Vícefunkční chemické a biochemické mikrosystémy Strana 1. Mikrofluidní bioaplikace

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Vícefunkční chemické a biochemické mikrosystémy Strana 1. Mikrofluidní bioaplikace"

Transkript

1 Vícefunkční chemické a biochemické mikrosystémy Strana 1 Mikrofluidní bioaplikace

2 Vícefunkční chemické a biochemické mikrosystémy Strana 2 Mikrofluidní aplikace pro bioanalýzu Transport, dávkování, promíchávání a adresování vzorků, pufrů a dalších elektrolytů. Homogenní a heterogenní biologické interakce typu ligand-receptor. Separace biologických molekul. Detekce a kvantifikace biologických složek. Zařízení integrující některé nebo všechny předešlé kroky.

3 Vícefunkční chemické a biochemické mikrosystémy Strana 3 Typická zařízení pro mikrofluidní bioaplikace Kapilární/mikrokanálkové elektroforetické a isoelektrické fokusační systémy. Dielektroforetické a elektroosmotické třídiče a koncentrátory. Mikrokanálkové struktury pro řízený elektrokinetický transport vzorků. Mikrofluidní čipy pro proteinovou analýzu s různým stupněm integrace. Vysoce integrované mikrofluidní čipy pro analýzu DNA/RNA. Mikrofluidní PCR systémy. Kontinuálně pracující biosenzory. Průtokové cytometry

4 Vícefunkční chemické a biochemické mikrosystémy Strana 4 PCR polymerázová řetězová reakce Metoda používaná ke zmnožení molekuly DNA ze vzorku Ke zmnožení je dostačující jedna kopie DNA molekuly, z toho plyne citlivost metody na kontaminaci vzorku biologickým materiálem Metoda je založena na řízeném střídání teplotních cyklů, kdy dochází ke zmnožování DNA rychlostí 2 n, kde n je počet teplotních cyklů Cykly se skládají z následujících kroků denaturace dvojšroubovice DNA při C hybridizace primeru na specifické místo ssdna 62 C syntéza komplementárního řetězce termofilní DNA polymerázou C Řízení teplotního režimu je klíčovým problémem PCR metody V mikrofluidice je kvalitní řízení teplotního režimu umožněno vysokým poměrem teplosměnné plochy vůči reakčnímu objemu Aplikace: selektivní výběr DNA, zesílení a kvantifikace, diagnostika nemocí

5 Vícefunkční chemické a biochemické mikrosystémy Strana 5 Mikrofluidní čip pro dynamickou PCR V dynamickém uspořádání protéká roztok obsahující vzorek DNA, primery, báze a DNA polymerázu opakovaně různými teplotními zónami. Amplifikace molekul DNA (cca 30 cyklů) trvá obvykle kolem 30 minut. Transport reakční směsi je obvykle proveden elektroosmoticky.

6 Vícefunkční chemické a biochemické mikrosystémy Strana 6 Dynamická PCR v zařízení se segmentovaným tokem V každé červené kapce probíhá amplifikace DNA. Jednotlivé kapky jsou odděleny olejovou fází. Kapky proudí v mikrokanálech v různých teplotních zónách dochází k amplifikaci. Jedná se o kontinuální sériové uspořádání PCR. IMM Mainz.

7 Vícefunkční chemické a biochemické mikrosystémy Přednáška #12 Strana 7 Digital PCR - Quantification (0, 1) https://www.thermofisher.com/cz/en/home/life-science/pcr/digital-pcr.html - Real time PCR - (1) non-specific fluorescent dyes that intercalate with any double-stranded DNA, and (2) sequence-specific DNA probes consisting of oligonucleotides that are labelled with a fluorescent reporter which permits detection only after hybridization of the probe with its complementary sequence

8 Vícefunkční chemické a biochemické mikrosystémy Strana 8 Mikrofluidní čip pro stacionární PCR Ve stacionárním uspořádání je vzorek a ostatní komponenty umístěn v mikrofluidní komoře. Pomocí topných tělísek je měněna okolní teplota v požadovaných cyklech. Běžně je dosahováno rychlosti změn teploty okolo 30 C s -1. Toto uspořádání je typické pro klasické PCR systémy, kde je ovšem dosahováno mnohem pomalejších změn teploty. Mikrofluidní čipy jsou náchylnější na kontaminaci DNA kvůli vysoké vzájemné afinitě používaných konstrukčních materiálů a biologických molekul.

9 Vícefunkční chemické a biochemické mikrosystémy Strana 9 Příklady komerčních PCR čipů Stacionární PCR Dynamická PCR Tradiční PCR

10 Vícefunkční chemické a biochemické mikrosystémy Strana 10 Elektroforéza Separační metoda založená na různé pohyblivosti iontů ve vloženém elektrickém poli. Obvykle jsou separovány velké molekuly biologického původu fragmenty DNA, proteiny atd. K separaci dochází, pokud molekuly nesou odlišný efektivní elektrický náboj nebo se liší jejich molekulové hmotnosti. Nárůst molekulové hmotnosti koreluje s poklesem difúzního koeficientu složky. Separace je obvykle prováděna na stacionárním médiu (vrstvě gelu) nebo v mikrokapiláře/mikrokanálku s axiálně vloženým stejnosměrným elektrickým napětím Molekuly s odlišnou pohyblivostí se rozdělí do separovaných zón. Velikost a poloha zón vypovídají o kvantitativním a kvalitativním složení separované směsi. K elektroforetickému systému je připojen detektor.

