Analýza mutací genu COL1A1 českých pacientů s diagnózou osteogenesis imperfecta, typ I-IV

Rozměr: px
Začít zobrazení ze stránky:

Download "Analýza mutací genu COL1A1 českých pacientů s diagnózou osteogenesis imperfecta, typ I-IV"

Transkript

1 cs30 Původní práce Analýza mutací genu COL1A1 českých pacientů s diagnózou osteogenesis imperfecta, typ I-IV Lucie Šormová 1, Ivan Mazura 1, Ivo Mařík lékařská fakulta Univerzity Karlovy v Praze, ČR 2 Ambulantní centrum pro vady pohybového aparátu, Praha, ČR Abstrakt Přehled: Osteogenesis imperfecta je celosvětově rozšířené onemocnění pojivové tkáně vyznačující se rozsáhlou klinickou heterogenitou. Hlavním klinickým příznakem je zvýšená fragilita kostí způsobená defektní produkcí kolagenu typu I, který je kódován geny COL1A1 a COL1A2. Z klinického, radiologického a genetického hlediska rozlišujeme 11 forem onemocnění, přičemž pouze první čtyři typy vznikají v důsledku mutací genů kolagenu typ I. Závažnost onemocnění se pohybuje od lehkých forem po letální typy onemocnění. Cíle a metody: Cílem studie je molekulárně-genetická analýza genu COL1A1 25 českých pacientů postižených onemocněním osteogenesis imperfecta, konkrétně I-IV typem, a následné porovnání klinického obrazu jedinců se shodnými změnami DNA. Kontakt: Lucie Šormová 1. lékařská fakulta, Univerzita Karlova v Praze Adresa: Kateřinská 32, Praha 2, ČR E mail: Výsledky: Mutace genu COL1A1 byly identifikovány u 3 z 25 českých OI pacientů. Jedná se o nepříbuzné jedince s diagnózou osteogenesis imperfecta typ IA, III a IVB. Závěr: Identifikace mutačního spektra prostřednictvím molekulárně genetických analýz dalších pacientů a jejich příbuzných je nezbytná nejen pro stanovení vztahů mezi genotypem a fenotypem postižených jedinců, ale zároveň pro porovnání frekvence výskytu identifikovaných mutací české populace s dalšími populacemi. Klíčová slova Osteogenesis imperfecta, kolagen typ I, COL1A1, COL1A2, MLBR, mutace EJBI 2012; 8(5):cs30 cs37 zasláno: 15. srpna 2012 přijato: 2. října 2012 publikováno: 22. listopadu Úvod Osteogenesis imperfecta je dědičné onemocnění pojivové tkáně, jehož charakteristickým klinickým znakem jsou křehké kosti s vysokým rizikem pro vznik zlomenin. Dalšími klinickými rysy této choroby jsou podprůměrný až malý vzrůst, kloubní hypermobilita, hyperlaxicita kůže, modré skléry, nedoslýchavost a dentinogenesis imperfecta. V některých případech jsou popisovány defekty plic či vaskulárního systému. Prvotní klasifikace, jejímž autorem byl David Sillence a která rozlišovala čtyři typy OI, vznikla v roce V průběhu následujících let byla tato klasifikace na základě identifikace nových klinických, radiologických a genetických znaků postupně rozšiřována o další typy až na současných 11 forem OI. Molekulární podstatou prvních čtyř forem jsou mutace genů kolagenu typ I (Collagen, type I, alpha-1 (COL1A1) a Collagen, type I, alpha-2 (COL1A2)), původ zbývajících typů jsou mutace genů Serpin peptidase inhibitor, clade F, member 1 (SerpinF1) (OI typ VI), genů 3-prolyl hydroxylačního komplexu - Cartilage associated protein (CRTAP), Leucine- and proline-enriched proteoglycan 1 (LEPRE1) a Peptidyl-prolyl isomerase 1 (Cyclophylin B) (PPIB) (OI typ VII, VIII a IX), a defekty chaperonů Serpin peptidase inhibitor, clade H, member 1 (SerpinH1) a FK506-binding protein 10 (FKBP10) (OI typ X a XI). Etiologie pátého typu OI není v současnosti jasná [5, 18]. 1.1 Kolagenní formy osteogenesis imperfecta OI typ I je nejmírnější formou OI s autozomálně dominantním typem dědičnosti. Riziko vzniku zlomenin je zvýšené v období dětství a následně v postmenopauzálním období žen a po šedesátém roce života mužů. Jedinci dosahují normální tělesné výšky, mohou mít mírně deformované kosti, modré zabarvení bělma a trpět nedoslýchavostí. U některých pacientů může být diagnostikována c 2012 EuroMISE s.r.o.

2 Šormová, Mazura, Mařík Analýza mutací genu COL1A1 cs31 dentinogenesis imperfecta (DI). Na základě přítomnosti tohoto znaku rozlišujeme OI typ IA (absence DI) a OI typ IB (přítomnost DI). Přítomnost výše uvedených znaků je vysoce variabilní [9, 17]. OI typ II je perinatálně letální formou. Běžným znakem je mrtvorozenost a vysoká úmrtnost jedinců v perinatálním období, která činí až 80 %. K prvním zlomeninám dochází již během intrauterinního vývoje plodu. Pacienti mají vážně deformované kosti, obličej trojúhelníkového tvaru a modře čí šedě zbarvené skléry. V rámci druhého typu jsou vyčleněny tři podtypy IIA, IIB a IIC, a to v závislosti na hodnocení výskytu radiologických znaků jako jsou deformace žeber a dlouhých kostí, cefalometrických znaků (makro- či mikrocefalie), typu dědičnosti a mutovaného genu (autozomálně dominantní typy IIA a IIC vznikají v důsledku mutací genů COL1A1 a COL1A2, zatímco kauzálním genem autozomálně recesivního typu IIB je gen CRTAP) [2]. Třetí typ onemocnění je mírně deformující autozomálně dominantní či recesivní formou OI. Pacienti jsou podprůměrného vzrůstu, mají krátké končetiny, vážně deformované kosti, hypermobilní klouby, trojúhelníkový obličej, tmavě modré skléry (během dospívání intenzita zabarvení klesá) a DI. Typickým radiologickým znakem jsou wormianské kůstky přítomné v lebečních švech a popcornová kalcifikace epifýz a metafýz dlouhých kostí. Z důvodu těžké skoliózy, tenkých diafýz dlouhých kostí a vysoké frekvence zlomenin, k nimž dochází během běžných denních aktivit, jsou pacienti po většinu života upoutání na invalidní vozík [13]. OI typ IV je nejvíce heterogenním, autozomálně dominantním typem tohoto onemocnění. Tělesná výška jedinců je podprůměrná až nízká, kosti jsou deformované a podobně jako u předchozího třetího typu, mohou být epifýzy a metafýzy dlouhých kostí popcornové struktury. První fraktury vznikají během porodu, pacienti mají bíle, šedě či modře zbarvené skléry a mohou mít diagnostikovánu otosklerózu. Typickým znakem tohoto typu je basilární imprese. Na základě přítomnosti DI jsou v rámci čtvrtého typu rozlišovány podtypy IVA (absence DI) a IVB (přítomnost DI) [7]. 1.2 Nekolagenní formy osteogenesis imperfecta OI type V je autozomálně dominantním typem osteogenesis imperfecta s nejasným genetickým původem. Jedná se o mírně deformující formu vyznačující se tvorbou hypertrofického kalu v místě zlomeniny a kalcifikací mezikostní membrány kostí předloktí [5, 12]. Šestý typ této choroby je přenášen autozomálně recesivně. Typickými znaky tohoto typu jsou vzhled kostních lamel, které svým tvarem připomínají rybí šupiny, a osteopenie. Dlouhé kosti pacientů jsou deformované, metafýzy mají bulvózní tvar [12, 13]. Tato forma je způsobena mutacemi genu SerpinF1 [5]. OI typ VII je autozomálně recesivní forma OI s vážným až letálním klinickým projevem. Hlavními znaky jsou rhisomelické zkrácení končetin a exoftalmus. Četnost zlomenin klesá během dospívání jedinců. Tento typ vzniká v důsledku mutací genu CRTAP [16]. Další autozomálně recesivním typem OI je typ VIII. Fenotyp postižených jedinců je podobně jako u předchozí formy velice variabilní od vážného k letálnímu projevu choroby. Typickým klinickým znakem je rhisomelické zkrácení končetin, dalšími běžně se vyskytujícími radiologickými znaky jsou bulbózní metafýzy, zkrácení dlouhých kostí a osteoporóza. Kauzálním genem je gen LEPRE1 [4, 5]. Osteogenesis imperfecta typ IX je mírnou až letální formou vyznačující se klinickými znaky shodnými s III a IV typem OI. Choroba je přenášena autozomálně recesivně a je způsobena defektním genem PPIB [9]. Vážný až letální OI typ X, autozomálně recesivní forma OI, vyplývá z mutací genu SerpinH1. Podobně jako u typů VII a VIII se tento typ vyznačuje rhizomelickým zkrácením končetin postižených jedinců [5]. Posledním typem OI je typ XI. Jedná se o autozomálně recesivní onemocnění, které je výsledkem mutací genu FKBP10. Typickým klinickým znakem jsou podobně jako u šestého typu kostní lamely tvaru rybích šupin [5]. 1.3 Molekulárně genetická podstata osteogenesis imperfecta % všech případů OI má svou genetickou podstatu v mutacích jednoho ze dvou genů kolagenu typ I COL1A a COL1A2. Molekula proteinu je tvořena dvěma alpha1 řetězci kódovanými genem COL1A1 na chromozomu 17 a jedním alpha2 řetězcem kódovaným genem COL1A2, který se nachází na chromozomu 7. Nesložené řetězce podléhají mnoha modifikacím (4-prolyl hydroxylace, 3-prolyl hydroxylace, hydroxylace lysinu, glykosylace), které zvyšují stabilitu molekuly proteinu. Takto modifikované řetězce jsou následně ve směru od C- k N-konci skládány v heterotrimer zakončený N- a C-terminálními propeptidy (tímto lze vysvětlit fakt, že mutace situované v C-oblasti molekuly proteinu mají za následek závažnější postižení jedinců) [1, 9]. Nejdůležitější aminokyselinou vyskytující se v alpha řetězci je glycin (Gly), který produkuje meziřetězové vazby. Glycin se nachází na každé třetí pozici 338 repetitivních sekvencí Gly-X-Y a zodpovídá za korektní formaci alpha řetězců do struktury trojšroubovice. Přibližně % strukturních defektů kolagenu typ I plyne ze substitucí glycinu jinou aminokyselinou [10]. 36 % substitucí glycinu kódovanými genem COL1A1 vede v letální fenotyp, zatímco v rámci genu COL1A2 má za následek letalitu 19 % záměn této aminokyseliny [5]. Dalšími klíčovými oblastmi alpha řetězců jsou místa vazeb transkripčních faktorů, tedy vazebná místa aktivačních proteinů (tzv. enhancery a silencery) aktivujících či inhibujících transkripci [6]. Dále mezi ně řadíme oblasti bohaté na CpG. c 2012 EuroMISE s.r.o.

