoři a Janu Š. Lepšovi za cenné rady a připomínky ke statistickému zpracování dat. Také děkuji všem dalším lidem, kteří mi jakkoliv pomohli. V neposlední řadě děkuji svému manželovi Davidovi a mým holčičkám Denisce a Terezce za to, že mě doprovázeli a dělali příjemnou společnost při všech, někdy nekonečných odběrech a počítání listů a strašně moc mě podporovali po všech stránkách po celou dobu studia.

4 Obsah 1 Úvod Metodika Charakteristika pokusných ploch Experiment 1 pokusná plocha Mokré a Třebín Experiment 2 pokusná plocha Mokré Zjišťování identity hostitele Izolace DNA PCR, purifikace a příprava sekvenční směsi Příprava vzorků pro SEM Statistické zpracování dat Výsledky Experiment 1 pokusná plocha Mokré a Třebín Odhad produkce vegetativní biomasy pomocí kalibračního datasetu Průběh růstu rostlin Investice do reprodukce Závislosti ovlivňující investici rostlin do reprodukce Experiment Počet rostlin ve čtverci v průběhu vegetační sezóny Produkce biomasy a morfologické charakteristiky Vztahy mezi hmotností sušiny vegetativní a reprodukční biomasy Zjišťování identity hostitele Diskuze Přežívání a vývoj jedinců druhu Melampyrum pratense v průběhu vegetační sezóny Souvislost mezi morfologickými charakteristikami, produkcí biomasy a investicemi do generativní reprodukce Vliv hustoty populace na přežívání, množství vyprodukované biomasy a investice do generativní reprodukce Vnější faktory ovlivňující studovanou populaci Identita hostitelských druhů Závěr Literatura Fotografická příloha... 44

5 1 ÚVOD Melampyrum pratense (černýš luční) patří mezi poloparazitické rostliny z čeledi Orobanchaceae (zárazovité). V minulosti byl řazen do čeledi Scrophulariaceae (Wolfe et al. 2005, Benett & Matthews 2006). Celý rod Melampyrum zahrnuje kořenové poloparazity, proto podobně jako řada jiných příbuzných taxonů (např. Rhinathus, Euphrasia, Odontites, Pedicularis) vytváří na svých kořenech speciální útvary tzv. haustoria. Haustorii se rostliny napojují na xylém kořene hostitele (dřevní část cévního svazku) a touto cestou se zásobují dostatečným množstvím pro život potřebných minerálních látek a vody (Slavíková 1986, Dalrymple 2007, Irving & Cameron 2009). U řady poloparazitických druhů rostlin však byl také zjištěn přenos organických látek pocházejících od hostitele. (Govier et al. 1967, Press et al 1987, Irving & Cameron 2009, Těšitel et al. 2010). Tyto rostliny jsou však kromě zmíněného parazitizmu také zelené, tudíž mají zachovanou schopnost vlastní asimilace díky své fotosyntetické aktivitě. Listy jsou pro poloparazitické rostliny důležité nejen kvůli fotosyntéze, ale i kvůli transpiraci, která v mnoha případech umožňuje získávání živin od hostitele (Press 1989). Případná defoliace snižuje u poloparazitických rostlin reprodukci a růst (Lehtilä & Syrjänen 1995). Poloparazitické rostliny jsou víceméně závislé na připojení k hostiteli, a připojením na vhodného hostitele rapidně zrychlí svůj růst, jsou vitálnější, větší, s větším počtem listů a začínají i dříve kvést. Naopak rostliny, u kterých k úspěšnému připojení nedošlo, zůstávají menší, vytvářejí málo listů a většinou se nevětví. Často nemají žádné květy a tudíž ani plody (Cantlon et al. 1963, Svensson et al. 2001). Některé poloparazitické druhy, tzv. fakultativní poloparaziti, mezi něž patří i druhy rodu Melampyrum, jsou teoreticky schopné svůj životní cyklus ukončit i bez hostitele, avšak jejich vitalita je vždy snížená a generativní reprodukce velmi omezená (Atsatt & Strong 1970, Irving & Cameron 2009). Soužití poloparazitické rostliny a hostitele je komplikované. Jedná se o kombinaci parasitismu a kompetice o světlo, kdy efekt hostitele na poloparazita nemusí být vždy pouze pozitivní (Atsatt & Strong 1970, Matthies 1995). Parazitické a kompetiční interakce mezi poloparazitem, hostitelem a okolní vegetací mohou nabývat různých intenzit v závislosti na druhové kombinaci hostitel-poloparazit (Cameron et al. 2006, Rümer et al. 2007), podmínkách prostředí (např. množství dostupných živin, Davies & Graves 2000, Cameron et al. 2009), ontogenetickém stadiu rostlin (semenáče vs. dospělé rostliny, Těšitel et al. 2010). Výsledkem těchto interakcí mohou být různé scénáře populační dynamiky poloparazitických rostlin od dominance poloparazita ve společenstvu, po jeho kompetiční vyloučení (Cameron 1

6 et al. 2009). S intenzitou kompetice souvisí i populační hustota hostitelského druhu. Vysoké populační hustoty hostitele dosahované obvykle na úživných stanovištích můžou například zapříčinit vyšší mortalitu semenáčků, na druhou stranu zbylé rostliny, které úspěšně přejdou do další fáze životního cyklu, mohou dosáhnout vyššího reprodukčního úspěchu (van Hulst et al. 1987, Mudrák & Lepš 2010). Předpokládá se, že Melampyrum pratense parazituje širokou škálu bylin, dřevin a keřů, které se vyskytují na stanovišti společně s ním, jako jsou například zástupci rodů Quercus, Betula, Corylus, Pinus, Vaccinium, Erica atd. (Smith 1963, Hartl in Hegi 1974, Štech 2000). V terénu je však velice obtížné přesně určit skutečného hostitele. K tomu je nutná preparace kořenového systému za účelem nalezení napojených haustorií na kořen hostitele a následně se po kořenu dopátrat až k parazitovanému druhu. Přes značnou pracnost a komplikovanost této metody se takto podařilo identifikovat hostitele např. Rhinanthus minor (Gibson & Watkinson 1989). Tato studie však byla založena na odběru kořenového balu a následné preparaci ex situ, V případě M. pratense je tento metodický přístup prakticky neproveditelný vzhledem k tomu, že nejčastěji předpokládanými hostitelskými druhy jsou poměrně velké dřeviny (Smith 1963, Hartl in Hegi 1974, Štech 2000). Vyřešit tento problém by tak mohla metoda DNA barcoding (Jackson et al. 1999, Kress et al. 2005, Taberlet et al. 2007, Valentini et al.2008), tj. identifikace hostitelů pomocí sekvenování DNA kořenů, na něž jsou haustoria napojena, čímž odpadne nutnost sledování hostitelského kořene k nadzemní části rostliny. Využití tohoto přístupu pro identifikaci hostitelů parazitických rostlin však zatím nebylo otestováno v praxi. Melampyrum pratense se přirozeně vyskytuje v poměrně rozsáhlém areálu. Oblast jeho rozšíření se rozprostírá v Evropě kromě její nejjižnější části, v Asii, kde roste hlavně v západní a na střední Sibiři, k východu zasahuje až na Altaj a do oblasti Angary (Meusel et al. 1978). V České republice ho najdeme od planárního až do subalpínského stupně. Roste hojně až velmi hojně v oreofytiku a mezofytiku, v teplejších oblastech je spíše vzácnější (Štech 2000). Biotopy, na kterých se tento druh přirozeně vyskytuje, jsou i jinak velmi různorodé. Můžeme se s ním setkat na suchých i zamokřených stanovištích. Roste v lesích listnatých, jehličnatých i smíšených. Najdeme ho na pasekách, v lemech lesních cest, na ladech, okrajích luk v nižších polohách i na horských až subalpínských loukách. Nevyhýbá se ani vřesovištím a rašeliništím. Upřednostňuje kyselá stanoviště, ale vzácněji ho můžeme najít i na vápencových substrátech (Smith 1963, Eliáš 1986, Štech 2000). 2

7 Podobně jako mnoho jiných poloparazitů je Melampyrum pratense striktně jednoletá rostlina, která se nikdy nerozmnožuje vegetativně (Klimeš & Klimešová CLOPLA), tudíž je úplně závislá na reprodukci semeny. V kombinaci s absencí dlouhověké semenné banky (sec. Heinken 2004) a architekturou rostliny, která znemožňuje regeneraci po jakémkoliv poškození pod úrovní poměrně vysoko položených děložních listů, se jedná o vcelku výjimečnou strategii mezi krytosemennými rostlinami. Populační dynamika M. pratense tak závisí čistě na reprodukční úspěšnosti rostlin měřené produkcí semen. Ta jsou produkována v tobolkách, které jsou uspořádány v úzkém jednostranném hroznu, který je dole řidší a směrem nahoru hustší. Toto plodenství vzniká z polytelického typu květenství, které se vyznačuje tím, že na hlavním stonku i na bočních větvích není ukončený terminálním květem (Slavíková 2002). Květy rozkvétají odspodu a stejně postupuje i dozrávání semen. Doba kvetení je červen až září (Štech 2000). Ačkoliv je tento údaj vztažený primárně k populacím, či souboru populací z ČR, může platit v některých případech i pro délku reprodukční sezóny jednotlivých rostlin. Vzhledem ke své hmotnosti, vypadávají semena ze zralých tobolek pouze do blízkosti mateřské rostliny a na větší vzdálenosti je rozšiřují mravenci (Heinken 2004). V jedné tobolce se nachází 1 až 4 semena. 3