11 Vícefunkční chemické a biochemické mikrosystémy Strana 11 Princip kapilární elektroforézy v mikrofluidních systémech Odpadní rezervoár W Rezervoár mobilní fáze - pufru Směr toku separovaných částic Odpadní rezervoár B Separační kanál Detektor W S Dávkování vzorku Rezervoár vzorku Zdroj stejnosměrného elektrického napětí

12 Vícefunkční chemické a biochemické mikrosystémy Strana 12 Využití elektroforézy elektroforetické kapilární pole Radiální matice separačních kanálků 96 kanálové mikrozařízení určené pro elektroforetickou separaci molekul DNA. Zařízení je opatřeno fluorescenčním detektorem. Separační kanál má průměr 200 mm. Kanálky dávkovacích zařízení mají šíři 110 mm a hloubku 50 mm. Délka separačních kanálů je 33 mm. Dávkovací zařízení

13 Vícefunkční chemické a biochemické mikrosystémy Strana 13 Využití elektroforézy automatizované 96-kapilárové zařízení pro separaci DNA 96 jamkové destička se vzorky DNA Separační kapiláry Zdroj vysokého napětí Fluorescenční detektor

14 Vícefunkční chemické a biochemické mikrosystémy Přednáška #12 Strana 14 Lidský genom obsahuje cca 3 bilióny bází - přibližně genů - Human genome project: completed in 2003 (trval 13 let, stál okolo - $2,7 bilionů - náročný) - Nyní orientace na zlepšení forenzních technik a ke zlepšení lidských podmínek (predikce zdravotních rizik, personalized medicine, jak gen ovlivňuje kódovaný protein a jeho funkčnost) NIH (National Institute of Health) = cena sekvenování jednoho genomu okolo 1000USD Místo, kde může mikrofluidika významě pomoci

15 Vícefunkční chemické a biochemické mikrosystémy Přednáška #12 Strana 15 Sekvenování DNA: Sangerova metoda

16 Vícefunkční chemické a biochemické mikrosystémy Strana kanálová kapilární zařízení pro sekvenování DNA Zařízení slouží k detekci různě velkých fragmentů DNA vzniklých syntézou komplementárního řetězce DNA při sekvenování. Každá báze je označena specifickou značkou (jednou ze čtyř), jejíž přítomnost je možno detekovat pomocí laserem indukované fluorescence. Z pořadí detekovaných zón a barvy lze určit sekvenci bazí.

17 Vícefunkční chemické a biochemické mikrosystémy Strana 17 Příklad komerčních sekvenovacích zařízení s integrovanou kapilární elektroforézou MegaBACE 4000 Capillary Array (jedno pole obsahuje 64 kapilár). Přístroj lze dále rozšířit.

18 Vícefunkční chemické a biochemické mikrosystémy Strana 18 Využití elektroforézy příprava koncentrovaného analytu Polopropustná vrstva DF Schéma koncentrátoru Zvýšení koncentrace vzorku Přivedení vzorku DF Odvedení koncentrátu na separaci

19 Vícefunkční chemické a biochemické mikrosystémy Přednáška #12 Strana 19 Next generation sequencing technology Prepare Genomic DNA Sample Attach DNA to the surface Bridge amplication Fragments become double stranded Denature the doublestranded molecules Complete amplification Determine first base Image first base Determine second base Image second base

20 Vícefunkční chemické a biochemické mikrosystémy Přednáška #12 Strana 20 Sequencing over multiple chemistries Align data

21 Vícefunkční chemické a biochemické mikrosystémy Strana 21 Isoelektrická fokusace Separační metoda využívající odlišnosti hodnoty isoelektrického bodu různých biomolekul. Isoelektrický bod odpovídá hodnotě ph, kdy daná molekula nese celkově nulový elektrický náboj. Pokud je hodnota ph nižší, biomolekula získává celkově kladný elektrický náboj. Pro hodnoty ph vyšší je náboj biomolekuly celkově záporný. Fokusační metoda je založena na faktu, že biologická molekula migruje v elektrickém poli pouze tehdy, pokud je její celkový elektrický náboj nenulový. Jestliže je molekula transportována do oblasti, kde hodnota ph je rovna isoelektrickému bodu, její migrace se zastaví. V tomto místě může být poté detekována. Obvykle je používáno sériové uspořádání (viz dále). Mikrofluidní systémy umožňují také paralelní uspořádání.

22 Vícefunkční chemické a biochemické mikrosystémy Strana 22 Isoelektrická fokusace Klasické sériové uspořádání s imobilizovaným gradientem ph V klasickém uspořádání je vytvořen sendvič skládající se z gelových komůrek oddělených membránami. V každé komůrce je pomocí pufru nastavena určitá hodnota ph. Komůrky jsou řazeny v sérii tak, aby hodnota ph monotónně klesala nebo rostla. Na systém je vloženo elektrické pole a do některé komory je vložen vzorek obsahující biologické molekuly. Ty se poté migrují do komor, kde je hodnota ph blízká jejich isoelektrickému bodu.

