Výzkumný ústav rostlinné výroby, v.v.i. Agrotest fyto, s.r.o. Bayer s.r.o. Editors: Pouchová V., Vaculová K., Ovesná J. ISBN

Rozměr: px
Začít zobrazení ze stránky:

Download "Výzkumný ústav rostlinné výroby, v.v.i. Agrotest fyto, s.r.o. Bayer s.r.o. Editors: Pouchová V., Vaculová K., Ovesná J. ISBN 978-80-7427-117-5"


1 Sborník příspěvků

2 Výzkumný ústav rostlinné výroby, v.v.i. Agrotest fyto, s.r.o. Bayer s.r.o. Editors: Pouchová V., Vaculová K., Ovesná J. ISBN

3 Obsah: Vliv genetických a agrotechnických faktorů na výskyt širokého spektra mykotoxinů v ječmeni 5 Hajšlová J., Džuman Z., Vepříková Z., Slavíková P., Jírů M., Šafránková I., Smutná P., Vaculová K., Zachariášová M. Lokalita jako významný produkční faktor u ječmene jarního 13 Cerkal R., Smutná P., Egert P., Tvarůžek L., Janečková L. Studium vlivu rozdílů v morfologických a vegetačních znacích na akumulaci mykotoxinů v zrně ječmene 21 Vaculová K., Milotová J., Balounová M., Matušinsky P., Zachariášová M., Hajšlová J., Džuman Z., Smutná P. Zhodnocení výskytu mykotoxinů v krmivech 31 Zachariášová M., Džuman Z., Hájková K., Vepříková Z., Hajšlová J. Osud mykotoxinů v gastrointestinálním traktu přežvýkavců, studie in vitro 37 Džuman Z., Vepříková Z., Fenclová M., Hajšlová J., Pozdíšek J., Křížová L., Stryk J., Zachariášová M. Detekce exprese vybraných genů syntézy trichothecenů u Fusarium culmorum po infekci ječmene 43 Faltusová Z., Ovesná J., Chrpová, J. Kontaminace ovsa sklizeného v čr fuzáriovými mykotoxiny 48 Polišenská I., Václavíková M., Jirsa O., Z. Štěrba, Hajšlová J. Technologická jakost a obsah deoxynivalenolu v zrnu obilovin s různou intenzitou kontaminace fusarium spp. 53 Capouchová I., Konvalina P., Stehno Z., Václavíková M., Prokinová E., Škeříková A., Janovská D. Zhodnocení komerčně dostupných rychlotestů pro stanovení obsahu deoxynivalenolu v cereáliích 58 Vepříková Z., Novotná D., Džuman Z., Václavíková M., Hajšlová J. Vliv fungicidního ošetření na infekci obilek ječmene houbami rodu fusarium 64 Kmoch M., Šafránková I., Pokorný R., Cerkal R. Geneticky modifikované organismy - hodnocení bezpečnosti a možnosti nových technologických postupů 71 Ovesná J. Rezidua pesticidů v ovoci a zelenině 75 v systémech integrované produkce a možnosti jejich regulace Kocourek F., Falta, V., Hajšlová J., Holý K., Hrbek V., Kocourek V., Stará, J., Urbanová J. Detekcia alergénnych zložiek v potravinách metódou real-time PCR 83 Piknová Ľ., Janská V., Siekel P. AFLP (Amplified Fragment Lenght Polymorphism) analýza kmenů Listeria monocytogenes 88 Hodek J., Purkrtová S., Karpíšková R., Pazlarová J., Demnerová K., Kučera L., Ovesná J. Možnosti využití matematických modelů předpovědní mikrobiologie 100 Erban V., Eichlerová E., Landfeld A., Čírtková V., Houška M. 3

4 Aplikácia interného štandardu v kvantifikácií alergénnych zložiek potravín polymerázovou reťazovou reakciou 105 Janská V., Piknová Ľ., Kuchta T., Siekel P Detekce přítomnosti sóji v mléčných výrobcích 110 Tesařová Z., Vráblík A, Hodek J., Šídová D., Ovesná J. Využitie ITS oblasti a 16s rdna génu pri identifikácii baktérií z hroznových bobúľ a z muštu 118 Godálová Z., Sallay B., Brežná B., Siekel P. Hodnocení změn genové exprese 124 vybraných odrůd ječmene stresovaných suchem s využitím dna čipů Svoboda P., Spiwok V., Jánská A., Hodek J., Ovesná J., Prášil I. Možnosti identifikace odrůd česneku 132 pomocí analýzy mikrosatelitů Leišová-Svobodová L., Mitrová K., Kučera L., Ovesná J. Komparativní in silico analýza sekvencí lakáz u ječmene a pšenice 139 Kučera L., Tomková L. Nutriční a senzorické vlastnosti a obsah vybraných kontaminantů v pekařských výrobcích z konvenčně a ekologicky pěstovaných obilovin 146 Gabrovská D., Fiedlerová V., Rysová J., Ouhrabková J., Laknerová I., Mašková E., Winterová R., Holasová M., Hajšlová J., Václavíková M., Capouchová I. Vytváření modelů předpovědní mikrobiologie 152 Erban V., Eichlerová E., Landfeld A., Čírtková V., Houška M. Vývoj a testování syntetické dna pro monitoring inhibicí/enhancerů ovlivňujících kvantitativní real-time PCR 157 Hodek J., Demnerová K., Ovesná J. Studium transgenních rostlin nesoucích geny pro dioxygenasu a metalothionein 164 Bečvářová Z., Neumannová E., Viktorová J., Nováková M., Fišer J., Macek T. Geneticky modifikované tabáky jako nástroj pro remediaci kontaminovaných ploch 169 Nováková M., Trbolová L., Viktorová J., Neumannová E., Fišer J., Bečvářová Z., Lovecká P., Macek T. Studium odpovědi ječmene na chlad pomocí dna čipů 174 Janská A., Aprile A., Cattivelli L., Zámečník J., De Bellis L., Ovesná J. Zeleniny rodu Allium jako potenciální zdroj minerálních látek určených k lidské spotřebě: obsah selenu 177 Ovesná J., Stavělíková H., Pouchová V. Rejstřík autorů: 183 4

