Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:



1 RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie

2 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin 3) Praktikum z genetiky populací

3 Vyučující: RNDr. Pavel Lízal, Ph.D.; doc. Jana Řepková, CSc.; Mgr. Aneta Mikulášová zájem se pohybuje v průměru kolem 200 studentů ~ 1/3 (78/245) má předmět povinný Molekulární biologie a genetika Lékařská genetika a mol. diagnostika Antropologie ostatní si volí dobrovolně Speciální biologie Ekologická a evoluční biologie Matematická biologie (2. ročník) Biologie se zaměřením na vzdělávání (4. ročník)

4 rozdělení do seminárních skupin po 18 až 20 studentech

5 Podmínky splnění: 80% docházka vyřešené zápočtové příklady odevzdaných 5 protokolů úspěšně složený zápočtový test (75 %)

6 Úspěšnost získání zápočtu: v průměru kolem 85 %

7 Struktura praktika (2 h, 90 min) úvodní prezentace tématu praktika experiment praktický, simulovaný řešení zápočtových příkladů na téma praktika

8 Experimenty především s využitím modelových organizmů Arabidopsis thaliana Drosophila melanogaster

9 Experimenty 1) Pozorování štěpení recesivně letálního znaku albina u monohybrida modelového organizmu Arabidopsis thaliana seznámení se s výhodami genetického modelu rozpoznávání vybraných mutantů

10 Experimenty seznámení se s výhodami genetického modelu rozpoznávání vybraných mutantů založení pokusu pro sledování segregace znaku v potomstvu monohybrida

11 Experimenty seznámení se s výhodami genetického modelu rozpoznávání vybraných mutantů založení pokusu pro sledování segregace znaku v potomstvu monohybrida

12 Experimenty

13 Experimenty 2) Pozorování dědičnosti s vazbou na pohlaví u modelového organizmu Drosophila melanogaster (mutace white) seznámení s modelem nácvik manipulace rozpoznávání vybraných mutantů rozpoznávání pohlaví

14 Experimenty založení pokusu v lichých týdnech usmrcení rodičů

15 Experimenty založení pokusu v lichých týdnech usmrcení rodičů v sudých týdnech vyhodnocování první a druhé generace potomků (celkem 1 měsíc s octomilkou)

16 Experimenty 3) Sledování dědičnosti kvantitativního znaku u modelového organizmu Drosophila melanogaster základní charakteristika kvantitativních znaků popis vzniku populace jedinců F 2 pro vyhodnocení stanovení počtu chloupků na vzorku 20 jedinců

17 Experimenty vyhodnocení pokusu

18 Experimenty 4) konstrukce vlastního rodokmenu seznámení s pravidly tvorby rodokmenů pokyny pro tvorbu

19 Experimenty 4) konstrukce vlastního rodokmenu seznámení s pravidly tvorby rodokmenů pokyny pro tvorbu v následujících 4 týdnech si zvolí znak, zjistí výskyt u příbuzných a namalují rodokmen klepněte na obrázek pro přesměrování na video Klepněte pro přímý odkaz do aplikace

20 Experimenty 4) konstrukce vlastního rodokmenu

21 Experimenty 5) sestavení karyotypu neznámého člověka seznámení s pravidly pro identifikaci lidských chromozomů obdrží vyfotografované chromozomy polovina sestavených, polovina neidentifikovaných = mají zařadit do páru

22 Experimenty 5) sestavení karyotypu neznámého člověka mohou si vyzkoušet také elektronicky klepněte na obrázek pro přesměrování na video Klepněte pro přímý odkaz do aplikace

23 Další dovednosti 6) ověření znalostí pomocí animací z e-skript segregace vloh, kombinace vloh, vazba genů klepněte na obrázek pro přesměrování na video Klepněte pro přímý odkaz do aplikace

24 Další dovednosti 6) ověření znalostí pomocí animací z e-skript genetické mapování Klepněte pro přímý odkaz do aplikace klepněte na obrázek pro přesměrování na video

25 Elektronická skripta jsou volně k dispozici přes elportál MU

26 Elektronická skripta jsou volně k dispozici přes elportál MU Klepněte pro přímý odkaz do aplikace klepněte na obrázek pro přesměrování na video