8 Klíčový vliv na hodnoty sezónních znaků a tedy na architekturu celé rostliny má délka vegetační sezóny, která je v našich podmínkách určována především nadmořskou výškou a limituje maximální počet lodyžních článků a s ním spojený pozdní počátek kvetení (Štech 1998, Těšitel 2005). Architektura rostlin M. pratense je však do určité míry ovlivňována i dalšími vlastnostmi stanoviště, jako jsou např. typ substrátu, světelné podmínky, hostitelské rostliny, ale také okolní vegetace (Štech 1996). Výraznou odlišností celkového charakteru sezónní variability druhu Melampyrum pratense je její kompletně retikulátní charakter. Na rozdíl od řady dalších poloparazitických druhů (např. Rhinanthus glacialis, Melampyrum nemorosum, Euphrasia rostkoviana) nejsou sezónní typy u druhu M. pratense příliš vyhraněné a vzájemně oddělené. Souvisí to zřejmě s biotopy, na kterých druh roste, a absencí následných selekčních tlaků typu managementu lučních porostů, které by původní diferenciaci v sezónních znacích zvýraznily a oddělily (Zopfi 1995, 1998, Štech 1998). Vztahy mezi morfologií vegetativních částí rostlin Melampyrum pratense a investicemi do generativní reprodukce, které lze považovat za měřítko reprodukční úspěšnosti, představují klíčové informace pro poznání biologie druhu. Existuje řada prací na druzích rodu Melampyrum, které se zabývají vztahy morfologie rostlin, fenologie a podmínek prostředí. Tyto závislosti jsou často interpetovány hypotézami zahrnující reprodukční úspěšnost rostlin. Zásadní bod takových interpretací, kterým je právě pojítko mezi vegetativní morfologií a reprodukční úspěšností, však dosud takřka nebyl studován. Většina studií se navíc zabývá rozdíly mezi populacemi, vnitropopulační variabilita v morfologii a reprodukční úspěšnosti rostlin je zanedbávána. Není tak vůbec jasné, čím jsou způsobeny rozdíly ve velikostech rostlin pozorované v rámci populace (Štech 1998), zda se například uplatňují podobné faktory, jako jsou ty ovlivňující mezipopulační variabilitu, a jaký mají vliv na celkovou reprodukční úspěšnost. Provádění reprodukčně-ekologických srovnávacích studií komplikuje mj. i délka reprodukční sezóny, kontinuální charakter kvetení a produkce semen, což znemožňuje vyhodnotit reprodukční úspěšnost pomocí jediného pozorování. Tato práce má za cíl vyplnit mezery v poznání vztahů mezi vegetativním růstem a reprodukční úspěšností rostlin a popsat vnitropopulační variabilitu v těchto parametrech včetně identifikace jejích příčin. Prostředkem k dosažení těchto cílů je především detailní sledování dvou populací na úrovni individuí během celé vegetační sezóny. 4

9 Cíle práce Zachytit a popsat přežívání a vývoj jedinců druhu Melampyrum pratense v průběhu vegetační sezóny a tedy celého životního cyklu. Popsat souvislost mezi vegetativními charakteristikami a investicemi do generativní reprodukce na úrovni jednotlivých individuí v rámci populace. Zjistit, jaký je vztah mezi populační hustotou sledované populace, množstvím vyprodukované biomasy a investicemi do generativní reprodukce. Pokusit se identifikovat nejvýznamnější vnější faktory ovlivňující studovanou populaci. Zjistit, zda je možné určit identitu hostitelských druhů ze vzorků kořenů a pokusit se zjistit, zda reprodukční úspěšnost závisí na druhu hostitele. 5

10 2 METODIKA Pro sledování průběhu růstu jedinců sloužil experiment 1. Vybrala jsem si dvě populace druhu Melampyrum pratense na dvou poměrně blízko sebe položených lokalitách. Na těchto jedincích jsem se snažila sledovat průběh jejich růstu, a to od stádia mladých rostlin až po dospělost, která vyvrcholila produkcí semen. Hmotnost jejich biomasy vytvářené v průběhu vegetační sezóny jsem hodnotila pomocí morfologických charakteristik a hmotnosti kalibračních rostlin v jednotlivých odběrech. S růstem rostlin souvisí alokace biomasy nejdříve do vegetativních částí, posléze také do reprodukčních částí rostlin, proto jsem se sledováním těchto morfologických charakteristik také snažila zjistit jejich vzájemný vztah v rámci jednotlivých individuí. K sledování vztahů mezi rostlinami populace sloužil experiment 2, kde jsem se pomocí opakovaných odběrů snažila zjistit, jak souvisí hustota jedinců, množství vyprodukované biomasy a jejich reprodukční úspěšnost Charakteristika pokusných ploch Pokusné plochy, na kterých jsem sledovala populaci druhu Melampyrum pratense, se nachází ZJZ od Českých Budějovic na okrajích lesa mezi obcemi Mokré a Třebín v nadmořské výšce cca 454 m n. m (obr. 2.1). Pokusná plocha u Mokrého se nacházela na východním okraji lesa blíže k obci Mokré (GPS: 48 57'40,0" s. š., '29,1" v. d., systém WGS 84). Druhá pokusná plocha se nacházela blíže k obci Třebín (GPS: 48 57'27,4", s. š., E '21,8" v. d., systém WGS 84). Rostlinné druhy (kromě mechového patra), které se vyskytovaly na studovaných plochách, jsou uvedeny v tabulce (tab. 1). Průměrná teplota v této oblasti v roce 2009 (měřená na meteorologické stanici v Českých Budějovicích) byla 9,5 C a průměrné srážky za rok 2009 byly 829,5 mm (podrobněji viz tab. 2; 6

11 Obr. 2.1 Lokalizace pokusných ploch se studovanými populacemi Melampyrum pratense, M = Mokré (experiment 1 a 2) a T = Třebín (experiment 2) (zdroj: Tab. 1 Seznam druhů vyskytujících se na sledovaných plochách společně s Melampyrum pratense (není zde uvedené mechové patro). Mokré Patro Třebín Patro Picea abies E 3 Quercus robur E 3 Pinus sylvestris E 3 Pinus sylvestris E 3 Quercus robur E 3 Sorbus aucuparia E 2, E 1 Frangula alnus E 2, E 1 Acer platanoides E 1 Anemone nemorosa E 1 Acer pseudoplatanus E 1 Anthoxanthum odoratum E 1 Avenella flexuosa E 1 Avenella flexuosa E 1 Betonica oficinalis E 1 Carex brizoides E 1 Dactylis glomerata E 1 Carex hirta E 1 Festuca ovina E 1 Deschampsia cespitosa E 1 Fragaria vesca E 1 Fragaria vesca E 1 Frangula alnus E 1 Hieracium murorum E 1 Galium boreale E 1 Holcus lanatus E 1 Holcus lanatus E 1 Juncus tenuis E 1 Luzula pilosa E 1 Luzula luzuloides E 1 Poa pratensis E 1 E 1 Ranunculus auricomus E 1 Poa anua E 1 Rubus sp. E 1 Poa nemoralis E 1 Taraxacum sect. Ruderalia E 1 Taraxacum sect. Ruderalia E 1 Tilia cordata E 1 Vaccinium myrtillus E 1 Vaccinium myrtillus E 1 Veronica chamaedrys E 1 Veronica chamaedrys E 1 Viola riviniana E 1 7

12 Tab. 2 Průměrná měsíční teplota a srážky ve vegetační sezóně 2009, tučně jsou vyznačeny měsíce, kdy probíhalo odečítání experimentu. Měsíc III. IV. V. VII. VIII. IX. Průměrná teplota vzduchu ( C) 4,4 12,7 14,3 15,8 19,2 19,2 15,2 Úhrn srážek (mm) 56 24, ,8 128,2 93,2 35, Experiment 1 pokusná plocha Mokré a Třebín Na pokusné ploše Mokré a pokusné ploše Třebín (obr. 2.1) jsem si na jaře 2009 označila 50 mladých rostlin z populace studovaného druhu Melampyrum pratense (štítek s číslem jsem lepila na stonek pod děložní listy). Uskutečnila jsem celkem 5 návštěv v přibližně měsíčních intervalech od dubna do srpna 2009, a to: 23. dubna, 21. května, 26. června, 29. července a 29. srpna. U jednotlivých rostlin jsem při každé návštěvě zaznamenávala morfologické charakteristiky (viz níže). Tyto označené rostliny jsem nesbírala. Sebrala jsem je až při poslední návštěvě 29. srpna. V blízkosti vybraných ploch jsem náhodně sebrala při každé návštěvě 20 rostlin černýše (nadzemní části rostlin), které sloužily jako kalibrační rostliny při statistickém vyhodnocování dat. U těchto rostlin jsem také zaznamenávala shodné morfologické charakteristiky a po usušení v sušárně (24 h při teplotě 80 C) zvážila nadzemní biomasu, kterou jsem napřed rozdělila na biomasu z vegetativních orgánů rostliny a na biomasu z reprodukčních orgánů rostliny. Na rostlinách jsem zaznamenávala tyto morfologické charakteristiky: - počet vegetativních internodií (internodia mezi děložními listy a nejvyšším párem větví) - počet interkalárních internodií (internodia mezi nejvyšším párem větví a nejspodnějšími květy) - počet listů (i počet opadaných listů) na hlavním stonku - počet listů na větvích - počet větví (1. i 2. řádu) alespoň s 1 párem listů - počet vyvinutých květů na hlavním stonku (včetně odkvetlých) - počet vyvinutých květů na větvích (včetně odkvetlých) - počet vyvinutých tobolek na hlavním stonku (včetně vysypaných) - počet vyvinutých tobolek na větvích (včetně vysypaných) - váhu sušiny z vegetativních orgánů (stonky + listy + listeny) 8