3 cs32 Šormová, Mazura, Mařík Analýza mutací genu COL1A1 Obrázek 1: Přehled identifikovaných mutací/polymorfismů v genu COL1A1. Tyto nukleotidy mohou podléhat metylacím, jejichž výsledkem je mírný fenotyp, pokud se tak stane v promotoru, exonu 1 či intronu1, a vážný klinický obraz, pokud se metylované CpG nacházejí v kódující oblasti genů COL1A1 a COL1A2. V současnosti je popisováno, že tomuto procesu může podléhat 26 z 338 kodonů glycinu v alpha řetězcích [8]. V rámci molekuly kolagenu dále existují tři vazebné oblast, tzv. Multi Ligand Binding Regions (MLBR1-3), které produkují mezimolekulární vazby s dalšími molekulami pojivové tkáně, jako např. integriny, oligomerní protein chrupavkové matrix (Cartilage Oligomeric Matrix Protein, COMP), SerpinH1 a další. Vazby s těmito proteiny zvyšují pevnost a pružnost kostí a je prokázáno, že mutace oblastí MLBR2 a MLBR3 mají ve většině případů za následek letální typy osteogenesis imperfecta [5, 15]. 1.4 Léčba jedinců postižených osteogenesis imperfecta Léčba jedinců s osteogenesis imperfecta je různá a individuální na základě konkrétního klinického, radiologického a biochemického obrazu. Medikamentózní léčba zahrnuje užívání kalcia, vitaminu D a léčbu bisfosfonáty, které jsou běžně podávány při léčbě mírných a vážných forem OI. Specifickou funkcí bisfosfonátů je inhibice osteoklastů na povrchu kostí, čímž je docíleno zvýšení hustoty kostí a snížení rizika vzniku zlomenin [3]. Ortotická léčba je indikována u pacientů majících skoliózu a lehké deformity kostí končetin. Oproti tomu vážné deformity a zlomeniny se signifikantní dislokací jsou léčeny chirurgicky osteotomií a fixací s použitím nitrodřeňových prutů, hřebů, pinů apod. Vážnou skoliózu lze korigovat chirurgicky zavedením tzv. Harringtonových prutů, tento způsob léčby však značně omezuje následný rozsah pohyblivosti páteře. V současné době jsou vyvíjeny metody tzv. buněčné a genové terapie. Jejich cílem je nahrazení defektních osteoblastů a deaktivace mutovaných genů, čímž by bylo docíleno zvýšení minerální denzity kostí (buněčná terapie) a snížení klinické závažnosti OI (genová terapie) [9, 11]. 2 Materiál a metody V rámci této studie byly analyzovány vzorky gdna získaných z žilní krve 25 českých pacientů (čtyři nepříbuzné rodiny a sedmnáct sporadických případů) s diagnózou osteogenesis imperfecta typ I-IV 19 pacientů postiženo OI typem IA, pět pacientů postiženo třetím typem onemocnění a jeden pacient typem IVB. Všichni vyšetřovaní pacienti podepsali informovaný souhlas povolující provedení molekulárně genetické analýzy jejich DNA. Vzorky krve byly kompletovány na několika pracovištích České republiky Praha, Brno, Hradec Králové, Olomouc a Ostrava. Molekulárně genetické analýzy izolované gdna byly zaměřeny na gen COL1A1 proteinu kolagenu typ I. Genomická DNA byla izolována s použitím QIAamp DNA Blood Midi Kit (QIAGEN) izolačního kitu a uchována při teplotě -20 C. Kvalita DNA izolátů byla ověřena elektroforeticky, kvantita spektrofotometricky. Takto ověřené vzorky DNA byly amplifikovány metodou polymerázové řetězové reakce (PCR) s použitím pro tuto analýzu speciálně vytvořených 100% komplementárních primerů zaměřených na šest regionů DNA zahrnujících exony Tato oblast DNA byla vybrána Tabulka 1: Přehled identifikovaných mutací/polymorfismů českých OI pacientů. Č. pacienta OI typ Pohlaví Věk Změna nukleotidu Mutace/ Umístění v COL1A1 (v rocích) Polymorfismus 1 III Žena 23 GGC/TGC Gly526Cys exon 31 ACT/ACC Thr588Thr exon 33 2 IA Muž 22 T/C I32T15375C intron 32 C/G I39C17332G intron 39 ACT/ACC Thr588Thr exon 33 3 IVB Žena 52 T/C I32T15375C intron 39 C/G I39C17332G intron 31 c 2012 EuroMISE s.r.o.