27 Koncepce vzhledem k zájmu (200 a více studentů) praktika navržena tak, aby: nebyla finančně nákladná byla realizovatelná ve standardních prostorách a přitom byla pro studenty přínosná a zajímavá Ohlasy

28 PRAKTIKUM Z GENETIKY ROSTLIN Vyučující: doc. Jana Řepková, CSc. Zaměření na metody genetické analýzy rostlin a problematiku genetických markerů 1. Genetická analýza a identifikace počtu genů odolnosti k padlí u planého ječmene Hordeum vulgare subsp. spontaneum. 2. Určení mikrosatelitních DNA markerů v genetické vazbě s genem odolnosti k padlí travnímu u ječmene. 3. Genetické mapování genů odolnosti k padlí travnímu u ječmene. Využití softwaru pro mapování. 4. Identifikace transgenních rostlin Arabidopsis thaliana prostřednictvím genu rezistence k antibiotiku. 5. Expresní analýza genu pro polyfenoloxidázu u jetele lučního pomocí RT-PCR.

29 PRAKTIKUM Z GENETIKY POPULACÍ Vyučující: RNDr. Pavel Lízal, Ph.D. zájem se pohybuje v průměru kolem 60 studentů úspěšnost kolem 92 % 54 má dvě části: výpočtovou praktickou (pro omezený počet zájemců) - obvykle 15 až 20 studentů

30 PRAKTIKUM Z GENETIKY POPULACÍ Výpočtová část řešení populačně-genetických příkladů formou e-learningu

31 PRAKTIKUM Z GENETIKY POPULACÍ Výpočtová část řešení populačně-genetických příkladů formou e-learningu klepněte na obrázek pro přesměrování na video

32 PRAKTIKUM Z GENETIKY POPULACÍ Praktická část pracují v 5 členných týmech 1) Celosemestrální pokus s octomilkou Sledování ustavení Hardy-Weinbergovy rovnováhy pro znak vázaný na pohlaví

33 PRAKTIKUM Z GENETIKY POPULACÍ Praktická část vyhodnocování populace v generacích t+1 až t+4 odevzdání týmových protokolů

34 PRAKTIKUM Z GENETIKY POPULACÍ Praktická část 2) Vyhodnocení dotazníků z populačního výzkumu v populaci člověka Stanovení Snyderových podílů, ověření HW rovnováhy pro dva znaky v populaci člověka a výpočet podílů heterozygotů mezi fenotypově dominantními jedinci

35 PRAKTIKUM Z GENETIKY POPULACÍ Praktická část každá skupina pracuje s 50 dotazníky

36 PRAKTIKUM Z GENETIKY POPULACÍ Praktická část 3) Stanovení shody v profilu DNA

37 PRAKTIKUM Z GENETIKY POPULACÍ Praktická část 3) Stanovení shody v profilu DNA

38 PRAKTIKUM Z GENETIKY POPULACÍ Praktická část 3) Stanovení shody v profilu DNA

39 PRAKTIKUM Z GENETIKY POPULACÍ 4) Exkurze na Ústavu soudního lékařství a v Laboratoři forenzní genetiky

40 Děkuji za pozornost

Výuka genetiky na Přírodovědecké fakultě MU

Výuka genetiky na Přírodovědecké fakultě MU MASARYKOVA UNIVERZITA Přírodovědecká fakulta Výuka genetiky na Přírodovědecké fakultě MU Jiří Doškař Ústav experimentální biologie, Oddělení genetiky a molekulární biologie 1 V akademickém roce 1964/1965


Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie

Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie 1) Zadávání témat dle studovaného oboru 2) Přehled řešených témat v minulosti 3) 4) Přehled externích školících pracovišť Zaměření


Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený


Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků


Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u



GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou


Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci


V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865


Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická


prof. RNDr. Jiří Doškař, CSc. Oddělení genetiky a molekulární biologie

prof. RNDr. Jiří Doškař, CSc. Oddělení genetiky a molekulární biologie prof. RNDr. Jiří Doškař, CSc. Oddělení genetiky a molekulární biologie Oddělení genetiky a molekulární biologie Profesoři prof. RNDr. Jiří Doškař, CSc. prof. RNDr. Jiřina Relichová, CSc. (emeritní) prof.