13 - váhu sušiny z reprodukčních orgánů (květy + nevysypané tobolky + prázdné vysypané tobolky + odhad váhy vysypaných semen). Váha vysypaných semen byla odhadnuta jako násobek počtu vysypaných tobolek a průměrné váhy semen na 1 tobolku. Tu jsem si stanovila tak, že jsem náhodně odebrala 50 tobolek černýše (ne ze studovaných rostlin) a všechna semena jsem zvážila. Z této váhy jsem pak spočítala průměrnou váhu semen na 1 tobolku. Dále jsem zaznamenávala u rostlin okus zvěří a mortalitu. Za okus jsem považovala ukousnutí hlavního vegetačního vrcholu (někdy doprovázeném i okusem spolu s několika větvemi), na rostlině však musely zůstat alespoň nějaké větve. Při ztrátě všech větví a listů ať už vlivem okusu nebo odumřením v intervalu mezi odběry, jsem tuto skutečnost považovala za mortalitu. Mortalita znamenala také z jiných důvodů zjištěnou nepřítomnost označené rostliny na vybrané ploše. Usychající rostliny (hlavně při posledním odběru) jsem do analýzy zahrnula v případě, že na rostlině bylo patrné ukončení životního cyklu, tj. byly odkvetlé a měly na sobě zralé tobolky, a to vysypané či ještě nevysypané Experiment 2 pokusná plocha Mokré Na jaře 2009 jsem si na jiném místě na vybrané ploše (obr. 2.1) s výskytem studovaného druhu M. pratense vytyčila pomocí měřícího pásma trvalou plochu o rozměrech 8 10 m. Snažila jsem se, aby na vybrané ploše bylo bohaté zastoupení studovaného druhu. Plochu jsem si důkladně označila kovovými zátkami a hřebíky na okrajích kvůli snadnému opakovanému nalezení vytyčené plochy pro další odběry. Na počítači jsem si náhodně vygenerovala souřadnice, podle kterých jsem následně odebírala rostliny z vytyčené plochy. Ze souřadnic jsem vytvořila graf pro kontrolu, jestli se některé souřadnice nepřekrývají, abych se vyhnula opakovanému odběru ze stejné plošky. Pro každý odběr jsem měla vygenerováno i několik náhradních souřadnic pro případ, že by ve čtverci nebyly žádné rostliny. Na odběr rostlin jsem používala odběrový čtverec (dřevěný rámeček o velikosti cm), který jsem umístila na vytyčenou plochu podle předem náhodně vygenerovaných souřadnic. Uskutečnila jsem tedy celkem 5 odběrů v přibližně měsíčních intervalech od dubna do srpna 2009, a to: 23. dubna, 21. května, 26. června, 29. července a 29. srpna. Při každém odběru jsem odebrala rostliny z 10 odběrových čtverců (v případě, že tam nic nerostlo, jsem použila náhradní souřadnice). Sbírala jsem nadzemní část všech rostlin, které jsem v odběrovém čtverci našla. U každé odebrané rostliny jsem zaznamenala morfologické charakteristiky a rostliny jsem uschovala pro sušení a následné vážení biomasy z vegetativních orgánů i 9

14 z reprodukčních orgánů. Nadzemní biomasu jsem v sušárně sušila 24 hodin při teplotě 80 C a následně zvážila na analytických vahách. Na rostlinách jsem zaznamenávala stejné morfologické charakteristiky jako ve výše popsaném experimentu 1 a okus rostlin (charakterizován také v předchozím experimentu) Zjišťování identity hostitele Z populace druhu M. pratense na pokusné ploše Mokré (mimo studované plošky) bylo náhodně vybráno 10 různě velkých rostlin černýše k zjištění identity hostitele a jejich porovnání. Tyto rostliny byly opatrně vykopány i s kořenovým balem o velikosti asi cm. Následně jsem pod binokulární lupou opatrně rozebírala kořenový bal každé odebrané rostliny za účelem nalezení haustorií, kterými jsou rostliny připojeny k svému hostiteli. Z každé rostliny jsem odebrala několik vzorků z různých kořenů hostitele, na které bylo napojené haustorium černýše. Celkem jsem odebrala 48 vzorků z různých kořenů hostitelů, 4 až 6 vzorků z jedné rostliny o velikosti cca 1 2 mm. Odebrané vzorky jsem uchovala v nádobě se silikagelem v mrazícím boxu. Následně jsem vzorky kořenů zpracovala pomocí metody DNA barcoding. Tato metoda slouží k identifikaci živočišných i rostlinných druhů. Pro identifikaci živočichů se využívá krátký úsek genu pro cytochrom C oxidázu I (Hebert et al. 2003). Pro rychlou identifikaci rostlin je však vhodnější použití jaderného ITS regionu DNA, nebo např. trnhpsba regionu chloroplastové DNA. Různí autoři však mají různé názory ohledně vhodného úseku DNA. (Jackson et al. 1999, Kress et al. 2005, Taberlet et al. 2007, Valentini et al. 2008). Identifikace organizmu je založena na srovnání získaných sekvencí se sekvencemi dostupnými v genové bance (GenBank). V této práci jsem použila metodu s využitím ITS regionu DNA. Získané sekvence z DNA kořenů hostitelů jsem srovnávala s databází GenBank pomocí aplikace BLAST (Nucleotide Blast) Izolace DNA Z odebraných vzorků z kořenů jsem následně izolovala DNA pomocí komerčního kitu (Invitek Plant Extraction Kit, Postupovala jsem podle standardního protokolu doporučeného výrobcem, pouze se změnou u finálního vymývání, kdy jsem použila 10

15 místo elučního pufru 50 μl vody, která byla předehřátá na 65 C. Izolovanou DNA jsem uschovala v mrazícím boxu pro další použití PCR, purifikace a příprava sekvenční směsi Z izolované DNA jsem amplifikovala vybrané úseky DNA pomocí tzv. nested PCR (polymerase chain reaction) podle standardního protokolu. To znamená, že jsem nejdříve amplifikovala úsek s templátem z DNA a pokračovala jsem další PCR (nested reakce), kde jako templát sloužil produkt předcházející PCR. Nejdříve jsem provedla 1. PCR se směsí o objemu 25 μl pro každý vzorek. Směs obsahovala 1 μl izolované DNA vzorku, 8,5 μl vody pro PCR, pár primerů (7,5 pmol každý) a 12,5 μl PP Master mix (2 konc.). Použila jsem primery: ITS 1P, který je specifický pro rostliny (5 CTTTATCATTTAGAGGAAGGAAG 3 ; Selosse et al. 2002), a ITS 4 (5 -TCCTCCGCTTATTGATATGC-3 ; White et al. 1990). Amplifikace probíhala v termocycleru BIOER XP CYCLER za podmínek uvedených v tabulce (tab. 3). Produkt 1. PCR jsem následně naředila 1:100 vodou pro PCR (1 μl produktu k 99 μl vody) a provedla jsem další PCR (nested reakce) s namíchanou směsí o objemu 25 μl, která obsahovala 1 μl ředěného produktu 1. PCR, 8,5 μl vody pro PCR, dva primery (po 7,5 pmol) a 12,5 μl PP Master mix (2 konc.).. Pro tuto reakci jsem použila primer ITS 1 (5 TCCGTAGGTGAACCTGCGG -3 ; White et al. 1990) a primer ITS 4 jako u předchozí reakce. Tab. 3 PCR cykly pro úseky ITS (40 cyklů). Teplota ( C) počáteční denaturace cykly denaturace nasedání primerů elongace konečná elongace Výsledek amplifikace jsem testovala elektroforézou na 1,5% agarosových gelech v TBE pufru. Dalším krokem byla purifikace, kterou jsem provedla podle výrobcem doporučeného protokolu. K 5 μl PCR produktu jsem přidala 2 μl ExoSAP (USB Inc., USA). Poté jsem připravila vzorky na sekvenaci. K 1,5 μl amplifikované DNA jsem přidala 6 μl směsi složené z 0,5 μl ITS1/ITS4 primeru a 5,5 μl vody, jakožto základ sekvenační reakce. Vzorky byly 11