4 Šormová, Mazura, Mařík Analýza mutací genu COL1A1 cs33 Obrázek 2: Sekvenční struktura exonu 31. Pozice substituce Gly526Cys je vyznačena tučně, záměna nukleotidu je zvýrazněna červenou kurzívou. Obrázek 3: Sekvenční struktura exonu 33. Pozice substituce Thr588Thr je vyznačena tučně, záměna nukleotidu je zvýrazněna červenou kurzívou. Obrázek 4: Sekvenční struktura intronu 32. Pozice polymorfismu I32T15375C je vyznačena červenou kurzívou. Obrázek 5: Sekvenční struktura intronu 39. Pozice substituce I39C17332G je vyznačena červenou kurzívou. na základě přítomnosti oblasti multi ligand binding region 2. Sekvence použitých primerů jsou následující: G1-1 CATCCGTCAAGGTGCGTCG a G1-2 CCTGCCCTG- GTCTTTTCCC produkující 350bp dlouhý amplikon zahrnující exon 31; G2-1 CTGGAGTCTGGGCTGTGAG a G2-2 GTGTTCTGCTTGTGTCTGGG primery syntetizující produkt o velikosti 660bp obsahující exon 32; G3 1 CCAGACACAAGCAGAACACT a G3-2 CTGAGAG- CAAGGGACAAGA zaměřené na 402bp dlouhý region s obsaženým exonem 33; G4-1 TCAACCTGGGAACCT- GGAG a G4-2 CAGCATCGCCTTTAGCACC, které produkují 662bp dlouhý PCR produkt zahrnující exony 34 a 35; G5-1 TTCCTGCCTCCATTACT GC a G5-2 AA- CAGCCAACTCATCCGAC amplifikující oblast o velikosti 426bp obsahující exony 36 a 37; a poslední pár primerů G6-1 GGTGCTACTGGTTTCCCTGG a G6-2 TCTGTTCTCCTTGGCTCC GC vymezující 645bp dlouhý úsek DNA s exony 38, 39 a 40. Pro polymerázovou řetězovou reakci byla připravena reakční směs o finálním objemu 50 µl. Složení reakční směsi bylo následující: 100 ng genomické DNA, 25 µl Taq PCR MasterMix (1000U) (QIAGEN) (tento mastermix obsahuje Taq polymerázu (5 U/µl), PCR Buffer, MgCl 2 (1,5 mm), dntps (4 x 200 µm)) a 0,5 µl (50 pmol) každého primeru. PCR byla provedena v 35 opakujících se cyklech zahrnujících 0,5 min při 95 C, 0,5 min při 59 C (systém G1)/ 58 C (systémy G2, G4 a G6)/ 57 C (systém G3)/ 53 C (systém G5), a 1 min při 72 C. Získané produkty byly elektroforeticky ověřeny na 2% agarózovém gelu. Sekvenční analýza PCR amplikonů genu COL1A1 byla provedena metodou automatického kapilárního sekvenování. V této studii byl použit BigDye R Terminator v3.1 Cycle Sequencing Kit (Life Technologies Corporation, USA). Získaná data byla porovnávána s odpovídajícími segmenty genu COL1A1 zdravé populace použitím PC programů DNA Baser a SeqScape R Software for Mutation Profiling v2.7. Identifikované změny DNA byly následně porovnávány s databází OMIM. 3 Výsledky Prostřednictvím molekulárně genetických analýz byly odhaleny mutace u tří z pětadvaceti českých OI pacientů. Změny byly nalezeny jak v kódujících, tak v nekódujících oblastech DNA, konkrétně v exonech 31 a 33 a intronech 32 a 39 (Tab. 1, Obr. 1). c 2012 EuroMISE s.r.o.

5 cs34 Šormová, Mazura, Mařík Analýza mutací genu COL1A1 Substituce glycinu cysteinem na pozici 526 exonu 31 (Obr. 2) byla odhalena v DNA vzorku pacienta postiženého třetím typem OI (viz. kapitolu 3.1.1). Jedná se o mutaci běžně se vyskytující u této formy choroby. Poprvé byla popsána v roce 1989 (Starman et al.) [14]. Další mutace kódující sekvence byla odhalena u pacientů s diagnózou osteogenesis imperfecta typ IA (viz. kapitolu 3.1.2) a IVB (viz. kapitolu 3.1.3) (Obr. 3). V obou případech se jedná o tichou mutaci threoninu na pozici 588 exonu 33. U těchto pacientů byly dále identifikovány změny v oblastech intronů 32 (Obr. 4) a 39 (Obr. 5). 3.1 Kazuistika Osteogenesis imperfecta typ III Prvním popisovaným případem je 23letá žena narozená z druhé gravidity nepostižených rodičů. Porod byl proveden císařským řezem, následně musel být novorozenec resuscitován. Porodní hmotnost byla 2450g, porodní délka byla 45cm. Diagnóza byla stanovena ihned po narození pacientky. mobilní klouby. U pacientky nebyla stanovena ani nedoslýchavost ani dentinogenesis imperfecta. Během porodu došlo ke zlomeninám obou femurů, rentgenové snímky však dále odhalily zhojené zlomeniny žeber a levé klíční kosti z prenatálního období. Pacientka utrpěla během dětství a dospívání četné zlomeniny kostí, především dlouhých kostí končetin. Poslední fraktura zlomenina pravé klavikuly, byla zaznamenána v 19 letech. Pacientka začala chodit až ve věku 6 let a to pouze s pomocí ortéz dolních končetin, od jedenácti let je upoutána na invalidní vozík. Osteoporóza byla diagnostikována radiologickým vyšetřením kostry ve věku 15 a následně potvrzena ve věku 18 let. Snížení denzity kostní hmoty (BMD) bylo zároveň prokázáno denzitometrickým vyšetřením. Antropologickým a rentgenologickým vyšetřením byly u pacienta potvrzeny následující klinické projevy onemocnění: soudkový tvar hrudníku, deformovaná žebra, pectus carinatum, vážná skolióza, platyspondylie hrudních obratlů, vyšší těla bederních obratlů, bikonkávní tvar obratlů hrudní a bederní páteře, deformace lebečních kostí, angulace pravého předloktí a femurů, šavlovité deformace humerů a tibií a zkrácené femury. Metafýzi a epifýzy kostí v oblasti kolenních kloubů vykazují popcornovou strukturu (Obr. 6), tedy znak typický pro třetí typ této choroby. Medikamentózní léčba, konkrétně kalcitoninem, byla zahájena ve věku 7 let. O sedm let později byla u pacienta zavedena léčba bisfosfonáty. Součástí léčby je dále suplementace kalcia a vitaminu D3. Od věku dvou let podstoupila pacientka několik chirurgických zákroků (korekční osteotomie s nitrodřeňovou fixací). Součástí komplexní léčby byla ve věku od 6 do 16 let léčba ortotická. Molekulárně-genetické vyšetření identifikovalo mutaci typickou pro tento typ OI Gly526Cys. Další analýzy odhalily u pacientky mutaci genu MTHFR (A1298C), jejímž důsledkem je zvýšená srážlivost krve Osteogenesis imperfecta typ IA Druhým případem je 22letý muž postižený prvním typem onemocnění. Pacient se narodil z třetího těhotenství zdravého páru. Porodní hmotnost byla 2800g, porodní délka byla 50cm. Obrázek 6: Popcornová struktura epifýzy femuru pacienta s diagnózou třetího typu OI. Obrázek 7: Světle modré zbarvení bělma u pacienta postiženého OI typem IA. Klinické znaky prezentované u tohoto jedince jsou Pacient má modrý kolorit sklér (Obr. 7) a trpí nemodré skléry, trigonocefalie, hyperbrachycefalie, wormian- doslýchavostí a tinnitem. Na kůži obličeje, krku a hrudské kůstky v lebečních švech, mírný exoftalmus a hyper- níku lze pozorovat četné lentigines. Dalšími klinickými c 2012 EuroMISE s.r.o.