5 VLIV GENETICKÝCH A AGROTECHNICKÝCH FAKTORŮ NA VÝSKYT ŠIROKÉHO SPEKTRA MYKOTOXINŮ V JEČMENI Influence of genetic and agronomical factors on the occurrence of multiple mycotoxins in barley 1 Hajšlová J., 1 Džuman Z., 1 Vepříková Z., 1 Slavíková P., 1 Jírů M., 2 Šafránková I., 2 Smutná P., 3 Vaculová K., 1 Zachariášová M. 1 Vysoká škola chemicko-technologická v Praze 2 Mendelova univerzita v Brně 3 Agrotest fyto, s.r.o. Kontaktní adresa 1. autora: prof. Ing. Jana Hajšlová, CSc., VŠCHT Praha, Technická 3, Praha 6, , Abstrakt Mikroskopické vláknité houby rodů Fusarium, Alternaria, Claviceps, Penicillium, či Asperigillus reprezentují významné polní patogeny napadající ječmen. Produkované mykotoxiny pak mohou znamenat významné zdravotní riziko pro člověka i pro hospodářská zvířata. Cílem realizované studie bylo zhodnotit vliv genetických a agrotechnických faktorů na výskyt více než 40mykotoxinů v ječmeni jarním. Celkem bylo analyzováno 39 odrůd ječmene jarního pěstovaného na několika lokalitách České republiky. Byly posuzovány hladiny výskytu mykotoxinů v závislosti na konkrétních odrůdách s rozdílným genetickým potenciálem akumulovat a metabolizovat mykotoxiny. Dále byl hodnocen vliv lokality i různého stupně fungicidního ošetření. Experimenty byly prováděny na přirozeně infikovaném, ale i cíleně inokulovaném ječmeni. Klíčová slova Mykotoxiny, odrůda ječmene, vliv lokality pěstování, vliv aplikace fungicidů. Abstract Microscopic filamentous fungi of the Fusarium, Alternaria, Claviceps, Penicillium, or Asperigillus genera represent important pathogens infecting field barley. Mycotoxins produced can be a health risk for humans and livestock. The aim of the study was to evaluate the influence of genetic and agronomical factors on the occurrence of mycotoxins in spring barley. In total, 39 varieties of barley grown in several locations within the Czech Republic were analyzed. Resistance of barley against accumulation of mycotoxins was monitored. Further, influence of growing locality and fungicide treatment was tested. Experiments were carried out both on naturally infected, and on artificially inoculated barley. Key words Mycotoxins, resistance of barley, influence of growing locality, effects of fungicides application 5

6 Úvod Mikroskopické vláknité houby rodu Fusarium (zvláště F. graminearum a F. culmorum), ale také Alternaria, Claviceps, Penicillium, či Asperigillus reprezentují významné polní patogeny napadající ječmen. Míra jejich výskytu na stanovišti je podmíněna spolupůsobením různých činitelů, např. počasí, agrotechniky, či konkrétní odrůdy. Kromě toho, že snižují kvalitu zrna a jsou příčinou výnosových ztrát, produkují tyto vláknité houby velké množství sekundárních metabolitů, mykotoxinů, vykazujících různý stupeň toxicity a majících tak negativní vliv na zdraví lidí a hospodářských zvířat. Mykotoxiny vláknitých hub rodu Fusarium jsou řazeny do několika hlavních skupin. Především se jedná o skupinu trichothecenů, fumonisinů, zearalenonů, ale i nově se vyskytujících enniatinů a beauvericinu. Nejvýznamnějšími alternariovými mykotoxiny jsou pak alternariol, alternariol monomethylether, altenuen, tentoxin a tenuazonová kyselina. Mezi reprezentanty sekundárních metabolitů patogenů rodu Claviceps patří námelové (ergotové) alkaloidy, např. ergosin, ergotamin, ergometrin, ergokornin, ergokristin a jejich stereoizomery. Škála produkovaných mykotoxinů je velmi variabilní, závisí na typu substrátu a dalších podmínkách prostředí, období kolonizace substrátu patogenem i na konkrétním chemotypu patogenu převládajícím v dané oblasti. V minulých letech byly v Evropě na pšenici dominantní druhy fusarií produkující deoxynivalenol (DON) ze skupiny trichothecenů typu B, který je díky četnosti svého výskytu považován za marker celkové mykotoxinové kontaminace. V posledních letech se však začínají rozšiřovat i typy vláknitých hub produkující ve velké míře trichothecen typu B nivalenol (NIV), ale i výše zmíněné nově se vyskytující enniatiny a beauvericin. Cílem prezentované práce bylo zhodnocení vlivu různých genetických a agrotechnických činitelů na výskyt širokého spektra mykotoxinů v ječmeni jarním. Pro tento účel byla analyzována řada odrůd a genetických zdrojů ječmene, pěstovaných na několika lokalitách České republiky. V první části studie byl testován vliv agrotechnických faktorů (vliv fungicidního ošetření, vliv lokality), druhá část byla fokusována převážně na posouzení genetických dispozic ječmene k akumulaci a metabolismu mykotoxinů. Testován byl i různý způsob chemického ošetření (vliv fungicidů). Vliv těchto faktorů na míru produkce mykotoxinů byl zhodnocen i na ječmeni cíleně infikovaném vláknitou houbou F. culmorum. Materiál a Metody Analyzované vzorky: Studie 1 Vliv agrotechnických faktorů na výskyt mykotoxinů v ječmeni. V rámci první studie bylo analyzováno celkem 320 vzorků ječmene jarního, pěstovaného v polních pokusech (sklizňová plocha parcely 10 m 2 ) 10 m 2 na čtyřech různých lokalitách v rámci ČR. Do pokusů byly zařazeny tyto odrůdy ječmene jarního: Aksamit, Bojos, Gladys, Kangoo, Malz, Prestige, Radegast, Sebastian, Tocada, Xanadu. Maloparcelní pokusy byly na jaře roku 2011 založeny na lokalitách Kroměříž, Senice, Libčany a Žabčice po předplodině cukrovce. Na každé lokalitě byly provedeny čtyři varianty fungicidního ošetření, které se mezi sebou lišily v druhu a způsobu aplikace ((1) kontrola bez fungicidů, (2) Hutton + Zantara, (3) Hutton + Prosaro, (4) Hutton + Prosaro s rozdílným termínem aplikace oproti variantě (3)). Stejný design byl použit jak v případě přirozené kontaminace, tak v případě cílené polní inokulace F. culmorum, která byla provedena postřikem ve vhodném vývojovém stádiu (BBCH 61 64), kdy je 50 % rostlin ve fázi počátku kvetení (koncentrace 0,5 mil. konidií F. culmorum /1 ml inokula, postřiková dávka 200 l/1 ha). Studie 2 Vliv genetických faktorů na výskyt mykotoxinů v ječmeni. V rámci druhé studie bylo analyzováno celkem 116 vzorků (29 odrůd a genetických zdrojů ječmene) z maloparcelních 6