16 následně sekvenovány v Sekvenačním centru Jihočeské university na automatickém sekvenátoru ABI PRISM 3130xl firmy Applied Biosystems. Některá neporušená připojení haustoria na kořen hostitele jsem uschovala k následnému pořízení dokumentačních snímků ze skenovacího elektronového mikroskopu (SEM). Vzorky pro SEM jsem fixovala v 2,5% glutaraldehydu v 0,1 M fosfátovém pufru (ph = 7.2) a uskladnila při 4 C. Následně jsem je dehydratovala (nahrazení vody v preparátu organickým rozpouštědlem) řadou roztoků acetonu se zvyšující se koncentrací (od %) a vysušila metodou kritického bodu pomocí dryer CPD 2 (Pelco TM). Vzorky byly posléze pokryty vrstvou zlata ve vakuu pomocí SEM Coating Unit E5100 (Polaron Equipment Ltd.). Morfologické parametry jsem pozorovala na SEMJEOL 6300 vybaveným Sony CCD kamerou Statistické zpracování dat Kalibrace vztahu mezi morfologií rostlin a produkcí vegetativní biomasy jsem provedla pomocí mnohonásobné lineární regrese, v níž vystupovaly morfologické charakteristiky jako prediktory a logaritmovaná hmotnost sušiny biomasy (dekadický logaritmus hmotnosti v miligramech) jako vysvětlovaná proměnná. Při volbě optimálního modelu jsem použila metodu backward selection (tj. postupné odebírání prediktorů z modelu, který zahrnuje všechny testované prediktory) a jako kritérium volby optimálního modelu parametr AIC (Akaike Information Criterion). Některé kalibrační modely proto zahrnují i proměnné, jejichž efekt není statisticky průkazný na hladině významnosti 0,05. Nicméně, vzhledem k tomu, že účelem kalibrace byl pouze co nejpřesnější odhad vegetativní biomasy rostlin z kalibrovaného datasetu, nemělo by být zahrnutí těchto nadbytečných prediktorů na škodu. Koeficienty determinace jednotlivých kalibračních modelů podávají informaci o přesnosti kalibračních rovnic a jejich robustnost byla dále testována krosvalidací regresních modelů. Krosvalidace spočívala v náhodném výběru 75% pozorování z příslušného vzorku, na jehož základě byl sestaven krosvalidační regresní model, kterým bylo následně fitováno zbylých 25% pozorování. Tato procedura byla opakována 500 a při každém opakování se zaznamenávala odchylka mezi fitovanými a pozorovanými hodnotami. Průměrná hodnota odchylek byla následně využita jako míra robustnosti kalibrace. 12

17 Proměnná relativní investice do generativní reprodukce sloužila jako míra reprodukční úspěšnosti jednotlivých rostlin v porovnání s ostatními pozorovanými rostlinami na dané lokalitě. Spočítala jsem jí jako podíl hmotnosti sušiny biomasy reprodukčních orgánů dané rostliny ku průměrné hmotnosti sušiny biomasy reprodukčních orgánů na lokalitě. Výpočet tedy probíhal obdobně jako výpočet relativní fitness v populační biologii (např. Neal 2004). Závislost investice do reprodukce na vegetativních charakteristikách rostlin byla testována pomocí obecného lineárního modelu, v němž jako vysvětlovaná proměnná vystupovala biomasa generativních orgánů (dekadický logaritmus hmotnosti v miligramech). Vztahy mezi jednotlivými vegetativními charakteristikami a investicí do reprodukce byly popsány pomocí marginálních efektů jednotlivých prediktorů. Celkový model popisující závislost byl potom sestaven pomocí forward selection. Prostorové rozmístění rostlin v experimentu 2 jsem hodnotila pomocí porovnávání variance a průměru počtu rostlin na odebraný čtverec spolu s výpočtem Loydova indexu shlukovitosti (Lepš 1996). Tyto výpočty poskytly nejen informaci o rozmístění jedinců, ale pomocí nich bylo možné usuzovat i na vliv a charakter působení vnitrodruhové kompetice v populaci (Lepš 1996, Begon et al. 1997), což dále doplňovaly korelační analýzy produkce biomasy a počtu rostlin odebraných ze čtverce. Pro základní statistické analýzy (deskriptivní statistika, korelace) a sestrojování grafů byl využit program Statistica, verze 9 (StatSoft, 2009). Sestavení kalibračních modelů, jejich krosvalidace a analýza vztahů mezi investicí do reprodukce a vegetativními charakteristikami byly provedeny v programu R, verze (R Core Development Team 2010). 13

18 3 VÝSLEDKY 3. 1 Experiment 1 pokusná plocha Mokré a Třebín Odhad produkce vegetativní biomasy pomocí kalibračního datasetu Odhad produkce vegetativní biomasy jedinců na základě kalibrace (vztahem morfologických charakteristik a hmotnosti sušiny biomasy v kalibračním datasetu) realisticky popsal průběh růstu zkoumaných rostlin (tab. 4). Množství vyprodukované vegetativní biomasy těsně souviselo s počtem listů na počátku vegetační sezóny, v průběhu reprodukční fáze bylo třeba použít pro odhad produkce biomasy několik prediktorů, z nichž největší vliv měl počet větví (tab. 4). Kalibrační model pracoval obzvlášť dobře v červnu a v červenci, kdy se podařilo zachytit značné rozdíly mezi rostlinami a vysvětlit cca 76 85% variability v produkci biomasy. Průměrná odchylka od modelu zjištěná krosvalidací obecného lineárního modelu byla nízká, řádově nižší v porovnání se zjištěnou hmotností sušiny (tab. 4). Věrohodnost popisu růstu rostlin pomocí kalibračního modelu podporuje i shoda v rozdělení produkce biomasy rostlin v kalibračním a kalibrovaném datasetu (obr. 3.1 obr. 3.4). 14


PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER Trojan V., Hanáček P., Havel L. Department of Plant Biology, Faculty of Agronomy, Mendel University of Agriculture and Forestry in Brno, Zemedelska


Uhlík v biomase horské louky sečené, mulčované a ponechané ladem

Uhlík v biomase horské louky sečené, mulčované a ponechané ladem Uhlík v biomase horské louky sečené, mulčované a ponechané ladem Zuzana Mašková Správa NP a CHKO Šumava, Sušice Jan Květ Přírodovědecká fakulta, Jihočeská univerzita v Českých Budějovicích Ústav systémové


Kořenový systém plodin jako adaptační opatření na sucho

Kořenový systém plodin jako adaptační opatření na sucho Sucho a degradace půd v České republice - 2014 Brno 7. 10. 2014 Kořenový systém plodin jako adaptační opatření na sucho Vodní provoz polních plodin Ing. Jana Klimešová Ing. Tomáš Středa, Ph.D. Mendelova


Užití země v České republice v letech 1994 až 2012 Karel Matějka IDS, Na Komořsku 2175/2a, 143 00 Praha 4, Česká republika matejka@infodatasys.

Užití země v České republice v letech 1994 až 2012 Karel Matějka IDS, Na Komořsku 2175/2a, 143 00 Praha 4, Česká republika matejka@infodatasys. Užití země v České republice v letech 1994 až 2012 Karel Matějka IDS, Na Komořsku 2175/2a, 143 00 Praha 4, Česká republika matejka@infodatasys.cz Po roce 19 došlo k výrazné změně hospodářských poměrů v


Využitípoloparazitických rostlin rodu kokrhel (Rhinanthusspp.) k potlačeníkompetičněsilných trav (třtiny křovištnía kostřavy červené)

Využitípoloparazitických rostlin rodu kokrhel (Rhinanthusspp.) k potlačeníkompetičněsilných trav (třtiny křovištnía kostřavy červené) Využitípoloparazitických rostlin rodu kokrhel (Rhinanthusspp.) k potlačeníkompetičněsilných trav (třtiny křovištnía kostřavy červené) Jan Mládek 1,2, Jakub Těšitel 2, Pavla Mládková 3, Stanislav Hejduk


Využití zásoby živin a primární produkce v eutrofních rybnících

Využití zásoby živin a primární produkce v eutrofních rybnících Využití zásoby živin a primární produkce v eutrofních rybnících Libor Pechar a kolektiv Jihočeská Univerzita v Českých Budějovicích Zemědělská fakulta, Laboratoř aplikované ekologie a ENKI o.p.s., Třeboň


You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) Závislost náhodných veličin Úvod Předchozí přednášky: - statistické charakteristiky jednoho výběrového nebo základního souboru - vztahy mezi výběrovým a základním souborem - vztahy statistických charakteristik


Korelační a regresní analýza

Korelační a regresní analýza Korelační a regresní analýza Analýza závislosti v normálním rozdělení Pearsonův (výběrový) korelační koeficient: r = s XY s X s Y, kde s XY = 1 n (x n 1 i=0 i x )(y i y ), s X (s Y ) je výběrová směrodatná


Je-li rostlinné společenstvo tvořeno pouze jedinci jedné populace, mluvíme o monocenóze nebo také o čistém prostoru.