6 cs35 Šormová, Mazura, Mařík Analýza mutací genu COL1A1 znaky jsou štíhlý hrudník s úzkými vertikálně postavenými žebry, vysoké patro, ochablé svalstvo, hypermobilní klouby a asymetrická ramena. První zlomeninu prodělal ve věku 2 let, další v 9 letech (fraktura hrudních obratlů), v 11 letech (fraktura obou loketních kostí) a v 15 letech života (fraktura druhého metakarpu pravé ruky). Rentgenové snímky zobrazují deformity páteře napřímení hrudní kyfózy, oploštění bederní lordózy, platyspondylie hrudních obratlů a mírná skolióza. Dlouhé kosti dolních končetin vykazují mírné deformace a pacient má zkrácený čtvrtý a pátý paprsek nohou. Denzitometrické vyšetření prokázalo sníženou minerální denzitu kostí vzhledem k danému kalendářnímu věku (Z-skóre je nižší než -2,0). Pacient je léčen bisfosfonáty, kalciem a vitaminem D3 a podstoupil několik operací zahrnujících nitrodřeňovou fixaci Kirschnerovými dráty a tympanotomii. kloubní hypermobilita, zkrácený trup a dolní končetiny a časté bolesti zad. Ve věku dvou let prodělala četné zlomeniny zejména kostí dolních končetin. Poslední fraktura byla zaznamenána ve věku 14 let. Radiologická vyšetření prokazují přítomnost bikonkávních obratlů hrudní a bederní páteře, šavlovité deformity tibií (Obr. 8) a pravého femuru, varózní krčky kostí stehenních a valgózní paty. Medikamentózní léčba bisfosfonáty byla u pacientky zavedena ve věku 42 let. Současně je léčena vitaminem D3. Pacientka podstoupila pouze jeden chirurgický zákrok ve věku 47 let, konkrétně korekční operaci levého femuru. V současnosti se pohybuje s pomocí invalidního vozíku či francouzských holí a používá kolenní ortézu. Další molekulárně genetická vyšetření odhalila přítomnost heterozygotní mutace v genu MTHFR (A1298C) a dále homozygotní mutace 7TA/7TA genu UGT 1A1, která se projevuje tzv. Gilbertovým syndromem Osteogenesis imperfecta typ IVB Zajímavá je zároveň rodinná anamnéza pacientky, neboť manžel a dcera jsou postiženi syndromem Charcot V posledním případě se jedná o 53letou ženu posti- Marie Tooth v kombinaci s diabetickou neuropatií. Dcera ženou čtvrtým typem osteogenesis imperfecta. Jedná se pacientky vykazuje dále svalovou atrofii, křeče a parestezii o první dítě narozené v rodině bez známek zvýšené fragi- dolních končetin. lity kostí. Porodní antropometrické parametry pacienta byly 2840g a 47cm. 4 Diskuze Osteogenesis imperfecta je vysoce heterogenní onemocnění s molekulárně genetickou podstatou v mutacích genů kolagenu typ I. Klinický obraz postižených pacientů vykazuje značné rozdíly jak mezi jednotlivými typy nemoci, tak v rámci stejné formy onemocnění. V současnosti je ve světové literatuře popisováno několik korelací mezi pozicí mutace a jejím výsledným fenotypovým projevem. Obecně lze říci, že letální fenotyp mají za následek mutace lokalizované v C-oblasti alpha řetězců, substituce glycinu a nahrazení aminokyselinového zbytku aminokyselinou (amk) s rozvětveným postranním řetězcem. Tento fenotyp mají dále za následek mutace vedoucí v tzv. skipping exonů v 3 oblasti genu COL1A1 (zejména exony 14, 20, 22, 27, 30, 44 a 47) a exonů nacházejících se 5 k exonu 27 genu COL1A2 a mutace vytvářející nová střihová místa [8]. V rámci alpha řetězců byly vymezeny dvě oblasti (nazývané MLBR2 a MLBR3) v sekvenci alpha1 řetězce a osm oblastí alpha2 řetězce, jejichž mutace mají za následek především letální OI typ II nebo III. Naopak mutace prvních 200 amk zbytků, substituce glycinu v prvních 8590 amk zbytcích, nonsense mutace vytvářející tzv. STOP kodon a změny v N-terminální oblasti proteinu mají za výsledek především neletální klinický obraz [4, 8]. Závěrem lze říci, že mutace genu COL1A1 vedou obecně ve vážnější fenotypový projev onemocnění než muobrázek 8: Šavlovitá deformita levé tibie pacienta s diagnózou tace genu COL1A2. Nesmíme však zapomínat, že exprese OI typ IVB. mutací je kromě genetických faktorů dále ovlivňována např. nutričními či environmentálními změnami. Do této Pacientka má modré skléry, otosklerózu a trpí onemoc- studie bylo zahrnuto 25 českých pacientů postižených jedněním dentinogenesis imperfecta druhou dentici ztra- nou z kolagenních forem osteogenesis imperfecta. Defektní tila již ve věku 20 let. Dalšími znaky jsou generalizovaná DNA byla odhalena u tří z těchto pacientů, přičemž se ve c 2012 EuroMISE s.r.o.

7 cs36 Šormová, Mazura, Mařík Analýza mutací genu COL1A1 dvou z těchto případů jednalo o nové jednobodové mutace či polymorfismy. Substituce glycinu cysteinem na pozici 526 byla stanovena u pacienta s třetím typem OI. Poprvé tuto mutaci popsal Starman et al. v roce 1989 na případu iráckého chlapce. Klinický obraz popisovaný u iráckého probanda vykazuje shodné projevy onemocnění jako u českého pacienta. Oba jedinci mají modré skléry, defektní tvorbu dentinu (avšak bez příznaků dentinogenesis imperfecta), deformované kosti, wormianské kosti a prodělali během porodu zlomeniny [14]. Substituovaný glycin se z hlediska lokalizace mutace v rámci alpha řetězců nalézá v oblasti vazby integrinů. Změny v tomto úseku DNA postihují tvorbu intermolekulárních vazeb, a tudíž vedou k poklesu pevnosti kostní hmoty. Protože se jedná o nejfrekventovanější mutaci v rámci třetí formy OI, můžeme předpokládat, že má tato substituce za následek vážné deformace kostí. Mutace Thr588Thr byla identifikována u dvou pacientů postižených odlišnými formami OI typem IA a IVB. I přesto vykazují oba pacienti shodné klinické rysy, jako například modrý kolorit sklér, nedoslýchavost, kloubní hypermobilitu či osteoporózu. I když tato mutace nepostihuje transkripci, může mít negativní vliv na následnou translaci a tvorbu mezimolekulárních vazeb s proteinem chrupavkové matrix (COMP), který se váže k molekule kolagenu typ I v oblasti definované kodony Lze předpokládat, že tiché mutace v místech vazeb COMP mohou být jedním ze signálů budoucího rozvoje osteopenie a osteoporózy. Zatím se však jedná pouze o spekulaci. V současnosti není tato identifikovaná změna DNA popisována v žádné zahraniční literatuře. Oba polymorfismy (I32T15375C, I39C17332G), identifikované v rámci této studie, byly nalezeny u pacientů se substitucí Thr588Thr exonu 33. Žádná z těchto změn nevede ani k tvorbě STOP kodonů, ani k produkci prodlouženého či zkráceného produktu důsledkem vzniku nových míst střihu. Z toho lze soudit, že nepostihují tvorbu kolagenu typ I. Tyto polymorfismy nebyly doposud popsány v žádné zahraniční literatuře. 5 Závěr V současnosti probíhá shromažďování dalšího biologického materiálu (venózní krev, kostní tkáň, embryonální tkáň) českých pacientů s diagnózou osteogenesis imperfecta typu I-IV pro navazující molekulárně genetické analýzy ostatních kódujících oblastí genu COL1A1. Pro tyto analýzy je plánováno použití High Resolution Melting analýzy a technologie Sangerova sekvenování. Studie bude provedena ve spolupráci s molekulárně genetickou laboratoří Centre for Medical Genetics, Univerzita Antverpy, Edegem, Belgie. Poděkování Poděkování patří Mgr. Tomáši Pexovi a RNDr. Markétě Zachové, Ph.D. za poskytnutí laboratorního zázemí pro molekulárně genetické analýzy a MUDr. Olze Hudákové za poskytnutí užitečných informací z hlediska klinického popisu jednotlivých typů této choroby. Práce vznikla za podpory projektu CBI č IM06014 a projektem SVV Univerzity Karlovy v Praze. Literatura [1] Alanay Y, Avaygan H, Camacho N, Utine GE, Boduroglu K, et al. Mutations in the Gene Encoding the RER Protein FKBP65 Cause Autosomal-Recessive Osteogenesis Imperfecta. The American Journal of Human Genetics Apr; 86: [2] Barnes AM, Chang W, Morello R, Cabral WA, Weis M, Eyre DR, et al. Deficiency of cartilage associated protein in recessive lethal osteogenesis imperfecta. New Eng J Med. 2006; 355: [3] Becker J, Semler O, Gilissen C, Li Y, Bolz HJ et al. Exome Sequencing Identifies Truncating Mutations in Human SER- PINF1 in Autosomal-Recessive Osteogenesis Imperfecta. The American Journal of Human Genetics Mar; 88: [4] Cabral WA, Chang W, Barnes AM, Wies MA Scott MA, Leikin S, et al. Prolyl 3-hydroxylase 1 causes a recessive metabolic bone disorder resembling lethal/severe osteogenesis imperfecta. Nat Genet Mar; 39(3): [5] Forlino A, Cabral WA, Barnes AV, Marini JC. New perspectives on osteogenesis imperfecta. Nat. Rev. Endocrinol. 2011; 7: [6] Ghosh AK. Factors Involved in the Regulation of Type I Collagen Gene Expression: Implication in Fibrosis. Exp. Biol. Med. 2002; 227: [7] Kashyap RR, Gopakumar R, Gogineni SB, Sreejan CK. Osteogenesis imperfecta type IV. Kerala Dental Journal Jan; 32(1): [8] Marini JC, et al. Consortium for Osteogenesis Imperfecta Mutations in the Helical Domain of Type I Collagen: Regions Rich in Lethal Mutations Align With Collagen Bonding Site for Integrins and Proteoglycans. Human Mutation. 2007; 28(3): [9] Marini JC. Osteogenesis imperfecta Available at: /parathyroid17.pdf. (Revised 1 March 2010). [10] Marini JC, Cabral WA, Barnes AM. Null mutations in LEPRE1 and CRTAP cause severe recessive osteogenesis imperfecta. Cell Tissue Res Jan; 339(1): [11] Niyibizi C, Wang S, Mi Z, Robbins PD. Gene therapy approaches for osteogenesis imperfecta. Gene Therapy. 2004; 11: [12] Roughley PJ, Rauch F, Glorieux FH. Osteogenesis imperfecta clinical and molecular diversity. European Cells and Materials. 2003; 5: [13] Sorin H, Cornel C, Cristian CG, Iuliana P. Osteogenesis imperfecta: forensic assessment of traumatic injuries. Case report and literature review. Rom J Leg Med. 2008; 16 (4): c 2012 EuroMISE s.r.o.