7 pokusů na dvou lokalitách (Kroměříž a Žabčice, výměra 2,5-4,5 m 2 ), jak za podmínek přirozené, tak umělé infekce patogenem F. culmorum. Odrůdy a genetické zdroje ječmene jarního (odrůdy registrované v ČR; další odrůdy, uchovávané v Genové bance ČR; nové genetické zdroje ječmene jarního se specifickou nutriční kvalitou zrna nebo rozdílnými morfologickými znaky klasu a rostliny): Ricardo, Cebada Capa, Waggon, AF Lucius, KM 2084, KM 2551, Annabel, Prosa, Henrike, Diplom, Nitran, Kompakt, Pejas, CDC Rattan, Merlin, Amulet, Nordus, Krasnodarskij 95, Chevron, Madeira, Primus, AC Klinick, Rolfi, Druvis, Taiga, KM 2460, KM 1057, Arra, 6NDRFG-1. Odrůdy byly pěstovány po vhodných předplodinách za použití optimální pěstební technologie pro jednotlivé lokality. Z prostředků chemické ochrany byly použity pouze nezbytné herbicidy. Inokulace parcel F. culmorum byla provedena shodně jako v případě Studie 1. Analytická metoda: Pro izolaci mykotoxinů z homogenizovaných vzorků byla použita metoda QuEChERS. 1 V tomto případě jsou analyty extrahovány směsí acetonitril : voda a s využitím anorganických solí (NaCl a MgSO 4 ) vysoleny do méně polární acetonitrilové fáze. Ta je pak analyzována metodou ultra-účinné kapalinové chromatografie s tandemovou hmotnostně-spektrometrickou detekcí (U-HPLC MS/MS). Pro chromatografickou separaci byl použit ultra-účinný kapalinový chromatograf Acquity (Waters) a chromatografická kolona HSS T3, 100 x 2.1 mm; 1,8 µm (Waters). Eluce mykotoxinů probíhala za podmínek gradientové eluce, mobilní fáze byly na bázi metanolu a vody s obsahem mravenčanu a octanu amonného. Teplota kolony byla udržována na 40 C, nástřikový objem byl 2 µl. Detekce byla prováděna prostřednictvím a tandemové hmotnostní-spektrometrie s hmotnostním analyzátorem typu lineární iontová past, qtrapms/ms (AB Sciex). Ionizace analytů probíhala elektrosprejem v obou ionizačních modech (positivní / negativní). Separace a detekce iontů byla realizována prostřednictvím MRM (multiple reaction monitoring) modu. Kvantifikace byla prováděna s pomocí nejintenzivnějšího (kvantifikačního) iontového přechodu metodou externí kalibrace na kalibrační řadu matričních standardů. Výsledky byly korigovány na výtěžnost metody, která byla zjištěna pomocí analýzy vzorků s přidaným známým množstvím mykotoxinů (tzv. spiky ). Analyzované mykotoxiny: Nivalenol (NIV), deoxynivalenol (DON), deoxynivalenol-3- glukosid (D3G), 3-acetyldeoxynivalenol (3-ADON), 15-acetyldeoxynivalenol (15-ADON), fusarenon-x (FUS-X), HT-2 toxin (HT-2), T-2 toxin (T-2), diacetoxyscirpenol (DAS), neosolaniol (NEO), enniatin A (EnnA), enniatin A1 (EnnA1), enniatin B (EnnB), enniatin B1 (EnnB1), beauvericin (BEA), zearalenon (ZEA), fumonisin B1 (FB1), fumonisin B (FB2), fumonisin B3 (FB3), alfa-zearalenol (alfa-zol), beta-zearalenol (beta-zol), altenuen (Ate), alternariol (Aol), alternariol monomethyleter (Amet), aflatoxin B1 (AFB1), aflatoxin B2 (AFB2), aflatoxin G1 (AFG1), aflatoxin G2 (AFG2), sterigmatocystin (STE), ergokristin (Ekristin), ergokristinin (E-kristinin), ergokornin (E-kornin), ergokorninin (E-korninin), ergokryptin (E-kryptin), ergokryptinin (E-kryptinin), ergosin (E-sin), ergotamin (E-tamin), agroklavin (Agro), penitrem A (PenA), roquefortin C (RoqC), tentoxin (Tentox), tenuazonová kyselina (TenAc), penicilliová kyselina (PenAc), mykofenolová kyselina (MP Ac) stachybotrylaktam (STACH), meleagrin (MEL), paxilline (PAX), gliotoxin (Glio), citrinin (CIT), patulin (PAT). Výsledky a diskuze Studie 1 Vliv agrotechnických faktorů na výskyt mykotoxinů v ječmeni. V roce 2011 byly nejčastěji přirozeně se vyskytujícími mykotoxiny ječmene jarního metabolity vláknitých hub rodu Fusarium. Kromě běžných fusariových mykotoxinů jako jsou NIV, DON, D3G, 3- a 15- acetyl-don (ADONs), HT-2 a T-2 toxin se s vysokou četností a na vysokých hladinách vyskytovaly také enniatiny. Nutno konstatovat, že profil detekovaných 7