Je-li rostlinné společenstvo tvořeno pouze jedinci jedné populace, mluvíme o monocenóze nebo také o čistém prostoru. EKOLOGIE SPOLEČENSTVA (SYNEKOLOGIE) Rostlinné společenstvo (fytocenózu) můžeme definovat jako soubor jedinců a populací rostlin rostoucích společně na určitém stanovišti, které jsou ovlivňovány svým prostředím,


Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae).

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). Populační studie Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). American Journal of Botany 87(8): 1128



ZMĚNY OBSAHŮ PRVKŮ V POROSTECH SMRKU, BUKU, JEŘÁBU ZMĚY OBSAHŮ PRVKŮ V POROSTECH SMRKU, BUKU, JEŘÁBU A BŘÍZY V PRŮBĚHU ROKU Řešitel: Výzkumný ústav lesního hospodářství a myslivosti, Jíloviště-Strnady Doba řešení: 23 24 Řešitelský kolektiv: Vít Šrámek,


vzorek1 0.0033390 0.0047277 0.0062653 0.0077811 0.0090141... vzorek 30 0.0056775 0.0058778 0.0066916 0.0076192 0.0087291

vzorek1 0.0033390 0.0047277 0.0062653 0.0077811 0.0090141... vzorek 30 0.0056775 0.0058778 0.0066916 0.0076192 0.0087291 Vzorová úloha 4.16 Postup vícerozměrné kalibrace Postup vícerozměrné kalibrace ukážeme na úloze C4.10 Vícerozměrný kalibrační model kvality bezolovnatého benzinu. Dle následujících kroků na základě naměřených


Úbytek stratosférického ozónu a pozorované abiotické poškození rostlin u nás

Úbytek stratosférického ozónu a pozorované abiotické poškození rostlin u nás Úbytek stratosférického ozónu a pozorované abiotické poškození rostlin u nás Libuše Májková, Státní rostlinolékařská správa Opava Tomáš Litschmann, soudní znalec v oboru meteorologie a klimatologie, Moravský


5 Potratovost. Tab. 5.1 Potraty, 2003 2013

5 Potratovost. Tab. 5.1 Potraty, 2003 2013 5 Potratovost V roce bylo hlášeno 10 37,7 tisíce potratů, z toho 13,7 tisíce samovolných potratů a 22,7 tisíce umělých přerušení těhotenství (UPT). Celkový počet potratů se dlouhodobě snižuje, přitom klesá


Pravděpodobnost v závislosti na proměnné x je zde modelován pomocí logistického modelu. exp x. x x x. log 1

Pravděpodobnost v závislosti na proměnné x je zde modelován pomocí logistického modelu. exp x. x x x. log 1 Logistická regrese Menu: QCExpert Regrese Logistická Modul Logistická regrese umožňuje analýzu dat, kdy odezva je binární, nebo frekvenční veličina vyjádřená hodnotami 0 nebo 1, případně poměry v intervalu


Tomáš Karel LS 2012/2013

Tomáš Karel LS 2012/2013 Tomáš Karel LS 2012/2013 Doplňkový materiál ke cvičení z předmětu 4ST201. Na případné faktické chyby v této presentaci mě prosím upozorněte. Děkuji. Tyto slidy berte pouze jako doplňkový materiál není



4ST201 STATISTIKA CVIČENÍ Č. 10 4ST201 STATISTIKA CVIČENÍ Č. 10 regresní analýza - vícenásobná lineární regrese korelační analýza Př. 10.1 Máte zadaný výstup regresní analýzy závislosti závisle proměnné Y na nezávisle proměnné X. Doplňte


Zpráva o testu dřevin na pozemku ve Stachách na Šumavě

Zpráva o testu dřevin na pozemku ve Stachách na Šumavě Ústřední kontrolní a zkušební ústav zemědělský Oddělení půdy a lesnictví Zpráva o testu dřevin na pozemku ve Stachách na Šumavě Průběžná zpráva Zpracoval: Ing. Dušan Reininger, Ph.D Dr.Ing. Přemysl Fiala


31. 3. 2014, Brno Hanuš Vavrčík Základy statistiky ve vědě

31. 3. 2014, Brno Hanuš Vavrčík Základy statistiky ve vědě 31. 3. 2014, Brno Hanuš Vavrčík Základy statistiky ve vědě Motto Statistika nuda je, má však cenné údaje. strana 3 Statistické charakteristiky Charakteristiky polohy jsou kolem ní seskupeny ostatní hodnoty


Tomáš Karel LS 2012/2013

Tomáš Karel LS 2012/2013 Tomáš Karel LS 2012/2013 Doplňkový materiál ke cvičení z předmětu 4ST201. Na případné faktické chyby v této presentaci mě prosím upozorněte. Děkuji. Tyto slidy berte pouze jako doplňkový materiál není


4 Porodnost a plodnost

4 Porodnost a plodnost 4 Porodnost a plodnost Od roku 2009 se počet živě narozených v ČR snižuje. V roce 2013 se živě narodilo 106,8 tisíce dětí. Poprvé v historii se na území Česka narodila paterčata. Podíl dětí narozených


LINEÁRNÍ REGRESE. Lineární regresní model

LINEÁRNÍ REGRESE. Lineární regresní model LINEÁRNÍ REGRESE Chemometrie I, David MILDE Lineární regresní model 1 Typy závislosti 2 proměnných FUNKČNÍ VZTAH: 2 závisle proměnné: určité hodnotě x odpovídá jediná hodnota y. KORELACE: 2 náhodné (nezávislé)


Zpráva o testu dřevin na pozemku ve Stachách na Šumavě

Zpráva o testu dřevin na pozemku ve Stachách na Šumavě Ústřední kontrolní a zkušební ústav zemědělský Oddělení bezpečnosti půdy a lesnictví Zpráva o testu dřevin na pozemku ve Stachách na Šumavě Průběžná zpráva Zpracoval : Dr.Ing. Přemysl Fiala Ing. Dušan



DOUTNÁČ - MONITORING LOKALITY PONECHANÉ SAMOVOLNÉMU VÝVOJI DOUTNÁČ - MONITORING LOKALITY PONECHANÉ SAMOVOLNÉMU VÝVOJI David Janik *, Dušan Adam, Pavel Unar, Tomáš Vrška, Libor Hort, Pavel Šamonil, Kamil Král Oddělení ekologie lesa, Výzkumný ústav Silva Taroucy


ANALÝZA: Nesezdaná soužití v ČR podle výsledků SLDB

ANALÝZA: Nesezdaná soužití v ČR podle výsledků SLDB ANALÝZA: Nesezdaná soužití v ČR podle výsledků SLDB Informace o nesezdaném soužití (Český statistický úřad používá k označení vztahu druha a družky pojem faktické manželství) byly zjišťovány ve Sčítáních


Nejnebezpečnější invazní druhy naší flóry

Nejnebezpečnější invazní druhy naší flóry Nejnebezpečnější invazní druhy naší flóry Invaze a její důsledky invazní (zavlečené, nepůvodní, introdukované) rostliny nejsou na daném území původní (domácí) a byly do něho člověkem úmyslně nebo neúmyslně


6. Lineární regresní modely

6. Lineární regresní modely 6. Lineární regresní modely 6.1 Jednoduchá regrese a validace 6.2 Testy hypotéz v lineární regresi 6.3 Kritika dat v regresním tripletu 6.4 Multikolinearita a polynomy 6.5 Kritika modelu v regresním tripletu


Ilustrační příklad odhadu LRM v SW Gretl

Ilustrační příklad odhadu LRM v SW Gretl Ilustrační příklad odhadu LRM v SW Gretl Podkladové údaje Korelační matice Odhad lineárního regresního modelu (LRM) Verifikace modelu PEF ČZU Praha Určeno pro posluchače předmětu Ekonometrie Needitovaná


Analýza provozu obecní výtopny na biomasu v Hostětíně v období 2002 2004

Analýza provozu obecní výtopny na biomasu v Hostětíně v období 2002 2004 Analýza provozu obecní výtopny na biomasu v Hostětíně v období 22 24 Tato zpráva obsahuje analýzu provozu obecní výtopny na biomasu v Hostětíně v období 22 24, která byla uvedena do provozu v roce 2 a


Zhodnocení vlivu rozsahu zatravnění orné půdy na koncentrace dusičnanů ve vybraných povodích horní Vltavy a Želivky

Zhodnocení vlivu rozsahu zatravnění orné půdy na koncentrace dusičnanů ve vybraných povodích horní Vltavy a Želivky Zhodnocení vlivu rozsahu zatravnění orné půdy na koncentrace dusičnanů ve vybraných povodích horní Vltavy a Želivky Tomáš Kvítek 1,2, Pavel Žlábek 2, Václav Bystřický 2, Petr Fučík 1, Jana Moravcová 2,


Primární produkce. Vazba sluneční energie v porostech Fotosyntéza Respirace

Primární produkce. Vazba sluneční energie v porostech Fotosyntéza Respirace Primární produkce Vazba sluneční energie v porostech Fotosyntéza Respirace Nadzemní orgány procesy fotosyntetické Podzemní orgány funkce akumulátoru (z energetického hlediska) Nadzemní orgány mechanická