8 Šormová, Mazura, Mařík Analýza mutací genu COL1A1 cs37 [14] Starman BJ, Eyre D, Charbonneau H, Harrylock M, Weis MA, Weiss L, Graham JM, Byers PH. The position of substitution for glycine by cysteine in the triple helical domain of the proalpha1(i) chains of type I collagen determines the clinical phenotype. J. Clin. Invest. 1989; 84: [15] Sweeney SM, Orgel JP, Fertala A, McAuliffe JD, Turner KR, Di Lullo GA, et al. Candidate cell and matrix interaction domains on the collagen fibril, the predominant protein of vertebrates. J Biol Chem Jul 25; 283(30): [16] Ward LM, Rauch F, Travers R, Chabot G, Szout EM, Lalic L, Roughley PJ, Glorieux FH. Osteogenesi imperfecta type VII: an autosomal recessive form of brittle bone disease. Bone. 2002; 31: [17] Wollina U, Koch A. Osteogenesis imperfecta type I and psoriasis a report on two cases. Egyptian Dermatology Online Journale Jun; 2(1): 15. [18] Yang Z, Zeng C, Wang Z, Shi HJ, Wang LT. Mutation characteristics in type I collagen genes in Chinese patients with osteogenesis imperfecta. Genetics and Molecular Research. 2011; 10 (1): c 2012 EuroMISE s.r.o.

Osteogenesis imperfecta typ I-IV, kolagenní porucha pojivové tkáně v české populaci

Osteogenesis imperfecta typ I-IV, kolagenní porucha pojivové tkáně v české populaci cs59 Původní práce Osteogenesis imperfecta typ I-IV, kolagenní porucha pojivové tkáně v české populaci Lucie Šormová1, Ivan Mazura2 1 Ústav hygieny a epidemiologie, 1. lékařská fakulta Univerzity Karlovy

Více

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009 Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková Parent projekt Praha 19.2.2009 Diagnostika MD její vývoj 1981-1986: zdokonalování diferenciální diagnostiky

Více

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení

Více

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder CADASIL analýza mutací v genu NOTCH3 H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder Ústav dědičných metabolických poruch 1. LF UK a VFN Oddělení patologie a nár. ref.

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

Cytokinový profil v periferii pacientů s osteoartrózou. rukou a genetické pozadí

Cytokinový profil v periferii pacientů s osteoartrózou. rukou a genetické pozadí Cytokinový profil v periferii pacientů s osteoartrózou rukou a genetické pozadí DNA Analýza XI Praha 1/6/214 Primární osteoartróza (OA) I. degenerativní kloubní onemocnění, výskyt stoupá s věkem eroze

Více

Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni

Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Hemofilie Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Definice hemofilie Nevyléčitelná vrozená krvácivá choroba s nedostatkem plazmatických faktorů FVIII hemofile A FIX hemofile

Více

Klinické a laboratorní aspekty osteoporosy

Klinické a laboratorní aspekty osteoporosy Klinické a laboratorní aspekty osteoporosy Vladimír Palička Ústav klinické biochemie a diagnostiky, Osteocentrum Lékařská fakulta a Fakultní nemocnice Hradec Králové BIOLAB, Hradec Králové, 31. května

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

Genetický screening predispozice k celiakii

Genetický screening predispozice k celiakii VETERINÁRN RNÍ A FARMACEUTICKÁ UNIVERZITA BRNO Farmaceutická fakulta Ústav humánn nní farmakologie a toxikologie Genetický screening predispozice k celiakii RNDr. Ladislava Bartošov ová,ph.d. 1, PharmDr.

Více

ILUSTRAČNÍ PŘÍKLADY OCENĚNÍ PRO POJISTNÉ PLNĚNÍ

ILUSTRAČNÍ PŘÍKLADY OCENĚNÍ PRO POJISTNÉ PLNĚNÍ ILUSTRAČNÍ PŘÍKLADY OCENĚNÍ PRO POJISTNÉ PLNĚNÍ PRACOVNÍ NESCHOPNOST NÁSLEDKEM ÚRAZU HLAVA Pohmoždění hlavy bez otřesu mozku Pohmoždění hlavy bez otřesu mozku s hospitalizací Zlomenina kostí nosních bez

Více

Části kostry, končetiny

Části kostry, končetiny AM110-0104 AM110-0084 AM110-0086 AM110-0102 AM110-0088 AM110-0065 AM110-0063 AM110-0059 AM110-0082 AM110-0090 AM110-0057 AM110-0061 AM110-0088 Kostra ruky, spojeno drátem, volba L/P AM110-0078 AM110-0080

Více

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00

Více

Downův syndrom. Renata Gaillyová OLG FN Brno

Downův syndrom. Renata Gaillyová OLG FN Brno Downův syndrom Renata Gaillyová OLG FN Brno Zastoupení genetických chorob a vývojových vad podle etiologie 0,6 %-0,7% populace má vrozenou chromosomovou aberaci incidence vážných monogenně podmíněných

Více

Vrozený zarděnkový syndrom - kazuistika. MUDr. Martina Marešová HS hl.m. Prahy

Vrozený zarděnkový syndrom - kazuistika. MUDr. Martina Marešová HS hl.m. Prahy Vrozený zarděnkový syndrom - kazuistika MUDr. Martina Marešová HS hl.m. Prahy Zarděnky - historie zarděnky byly poprvé popsány ve 2. pol. 18. stol. v roce 1866 nazvány rubella v roce 1941 australský oftalmolog

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

Proteiny Genová exprese. 2013 Doc. MVDr. Eva Bártová, Ph.D.

Proteiny Genová exprese. 2013 Doc. MVDr. Eva Bártová, Ph.D. Proteiny Genová exprese 2013 Doc. MVDr. Eva Bártová, Ph.D. Bílkoviny (proteiny), 15% 1g = 17 kj Monomer = aminokyseliny aminová skupina karboxylová skupina α -uhlík postranní řetězec Znát obecný vzorec

Více

TRÁPÍ VÁS NEBO VAŠE BLÍZKÉ BOLEST?

TRÁPÍ VÁS NEBO VAŠE BLÍZKÉ BOLEST? TRÁPÍ VÁS NEBO VAŠE BLÍZKÉ BOLEST? ZDE APLIKUJEME -MD INJEKCE Kompletní řada certifikovaných zdravotnických středků terapii bolesti způsobené onemocněním pohybového a podpůrného aparátu. zmírnění bolesti

Více

Současné vyšetřovací metody používané k diagnóze hemofilie. Mgr. Jitka Prokopová Odd. hematologie a transfuziologie Nemocnice Pelhřimov, p.o.