Zaměření bakalářské práce (témata BP)

Zaměření bakalářské práce (témata BP) Zaměření bakalářské práce (témata BP) Obor: Buněčná a molekulární diagnostika - zadává katedra - studenti si témata losují Obor: molekulární biologie a genetika - témata BP vychází z vybraného tématu DP



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


Aktivity se studenty přímo na přednášce

Aktivity se studenty přímo na přednášce Aktivity se studenty přímo na přednášce RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie přemýšlel jsem, jak udělat


Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


Cvičení z genetiky a cytogenetiky na Přírodovědecké fakultě UK v Praze

Cvičení z genetiky a cytogenetiky na Přírodovědecké fakultě UK v Praze Cvičení z genetiky a cytogenetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Studenti si tvoří vlastní studijní plán, ale musejí naplnit povinný limit kreditů Velká pestrost


Genetika populací. Doposud genetika na úrovni buňky, organizmu

Genetika populací. Doposud genetika na úrovni buňky, organizmu Doposud genetika na úrovni buňky, organizmu - jedinec nás nezajímá - pouze jeho gamety a to jako jedny z mnoha = genofond = soubor všech gamet skupiny jedinců Populace mnoho různých definic - skupina organizmů


Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA


Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií

Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Obecná genetika Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Ing. Roman Longauer, CSc. Ústav zakládání a pěstění lesů, LDF MENDELU Brno Tento projekt je spolufinancován Evropským


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


11.5 Studijní obor: Molekulární biologie a genetika, směr Molekulární biologie a genetika

11.5 Studijní obor: Molekulární biologie a genetika, směr Molekulární biologie a genetika 11.5 Studijní obor: Molekulární biologie a genetika, směr Molekulární biologie a genetika Základní pokyny Studenti, kteří jsou řádně zapsáni do 1. semestru studia navazujícího magisterského oboru Molekulární


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


ANOTACE vytvořených/inovovaných materiálů

ANOTACE vytvořených/inovovaných materiálů ANOTACE vytvořených/inovovaných materiálů Číslo projektu Číslo a název šablony klíčové aktivity Tematická oblast Formát Druh učebního materiálu Druh interaktivity CZ.1.07/1.5.00/34.0722 III/2 Inovace a


Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského


GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných


Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je





Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010



ODDĚLENÍ GENETIKY A ŠLECHTĚNÍ ODDĚLENÍ GENETIKY A ŠLECHTĚNÍ Pracovní tým Ing. Zelený Lubor vedoucí oddělení šlechtění, skladování, zpracování a agrotechnika ovoce vnitřní kvalita plodů a spektroskopické metody NIR komercionalizace


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


Bakalářské práce. Magisterské práce. PhD práce

Bakalářské práce. Magisterské práce. PhD práce Bakalářské práce Magisterské práce PhD práce Témata bakalářských prací na školní rok 2015-2016 1 Název Funkční analýza jaderných proteinů fosforylovaných pomocí mitogenaktivovaných proteinkináz. Školitel


12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat


Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc.

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc. Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské praxi doc. RNDr. Ivan Mazura, CSc. Historie forenzní genetiky 1985-1986 Alec Jeffreys a satelitní DNA 1980 Ray


Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje


Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Tradice šlechtění šlechtění zlepšování pěstitelsky, technologicky a spotřebitelsky významných vlastností


Genetické mapování. v přírodních populacích i v laboratoři

Genetické mapování. v přírodních populacích i v laboratoři Genetické mapování v přírodních populacích i v laboratoři Funkční genetika Cílem je propojit konkrétní mutace/geny s fenotypem Vzniklý v laboratoři pomocí mutageneze či vyskytující se v přírodě. Forward


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání


Bioinformatika a výpočetní biologie KFC/BIN. I. Přehled

Bioinformatika a výpočetní biologie KFC/BIN. I. Přehled Bioinformatika a výpočetní biologie KFC/BIN I. Přehled RNDr. Karel Berka, Ph.D. Univerzita Palackého v Olomouci Definice bioinformatiky (Molecular) bio informatics: bioinformatics is conceptualising biology