Testování Nano-Gro na pšenici ozimé Polsko 2007/2008 (registrační testy IUNG, Pulawy) 1. Metodika

Testování Nano-Gro na pšenici ozimé Polsko 2007/2008 (registrační testy IUNG, Pulawy) 1. Metodika Testování Nano-Gro na pšenici ozimé Polsko 2007/2008 (registrační testy IUNG, Pulawy) Růstový stimulátor Nano-Gro, nanotechnologie vyrobená a dovezená z USA, prošla v letech 2007/2008 mnoho chemickými,


Kompetice a mortalita

Kompetice a mortalita Kompetice a mortalita Nauka o růstu lesa Michal Kneifl Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/28.0018 Úvod vnitrodruhové a mezidruhové


6. Lineární regresní modely

6. Lineární regresní modely 6. Lineární regresní modely 6.1 Jednoduchá regrese a validace 6.2 Testy hypotéz v lineární regresi 6.3 Kritika dat v regresním tripletu 6.4 Multikolinearita a polynomy 6.5 Kritika modelu v regresním tripletu


Hlavní geologické procesy miniprojekt VALOVA SKÁLA

Hlavní geologické procesy miniprojekt VALOVA SKÁLA Hlavní geologické procesy miniprojekt VALOVA SKÁLA Zpracovali: žáci Základní školy Vsetín, Luh 1544 13.11.2013 Obsah 1. Úvod... 2 2. Cíl miniprojektu... 2 2.1. Orientace v terénu... 2 2.2. Dokumentační






MĚŘENÍ STATISTICKÝCH ZÁVISLOSTÍ MĚŘENÍ STATISTICKÝCH ZÁVISLOSTÍ v praxi u jednoho prvku souboru se často zkoumá více veličin, které mohou na sobě různě záviset jednorozměrný výběrový soubor VSS X vícerozměrným výběrovým souborem VSS


Pravděpodobnost a matematická statistika Doc. RNDr. Gejza Dohnal, CSc. dohnal@nipax.cz

Pravděpodobnost a matematická statistika Doc. RNDr. Gejza Dohnal, CSc. dohnal@nipax.cz Pravděpodobnost a matematická statistika Doc. RNDr. Gejza Dohnal, CSc. dohnal@nipax.cz Pravděpodobnost a matematická statistika Doc. RNDr. Gejza Dohnal, CSc. dohnal@nipax.cz Pravděpodobnost a matematická





Dřeviny ČR Smrčiny a subalpinské křoviny

Dřeviny ČR Smrčiny a subalpinské křoviny Dřeviny ČR Smrčiny a subalpinské křoviny Pozn.: Do smrčin a subalpinských křovin v přírodě zasahují i dřeviny nižších poloh, uvedené v dalších souborech. V tomto souboru jsou uvedeny dřeviny, které ve


Inferenční statistika - úvod. z-skóry normální rozdělení pravděpodobnost rozdělení výběrových průměrů

Inferenční statistika - úvod. z-skóry normální rozdělení pravděpodobnost rozdělení výběrových průměrů Inferenční statistika - úvod z-skóry normální rozdělení pravděpodobnost rozdělení výběrových průměrů Pravděpodobnost postupy induktivní statistiky vycházejí z teorie pravděpodobnosti pravděpodobnost, že


Statistická analýza dat podzemních vod. Statistical analysis of ground water data. Vladimír Sosna 1

Statistická analýza dat podzemních vod. Statistical analysis of ground water data. Vladimír Sosna 1 Statistická analýza dat podzemních vod. Statistical analysis of ground water data. Vladimír Sosna 1 1 ČHMÚ, OPZV, Na Šabatce 17, 143 06 Praha 4 - Komořany sosna@chmi.cz, tel. 377 256 617 Abstrakt: Referát



3/8.4 PRAKTICKÉ APLIKACE PŘI POUŽÍVÁNÍ NEJISTOT PROKAZOVÁNÍ SHODY VÝROBKŮ část 3, díl 8, kapitola 4, str. 1 3/8.4 PRAKTICKÉ APLIKACE PŘI POUŽÍVÁNÍ NEJISTOT Vyjadřování standardní kombinované nejistoty výsledku zkoušky Výsledek zkoušky se vyjadřuje v


Měření závislosti statistických dat

Měření závislosti statistických dat 5.1 Měření závislosti statistických dat Každý pořádný astronom je schopen vám předpovědět, kde se bude nacházet daná hvězda půl hodiny před půlnocí. Ne každý je však téhož schopen předpovědět v případě





Vysoká škola báňská technická univerzita Ostrava. Fakulta elektrotechniky a informatiky

Vysoká škola báňská technická univerzita Ostrava. Fakulta elektrotechniky a informatiky Vysoká škola báňská technická univerzita Ostrava Fakulta elektrotechniky a informatiky Bankovní účty (semestrální projekt statistika) Tomáš Hejret (hej124) 18.5.2013 Úvod Cílem tohoto projektu, zadaného


CVIČENÍ 3: VODNÍ PROVOZ (POKRAČOVÁNÍ), MINERÁLNÍ VÝŽIVA. Pokus č. 1: Stanovení celkové a kutikulární transpirace listů analýzou transpirační křivky

CVIČENÍ 3: VODNÍ PROVOZ (POKRAČOVÁNÍ), MINERÁLNÍ VÝŽIVA. Pokus č. 1: Stanovení celkové a kutikulární transpirace listů analýzou transpirační křivky CVIČENÍ 3: VODNÍ PROVOZ (POKRAČOVÁNÍ), MINERÁLNÍ VÝŽIVA Pokus č. 1: Stanovení celkové a kutikulární transpirace listů analýzou transpirační křivky Analýza transpiračních křivek, založená na vážení odříznutých


Monitoring aluviálních ekosystémů

Monitoring aluviálních ekosystémů Monitoring aluviálních ekosystémů součást projektu VaV 610/4/01 Zpráva pro AOPK ČR DAPHNE ČR - Institut aplikované ekologie zpracoval: Bc. Záboj Hrázský České Budějovice 2004 Tato práce je součástí projektu


Příloha P.1 Mapa větrných oblastí

Příloha P.1 Mapa větrných oblastí Příloha P.1 Mapa větrných oblastí P.1.1 Úvod Podle metodiky Eurokódů se velikost zatížení větrem odvozuje z výchozí hodnoty základní rychlosti větru, definované jako střední rychlost větru v intervalu


Ing. Radovan Nečas Mgr. Miroslav Hroza

Ing. Radovan Nečas Mgr. Miroslav Hroza Výzkumný ústav stavebních hmot, a.s. Hněvkovského, č.p. 30, or. 65, 617 00 BRNO zapsaná v OR u krajského soudu v Brně, oddíl B, vložka 3470 Aktivační energie rozkladu vápenců a její souvislost s ostatními



DESIGN HALOGENOVÝCH VÝBOJEK DESIGN HALOGENOVÝCH VÝBOJEK (Vliv koroze elektrod na světelný tok a barevnou teplotu u halogenových výbojek) Karel Chobot VŠB TU Ostrava Fakulta metalurgie a materiálového inženýrsví Abstrakt V článku


Statistické metody v ekonomii. Ing. Michael Rost, Ph.D.

Statistické metody v ekonomii. Ing. Michael Rost, Ph.D. Statistické metody v ekonomii Ing. Michael Rost, Ph.D. Jihočeská univerzita v Českých Budějovicích Test χ 2 v kontingenční tabulce typu 2 2 Jde vlastně o speciální případ χ 2 testu pro čtyřpolní tabulku.


Úloha 1. Napište matici pro případ lineárního regresního spline vyjádřeného přes useknuté

Úloha 1. Napište matici pro případ lineárního regresního spline vyjádřeného přes useknuté Úloha 1. Napište matici pro případ lineárního regresního spline vyjádřeného přes useknuté polynomy pro případ dvou uzlových bodů ξ 1 = 1 a ξ 2 = 4. Experimentální body jsou x = [0.2 0.4 0.6 1.5 2.0 3.0


Pozn. přeskakuji zde popisnou statistiku, jinak by měla být součástí každé analýzy.