8 mykotoxinů se významně lišil mezi jednotlivými pěstebními lokalitami (viz Tabulka 1). Nejvyšší průměrné hladiny přirozeně se vyskytujících mykotoxinů byly zaznamenány na lokalitě Kroměříž. Opačná situace pak nastala na lokalitě Žabčice, kde byl detekován a kvantifikován pouze jediný mykotoxin, enniatin A. Co se týká zhodnocení výskytu a obsahu mykotoxinů v ječmeni po umělé inokulaci vláknitou houbou F. culmorum, byla pozorována zajímavá skutečnost. Zatímco v případě trichothecenů typu B (DON, D3G, ADONs) a ZON došlo k významnému navýšení jejich koncentračních hladin oproti neinfikované kontrole, v případě enniatinů došlo překvapivě k opačné situaci. Přítomnost cíleně inokulovaného patogenu buď jejich hladiny v ječmeni vůbec neovlivnila, nebo v řadě případů dokonce výrazně zredukovala. Příčinou bude zřejmě fakt, že tyto nově se vyskytující fusariové mykotoxiny jsou produkovány jinými fusariovými chemotypy, které byly v důsledku zvýšené přítomnosti umělého inokula potlačeny. Tabulka 1: Koncentrace nejčetněji detekovaných mykotoxinů v závislosti na pěstební lokalitě (varianta pěstování bez fungicidního ošetření, průměrné hodnoty ze všech odrůd; µg/kg). Přirozená infekce NIV DON D3G ADONs HT-2 T-2 ZON Enn B Enn B1 Enn A Enn A1 Kroměříž 65, , Senice 60,0 6,6-60,0 44,3 26,5 25, Libčany ,3 21,9 1, , Žabčice Cílená inokulace NIV DON D3G ADONs HT-2 T-2 ZON Enn B Enn B1 Enn A Enn A1 Kroměříž , ,6 Senice 60, , Libčany 46, , ,2 Žabčice , V rámci realizovaného experimentu byly na rostliny ječmene jarního aplikovány fungicidy s účinnými látkami cílenými proti fusariím (Hutton s účinnými látkami prothioconazol, spiroxamin a tebuconazol, Zantara s účinnými látkami tebuconazol a bixafen, a Prosaro obsahující prothioconazol a tebuconazol). Ve většině případů docházelo po aplikaci fungicidů také k procentuálnímu poklesu obsahu mykotoxinů DON, D3G, ADONs a ZON vzhledem ke kontrole (viz Obrázek 1). Jedinou výjimkou, kde došlo k mírnému zvýšení průměrných hladin těchto mykotoxinů po aplikaci fungicidů, byl případ přirozeně kontaminovaného ječmene pěstovaného v Libčanech. Příčinou mohl být např. nevhodný termín aplikace fungicidu vzhledem ke stupni zralosti, nebo samotná koncentrace fungicidu. Zrna napadená v mléčné zralosti jsou totiž houbovým myceliem prorůstána mnohem silněji, než je tomu v případě napadení v pozdějších stádiích vývoje ječmene. Vliv koncentrace fungicidu na inhibici růstu tohoto patogenu a následnou produkci mykotoxinů je pak velmi rozdílný. Co se však týká enniatinů, opět byl zaznamenán naprosto odlišný trend v jejich bilanci. Po aplikaci fungicidních přípravků došlo k výraznému nárůstu jejich koncentračních hladin, a to až o několik stovek procent vzhledem k neošetřené kontrole. Použití výše specifikovaných fungicidů evidentně potlačilo producenty běžných fusariových mykotoxinů ve prospěch producentů těchto nově se vyskytujících enniatinů. Co se týká korelace obsahu mykotoxinů ve vztahu s konkrétní odrůdou ječmene jarního, byly zaznamenány jisté odlišnosti mezi přirozenou infekcí a cílenou inokulací. Dá se však říci, že mezi odrůdy vykazující opakovaně vyšší hladiny mykotoxinů patřil Gladys. Naopak nižší hodnoty celkového obsahu mykotoxinů jak při při přirozené, tak při umělé infekci, byly nalézány u odrůd Malz a Xanadu. V tomto kontextu je nutno uvézt, že dle studie Šafránková 8

9 et al patřil Malz k odrůdám s nejvyšším stupněm napadení fuzárii. Porovnání s obsahem mykotoxinů v zrnu však nebylo v této publikaci provedeno. 2 Obrázek 1: Procentuální bilance obsahu mykotoxinů po fungicidním ošetření vzhledem ke kontrole. Průměrné hodnoty ze všech odrůd. (A) přirozená kontaminace, lokalita Kroměříž, (B) umělá inokulace, lokalita Kroměříž, (C) přirozená kontaminace, lokalita Libčany, (D) umělá inokulace, lokalita Libčany. Studie 2 Vliv genetických faktorů na výskyt mykotoxinů v ječmeni. Do druhého experimentu byly zařazeny odrůdy a nové genetické zdroje ječmene jarního, vybrané na základě deklarované rozdílné odolnosti vůči napadení fusárii. Tyto materiály se lišily jak v hospodářských, tak morfologických znacích (zejména klasu) a také v chemickém složení zrna. Co se týká celkového posouzení rozsahu mykotoxinové kontaminace přirozeně infikovaného ječmene, vyšší hladiny mykotoxinů byly zaznamenány v lokalitě Žabčice. Byly detekovány převážně mykotoxiny fusariové (hlavně trichotheceny typu B a enniatiny), ale i mykotoxiny alternariové. Alternariové toxiny byly sice kvantifikovány v nižších koncentracích, ale zato s poměrně vysokou četností výskytu. To může souviset s podmínkami počasí v Žabčicích (vyšší teploty a dostatek srážek během července), což je pro patogena rodu Alternaria velmi výhodné. Po umělé inokulaci vláknitou houbou F. culmorum došlo v ječmeni jarním k významnému zvýšení hladin trichothecenů typu B, zvláště pak v lokalitě Kroměříž. Rozdíl oproti Žabčicím zde byl řádově v deseti tisících μg/kg, ačkoliv výchozí kontaminace přirozeně kontaminovaného ječmene byla v Žabčicích podstatně vyšší. Tento trend lze vysvětlit 9

10 průběhem počasí v obou lokalitách. V Žabčicích byl v květnu a červnu 2011 (doba provedení umělé inokulace) celkově podprůměrný úhrn srážek a nadprůměrná teplota, což pro růst fusariového patogenu není příliš optimální. Nicméně aplikace koncentrátu F. culmorum pravděpodobně i tak ovlivnila možnost napadení jinými druhy vláknitých hub. Když pak v první dekádě července přišly silnější srážky i v Žabčicích mohlo dojít k pomnožení oněch dalších druhů a pozdějšímu napadení i porostů s přirozenou kontaminací. V Kroměříži byly naopak srážky silné již v květnu, takže umělá infekce se uchytila od počátku dobře. Co se týká koncentrace enniatinů, umělá inokulace F. culmorum opět způsobila výrazné snížení jejich hladin, pravděpodobně opět díky výše zmíněné kompetici jejich producentů. Tabulka 2: Koncentrace fusariových mykotoxinů, průměr ze všech odrůd (µg/kg). Přirozená infekce NIV DON D3G ADONs HT-2 T-2 ZON Enn B Enn B1 Enn A Enn A1 Kroměříž , Žabčice , Cílená inokulace NIV DON D3G ADONs HT-2 T-2 ZON Enn B Enn B1 Enn A Enn A1 Kroměříž ,2 3, Žabčice ,9 2, Tabulka 3: Koncentrace alternariových mykotoxinů, průměr ze všech odrůd (µg/kg). Přirozená infekce Ate Aol Amet Tentox TenAc Kroměříž - 7,2 2,1 - - Žabčice - 2,0 1,6 8,1 38 Cílená inokulace Ate Aol Amet Tentox TenAc Kroměříž ,0 - - Žabčice ,3 926 Zajímavá je i otázka mykotoxinové kontaminace ve vztahu k jednotlivým odrůdám. Nálezy mykotoxinů při cílené polní inokulaci ječmene jarního houbou F. culmorum jsou pro obě lokality ilustrovány na Obrázku 2. Nižší hladiny trichothecenů typu B byly v obou případech pozorovány u odrůd s bezpluchým typem zrna AF Lucius (DON µg/kg pro Kroměříž, 193 µg/kg pro Žabčice), CDC Rattan (DON 8012 µg/kg pro Kroměříž, <LOQ pro Žabčice) a Taiga (DON µg/kg pro Kroměříž, 502 µg/kg pro Žabčice) a rovněž u nových genetických zdrojů s bezpluchým zrnem KM 2460 (DON 7004 µg/kg pro Kroměříž, 622 µg/kg pro Žabčice) a KM 1057 (DON 8369 µg/kg pro Kroměříž, 487 µg/kg pro Žabčice). Z pluchatých materiálů měly nízké hladiny odrůdy Amulet (DON 9953 µg/kg pro Kroměříž, 537 µg/kg pro Žabčice) a Primus (DON 8375 µg/kg pro Kroměříž, 1300 µg/kg pro Žabčice), Oproti tomu, vysoké nálezy mykotoxinu DONu vykazovaly odrůdy Ricardo (DON µg/kg pro Kroměříž, 6169 µg/kg pro Žabčice), Cebada Capa (DON µg/kg pro Kroměříž, 5903 µg/kg pro Žabčice), Rolfi (DON µg/kg pro Kroměříž, 1483 µg/kg pro Žabčice) a Druvis (DON µg/kg pro Kroměříž, 4473 µg/kg pro Žabčice). Koncentrační hladiny glukosilované formy DON, DON-3-glukosidu, se ve všech případech pohybovaly v intervalu 17 až 56%. 10