Současné vyšetřovací metody používané k diagnóze hemofilie. Mgr. Jitka Prokopová Odd. hematologie a transfuziologie Nemocnice Pelhřimov, p.o. Současné vyšetřovací metody používané k diagnóze hemofilie Mgr. Jitka Prokopová Odd. hematologie a transfuziologie Nemocnice Pelhřimov, p.o. Seminář podpořen z projektu: Vzdělávací síť hemofilických center

Více

ný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 gen Prohlášení Informace k onemocn BRCA1 gen

ný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 gen Prohlášení Informace k onemocn BRCA1 gen Dědičný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 genů. Foretová L., Macháčková E. Oddělení epidemiologie a genetiky nádorů, Masarykův onkologický ústav, Brno foretova@mou.cz

Více

Genetika dědičných neuropatií

Genetika dědičných neuropatií Genetika dědičných neuropatií P. Seeman Klinika dětské neurologie, DNA laboratoř, UK 2. LF a FN Motol Praha a CMT tým UK 2. LF a FNM CMT - dědičná choroba Známo již od Charcota, Marie a Tootha téměř 130

Více

Obecná anatomie kostí a kloubů. Karel Smetana Anatomický ústav 1. LF UK

Obecná anatomie kostí a kloubů. Karel Smetana Anatomický ústav 1. LF UK Obecná anatomie kostí a kloubů Karel Smetana Anatomický ústav 1. LF UK Endoskelet vs exoskelet Typy kostí Plochá Krátká Dlouhá David B. Fankhauser, Ph.D., Professor of Biology and Chemistry University

Více

Šablona č. 01.33. Přírodopis. Opakování: Kosterní soustava člověka

Šablona č. 01.33. Přírodopis. Opakování: Kosterní soustava člověka Šablona č. 01.33 Přírodopis Opakování: Kosterní soustava člověka Anotace: Opakování učiva o kosterní soustavě člověka Autor: Ing. Ivana Přikrylová Očekávaný výstup: Písemné opakování učiva o kosterní soustavě.

Více

Anotace: Žáci se během prezentace seznámili s kosterní soustavou, s nejdůležitějšími částmi kost. soustavy. Prezentace trvala 35 minut.

Anotace: Žáci se během prezentace seznámili s kosterní soustavou, s nejdůležitějšími částmi kost. soustavy. Prezentace trvala 35 minut. Základní škola a mateřská škola Lázně Kynžvart Autor: PAVLÍNA SEDLÁKOVÁ NÁZEV: VY_32_INOVACE_01_CJS_13 Vzdělávací oblast: Člověk a jeho svět Ročník: 5. Druh učebního materiálu: prezentace Číslo projektu:

Více

http://www.vrozene-vady.cz

http://www.vrozene-vady.cz Prevence vrozených vad z pohledu genetika MUDr. Vladimír Gregor, RNDr. Jiří Horáček odd. lékařské genetiky, Fakultní Thomayerova nemocnice v Praze Genetické poradenství Klinická genetika se zabývá diagnostikou

Více

Doporučený postup č. 3. Genetické laboratorní vyšetření v reprodukční genetice

Doporučený postup č. 3. Genetické laboratorní vyšetření v reprodukční genetice Účinnost k 1. 12. 2014 Doporučený postup č. 3 Genetické laboratorní vyšetření v reprodukční genetice Stav změn: 1. vydání Základním předpokladem genetického laboratorního vyšetření v reprodukční genetice

Více

VÁPNÍK A JEHO VÝZNAM

VÁPNÍK A JEHO VÝZNAM VÁPNÍK A JEHO VÝZNAM MUDr. Barbora Schutová, 2009 Ústav normální, patologické a klinické fyziologie, 3. LF UK Pozn.: Obrázky byly z důvodu autorských práv odstraněny nebo nahrazeny textem VÁPNÍK A JEHO

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Nemoci opěrné soustavy

Nemoci opěrné soustavy Nemoci opěrné soustavy EU peníze středním školám Didaktický učební materiál Anotace Označení DUMU: VY_32_INOVACE_BI1.4 Předmět: Biologie Tematická oblast: Biologie člověka Autor: RNDr. Marta Najbertová

Více

,, Cesta ke zdraví mužů

,, Cesta ke zdraví mužů PREZENTACE VÝSLEDKŮ ŘEŠENÍ PILOTNÍHO PROJEKTU PREVENTIVNÍ PÉČE PRO MUŢE,, Cesta ke zdraví mužů prim. MUDr. Monika Koudová GHC GENETICS, s.r.o.- NZZ, Praha Projekt byl realizován ve dvou etapách: I. etapa

Více

Genetika člověka GCPSB

Genetika člověka GCPSB Inovace předmětu Genetika člověka GCPSB Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/28.0032 Genetika člověka / GCPSB 7. Genetika

Více

KOMBINACE PEPTIDŮ BRÁNÍCÍCH STÁRNUTÍ

KOMBINACE PEPTIDŮ BRÁNÍCÍCH STÁRNUTÍ KOMBINACE PEPTIDŮ BRÁNÍCÍCH STÁRNUTÍ GMP PEPTIDY PRO KOSMETICKÉ PŘÍPRAVKY NOVÁ SYNTETICKÁ SLOŽKA KOSMETICKÝCH PŘÍPRAVKŮ PŘEHLED Výzkum základních biochemických mechanismů působení proti vráskám vedl k

Více

Pacient s hemofilií. Radomíra Hrdličková

Pacient s hemofilií. Radomíra Hrdličková Pacient s hemofilií Radomíra Hrdličková Hemofilie Vrozené krvácivé onemocnění (Genetická porucha sekundární hemostázy) Hemofilie A - deficit koagulačního faktoru VIII Hemofilie B - deficit koagulačního

Více

Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární

Více

HEMOFILIE - DIAGNOSTIKA A LÉČBA V SOUČASNOSTI

HEMOFILIE - DIAGNOSTIKA A LÉČBA V SOUČASNOSTI HEMOFILIE - DIAGNOSTIKA A LÉČBA V SOUČASNOSTI Patofyziologie hemofilie Deficit koagulačního faktoru VIII (hemofilie A) nebo IX (hemofilie B), jeho dysfunkce nebo přítomnost jeho inhibitorů vede k poruše

Více

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ

Více

ALLELE FREQUENCY OF KIT GENE ASSOCIATED WITH TOBIANO SPOTTING PATTERN IN PAINT HORSE BREED

ALLELE FREQUENCY OF KIT GENE ASSOCIATED WITH TOBIANO SPOTTING PATTERN IN PAINT HORSE BREED ALLELE FREQUENCY OF KIT GENE ASSOCIATED WITH TOBIANO SPOTTING PATTERN IN PAINT HORSE BREED FREKVENCE ALEL GENU KIT ASOCIOVANÉHO SE STRAKATOSTÍ TOBIANO U KONÍ PLEMENE PAINT HORSE Chalupová P., Déduchová

Více

www.printo.it/pediatric-rheumatology/cz/intro

www.printo.it/pediatric-rheumatology/cz/intro www.printo.it/pediatric-rheumatology/cz/intro Candle Verze č 2016 1. CO JE CANDLE 1.1 Co je to? Chronická atypická neutrofilní dermatóza s lipodystrofií a zvýšenou teplotou (CANDLE) patří mezi vzácná dědičná

Více

Studium genetické predispozice ke vzniku karcinomu prsu

Studium genetické predispozice ke vzniku karcinomu prsu Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie

Více

NAŠE ZKUŠENOSTI S LÉČBOU PERIPROSTETICKÝCH ZLOMENIN STEHENNÍ KOSTI. Klíčová slova - periprostetická zlomenina, osteosyntéza, svorková dlaha.

NAŠE ZKUŠENOSTI S LÉČBOU PERIPROSTETICKÝCH ZLOMENIN STEHENNÍ KOSTI. Klíčová slova - periprostetická zlomenina, osteosyntéza, svorková dlaha. NAŠE ZKUŠENOSTI S LÉČBOU PERIPROSTETICKÝCH ZLOMENIN STEHENNÍ KOSTI L. Pleva, R. Madeja, M. Šír Traumatologické centrum FNsP Ostrava Souhrn Autoři ve svém sdělení uvádějí možnosti léčby periprostetických

Více

binding protein alpha (CEBPA) a prognostický význam mutací v jeho genu u Ota Fuchs, Arnošt t Kostečka, Monika

binding protein alpha (CEBPA) a prognostický význam mutací v jeho genu u Ota Fuchs, Arnošt t Kostečka, Monika Transkripční faktor CCAAT/enhancer binding protein alpha (CEBPA) a prognostický význam mutací v jeho genu u akutní myeloidní leukemie Ota Fuchs, Arnošt t Kostečka, Monika Holická,, Martin Vostrý, ÚHKT

Více

Bioinformatika a výpočetní biologie KFC/BIN. I. Přehled

Bioinformatika a výpočetní biologie KFC/BIN. I. Přehled Bioinformatika a výpočetní biologie KFC/BIN I. Přehled RNDr. Karel Berka, Ph.D. Univerzita Palackého v Olomouci Definice bioinformatiky (Molecular) bio informatics: bioinformatics is conceptualising biology