23 Vícefunkční chemické a biochemické mikrosystémy Strana 23 Paralelní uspořádání komor s různou hodnotou ph Isoelektrická fokusace V paralelním uspořádání jsou komůrky s rozdílně nastavenými hodnotami ph odděleny nepropustnou přepážkou. V mikrofluidice je možno vytvořit velké pole komůrek s velmi malým charakteristickým rozměrem. Kolmo k tomuto komůrkovému poli je vložen gradient elektrického potenciálu a vzorek obsahující biologické molekuly je umístěn nad a/nebo pod komorami. Biomolekuly jsou poté separovány podle svého isoelektrického bodu v odpovídajících komůrkách. Uvedené řešení výrazně urychluje fokusaci vzhledem ke krátkým transportním vzdálenostem v laterálním směru. Je možno také využít automatických detektorů.

24 Vícefunkční chemické a biochemické mikrosystémy Přednáška #12 Strana 24 SDS-PAGE Western blot Nterminus antibody T Sch

Vícefunkční chemické a biochemické mikrosystémy Strana 1. Mikrofluidní bioaplikace

Vícefunkční chemické a biochemické mikrosystémy Strana 1. Mikrofluidní bioaplikace Vícefunkční chemické a biochemické mikrosystémy Strana 1 Mikrofluidní bioaplikace Vícefunkční chemické a biochemické mikrosystémy Strana 2 Mikrofluidní aplikace pro bioanalýzu Transport, dávkování, promíchávání

Více

Microfluidic systems, advantages and applications Monika Kremplová, Mgr.

Microfluidic systems, advantages and applications Monika Kremplová, Mgr. Název: Školitel: Microfluidic systems, advantages and applications Monika Kremplová, Mgr. Datum: 21. 6. 2013 Reg.č.projektu: CZ.1.07/2.3.00/20.0148 Název projektu: Mezinárodní spolupráce v oblasti "in

Více

Pokročilé biofyzikální metody v experimentální biologii

Pokročilé biofyzikální metody v experimentální biologii Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 1/1 Proč biofyzikální metody? Biofyzikální metody využívají fyzikální principy ke studiu biologických systémů Poskytují kvantitativní

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY ELEKTROFORÉZA K čemu to je? kritérium čistoty preparátu stanovení molekulové hmotnosti makromolekul stanovení izoelektrického

Více

Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace

Více

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

APLIKOVANÉ ELEKTROMIGRAČNÍ METODY

APLIKOVANÉ ELEKTROMIGRAČNÍ METODY APLIKOVANÉ ELEKTROMIGRAČNÍ METODY Princip: migrace elektricky nabitých částic v elektrickém poli Druhy iontů: +, -, obojaký (zwitterion), vícenásobný Typy migrace: a) přímá migrují ionty analytů b) nepřímá

Více

Princip DNA čipu- schéma

Princip DNA čipu- schéma DNA čipy Zařízení pro detekci specifické sekvence bází v molekule DNA nebo RNA DNA čip je tvořen maticí detekčních míst (microarray) Detekční místa jsou obvykle tvořena gelem s imobilizovaným receptorem

Více

Hmotnostní spektrometrie

Hmotnostní spektrometrie Hmotnostní spektrometrie Princip: 1. Ze vzorku jsou tvořeny ionty na úrovni molekul, nebo jejich zlomků (fragmentů), nebo až volných atomů dodáváním energie, např. uvolnění atomů ze vzorku nebo přímo rozštěpení

Více

Laboratorní analytické metody. Petr Tůma

Laboratorní analytické metody. Petr Tůma Laboratorní analytické metody Petr Tůma Rozdělení analytických metod Metody separační Chromatografie kapalinová plynová Elektroforéza Metody spektrální absorpční spektrometrie v UV/VIS Metody elektrochemické

Více

Vizualizace DNA ETHIDIUM BROMID. fluorescenční barva interkalační činidlo. do gelu do pufru barvení po elfu SYBR GREEN

Vizualizace DNA ETHIDIUM BROMID. fluorescenční barva interkalační činidlo. do gelu do pufru barvení po elfu SYBR GREEN ETHIDIUM BROMID fluorescenční barva interkalační činidlo do gelu do pufru barvení po elfu Vizualizace DNA SYBR GREEN Barvení proteinů Coommassie Brilliant Blue Coomassie Blue x barvení stříbrem Porovnání

Více

VÝUKOVÝ MODUL MEMBRÁNOVÝCH PROCESŮ TÉMATA PŘEDNÁŠEK

VÝUKOVÝ MODUL MEMBRÁNOVÝCH PROCESŮ TÉMATA PŘEDNÁŠEK VÝUKOVÝ MODUL MEMBRÁNOVÝCH PROCESŮ TÉMATA PŘEDNÁŠEK TRANSPORT LÁTEK MEMBRÁNAMI Transport látek porézními membránami - Plouživý tok nestlačitelných tekutin vrstvou částic - Plouživý tok stlačitelných tekutin

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

Hybridizace nukleových kyselin

Hybridizace nukleových kyselin Hybridizace nukleových kyselin Tvorba dvouřetězcových hybridů za dvou jednořetězcových a komplementárních molekul Založena na schopnosti denaturace a renaturace DNA. Denaturace DNA oddělení komplementárních

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2 http://www.paternityexperts.com/basicgenetics.html

Více

Průtokové metody (Kontinuální měření v proudu kapaliny)

Průtokové metody (Kontinuální měření v proudu kapaliny) Průtokové metody (Kontinuální měření v proudu kapaliny) 1. Přímé měření: analyzovaná kapalina většinou odvětvena + vhodný detektor 2. Kapalinová chromatografie (HPLC) Stanovení po předchozí separaci 3.