11 Obrázek 2: Mykotoxinová kontaminace jednotlivých odrůd ječmene po cílené inokulaci F. culmorum. (A) lokalita Kroměříž, (B) lokalita Žabčice. V kontextu s nálezy mykotoxinů ve vztahu k jednotlivým odrůdám ječmene však zůstává otázkou, zda tyto nálezy volného a glukosilovaného DON skutečně vypovídají o celkové mykotoxikologické kvalitě ječmene. Je již částečně známo, že skrytou hrozbu při následném technologickém zpracování může znamenat i DON, který je navázán na zásobních polysacharidech zrna (škrobu), a který se může při procesech zpracování potravinářských surovin uvolňovat. Zejména se pak jedná o technologie zahrnujících enzymatické procesy, jako je sladařství a pivovarství. 3,4 V nadcházejících měsících a letech bude úsilí vědecké práce soustředěno na získání informací, které tyto komplikované a komplexní odpovědi budou moci poskytnout. Dedikace Práce byla financována ze zdrojů poskytnutých Ministerstvem zemědělství v rámci projektu QI111B044. Použitá literatura 1. Lacina et al. 2012: Critical assessment of extraction methods for the simultaneous determination of pesticide residues and mycotoxins in fruits, cereals, spices and oil seeds employing ultra-high performance liquid chromatography-tandem mass spektrometry. J. Chromatogr. A 1262,

12 2. Šafránková et al. 2010: Mykoflóra zrn sladovnických odrůd a linií ječmene jarního na lokalitách Kroměříž a Žabčice, Kvasný průmysl 56, Zachariasova et al. 2012: Deoxynivalenol-oligoglycosides: new masked Fusarium toxins occurring in malt, beer and breadstuff. J. Agric. Food Chem. 60, Kostelanská et al. 2011: Fusariové mykotoxiny v ječmeni jarním a jejich výskyt v rámci technologického řetězce ječmen-slad-pivo Kvasný průmysl 7-8,

13 LOKALITA JAKO VÝZNAMNÝ PRODUKČNÍ FAKTOR U JEČMENE JARNÍHO Locality as an important production factor of spring barley 1 Cerkal R., 1 Smutná P., 3 Egert P., 2 Tvarůžek L., 1 Janečková L. 1 Mendelova univerzita v Brně 2 Agrotest fyto, s.r.o. 3 Bayer s.r.o. Kontaktní adresa 1. autora: Doc.Ing. Radim Cerkal, PhD., Mendelova univerzita v Brně, Zemědělská 1, Brno Abstrakt V roce 2011 byl na čtyřech lokalitách (Kroměříž, Libčany, Senice, Žabčice) hodnocen produkční potenciál deseti odrůd ječmene jarního různé provenience (Aksamit, Bojos, Gladys, Kangoo, Malz, Prestige, Radegast, Sebastian, Tocada, Xanadu) ošetřovaných kombinacemi fungicidních přípravků Hutton (účinné látky tebukonazol, spiroxamin, prothiokonazol), Prosaro 250 EC (tebukonazol, prothiokonazol) a Zantara (tebukonazol, bixafen). Pro zvýšení infekčního tlaku byla polovina parcel na každé lokalitě inokulována izolátem F. culmorum (v BBCH 61 64). Výnos zrna se pohyboval na jednotlivých lokalitách v intervalu 5,30 8,78 t ha 1 (Žabčice < Senice < Libčany < Kroměříž). Nejvíce adaptabilními na podmínky prostředí lokalit byly odrůdy Tocada (7,85 t ha 1 ) > Gladys (7,75 t ha 1 ) > Sebastian (7,5 t ha 1 ), nejméně pak Malz (7,12 t ha 1 ) < Prestige (7,25 t ha 1 ) < Radegast (7,26 t ha 1 ). Účinnost jednotlivých strategií eliminace patogenů se lišila v závislosti na průběhu povětrnostních podmínek na lokalitě. Jako relativně nejúčinnější byla vyhodnocena kombinace Hutton (v BBCH 39) + Zantara (v BBCH 65). Klíčová slova sucho, ječmen, výnos, patogeny Abstract In 2011, the production potential of ten spring barley varieties of various origins (Aksamit, Bojos, Gladys, Kangoo, Malz, Prestige, Radegast, Sebastian, Tocada, Xanadu) treated by combination of fungicides Hutton (active ingredients tebuconazole, spiroxamine, prothioconazole), Prosaro 250 EC (tebuconazole, prothioconazole) and Zantara (tebuconazole, bixafen) was evaluated. To increase the infection level, half of the plots on each locality was inoculated with the F. culmorum (in BBCH 61 64) isolate. The grain yield on experimental localities ranged within the interval of t ha 1 (Žabčice < Senice < Libčany < Kroměříž). The most adaptable to the localities environmental conditions were varieties Tocada (7.85 t ha 1 ) > Gladys (7.75 t ha 1 ) > Sebastian (7.5 t ha 1 ), the least adaptable was Malz (7.12 t ha 1 ) < Prestige (7.25 t ha 1 ) < Radegast (7.26 t ha 1 ). The effectiveness of particular strategies of pathogens control depended on climatic conditions on each locality. The Hutton (in BBCH 39) + Zantara (in BBCH 65) combination produced the largest effect on Fusarium head blight. 13