Více

Opěrná a pohybová soustava

Opěrná a pohybová soustava Kosti kostra (skelet) - dospělý cca 206 kostí, dítě cca 300-13 14% hmotnosti - kosti dlouhé, krátké, ploché - chrupavka, vazivo Funkce: opora ochrana (orgánů) tvorba krve pohyb ukládání minerálních látek

Více

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD Shrnutí webináře Dystrofin 101: vše, co jste kdy chtěli vědět o dystrofinu (a nebáli jste se zeptat) Francesco Muntoni (University College of London), John Porter (PPMD) Dystrofinopatie: DMD versus BMD

Více

Morbus von Willebrand

Morbus von Willebrand Morbus von Willebrand 08:48 Bohumír Blažek Morbus von Willebrand nejčastější krvácivá choroba postihuje asi 1 % světové populace mírné symptomy, část nediagnostikována některé formy s těžkým průběhem zvláště

Více

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION VYUŽITÍ AUTOMATICKÉHO SEKVENOVÁNÍ DNA PRO DETEKCI POLYMORFISMŮ KANDIDÁTNÍCH GENŮ U PRASAT Vykoukalová Z., Knoll A.,

Více

Případ rodiny s malým vzrůstem a zkaženými zuby

Případ rodiny s malým vzrůstem a zkaženými zuby 339 Případ rodiny s malým vzrůstem a zkaženými zuby MUDr. Andrea Hladíková, Ph.D. 1, 2, MUDr. Eva Šilhánová 1, 2, MUDr. Jana Černá 3, Mgr. Renata Taslerová, Ph.D. 4, RNDr. Lenka Fajkusová, CSc. 4 1 Oddělení

Více

Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Výukový materiál zpracován v rámci projektu EU peníze školám Registrační číslo projektu: Šablona/číslo materiálu: Jméno autora: Třída/ročník CZ.1.07/1.5.00/34.0996 III/2 VY_32_INOVACE_TVD539 Mgr. Lucie

Více

www.printo.it/pediatric-rheumatology/cz/intro Blauův syndrom Verze č 2016 1. CO JE BLAUŮV SYNDROM/ JUVENILNÍ SARKOIDÓZA? 1.1 Co je to? Blauův syndrom je dědičné onemocnění. Pacienti trpí kombinací projevů:

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin

Více

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné

Více

Jistota účinnosti léčby osteoporózy. Potvrzení kostními markery již po 90 dnech

Jistota účinnosti léčby osteoporózy. Potvrzení kostními markery již po 90 dnech Jistota účinnosti léčby osteoporózy Potvrzení kostními markery již po 90 dnech Kosti jsou živé tkáně Věděli jste, že vaše kosti samy přeměňují různé živiny? Kostní tkáň se po celý váš život neustále odbourává

Více

Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor

Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor Moto: Nejvyšším štěstím každé rodiny je zdravé dítě Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor ČLK, 14. února 2013 Úvod Od poznání možností, které nám nabízí prenatální diagnostika, se embryo či později

Více

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE

GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE POHLED Z LABORATOŘE Petra Hedvičákov ková ÚBLG FN Motol Odd. lékal kařské molekulárn rní genetiky MZO 00064203 23.-24.5.2008

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny

Více

OSTEOPORÓZA. Markéta Vojtová

OSTEOPORÓZA. Markéta Vojtová OSTEOPORÓZA Markéta Vojtová Kost 1 Metabolicky aktivní orgán mechanická role + zásobárna minerálů organická složka (osein = kolagenní fibrily) anorganická složka (Ca, P, F) Maximum kostní hmoty 3. dekáda

Více

Vše co potřebujete vědět o hemoroidech. Rady pro pacienty

Vše co potřebujete vědět o hemoroidech. Rady pro pacienty Vše co potřebujete vědět o hemoroidech Rady pro pacienty CO? CO? JAK? JAK? KDY? KDY? PROČ? PROČ? CO CO jsou hemoroidy? je hemoroidální onemocnění? Anatomie řitního kanálu a konečníku Hemoroidy jsou přirozenou

Více

MUDr. Helena Šutová Laboratoře Mikrochem a.s.

MUDr. Helena Šutová Laboratoře Mikrochem a.s. Laboratorní diagnostika celiakie MUDr. Helena Šutová Laboratoře Mikrochem a.s. Celiakie Autoimunní onemocnění způsobené požitím lepku (glutenu) s typickým zánětlivým postižením tenkého střeva s genetickou

Více

Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.

Více

Trpíte defekty artikulární chrupavky? My máme řešení. ChondroFiller. Informace pro pacienty

Trpíte defekty artikulární chrupavky? My máme řešení. ChondroFiller. Informace pro pacienty Trpíte defekty artikulární chrupavky? My máme řešení. ChondroFiller Informace pro pacienty Vážený paciente, trpíte bolestmi kolenního, hlezenního nebo ramenního kloubu máte diagnostikovaný defekt kloubní

Více

Porucha srážlivosti krve Chorobná krvácivost Deficit faktoru VIII nebo IX, vzácně XI Celoživotní záležitost Geneticky podmíněné onemocnění

Porucha srážlivosti krve Chorobná krvácivost Deficit faktoru VIII nebo IX, vzácně XI Celoživotní záležitost Geneticky podmíněné onemocnění Život s hemofilií Hemofilie Porucha srážlivosti krve Chorobná krvácivost Deficit faktoru VIII nebo IX, vzácně XI Celoživotní záležitost Geneticky podmíněné onemocnění Genetika Chybná genetická informace

Více

GENvia, s.r.o. Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So

GENvia, s.r.o. Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So 20 1USA I Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 II Ne Po Út St

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

Vápník v prevenci a léčbě osteoporózy M. Stránský ISPM UNI Zürich

Vápník v prevenci a léčbě osteoporózy M. Stránský ISPM UNI Zürich Vápník v prevenci a léčbě osteoporózy M. Stránský ISPM UNI Zürich VI. Západoslovenské dni o osteoporóze Nitra 7. -8.2.2008 Osteoporóza je dětská nemoc (Kasper) Definice osteoporózy Osteoporóza je systémové

Více

Stavba pojivová tkáň (spojuje a izoluje orgány, složí k ukládání rezervních látek, plní funkci ochrannou). Tvoří ji: - vazivo - chrupavka - kost

Stavba pojivová tkáň (spojuje a izoluje orgány, složí k ukládání rezervních látek, plní funkci ochrannou). Tvoří ji: - vazivo - chrupavka - kost Opěrná (kosterní) soustava (skelet) - Tvořena pevnou a pohybovou oporu celého těla - orgán pasívního pohybu - krvetvorba - ochrana ostatních orgánů (např. páteř mícha, hrudník plíce, srdce aj.) Stavba

Více

doc. RNDr. Milan Bartoš, Ph.D.

doc. RNDr. Milan Bartoš, Ph.D. doc. RNDr. Milan Bartoš, Ph.D. Konference Klonování a geneticky modifikované organismy Parlament České republiky, Poslanecká sněmovna 7. května 2015, Praha Výroba léků rekombinantních léčiv Výroba diagnostických

Více

Osteoartróza (OA) je degenerativní, pomalé a progresivní onemocnění chrupavky synoviálního kloubu.