Více

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování

Více

SDS polyakrylamidová gelová elektroforéza (SDS PAGE)

SDS polyakrylamidová gelová elektroforéza (SDS PAGE) SDS polyakrylamidová gelová elektroforéza (SDS PAGE) Princip SDS polyakrylamidová gelová elektroforéza slouží k separaci proteinů na základě jejich velikosti (molekulové hmotnosti). Zahřátím vzorku za

Více

laktoferin BSA α S2 -CN α S1 -CN Popis: BSA bovinní sérový albumin, CN kasein, LG- laktoglobulin, LA- laktalbumin

laktoferin BSA α S2 -CN α S1 -CN Popis: BSA bovinní sérový albumin, CN kasein, LG- laktoglobulin, LA- laktalbumin Aktivita KA 2340/4-8up Stanovení bílkovin v mléce pomocí SDS PAGE (elektroforéza na polyakrylamidovém gelu s přídavkem dodecyl sulfátu sodného) vypracovala: MVDr. Michaela Králová, Ph.D. Princip: Metoda

Více

VÝUKOVÝ MODUL MEMBRÁNOVÝCH PROCESŮ SYLABY PŘEDNÁŠEK TRANSPORT LÁTEK MEMBRÁNAMI MEMBRÁNOVÉ MATERIÁLY

VÝUKOVÝ MODUL MEMBRÁNOVÝCH PROCESŮ SYLABY PŘEDNÁŠEK TRANSPORT LÁTEK MEMBRÁNAMI MEMBRÁNOVÉ MATERIÁLY VÝUKOVÝ MODUL MEMBRÁNOVÝCH PROCESŮ SYLABY PŘEDNÁŠEK TRANSPORT LÁTEK MEMBRÁNAMI zodpovědni: P. Mikulášek, H. Jiránková, M. Šípek, K. Friess, K. Bouzek Transport látek porézními membránami (P. Mikulášek)

Více

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje

Více

Fragment Analyzer UNIKÁTNÍ KAPILÁROVÝ FRAGMENTAČNÍ ANALYZÁTOR VÝBORNÉ VÝSLEDKY UNIKÁTNÍ VLASTNOSTI

Fragment Analyzer UNIKÁTNÍ KAPILÁROVÝ FRAGMENTAČNÍ ANALYZÁTOR VÝBORNÉ VÝSLEDKY UNIKÁTNÍ VLASTNOSTI Fragment Analyzer UNIKÁTNÍ KAPILÁROVÝ FRAGMENTAČNÍ ANALYZÁTOR VÝBORNÉ VÝSLEDKY UNIKÁTNÍ VLASTNOSTI Výborný přístroj, výborné výsledky Fragmentační analyzátor je automatizovaný kapilárový systém s CE značkou

Více

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi

Více

Diagnostické metody v analýze potravin. Matej Pospiech, FVHE Brno

Diagnostické metody v analýze potravin. Matej Pospiech, FVHE Brno Diagnostické metody v analýze potravin Matej Pospiech, FVHE Brno Důvody diagnostiky potravin Dodržování legislativních požadavků Vlastní kontrola v provozu Národní legislativa Evropská a mezinárodní legislativa

Více

Stanovení paracetamolu, kofeinu a propyfenazonu v tabletách Valetol

Stanovení paracetamolu, kofeinu a propyfenazonu v tabletách Valetol Úkol: Stanovení paracetamolu, kofeinu a propyfenazonu v tabletách Valetol pomocí CE-LIF Proveďte separaci a následné stanovení účinných látek (paracetamol, propyfenazon, kofein) v přípravku Valetol pomocí

Více

STAFYLOKOKOVÉ ENTEROTOXINY. Zdravotní nezávadnost potravin. Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336

STAFYLOKOKOVÉ ENTEROTOXINY. Zdravotní nezávadnost potravin. Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336 STAFYLOKOKOVÉ ENTEROTOXINY Zdravotní nezávadnost potravin Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336 OBSAH: Základní charakteristika Staphylococcus aureus Stafylokokové enterotoxiny

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby

Více

METODY STUDIA PROTEINŮ

METODY STUDIA PROTEINŮ METODY STUDIA PROTEINŮ Mgr. Vlasta Němcová vlasta.furstova@tiscali.cz OBSAH PŘEDNÁŠKY 1) Stanovení koncentrace proteinu 2) Stanovení AMK sekvence proteinu Hmotnostní spektrometrie Edmanovo odbourávání

Více

Metody testování humorální imunity

Metody testování humorální imunity Metody testování humorální imunity Co je to humorální imunita? Humorální = látková Buněčné produkty Nespecifická imunita příklady:» Lysozym v slinách, slzách» Sérové proteiny (proteiny akutní fáze)» Komplementový