14 Key words drought, barley, yield, pathogens, Fusarium Úvod Z hlediska produkčního potenciálu charakterizují lokalitu zejména půdní a klimatické podmínky. Pro vývoj porostů jsou ale mnohem významnější agrometeorologické podmínky v průběhu vegetační doby pěstované plodiny. Mezi vážná přírodní rizika posledních ročníků patří meteorologické extrémy, nejčastěji období tzv. agronomického sucha, kdy množství půdní vláhy nedostačuje nárokům rostlin, v kombinaci s vysokými teplotami. Sezónní a mezisezónní variabilita klimatických a povětrnostních podmínek je pro oblast střední a západní Evropy hlavním faktorem ovlivňujícím výnos (REILLY, SCHIMMELPFENNIG 1999; DARWIN, KENNEDY 2000). Pro region České republiky potvrzují tento trend např. TRNKA (2008), HRSTKOVÁ, STŘEDA (2009). Průběh počasí ovlivňuje nejen růst rostlin, ale také mikroklima porostů a tedy i potenciál prostředí k rozvoji patogenů. Cílem této práce proto bylo: i) Zhodnotit produkční potenciál ječmene jarního v různých podmínkách prostředí; ii) Ověřit adaptabilitu vybraných odrůd na podmínky pěstebních lokalit; iii) Posoudit efekt navržené strategie eliminace přirozené a umělé infekce porostů patogeny r. Fusarium. Materiál a metody Pokusy s ječmenem jarním byly v roce 2011 založeny na lokalitách Kroměříž, Libčany, Senice a Žabčice po předplodině řepě cukrové. Do pokusů byl na každé lokalitě zařazen soubor deseti odrůd Aksamit (CZ), Bojos (CZ), Malz (CZ), Radegast (CZ), Gladys (NL), Tocada (D), Sebastian (DK), Kangoo (NL), Prestige (F) a Xanadu (D). V průběhu vegetace byly porosty ošetřovány fungicidními přípravky dle schématu uvedeného v tab. 1. Cílem aplikace fungicidu Hutton jako standardního ošetření u všech fungicidních variant bylo dosáhnout dezinfekčních podmínek před nástupem fuzarióz, termín aplikace v BBCH a BBCH 39 byl zvolen vzhledem ke genu odolnosti proti padlí (Mlo) u některých odrůd. Agrotechnická data shrnuje tab. 2. V růstové fázi BBCH (počátek kvetení) proběhla inokulace části porostů (½) izolátem F. culmorum (koncentrace 0,5 mil. konidií /1 ml inokula, postřiková dávka 200 l ha 1 ). Výnos zrna byl přepočten na 14% vlhkost. Lokalita Kroměříž (17 22 E, N) Lokalita se nachází v řepařské výrobní oblasti. Pozemky mají průměrnou nadmořskou výšku 235 m n. m., roční úhrn srážek dosahuje cca 560 mm (průměr let ), srážkově nejbohatší je měsíc červen. Průměrná roční teplota je 8,7 C. Půda je klasifikována jako černozem luvická (ČMl), půdním druhem je prachová hlína. Povětrnostní podmínky ročníku 2011 znázorňuje obr. 1a. Lokalita Libčany (15 40 E, N) Lokalita je v teplém, mírně vlhkém klimatickém regionu řepařské výrobní oblasti v nadmořské výšce cca 250 m n. m. Průměrná roční teplota dosahuje 8,5 C a roční úhrn srážek představuje 600 mm. Půdy jsou jílovitohlinité, ilimerizované. Povětrnostní podmínky ročníku 2011 znázorňuje obr. 1b. Lokalita Senice (17 6 E, N) Lokalita se nachází v nadmořské výšce 250 m n. m. a patří do řepařské výrobní oblasti s teplým, mírně vlhkým klimatem. Roční suma srážek dosahuje 600 mm, průměrná roční 14

15 teplota je 8,1 C. Půdy jsou středně těžké, hlinité, půdním typem je degradovaná černozem. Povětrnostní podmínky ročníku 2011 znázorňuje obr. 1c. Lokalita Žabčice (16 37 E, N) Lokalita se nachází v kukuřičné výrobní oblasti a patří mezi nejteplejší regiony České republiky. Pokusné pozemky mají průměrnou nadmořskou výšku 179 m n. m., průměrný roční úhrn srážek představuje 483 mm (průměr let ), srážkově nejbohatší je měsíc červen (SVOBODA, BROTAN 2006). Povětrnostní podmínky ročníku 2011 znázorňuje obr. 1d. Půda je klasifikována jako fluvizem glejová. Zrnitostně se jedná o jílovitohlinitou až jílovitou půdu středně těžkou až těžkou. V suchém období svrchní půdní horizonty vysychají a vznikají v nich trhliny. Tab. 1 Schéma fungicidní ochrany ječmene jarního na pokusných lokalitách Kroměříž, Libčany, Senice a Žabčice v roce Varianta/ Ošetření Ošetření v BBCH Ošetření v BBCH 39 Ošetření v BBCH 65 1 Kontrola bez ošetření 2 Hutton 0,8 l ha 1 Zantara 1,5 l ha 1 3 Hutton 0,8 l ha 1 Prosaro 250 EC 0,75 l ha 1 4 Hutton 0,8 l ha 1 Prosaro 250 EC 0,75 l ha 1 Tab. 2 Termíny setí, způsoby ošetřování, sklizeň a doba vegetace ječmene jarního na pokusných lokalitách Kroměříž, Libčany, Senice a Žabčice v roce Lokalita Kroměříž Libčany Senice Žabčice Setí Dávka N (kg ha 1 ) Ošetřování Moddus (0,4 l ha 1 ) Axial Plus (0,6 l ha 1 ) Mustang Forte (0,8 l ha 1 ) Proteus (0,5 kg ha 1 ) Cerone (0,75 a 0,5 l ha 1 ) Sekator OD (0,12 l ha 1 ) + Esteron (0,3 l ha 1 ) v BBCH 25 Lintur 70 WG (150 g ha 1 ) Puma Extra (0,8 l ha 1 ) Inokulace Sklizeň Délka vegetace [dny]