Osteoartróza (OA) je degenerativní, pomalé a progresivní onemocnění chrupavky synoviálního kloubu. 1.2 OBECNÁ ČÁST OSTEOARTRÓZA 1.2.1 Osteoarthrosis deformans definice Osteoartróza (OA) je degenerativní, pomalé a progresivní onemocnění chrupavky synoviálního kloubu. Všechny stavy a procesy, které mění

Více

Martina Havlíčková Helena Jiřincová. NRL pro chřipku, Státní zdravotní ústav

Martina Havlíčková Helena Jiřincová. NRL pro chřipku, Státní zdravotní ústav Pandemic H1N1 2009 Martina Havlíčková Helena Jiřincová NRL pro chřipku, Státní zdravotní ústav Z historie H1N1 1916-1917 pravděpodobná cirkulace viru, malá ohniska, lokální epidemie ve vojenských táborech,

Více

Forenzní stomatologie. doc. MUDr. Alexander Pilin, CSc. Ústav soudního lékařství a toxikologie 1. LF UK a VFN v Praze

Forenzní stomatologie. doc. MUDr. Alexander Pilin, CSc. Ústav soudního lékařství a toxikologie 1. LF UK a VFN v Praze Forenzní stomatologie doc. MUDr. Alexander Pilin, CSc. Ústav soudního lékařství a toxikologie 1. LF UK a VFN v Praze PČR Vyšetřování trestných činů Forenzní vědy Státní zástupce Forenzní stomatologie Trestní

Více

Charakteristiky vybraných deformit pátere Detská kyfóza Scheuermanova nemoc Hyperlordóza Plochá záda Skoliotické držení - skolióza

Charakteristiky vybraných deformit pátere Detská kyfóza Scheuermanova nemoc Hyperlordóza Plochá záda Skoliotické držení - skolióza DEFORMITY PÁTERE Obsah prednášky Charakteristiky vybraných deformit pátere Detská kyfóza Scheuermanova nemoc Hyperlordóza Plochá záda Skoliotické držení - skolióza Detská kyfóza (školní kulatá záda) Prícina:

Více

Deficit mevalonátkinázy (MKD) (nebo hyper IgD syndrom)

Deficit mevalonátkinázy (MKD) (nebo hyper IgD syndrom) www.printo.it/pediatric-rheumatology/cz/intro Deficit mevalonátkinázy (MKD) (nebo hyper IgD syndrom) Verze č 2016 1. CO JE MKD? 1.1 Co je to? Deficit mevalonákinázy patří mezi dědičná onemocnění. Jedná

Více

Úřad pro ochranu osobních údajů Pplk. Sochora 27, 170 00 Praha 7 Zasláno na e-mail: posta@uoou.cz. v Praze dne 4.9.2013.

Úřad pro ochranu osobních údajů Pplk. Sochora 27, 170 00 Praha 7 Zasláno na e-mail: posta@uoou.cz. v Praze dne 4.9.2013. Úřad pro ochranu osobních údajů Pplk. Sochora 27, 170 00 Praha 7 Zasláno na e-mail: posta@uoou.cz v Praze dne 4.9.2013 Dobrý den, obracím se na vás jménem občanského sdružení Iuridicum Remedium s podnětem

Více

Význam kostry. Mgr. Martina Březinová

Význam kostry. Mgr. Martina Březinová Identifikátor materiálu: EU 7-40 Přírodopis, 8.ročník Anotace Význam kostry Autor Mgr. Martina Březinová Jazyk Čeština Očekávaný výstup Speciální vzdělávací potřeby Žáci určí, co je oporou lidského těla,

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010

Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010 Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem Milan Bartoš Forum veterinarium, Brno 2010 Vývoj farmakogenetické diagnostické soupravy pro stanovení genetických polymorfismů

Více

HIV (z klinického pohledu)

HIV (z klinického pohledu) HIV (z klinického pohledu) David Jilich HIV centrum, Nemocnice Na Bulovce, Praha 11.12. 2014 Vývoj situace ve světě Changes in incidance rate 2001 to 2009 zdroj: UNAIDS Zákadní charakteristika virová infekce

Více

NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ

NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ Doc. MUDr. A. Šantavá, CSc. Ústav lékařské genetiky a fetální medicíny LF a UP Olomouc Význam genetiky v diagnostice neuromuskulárních onemocnění Podílí

Více

Laboratorní vyšetření v těhotenství- screening vrozených vývojových vad RNDr. I. Klabenešová OKB FN BRNO Metodika screeningu Lékařský screening slouží k vyhledávání osob s významným rizikem výskytu určité

Více

+ F1 F2 + TRANSPLANTAČNÍ PRAVIDLA. Inbrední kmen A. Inbrední kmen B. Genotyp aa. Genotyp bb. Genotype ab. ab x ab. aa ab ab bb Genotypy

+ F1 F2 + TRANSPLANTAČNÍ PRAVIDLA. Inbrední kmen A. Inbrední kmen B. Genotyp aa. Genotyp bb. Genotype ab. ab x ab. aa ab ab bb Genotypy IMUNOGENETIKA II TRANSPLANTAČNÍ PRAVIDLA Inbrední kmen A Inbrední kmen B - F1 - e x F2 y y TRANSPLANTAČNÍ PRAVIDLA Inbrední kmen A Inbrední kmen B - F1 - e 3 4 x 3 4 F2 - - y y Transplantace orgánů,, které

Více

OSTEOPORÓZA PÁTEŘE. Tóth L., Včelák J. O r t h o p a e d i c c l i n i c B U L O V K A P r a g u e

OSTEOPORÓZA PÁTEŘE. Tóth L., Včelák J. O r t h o p a e d i c c l i n i c B U L O V K A P r a g u e OSTEOPORÓZA PÁTEŘE Tóth L., Včelák J. O r t h o p a e d i c c l i n i c B U L O V K A P r a g u e Na osteoporózou postižené páteři musíme rozlišovat dvě zásadně odlišné způsoby poškození. Bez úrazu vzniká:

Více

KONGENITÁLNÍ SVALOVÉ DYSTROFIE

KONGENITÁLNÍ SVALOVÉ DYSTROFIE KONGENITÁLNÍ SVALOVÉ DYSTROFIE Vondráček P. Hermanová M. Fajkusová L. Klinika dětské neurologie LF MU a FN Brno Patologicko-anatomický ústav LF MU a FN Brno CMBGT IHOK FN Brno Kongenitální svalové dystrofie

Více

Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu

Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu Srovnal J. 1, Cincibuch J. 2, Cwierkta K. 2, Melichar B. 2, Aujeský R. 3, Vrba R.

Více

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Osteoporóza. Osteoporóza ztráta jak organické, tak anorganické složky (řídnutí) Osteomalácie ztráta anorganické složky (měknutí)

Osteoporóza. Osteoporóza ztráta jak organické, tak anorganické složky (řídnutí) Osteomalácie ztráta anorganické složky (měknutí) Terapie osteoporozy Osteoporóza systémová choroba kostry charakterizovaná snížením kostní hmoty se zhoršením mikroarchitektury kosti a s následným vzestupem fragility a rizikem zlomenin Osteoporóza Osteoporóza

Více

Rozhodovací proces při akutním útlaku míchy expansivním extraspinálním procesem

Rozhodovací proces při akutním útlaku míchy expansivním extraspinálním procesem Rozhodovací proces při akutním útlaku míchy expansivním extraspinálním procesem Zdeněk Adam a Pavel Šlampa Interní hematoonkologická klinika LF MU a FN Brno Radioterapeutická klinika MOU NADAČNÍ FOND Česká

Více

UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Vývojové vady a ortopedie. studijní opora pro kombinovanou formu studia

UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Vývojové vady a ortopedie. studijní opora pro kombinovanou formu studia UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vývojové vady a ortopedie studijní opora pro kombinovanou formu studia Tělesná výchova a sport zdravotně postižených Doc.MUDr.Eva Kohlíková,

Více

ANALÝZA OBRAZU V HODNOCENÍ SYMETRIE OBLIČEJE Patrik Fiala, Pavel Kasal, Lubomír Štěpánek, Jan Měšťák

ANALÝZA OBRAZU V HODNOCENÍ SYMETRIE OBLIČEJE Patrik Fiala, Pavel Kasal, Lubomír Štěpánek, Jan Měšťák ANALÝZA OBRAZU V HODNOCENÍ SYMETRIE OBLIČEJE Patrik Fiala, Pavel Kasal, Lubomír Štěpánek, Jan Měšťák Anotace Pro objektivní pohled na atraktivitu lidského obličeje jsou využívány metody, které hodnotí

Více

Markery kostního metabolizmu

Markery kostního metabolizmu Markery kostního metabolizmu MUDr. Richard Pikner, Ph.D. Odbor klinických laborato í, Oddělení kostního metabolizmu Klatovská nemocnice, a. s. Osteoblasty Osteoklast Rezorpční lakuna Osteocyty Remodelační

Více

Obsah ÚVOD. Definice fitness. Vliv kulturistiky na současnou fitness praxi. Historie kulturistiky. Definice síly. Druhy síly

Obsah ÚVOD. Definice fitness. Vliv kulturistiky na současnou fitness praxi. Historie kulturistiky. Definice síly. Druhy síly Obsah ÚVOD Definice fitness Vliv kulturistiky na současnou fitness praxi Historie kulturistiky Definice síly Druhy síly Rozložení svalstva na těle Velikost zatížení Počet opakování cviků a počet sérií

Více