Více

Izolace nukleových kyselin

Izolace nukleových kyselin Izolace nukleových kyselin Požadavky na izolaci nukleových kyselin V nativním stavu z přirozeného materiálu v dostatečném množství požadované čistotě. Nukleové kyseliny je třeba zbavit všech látek, které

Více

Identifikace a stanovení chininu v toniku pomocí CE-MS

Identifikace a stanovení chininu v toniku pomocí CE-MS Identifikace a stanovení chininu v toniku pomocí CE-MS Úkol: Stanovte množství chininu v nealkoholickém nápoji (tonik) pomocí kapilární zónové elektroforézy ve spojení s hmotnostní spektrometrií Teoretická

Více

Moderní nástroje pro zobrazování biologicky významných molekul pro zajištění zdraví. René Kizek

Moderní nástroje pro zobrazování biologicky významných molekul pro zajištění zdraví. René Kizek Moderní nástroje pro zobrazování biologicky významných molekul pro zajištění zdraví René Kizek 12.04.2013 Fluorescence je fyzikálně chemický děj, který je typem luminiscence. Luminiscence se dále dělí

Více

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční

Více

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace

Více

HMOTNOSTNÍ SPEKTROMETRIE - kvalitativní i kvantitativní detekce v GC a LC - pyrolýzní hmotnostní spektrometrie - analýza polutantů v životním

HMOTNOSTNÍ SPEKTROMETRIE - kvalitativní i kvantitativní detekce v GC a LC - pyrolýzní hmotnostní spektrometrie - analýza polutantů v životním HMOTNOSTNÍ SPEKTROMETRIE - kvalitativní i kvantitativní detekce v GC a LC - pyrolýzní hmotnostní spektrometrie - analýza polutantů v životním prostředí - farmakokinetické studie - kvantifikace proteinů

Více

Imunochemické metody. na principu vazby antigenu a protilátky

Imunochemické metody. na principu vazby antigenu a protilátky Imunochemické metody na principu vazby antigenu a protilátky ANTIGEN (Ag) specifická látka (struktura) vyvolávající imunitní reakci a schopná vazby na protilátku PROTILÁTKA (Ab antibody) molekula bílkoviny

Více

LABORATOŘ OBORU I ÚSTAV ORGANICKÉ TECHNOLOGIE (111) Použití GC-MS spektrometrie

LABORATOŘ OBORU I ÚSTAV ORGANICKÉ TECHNOLOGIE (111) Použití GC-MS spektrometrie LABORATOŘ OBORU I ÚSTAV ORGANICKÉ TECHNOLOGIE (111) C Použití GC-MS spektrometrie Vedoucí práce: Doc. Ing. Petr Kačer, Ph.D., Ing. Kamila Syslová Umístění práce: laboratoř 79 Použití GC-MS spektrometrie

Více

ZÁKLADNÍ MODELY TOKU PORÉZNÍ MEMBRÁNOU

ZÁKLADNÍ MODELY TOKU PORÉZNÍ MEMBRÁNOU ZÁKLADNÍ MODELY TOKU PORÉZNÍ MEMBRÁNOU Znázornění odporů způsobujících snižování průtoku permeátu nástřik porézní membrána Druhy odporů R p blokování pórů R p R a R m R a R m R g R cp adsorbce membrána

Více

Trendy v moderní HPLC

Trendy v moderní HPLC Trendy v moderní HPLC Josef Cvačka, 5.1.2011 CHROMATOGRAFIE NA ČIPECH Miniaturizace separačních systémů Mikrofluidní čipy Mikrofabrikace Chromatografické mikrofluidní čipy s MS detekcí Praktické využití

Více

Elektroforéza Sekvenování

Elektroforéza Sekvenování Elektroforéza Sekvenování Výsledek PCR Elektroforéza V molekulární biologii se používá k separaci nukleových kyselin a bílkovin Principem je pohyb nabitých molekul v elektrickém poli Gelová, polyakrylamidová

Více

Laboratorní přístrojová technika

Laboratorní přístrojová technika Laboratorní přístrojová technika Co najdeme v laboratoři? Přístroje pro obecné použití centrifugy, třepačky, pipety, biohazard boxy Trocha teorie o DNA a PCR Analytické přístroje a příprava vzorků elektroforézy

Více

Enterotoxiny Staphylococcus aureus. Jana Kotschwarová Andrea Koťová

Enterotoxiny Staphylococcus aureus. Jana Kotschwarová Andrea Koťová Enterotoxiny Staphylococcus aureus Jana Kotschwarová Andrea Koťová Obsah Charakteristika Staphylococcus aureus Vlastnosti Faktory virulence Enterotoxiny Patogeneze Výskyt Metody stanovení Prevence výskytu

Více

Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka

Více

Polymorfizmy detekované. polymorfizmů (Single Nucleotide

Polymorfizmy detekované. polymorfizmů (Single Nucleotide Polymorfizmy detekované speciálními metodami s vysokou rozlišovací schopností Stanovení jednonukleotidových polymorfizmů (Single Nucleotide Polymorphisms - SNPs) Příklad jednonukleotidových polymorfizmů

Více

CHROMATOGRAFIE ÚVOD Společný rys působením nemísících fází: jedna fáze je nepohyblivá (stacionární), druhá pohyblivá (mobilní).