16 Obr. 1 Průběh povětrnostních podmínek na lokalitách Kroměříž, Libčany, Senice a Žabčice v roce a) Kroměříž (17 22 E, N) b) Libčany (15 40 E, N; data pocházejí ze stanice Nechanice) c) Senice (17 6 E, N; dlouhodobé normály pocházejí ze stanice Věrovany) d) Žabčice (16 37 E, N) Pozn. Šedě podbarvené úseky grafu vyjadřují období s nedostatkem vláhy. Výsledky a diskuze V Kroměříži (tab. 3) byly v roce 2011 dosaženy velmi vysoké výnosy, které se pohybovaly v průměru od 7,56 t ha 1 (Sebastian) až po 9,84 t ha 1 (Aksamit). Mezi kontrolní variantou a variantami s fungicidním ošetřením byla zjištěna výnosová diference na úrovni 1,06 1,56 t ha 1, přičemž ošetření porostů bylo efektivnější na neinokulované variantě (výnosové diference 1,51 2,08 t ha 1 ) oproti variantě s inokulací (od 0,62 do 1,04 t ha 1 ). Podobně jako v Žabčicích také v Kroměříži nebyly mezi variantami použitých fungicidních přípravků (2 4) a jejich kombinací zjištěny průkazné výnosové rozdíly. 16

17 Také lokalita Libčany (tab. 4) patřila v roce 2011 k místům s vysokým výnosem zrna (8,32 t ha 1 ), i když zde byly porosty ječmene v počátku vegetace (březen, duben) stresovány suchem (obr. 1b). K odrůdám s vysokým výnosem zrna a tedy dobrou adaptabilitou k podmínkám prostředí patřily Tocada (8,90 t ha 1 ), Xanadu (8,80 t ha 1 ) a Sebastian (8,83 t ha 1 ). Naopak výnosově podprůměrná byla podobně jako v Senici odrůda Malz (7,77 t ha 1 ). Inokulované varianty poskytly průměrně vyšší výnosy než varianty bez inokulace, a to o 1,1 5,9 %. Všechny použité strategie eliminace výskytu patogenů (var. 2 4) byly z výnosového hlediska účinné a přispěly ke zvýšení výnosu zrna oproti kontrolní variantě o 15,2 (var. 4) až 18,6 % (var. 3). Lokalita Senice patří k regionům s relativně vysokou roční srážkovou činností (600 mm) a oproti Libčanům a Žabčicím zde nebyly v roce 2011 porosty na počátku vegetace vystaveny suchu. Průměrný výnos na lokalitě ale dosáhl jen 7,47 t ha 1 (tab. 5), tedy o % méně než na lokalitách Libčany a Kroměříž. Nejvyšší produktivitu měla odrůda Sebastian (8,07 t ha 1 ), naopak výnosově nejhorší byla odrůda Malz (6,79 t ha 1 ). Na této lokalitě se jako na jediné projevily průkazné rozdíly ve výnosu zrna po různých způsobech ošetření porostů fungicidy, kdy aplikace přípravků Hutton (v BBCH 39) a Zantara (v BBCH 65) na variantách č. 2 podpořila produktivitu porostů v porovnání s neošetřenými kontrolními variantami až o 23 %. Prakticky nejnižší výnosová úroveň (tab. 6) odrůd ječmene jarního (5,30 t ha 1 ) byla dosažena na lokalitě Žabčice (od 4,21 t ha 1 u odrůdy Radegast až po 5,86 t ha 1 u odrůdy Tocada). Mezi variantami použitých fungicidních přípravků (1 4) a jejich kombinací nebyly zjištěny průkazné výnosové rozdíly. Neinokulované varianty poskytly v porovnání s inokulovanými variantami v závislosti na použité fungicidní ochraně průměrně o 32 (var. 1), 28 (var. 2), 21 (var. 3) a 43 % (var. 4) vyšší výnos zrna na hektar. Tab. 3 Průměrný výnos zrna ječmene jarního [t ha 1 ] po ošetření fungicidními přípravky (Hutton, Prosaro 250 EC, Zantara) a inokulaci F. culmorum na lokalitě Kroměříž v roce Odrůda Průměr Fungicidní ošetření / Inokulace (kontrola) (Hutton + Zantara) (Hutton + Prosaro) (Hutton + Prosaro) N I N I N I N I Aksamit 9,84 a 9,61 8,15 10,48 10,71 11,14 8,38 10,33 9,93 Bojos 8,74 ab 8,19 7,65 9,58 8,61 9,46 8,57 8,62 9,21 Gladys 9,68 a 9,20 8,60 10,51 9,10 10,15 9,92 10,48 9,50 Kangoo 8,26 ab 6,33 7,50 10,65 8,86 8,13 7,26 9,40 7,93 Malz 8,64 ab 8,60 8,21 8,92 9,41 8,32 8,57 7,69 9,37 Prestige 9,06 ab 8,52 8,01 9,15 9,61 9,78 11,82 8,77 6,85 Radegast 8,99 ab 6,44 8,08 9,91 8,75 10,43 8,46 10,97 8,90 Sebastian 7,56 b 3,91 8,62 6,28 8,66 7,57 9,55 6,27 9,64 Tocada 8,97 ab 6,41 9,70 9,76 10,01 8,49 10,20 8,17 9,00 Xanadu 8,05 ab 6,81 7,52 9,51 8,72 7,57 8,04 8,39 7,83 7,40 8,20 9,48 9,24 9,10 9,08 8,91 8,82 Průměr 8,78 7,80 b 9,36 a 9,09 a 8,86 a Pozn. I inokulováno, N neinokulováno; Data pocházejí pouze z jednoho opakování.; Testováno dle Tukeye; Průměry jednotlivých variant/odrůd se významně ( 0,05) neliší, pokud jsou za nimi uvedena stejná písmena. 17