Pozn. přeskakuji zde popisnou statistiku, jinak by měla být součástí každé analýzy. Pozn. přeskakuji zde popisnou statistiku, jinak by měla být součástí každé analýzy. Z pastí na daném území byla odhadnuta abundance několika druhů: myšice lesní 250, myšice křovinná 200, hraboš polní 150,


1. Určete závislost povrchového napětí σ na objemové koncentraci c roztoku etylalkoholu ve vodě odtrhávací metodou.

1. Určete závislost povrchového napětí σ na objemové koncentraci c roztoku etylalkoholu ve vodě odtrhávací metodou. 1 Pracovní úkoly 1. Určete závislost povrchového napětí σ na objemové koncentraci c roztoku etylalkoholu ve vodě odtrhávací metodou. 2. Sestrojte graf této závislosti. 2 Teoretický úvod 2.1 Povrchové napětí


Vyšší odborná škola a Střední škola Varnsdorf, příspěvková organizace. Šablona 09 VY 32 INOVACE 0115 0309

Vyšší odborná škola a Střední škola Varnsdorf, příspěvková organizace. Šablona 09 VY 32 INOVACE 0115 0309 Vyšší odborná škola a Střední škola Varnsdorf, příspěvková organizace Šablona 09 VY 32 INOVACE 0115 0309 VÝUKOVÝ MATERIÁL Identifikační údaje školy Číslo projektu Název projektu Číslo a název šablony Autor


Profilování vzorků heroinu s využitím vícerozměrné statistické analýzy

Profilování vzorků heroinu s využitím vícerozměrné statistické analýzy Profilování vzorků heroinu s využitím vícerozměrné statistické analýzy Autor práce : RNDr. Ivo Beroun,CSc. Vedoucí práce: prof. RNDr. Milan Meloun, DrSc. PROFILOVÁNÍ Profilování = klasifikace a rozlišování


Výběrové šetření o zdravotním stavu české populace (HIS CR 2002) Fyzická aktivita (VIII. díl)

Výběrové šetření o zdravotním stavu české populace (HIS CR 2002) Fyzická aktivita (VIII. díl) Aktuální informace Ústavu zdravotnických informací a statistiky České republiky Praha 12. 12. 2002 60 Výběrové šetření o zdravotním stavu české populace (HIS CR 2002) Fyzická aktivita (VIII. díl) Tato


Význam meteorologických měření v systému integrovaného pěstování ovoce

Význam meteorologických měření v systému integrovaného pěstování ovoce Význam meteorologických měření v systému integrovaného pěstování ovoce Tomáš Litschmann Dne 29. března 2005 nabylo účinnosti nařízení vlády č.119/2005 Sb., které ve svém 14a ukládá pěstitelům žádajícím



O MOŽNOSTI ADJUSTACE IMISNÍCH KONCENTRACÍ NA METEOROLOGICKÉ PODMÍNKY. RNDr. Josef Keder, CSc. O MOŽNOSTI ADJUSTACE IMISNÍCH KONCENTRACÍ NA METEOROLOGICKÉ PODMÍNKY RNDr. Josef Keder, CSc. Zadání úlohy V souladu s požadavkem zadavatele (MŽP) bude zpracována metodika, umožňující oprostit průměrné


WWW.METEOVIKYROVICE. WWW.METEOVIKYROVICE.WBS.CZ KLIMATICKÁ STUDIE. Měsíc květen v obci Vikýřovice v letech 2006-2009. Ondřej Nezval 3.6.

WWW.METEOVIKYROVICE. WWW.METEOVIKYROVICE.WBS.CZ KLIMATICKÁ STUDIE. Měsíc květen v obci Vikýřovice v letech 2006-2009. Ondřej Nezval 3.6. WWW.METEOVIKYROVICE. WWW.METEOVIKYROVICE.WBS.CZ KLIMATICKÁ STUDIE Měsíc květen v obci Vikýřovice v letech 2006-2009 Ondřej Nezval 3.6.2009 Studie porovnává jednotlivé zaznamenané měsíce květen v letech


Nezaměstnanost absolventů škol se středním a vyšším odborným vzděláním 2015. Mgr. Martin Úlovec

Nezaměstnanost absolventů škol se středním a vyšším odborným vzděláním 2015. Mgr. Martin Úlovec Nezaměstnanost absolventů škol se středním a vyšším odborným vzděláním 2015 Mgr. Martin Úlovec Praha 2015 1 OBSAH 1. Úvodní poznámky... 3 2. Nezaměstnanost absolventů škol a hospodářská krize... 4 3. Počty


Statistika. Regresní a korelační analýza Úvod do problému. Roman Biskup

Statistika. Regresní a korelační analýza Úvod do problému. Roman Biskup Statistika Regresní a korelační analýza Úvod do problému Roman Biskup Jihočeská univerzita v Českých Budějovicích Ekonomická fakulta (Zemědělská fakulta) Katedra aplikované matematiky a informatiky 2008/2009


veličin, deskriptivní statistika Ing. Michael Rost, Ph.D.

veličin, deskriptivní statistika Ing. Michael Rost, Ph.D. Vybraná rozdělení spojitých náhodných veličin, deskriptivní statistika Ing. Michael Rost, Ph.D. Třídění Základním zpracováním dat je jejich třídění. Jde o uspořádání získaných dat, kde volba třídícího


Univerzita Hradec Králové Přírodovědecká fakulta katedra biologie

Univerzita Hradec Králové Přírodovědecká fakulta katedra biologie Univerzita Hradec Králové Přírodovědecká fakulta katedra biologie Populační ekologie, stanovištní nároky a generativní reprodukce kriticky ohrožených druhů cévnatých rostlin ČR (Adenophora liliifolia,


2. Úroveň bydlení, náklady na bydlení a ceny nemovitostí v Královéhradeckém kraji

2. Úroveň bydlení, náklady na bydlení a ceny nemovitostí v Královéhradeckém kraji 2. Úroveň bydlení, náklady na bydlení a ceny nemovitostí v Královéhradeckém kraji 2.1. Charakteristika domovního a bytového fondu a úrovně bydlení Ucelené informace o domovním a bytovém fondu poskytuje


ENVItech Bohemia s.r.o. Vyhodnocení kvality ovzduší v Otrokovicích v roce 2015

ENVItech Bohemia s.r.o. Vyhodnocení kvality ovzduší v Otrokovicích v roce 2015 ENVItech Bohemia s.r.o. Vyhodnocení kvality ovzduší v Otrokovicích v roce 215 215 Obsah 1 Úvod... 2 2 Imisní limity... 3 3 Vyhodnocení kvality ovzduší v Otrokovicích... 4 3.1 Suspendované částice PM 1,





Lapací zařízení vznikla přeměnou jednoho orgánu rostliny. Jde o orgánu).

Lapací zařízení vznikla přeměnou jednoho orgánu rostliny. Jde o orgánu). Ekologie rostlin praktické cvičení Materiál: stonek hluchavky, lodyha prustky, stonek rozchodníku, list rozchodníku, list divizny, list puškvorce, jehlice borovice, list břečťanu Pomůcky: mikroskop, lupa,


Kalibrace a limity její přesnosti

Kalibrace a limity její přesnosti Univerzita Pardubice Fakulta chemicko technologická Katedra analytické chemie Licenční studium chemometrie Statistické zpracování dat Kalibrace a limity její přesnosti Zdravotní ústav se sídlem v Ostravě


EKONOMETRIE 7. přednáška Fáze ekonometrické analýzy

EKONOMETRIE 7. přednáška Fáze ekonometrické analýzy EKONOMETRIE 7. přednáška Fáze ekonometrické analýzy Ekonometrická analýza proces, skládající se z následujících fází: a) specifikace b) kvantifikace c) verifikace d) aplikace Postupné zpřesňování jednotlivých


Výskyt škůdců máku v letech 2003-2007 na provozních porostech máku na severní, střední a jižní Moravě a některé zásady ochrany proti nim

Výskyt škůdců máku v letech 2003-2007 na provozních porostech máku na severní, střední a jižní Moravě a některé zásady ochrany proti nim Výskyt škůdců máku v letech 2003-2007 na provozních porostech máku na severní, střední a jižní Moravě a některé zásady ochrany proti nim Jiří Havel, Jiří Rotrekl V letech 2003 až 2007 jsme hodnotili výskyt


Zpráva Dopady kombinovaného použití Lignohumátu a sulfuron-metylu na plevelné rostliny a jarní ječmen

Zpráva Dopady kombinovaného použití Lignohumátu a sulfuron-metylu na plevelné rostliny a jarní ječmen Zpráva Dopady kombinovaného použití Lignohumátu a sulfuron-metylu na plevelné rostliny a jarní ječmen Autor a zpravodaj: postgraduální student Státní zemědělské univerzity v Petrohradu, S.S. Skrenževsky


6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního


Základní škola Na Líše 936/16, Praha 4, Michle Dendrologický průzkum území. Táborská 350/32, Praha 4. Praha 4, k.ú. Michle

Základní škola Na Líše 936/16, Praha 4, Michle Dendrologický průzkum území. Táborská 350/32, Praha 4. Praha 4, k.ú. Michle Ing. MARCELA BITTNEROVÁ, Ph.D. Zahradní a krajinářská tvorba marcela.bittnerova@seznam.cz Veltruská 532/11 190 00 Praha 9 Základní škola Na Líše 936/16, Praha 4, Michle Dendrologický průzkum území INVESTOR


Vyhodnocení cenového vývoje drahých kovů na světových burzách v období let 2005 2010

Vyhodnocení cenového vývoje drahých kovů na světových burzách v období let 2005 2010 Vyhodnocení cenového vývoje drahých kovů na světových burzách v období let 2005 2010 Martin Maršík, Jitka Papáčková Vysoká škola technická a ekonomická Abstrakt V předloženém článku autoři rozebírají vývoj


Der Einfluss von Überkonzentrationen bodennahen Ozons auf die Gesundheit der Waldbaumarten im Osterzgebirge sowie Möglichkeiten der Vorhersage.