CHROMATOGRAFIE ÚVOD Společný rys působením nemísících fází: jedna fáze je nepohyblivá (stacionární), druhá pohyblivá (mobilní). CHROMATOGRAFIE ÚOD Existují různé chromatografické metody, viz rozdělení metod níže. Společný rys chromatografických dělení: vzorek jako směs látek - složek se dělí na jednotlivé složky působením dvou

Více

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

Aplikační rozsah chromatografie

Aplikační rozsah chromatografie Chromatografické metody II. Aplikační rozsah chromatografie Chromatografie Kapalinová chromatografie rozdělení Nízkotlaká (atmosferický tlak) LPC Střednětlaká (4 Mpa) FPLC Vysokotlaká (40 Mpa) HPLC Ultravysokotlaká

Více

Pražské analytické centrum inovací Projekt CZ / /0002 spolufinancovaný ESF a Státním rozpočtem ČR

Pražské analytické centrum inovací Projekt CZ / /0002 spolufinancovaný ESF a Státním rozpočtem ČR Pražské analytické centrum inovací Projekt CZ.04.3.07/4.2.01.1/0002 spolufinancovaný ESF a Státním rozpočtem ČR SEPARACE PROTEINŮ Preparativní x analytická /měřítko, účel/ Zvláštnosti dané povahou materiálu

Více

Elektromigrační metody

Elektromigrační metody Elektromigrační metody Princip: molekuly nesoucí náboj se pohybují ve stejnosměrném elektrickém Arne Tiselius rozdělil proteiny krevního séra na základě jejich rozdílných rychlostí pohybu v elektrickém

Více

Obr. 1. Stuktura glukózy, fruktózy a sacharózy.

Obr. 1. Stuktura glukózy, fruktózy a sacharózy. 1. Analýza sacharidů v medu pomocí kapilární elektroforézy Med je přírodní produkt, který vyrábí včely z nektaru různých rostlin. Jedná se o vodný přesycený roztok sacharidů, který obsahuje také komplexní

Více

Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 4. Metody molekulární biologie I Izolace DNA a RNA Specifické postupy pro baktérie, kvasinky, rostlinné a živočišné tkáně U RNA nutno zabránit kontaminaci

Více

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION VYUŽITÍ AUTOMATICKÉHO SEKVENOVÁNÍ DNA PRO DETEKCI POLYMORFISMŮ KANDIDÁTNÍCH GENŮ U PRASAT Vykoukalová Z., Knoll A.,

Více

Mikročipy v mikrobiologii

Mikročipy v mikrobiologii Mikročipy v mikrobiologii doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 Obsah přednášky 1) Charakteristika biočipů, DNA microarrays a DNA chip 2) Výroba čipů, charakteristika

Více

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)

Více

ÚSTAV CHEMIE A ANALÝZY POTRAVIN

ÚSTAV CHEMIE A ANALÝZY POTRAVIN VYSOKÁ ŠKOLA CHEMICKO-TECHNOLOGICKÁ V PRAZE ÚSTAV CHEMIE A ANALÝZY POTRAVIN Technická 5, 166 28 Praha 6 tel./fax.: + 420 220 443 185; jana.hajslova@vscht.cz LABORATOŘ Z ANALÝZY POTRAVIN A PŘÍRODNÍCH PRODUKTŮ

Více

Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,

Více

Praktika a analytické metody. ie/vyuka/bakalari/practicals

Praktika a analytické metody.  ie/vyuka/bakalari/practicals Praktika a analytické metody http://www.lf3.cuni.cz/cs/pracoviste/chem ie/vyuka/bakalari/practicals Volumetrie kvantitativní metoda měření objemů roztoků ke stanovení neznámých koncentrací analyzovaných

Více

Mikrofluidní systém pro měření vodivosti

Mikrofluidní systém pro měření vodivosti Mikrofluidní systém pro měření vodivosti Autoři: Ing. Jiří Sedláček, Ing. Jaromír Žák, Ing. Jan Pekárek, Ing. Jana Chomoucká, PhD., Doc. Ing. Jaromír Hubálek, PhD., prof. René Kizek, Ph.D. Jedná se o systém

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti CHROMATOGRAFIE

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti CHROMATOGRAFIE Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti CHROMATOGRAFIE Chromatografie co je to? : široká škála fyzikálních metod pro analýzu nebo separaci komplexních směsí proč je to super?

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN

ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN Fragmenty nukleových kyselin lze dle jejich velikosti rozdělit elektroforézou. Elektroforéza využívá rozdílné pohyblivosti jednotlivých fragmentů, danou právě

Více

Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní

Více

DY D NE N X Hana Vlastníková

DY D NE N X Hana Vlastníková DYNEX Hana Vlastníková Molekulární biologie: Vybavení laboratoře na klíč Přístrojová technika Kompatibilní diagnostické soupravy Profesionální přístup SOP Technická podpora Servis Přístrojové vybavení:

Více

Sekvenování nové generace. Radka Reifová

Sekvenování nové generace. Radka Reifová Sekvenování nové generace Radka Reifová Prezentace ke stažení www.natur.cuni.cz/zoologie/biodiversity v záložce Přednášky 1. Přehled sekvenačních metod nové generace 2. Využití sekvenačních metod nové

Více

Mikrobiologické diagnostické metody. MUDr. Pavel Čermák, CSc.