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


VY_32_INOVACE_11.18 1/6 Genetika Genetika

VY_32_INOVACE_11.18 1/6 Genetika Genetika 1/6 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


Genová vazba. Obr. č. 1: Thomas Hunt Morgan

Genová vazba. Obr. č. 1: Thomas Hunt Morgan Genová vazba Jednou ze základních podmínek platnosti Mendelových zákonů je lokalizace genů, které podmiňují různé vlastnosti na různých chromozómech. Toto pravidlo umožňuje volnou kombinovatelnost genů


Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi


1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.


GENETIKA U VLS ČR, s. p. Ing. Pavel Češka Vojenské lesy a statky ČR, s. p.

GENETIKA U VLS ČR, s. p. Ing. Pavel Češka Vojenské lesy a statky ČR, s. p. GENETIKA U VLS ČR, s. p. Ing. Pavel Češka Vojenské lesy a statky ČR, s. p. STRUČNÝ POPIS SOUČASNÉHO STAV GENETIKY U VLS je v současnosti využíván především reprodukční materiál z identifikovaných a kvalifikovaných



EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence


Vytvořen. ení genetické databanky vybraných druhů savců ČR ití pro udržitelný rozvoj dopravy. Tomáš. Libosvár

Vytvořen. ení genetické databanky vybraných druhů savců ČR ití pro udržitelný rozvoj dopravy. Tomáš. Libosvár Vytvořen ení genetické databanky vybraných druhů savců ČR k využit ití pro udržitelný rozvoj dopravy Tomáš Libosvár TA02031259 Vytvořen ení genetické databanky vybraných druhů savců ČR k využit ití pro


Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010

Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010 Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem Milan Bartoš Forum veterinarium, Brno 2010 Vývoj farmakogenetické diagnostické soupravy pro stanovení genetických polymorfismů


Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické


Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u


Příbuznost a inbreeding

Příbuznost a inbreeding Příbuznost a inbreeding Příbuznost Přímá (z předka na potomka). Souběžná (mezi libovolnými jedinci). Inbreeding Inbrední koeficient je pravděpodobnost, že dva geny přítomné v lokuse daného jedince jsou


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání


Aplikovaná bioinformatika

Aplikovaná bioinformatika Aplikovaná bioinformatika Číslo aktivity: 2.V Název klíčové aktivity: Na realizaci se podílí: Implementace nových předmětů do daného studijního programu doc. RNDr. Michaela Wimmerová, Ph.D., Mgr. Josef


Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Níže uvedené komentáře by měly pomoci soutěžícím z kategorie B ke snazší orientaci


Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00


Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol 20.5.2015 Popis klinických příznaků, možnosti léčby Muži: střední až těžká mentální


GENETIKA. zkoumá dědičnost a proměnlivost organismů

GENETIKA. zkoumá dědičnost a proměnlivost organismů GENETIKA zkoumá dědičnost a proměnlivost organismů Dědičnost: schopnost organismů uchovávat informace o své struktuře a funkčních schopnostech a předávat je svým potomkům Proměnlivost (variabilita) je


Studijní obor: Bioanalytik odborný pracovník v laboratorních metodách

Studijní obor: Bioanalytik odborný pracovník v laboratorních metodách Magisterský studijní program Biochemie (doplněk ke studijnímu katalogu zveřejněnému na webových stránkách fakultu Garant studijního programu Prof.


Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Petr Lesný 1, Pavel Seeman 2, Daniel Groh 1 1 ORL klinika UK 2. LF a FN Motol Subkatedra dětské ORL IPVZ Přednosta doc. MUDr. Zdeněk Kabelka


Základní geneticky podmíněné vady a vrozené vývojové vady možnosti prevence

Základní geneticky podmíněné vady a vrozené vývojové vady možnosti prevence Základní geneticky podmíněné vady a vrozené vývojové vady možnosti prevence Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Květen 2011 Mgr. Radka Benešová


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


ZÁVĚRY z 6. jednání konaného dne 24.9. 2007 ve VÚVeL

ZÁVĚRY z 6. jednání konaného dne 24.9. 2007 ve VÚVeL Rada instituce Výzkumného ústavu veterinárního lékařství, v.v.i. Hudcova 70; 621 00 Brno ZÁVĚRY z 6. jednání konaného dne 24.9. 2007 ve VÚVeL Schválení programu jednání 1. Návrh ukazatelů pro hodnocení


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


doc. Ing. Jiří Skládanka, Ph.D.

doc. Ing. Jiří Skládanka, Ph.D. doc. Ing. Jiří Skládanka, Ph.D. Vytvoření osnov kurzů Vytvoření vzdělávacích materiálů Akreditace kurzů Pilotní ověření kurzů Evaluace kurzů Metody studia ekosystémů Analytická chemie Potravinářská


Protokoly z projektových dnů na vysokých školách

Protokoly z projektových dnů na vysokých školách Podpora technického a přírodovědného vzdělávání v Pardubickém kraji reg. č. CZ.1.07/1.1.00/44.0012 KA11 (KA7) Dlouhodobá spolupráce středních škol a vysokých škol vedoucí k udržení/zvýšení zájmu žáků SŠ


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)


Člověk a příroda přírodopis volitelný předmět

Člověk a příroda přírodopis volitelný předmět Vyučovací předmět : Období ročník : Učební texty : Člověk a příroda přírodopis volitelný předmět 3. období 9. ročník Jan Stoklasa a kol. : Organismy, prostředí, člověk /učebnice přírodopisu pro 9. roč.


A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům Karlova univerzita, Lékařská fakulta Hradec Králové Obor: všeobecné lékařství - test z biologie Vyberte tu z nabídnutých odpovědí (1-5), která je nejúplnější. Otázka Odpověď 1. Mezi organely membránového


Podmínky pro hodnocení žáka v předmětu biologie

Podmínky pro hodnocení žáka v předmětu biologie Podmínky pro hodnocení žáka v předmětu biologie 1. ročník čtyřletého všeobecného a 5. ročník osmiletého studia Minimální počet známek za pololetí: 4 obecné základy biologie histologie rostlin vegetativní


Bakalářské práce. Magisterské práce. PhD práce

Bakalářské práce. Magisterské práce. PhD práce Bakalářské práce Magisterské práce PhD práce Témata bakalářských prací na školní rok 2017-2018 1 Název Fenotypová analýza vybraných dvojitých mutantů MAPK v podmínkách abiotického stresu. Školitel Mgr.


Význam genetického vyšetření u pacientů s mentální retardací

Význam genetického vyšetření u pacientů s mentální retardací Význam genetického vyšetření u pacientů s mentální retardací Šantavá, A., Hyjánek, J., Čapková, P., Adamová, K., Vrtěl, R. Ústav lékařské genetiky a fetální medicíny FN a LF UP Olomouc Mentální retardace


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Heritabilita. Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability

Heritabilita. Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability Heritabilita Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability h 2 = V A / V P Výpočet genetické determinance znaku h 2 = V G / V P Heritabilita závisí


Okruhy otázek ke zkoušce

Okruhy otázek ke zkoušce Okruhy otázek ke zkoušce 1. Úvod do biologie. Vznik života na Zemi. Evoluční vývoj organizmů. Taxonomie organizmů. Původ a vývoj člověka, průběh hominizace a sapientace u předků člověka vyšších primátů.


Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika


Jak by mohlo vypadat ideální doktorandské studium?

Jak by mohlo vypadat ideální doktorandské studium? Jak by mohlo vypadat ideální doktorandské studium? Mgr. Markéta Wayhelová Ústav experimentální biologie Přírodovědecká fakulta, Masarykova univerzita Brno Workshop Univerzitní vzdělávání genegky Brno,


Hodnocení e-learningu

Hodnocení e-learningu Hodnocení e-learningu Ing. Monika Kavanová, Ph.D. Oracle - Regional Education Director 1. března 2005 Hodnocení e-learningu Hodnotící strategie Hodnocení znalostí jednotlivců