Der Einfluss von Überkonzentrationen bodennahen Ozons auf die Gesundheit der Waldbaumarten im Osterzgebirge sowie Möglichkeiten der Vorhersage. Vliv nadlimitních koncentrací přízemního ozónu na zdravotní stav asimilačního aparátu lesních dřevin ve východním Krušnohoří a možnosti jeho prognózování. Der Einfluss von Überkonzentrationen bodennahen



DYNAMIKA PROMĚNLIVOSTI KONVERZNÍHO FAKTORU ZA TYPICKÝCH DNŮ DYNAMIKA PROMĚNLIVOSTI KONVERZNÍHO FAKTORU ZA TYPICKÝCH DNŮ Marcela Mašková, Jaroslav Rožnovský Ústav krajinné ekologie, Vysoká škola zemědělská Brno ÚVOD Základem existence a produkční aktivity rostlin


Popis metod CLIDATA-GIS. Martin Stříž

Popis metod CLIDATA-GIS. Martin Stříž Popis metod CLIDATA-GIS Martin Stříž Říjen 2008 Obsah 1CLIDATA-SIMPLE...3 2CLIDATA-DEM...3 2.1Metodika výpočtu...3 2.1.1Výpočet regresních koeficientů...3 2.1.2 nalezených koeficientu...5 2.1.3Výpočet


Intervalový odhad. Interval spolehlivosti = intervalový odhad nějakého parametru s danou pravděpodobností = konfidenční interval pro daný parametr

Intervalový odhad. Interval spolehlivosti = intervalový odhad nějakého parametru s danou pravděpodobností = konfidenční interval pro daný parametr StatSoft Intervalový odhad Dnes se budeme zabývat neodmyslitelnou součástí statistiky a to intervaly v nejrůznějších podobách. Toto téma je také úzce spojeno s tématem testování hypotéz, a tedy plynule


Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží



TECHNIKA UMĚLÝCH PROMĚNNÝCH V PRŮŘEZOVÉ ANALÝZE A V MODELECH ČASOVÝCH ŘAD TECHNIKA UMĚLÝCH PROMĚNNÝCH V PRŮŘEZOVÉ ANALÝZE A V MODELECH ČASOVÝCH ŘAD Umělé (dummy) proměnné se používají, pokud chceme do modelu zahrnout proměnné, které mají kvalitativní či diskrétní charakter,


Úvodem Dříve les než stromy 3 Operace s maticemi

Úvodem Dříve les než stromy 3 Operace s maticemi Obsah 1 Úvodem 13 2 Dříve les než stromy 17 2.1 Nejednoznačnost terminologie 17 2.2 Volba metody analýzy dat 23 2.3 Přehled vybraných vícerozměrných metod 25 2.3.1 Metoda hlavních komponent 26 2.3.2 Faktorová


Bolševník velkolepý mýty a fakta o ekologii invazního druhu

Bolševník velkolepý mýty a fakta o ekologii invazního druhu Bolševník velkolepý mýty a fakta o ekologii invazního druhu Irena Perglová, Jan Pergl, Petr Pyšek, Lenka Moravcová Autoři věnují honorář Nadaci Živa Bolševník velkolepý (Heracleum mantegazzianum) je pravděpodobně





Mgr. Jan Mládek, Ph.D. (2013)

Mgr. Jan Mládek, Ph.D. (2013) Ekologie zdrojů: interakce půdy, vegetace a herbivorů (EKO/EZI) Mgr. Jan Mládek, Ph.D. (2013) 5. blok 11/04/2013 Rozvoj a inovace výuky ekologických oborů formou komplementárního propojení studijních programů


Podtéma: Stromy. Název práce: Javory x-krát jinak. Členové Přírodovědného kroužku Klubu NATURA při Gymnáziu ve Dvoře Králové nad Labem

Podtéma: Stromy. Název práce: Javory x-krát jinak. Členové Přírodovědného kroužku Klubu NATURA při Gymnáziu ve Dvoře Králové nad Labem GYMNÁZIUM DVŮR KRÁLOVÉ NAD LABEM Odborná práce Přírodovědného kroužku Klubu NATURA při Gymnáziu ve Dvoře Králové nad Labem Člověk a příroda versus Příroda a člověk Podtéma: Stromy Název práce: Javory x-krát


Tomáš Karel LS 2012/2013

Tomáš Karel LS 2012/2013 Tomáš Karel LS 2012/2013 Doplňkový materiál ke cvičení z předmětu 4ST201. Na případné faktické chb v této presentaci mě prosím upozorněte. Děkuji. Tto slid berte pouze jako doplňkový materiál není v nich


10. Předpovídání - aplikace regresní úlohy

10. Předpovídání - aplikace regresní úlohy 10. Předpovídání - aplikace regresní úlohy Regresní úloha (analýza) je označení pro statistickou metodu, pomocí nichž odhadujeme hodnotu náhodné veličiny (tzv. závislé proměnné, cílové proměnné, regresandu


Hodina 50 Strana 1/14. Gymnázium Budějovická. Hodnocení akcií

Hodina 50 Strana 1/14. Gymnázium Budějovická. Hodnocení akcií Hodina 50 Strana /4 Gymnázium Budějovická Volitelný předmět Ekonomie - jednoletý BLOK ČÍSLO 8 Hodnocení akcií Předpokládaný počet : 9 hodin Použitá literatura : František Egermayer, Jan Kožíšek Statistická


3.3 Data použitá v analýze

3.3 Data použitá v analýze ALCHYMIE NEPOJISTNÝCH SOCIÁLNÍCH DÁVEK 3.3 Data použitá v analýze V kapitole se vychází zejména z mikrodat statistického šetření SILC, které je dnes jednotně využíváno ve všech zemích EU k měření sociální


Leština doškolovací kurz Vzorkování železničního svršku II. Petr Kohout, Zdeněk Veverka, Pavel Bernáth

Leština doškolovací kurz Vzorkování železničního svršku II. Petr Kohout, Zdeněk Veverka, Pavel Bernáth Leština doškolovací kurz Vzorkování železničního svršku II Petr Kohout, Zdeněk Veverka, Pavel Bernáth 23. červen 2010 Leština doškolovací seminář Vzorkování železničního svršku II Naformátováno: Podtržení



ENERGIE A DOPRAVA V EU-25 VÝHLED DO ROKU 2030 ENERGIE A DOPRAVA V EU-25 VÝHLED DO ROKU 2030 ČÁST IV Evropská energetika a doprava - Trendy do roku 2030 4.1. Demografický a ekonomický výhled Zasedání Evropské rady v Kodani v prosinci 2002 uzavřelo


Agentura ochrany přírody a krajiny České republiky Správa CHKO Broumovsko. Plán péče. o přírodní památku Šafránová stráň. na období 2009 2018

Agentura ochrany přírody a krajiny České republiky Správa CHKO Broumovsko. Plán péče. o přírodní památku Šafránová stráň. na období 2009 2018 Agentura ochrany přírody a krajiny České republiky Správa CHKO Broumovsko Plán péče o přírodní památku Šafránová stráň na období 2009 2018 Obsah: 1. ZÁKLADNÍ IDENTIFIKAČNÍ A POPISNÉ ÚDAJE O ZCHÚ - PŘÍRODNÍ


Porovnání dvou výběrů

Porovnání dvou výběrů Porovnání dvou výběrů Menu: QCExpert Porovnání dvou výběrů Tento modul je určen pro podrobnou analýzu dvou datových souborů (výběrů). Modul poskytuje dva postupy analýzy: porovnání dvou nezávislých výběrů


Krajina a její dimenze. krajinná heterogenita, koncept měřítka (scale), hierarchická struktura krajinných komponent

Krajina a její dimenze. krajinná heterogenita, koncept měřítka (scale), hierarchická struktura krajinných komponent Krajina a její dimenze krajinná heterogenita, koncept měřítka (scale), hierarchická struktura krajinných komponent 29 Krajinná heterogenita Heterogenita je vlastnost, kterou se označuje skutečnost, že


Využití faktorového plánování v oblasti chemických specialit

Využití faktorového plánování v oblasti chemických specialit LABORATOŘ OBORU I T Využití faktorového plánování v oblasti chemických specialit Vedoucí práce: Ing. Eliška Vyskočilová, Ph.D. Umístění práce: FO7 1 ÚVOD Faktorové plánování je optimalizační metoda, hojně


Zpracování průzkumu návštěvnosti na komunikacích Krásná - Lysá hora a Trojanovice - Pustevny

Zpracování průzkumu návštěvnosti na komunikacích Krásná - Lysá hora a Trojanovice - Pustevny Zpracování průzkumu návštěvnosti na komunikacích Krásná - Lysá hora a Trojanovice - Pustevny Zpráva pro veřejnost za rok 212 Zpracovali: Bc. Eva Jirásková, Mgr. David Zahradník, RNDr. Marek Banaš, Ph.D.


Ekologie tropických lesů a jejich obyvatel

Ekologie tropických lesů a jejich obyvatel Ekologie tropických lesů a jejich obyvatel Vojtěch Novotný Biologické centrum AV ČR a Přírodovědecká fakulta Jihočeské univerzity Ekologický problém č. 1: Jaký je mechanismus koexistence tisíců druhů