Mikrobiologické diagnostické metody. MUDr. Pavel Čermák, CSc. Mikrobiologické diagnostické metody MUDr. Pavel Čermák, CSc. Princip identifikace soubor ZNAKŮ s rozdílnou separační hodnotou S HODNOTA S: S 1 S 2 S 3 Základní problémy Minimum morfologických znaků Podobná

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Analýza transkriptomu Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s moderními metodami komplexní

Více

Metody studia exprese mrna. jádro a genová exprese 2007

Metody studia exprese mrna. jádro a genová exprese 2007 Metody studia exprese mrna Buněčné jádro a genová exprese 2007 Aktivita genu je primárn ě vyjád ř ena jeho transkripcí-prvním krokem vedoucím k syntéze kódovaného proteinu. Cíle metod Ur č ení mno ž ství

Více

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Biotechnologický kurz Biotechnologický kurz II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně Zemědělská

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

Elektroforéza v přítomnosti SDS SDS PAGE

Elektroforéza v přítomnosti SDS SDS PAGE Elektroforéza v přítomnosti SDS SDS PAGE Elektroforéza v přítomnosti SDS SDS PAGE je jednoduchá, rychlá a reprodukovatelná metoda pro kvalifikovanou charakterizaci a srovnání bílkovin.tato metoda separuje

Více

Analýza kofeinu v kávě pomocí kapalinové chromatografie

Analýza kofeinu v kávě pomocí kapalinové chromatografie Analýza kofeinu v kávě pomocí kapalinové chromatografie Kofein (obr.1) se jako přírodní alkaloid vyskytuje v mnoha rostlinách (např. fazolích, kakaových bobech, černém čaji apod.) avšak nejvíce je spojován

Více

Environmentální aplikace molekulární biologie

Environmentální aplikace molekulární biologie Environmentální aplikace molekulární biologie Petra Jančová, Kristýna Maršálková, Jana Šerá, Hana Pištěková Ústav Inženýrství Ochrany Životního Prostředí, Fakulta Technologická, Univerzita Tomáše Bati

Více

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.

Více

Stanovení cholesterolu ve vaječném žloutku a mléce kapilární elektroforézou

Stanovení cholesterolu ve vaječném žloutku a mléce kapilární elektroforézou Stanovení cholesterolu ve vaječném žloutku a mléce kapilární elektroforézou Úkol Stanovte obsah cholesterolu ve vaječném žloutku a mléce pomocí kapilární elektroforézy. Teoretická část Cholesterol je steroidní

Více

Praktický kurz Pokročilé biofyzikální přístupy v genomice a proteomice. 12.-13. května 2010

Praktický kurz Pokročilé biofyzikální přístupy v genomice a proteomice. 12.-13. května 2010 www.modernibiofyzika.cz Oddělení funkční genomiky a proteomiky Ústav experimentální biologie, Přírodovědecká fakulta Masarykova univerzita Praktický kurz Pokročilé biofyzikální přístupy v genomice a proteomice

Více

Vybrané spektroskopické metody

Vybrané spektroskopické metody Vybrané spektroskopické metody a jejich porovnání s Ramanovou spektroskopií Předmět: Kapitoly o nanostrukturách (2012/2013) Autor: Bc. Michal Martinek Školitel: Ing. Ivan Gregora, CSc. Obsah přednášky

Více

1. Metodika. Protokol č. F1-4 Metodika: Srovnávací analýza efektivity přípravy rekombinantního proteinu ve fermentoru

1. Metodika. Protokol č. F1-4 Metodika: Srovnávací analýza efektivity přípravy rekombinantního proteinu ve fermentoru Protokol č.: F1-4 Datum: 20.12.2010 Metodika: analýza efektivity přípravy výběr z výsledků ze zkušebních provozů výroby antigenů. Vypracoval: Ing. Václav Filištein, Mgr. Tereza Chrudimská, Spolupracující

Více

Biotechnologický kurz. III. letní škola metod molekulární biologie nukleových kyselin a genomiky

Biotechnologický kurz. III. letní škola metod molekulární biologie nukleových kyselin a genomiky Biotechnologický kurz Biotechnologický kurz III. letní škola metod molekulární biologie nukleových kyselin a genomiky 18. - 22. 6. 2012 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně

Více

SLEDOVÁNÍ VZTAHU MEZI OBSAHEM ENZYMU RUBISCO A KONCENTRACÍ CO 2 V CHLOROPLASTU

SLEDOVÁNÍ VZTAHU MEZI OBSAHEM ENZYMU RUBISCO A KONCENTRACÍ CO 2 V CHLOROPLASTU SLEDOVÁNÍ VZTAHU MEZI OBSAHEM ENZYMU RUBISCO A KONCENTRACÍ CO 2 V CHLOROPLASTU Nikola Burianová Experimentální biologie 2.ročník navazujícího studia Katedra Fyziky Ostravská univerzita v Ostravě OBSAH

Více

Afinitní kapilární elektroforéza

Afinitní kapilární elektroforéza Pražské analytické centrum inovací Projekt CZ.04.3.07/4.2.01.1/0002 spolufinancovaný ESF a Státním rozpočtem ČR Afinitní kapilární elektroforéza Věra Pacáková a Tereza Vařilová PřF UK Praha Obsah 1. Úvod

Více

Moderní vizualizační nástroje pro elektrochemickou detekci iontů těžkých kovů

Moderní vizualizační nástroje pro elektrochemickou detekci iontů těžkých kovů Název: Školitel: Moderní vizualizační nástroje pro elektrochemickou detekci iontů těžkých kovů Renáta Kenšová, Marie Konečná Datum: 11. 9. 2013 Reg.č.projektu: CZ.1.07/2.3.00/20.0148 Název projektu: Mezinárodní

Více

Praktický kurz Monitorování hladiny metalothioneinu po působení iontů těžkých kovů Vyhodnocení měření

Praktický kurz Monitorování hladiny metalothioneinu po působení iontů těžkých kovů Vyhodnocení měření Laboratoř Metalomiky a Nanotechnologií Praktický kurz Monitorování hladiny metalothioneinu po působení iontů těžkých kovů Vyhodnocení měření Vyučující: Ing. et Ing. David Hynek, Ph.D., Prof. Ing. René

Více

PROTOKOL WESTERN BLOT

PROTOKOL WESTERN BLOT WESTERN BLOT 1. PŘÍPRAVA ELEKTROFORETICKÉ APARATURY Saponátem a vodou se důkladně umyjí skla, plastové vložky a hřebínek, poté se důkladně opláchnou deionizovanou/destilovanou vodou a etanolem a nechají

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD

Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD Dana Vejmelková, Milan Šída, Kateřina Jarošová, Jana Říhová Ambrožová VODÁRENSKÁ BIOLOGIE, 1. 2. 2017 ÚVOD Sledované parametry,

Více

Molekulární genetika

Molekulární genetika Molekulární genetika Genetické inženýrství Technologie rekombinantní DNA Vektor Genomová DNA Štěpení RE Rozštěpení stejnou RE, lepivé konce Ligace Transformace Bakteriální chromozóm Rekombinantní vektor

Více

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR)

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek

Více

Chemické senzory Principy senzorů Elektrochemické senzory Gravimetrické senzory Teplotní senzory Optické senzory Fluorescenční senzory Gravimetrické chemické senzory senzory - ovlivňov ování tuhosti pevného

Více

fokusaci v Úvod objemů vzorku. separaci nachází ve stavu nazývá Amfolyty jsou tedy Obrázek

fokusaci v Úvod objemů vzorku. separaci nachází ve stavu nazývá Amfolyty jsou tedy Obrázek Protokol pro laboratorní úlohu: Separace směsi proteinů na zařízení pro izoelektrickou rozbíhavém toku fokusaci v Úvod Přirozeně se proteiny se vyskytují ve velmi složitých směsích. Pro jejich analýzu

Více

Rozpustnost Rozpustnost neelektrolytů

Rozpustnost Rozpustnost neelektrolytů Rozpustnost Podobné se rozpouští v podobném látky jejichž molekuly na sebe působí podobnými mezimolekulárními silami budou pravděpodobně navzájem rozpustné. Př.: nepolární látky jsou rozpustné v nepolárních

Více

Teorie transportu plynů a par polymerními membránami. Doc. Ing. Milan Šípek, CSc. Ústav fyzikální chemie VŠCHT Praha

Teorie transportu plynů a par polymerními membránami. Doc. Ing. Milan Šípek, CSc. Ústav fyzikální chemie VŠCHT Praha Teorie transportu plynů a par polymerními membránami Doc. Ing. Milan Šípek, CSc. Ústav fyzikální chemie VŠCHT Praha Úvod Teorie transportu Difuze v polymerních membránách Propustnost polymerních membrán

Více

Tematické okruhy pro státní závěrečné zkoušky v navazujícím magisterském studiu na Fakultě chemicko-inženýrské v akademickém roce 2015/2016

Tematické okruhy pro státní závěrečné zkoušky v navazujícím magisterském studiu na Fakultě chemicko-inženýrské v akademickém roce 2015/2016 Tematické okruhy pro státní závěrečné zkoušky v navazujícím magisterském studiu na Fakultě chemicko-inženýrské v akademickém roce 2015/2016 1. Průběh státní závěrečné zkoušky (SZZ) navazujících magisterských

Více

Spojení hmotové spektrometrie se separačními metodami

Spojení hmotové spektrometrie se separačními metodami Spojení hmotové spektrometrie se separačními metodami RNDr. Radomír Čabala, Dr. Katedra analytické chemie Přírodovědecká fakulta Univerzita Karlova Praha Spojení hmotové spektrometrie se separačními metodami

Více

PREKONCENTRAČNÍ TECHNIKY V KAPILÁRNÍ ELEKTROFORÉZE

PREKONCENTRAČNÍ TECHNIKY V KAPILÁRNÍ ELEKTROFORÉZE MASARYKOVA UNIVERZITA Přírodovědecká fakulta Ústav biochemie Návod do cvičení PREKONCENTRAČNÍ TECHNIKY V KAPILÁRNÍ ELEKTROFORÉZE LABORATORNÍ CVIČENÍ Mgr. Aleš Mádr 2012 Vzniklo díky finanční podpoře Ministerstva

Více