18 Tab. 4 Průměrný výnos zrna ječmene jarního [t ha 1 ] po ošetření fungicidními přípravky (Hutton, Prosaro 250 EC, Zantara) a inokulaci F. culmorum na lokalitě Libčany v roce Odrůda Průměr 1 (kontrola) Fungicidní ošetření / Inokulace 3 (Hutton + Prosaro) 2 (Hutton + Zantara) 4 (Hutton + Prosaro) N I N I N I N I Aksamit 7,89 bc 7,10 8,20 7,20 8,78 7,26 8,93 7,21 8,49 Bojos 8,31 abc 7,48 8,68 8,08 9,15 7,83 8,89 7,97 8,42 Gladys 8,31 abc 8,25 7,99 7,96 8,38 8,26 8,95 8,00 8,67 Kangoo 8,38 abc 7,08 7,87 9,20 8,16 9,43 8,42 8,51 8,39 Malz 7,77 c 7,09 7,60 8,03 8,45 6,58 8,59 7,72 8,07 Prestige 7,83 c 6,57 6,93 8,65 7,80 8,61 8,14 8,01 7,91 Radegast 8,22 abc 7,94 8,59 8,15 8,59 7,92 8,56 8,29 7,69 Sebastian 8,83 ab 8,23 7,57 8,51 8,74 9,41 9,77 9,23 9,19 Tocada 8,90 a 7,83 7,53 9,44 9,08 9,36 9,84 9,27 8,88 Xanadu 8,80 ab 8,08 8,06 9,26 8,29 9,45 9,05 9,18 9,00 Průměr 8,32 7,57 7,90 8,45 8,54 8,41 8,91 8,34 8,47 7,73 b 8,46 a 8,66 a 8,41 a Pozn. I inokulováno, N neinokulováno; Data pocházejí pouze z jednoho opakování.; Testováno dle Tukeye; Průměry jednotlivých variant/odrůd se významně ( 0,05) neliší, pokud jsou za nimi uvedena stejná písmena. Tab. 5 Průměrný výnos zrna ječmene jarního [t ha 1 ] po ošetření fungicidními přípravky (Hutton, Prosaro 250 EC, Zantara) a inokulaci F. culmorum na lokalitě Senice v roce Odrůda Průměr 1 (kontrola) Fungicidní ošetření / Inokulace 3 (Hutton + Prosaro) 2 (Hutton + Zantara) 4 (Hutton + Prosaro) N I N I N I N I Aksamit 7,86 ab 7,24 6,90 8,65 8,65 7,27 7,54 8,49 8,15 Bojos 7,73 ab 6,86 7,49 8,33 8,68 7,59 7,50 7,75 7,61 Gladys 7,45 abcd 6,24 7,01 7,94 8,13 7,72 7,52 6,74 8,28 Kangoo 7,40 abcd 6,61 6,51 7,82 8,37 7,75 7,50 6,72 7,95 Malz 6,79 d 5,68 6,27 6,98 8,16 6,44 6,92 6,32 7,58 Prestige 6,92 cd 5,65 5,53 7,81 7,53 6,81 7,00 7,01 8,00 Radegast 7,60 abc 6,81 7,90 7,82 8,60 7,74 7,13 6,89 7,93 Sebastian 8,07 a 6,98 7,51 8,37 9,13 8,32 8,08 7,67 8,51 Tocada 7,68 ab 6,39 6,93 8,29 8,66 7,91 7,33 7,83 8,14 Xanadu 7,16 bcd 6,34 5,95 8,03 7,87 7,15 6,90 7,34 7,72 Průměr 7,47 6,48 6,80 8,00 8,38 7,47 7,34 7,28 7,99 6,64 c 8,19 a 7,41 b 7,64 b Pozn. I inokulováno, N neinokulováno; Data pocházejí pouze z jednoho opakování.; Testováno dle Tukeye; Průměry jednotlivých variant/odrůd se významně ( 0,05) neliší, pokud jsou za nimi uvedena stejná písmena. 18

19 Tab. 6 Průměrný výnos zrna ječmene jarního [t ha 1 ] po ošetření fungicidními přípravky (Hutton, Prosaro 250 EC, Zantara) a inokulaci F. culmorum na lokalitě Žabčice v roce Odrůda Průměr 1 (kontrola) Fungicidní ošetření / Inokulace 3 (Hutton + Prosaro) 2 (Hutton + Zantara) 4 (Hutton + Prosaro) N I N I N I N I Aksamit 5,35 a 5,57 5,09 6,34 4,87 5,92 5,03 5,63 4,34 Bojos 4,92 ab 6,23 4,03 5,87 4,14 5,97 3,99 5,89 3,26 Gladys 5,55 a 6,48 4,82 6,27 4,86 6,27 5,55 6,08 4,07 Kangoo 5,54 a 5,94 5,03 6,03 5,03 6,05 5,40 6,39 4,46 Malz 5,27 a 6,04 4,57 5,95 4,39 6,01 4,96 5,94 4,26 Prestige 5,18 a 6,16 4,47 5,91 4,27 6,06 5,07 5,60 3,94 Radegast 4,21 b 5,70 3,12 5,38 3,78 4,84 3,17 4,93 2,80 Sebastian 5,54 a 6,29 4,62 6,42 4,82 6,38 4,92 6,18 4,68 Tocada 5,86 a 6,72 5,29 6,62 5,66 5,99 5,33 6,56 4,74 Xanadu 5,53 a 6,01 5,28 5,84 5,35 5,93 5,35 5,71 4,77 Průměr 5,30 6,11 4,63 6,06 4,72 5,94 4,88 5,89 4,13 5,37 a 5,39 a 5,41 a 5,01 a Pozn. I inokulováno, N neinokulováno; Data jsou průměrem ze dvou opakování; Testováno dle Tukeye; Průměry jednotlivých variant/odrůd se významně ( 0,05) neliší, pokud jsou za nimi uvedena stejná písmena. Závěr Produkční potenciál ječmene jarního se v podmínkách jednotlivých lokalit pohyboval v rozmezí 5,30 8,78 t ha 1 (Žabčice < Senice < Libčany < Kroměříž). Nejvíce adaptabilními na podmínky prostředí lokalit byly odrůdy Tocada (7,85 t ha 1 ) > Gladys (7,75 t ha 1 ) > Sebastian (7,5 t ha 1 ), nejméně pak Malz (7,12 t ha 1 ) < Prestige (7,25 t ha 1 ) < Radegast (7,26 t ha 1 ). Účinnost jednotlivých strategií eliminace patogenů se lišila v závislosti na průběhu povětrnostních podmínek na lokalitě. Jako relativně nejúčinnější byla vyhodnocena kombinace Hutton (v BBCH 39) + Zantara (v BBCH 65). Aplikace fungicidů Prosaro a Zantara v období kvetení patří v současné době k základním strategiím eliminace výskytu fuzarióz v porostech pšenice a ječmene. Prosaro díky kombinaci dvou nejsilnějších azolů (tebukonazol, prothiokonazol) představuje jeden z nejúčinnějších fungicidů pro použití v období kvetení. Na druhé straně Zantara je fungicidem, u kterého kombinace tebukonazolu a nové účinné látky bixafenu může eliminovat případný vznik rezistence. Dedikace Příspěvek vznikl za finanční podpory projektu QI111B044 s názvem Komplexní strategie pro minimalizaci negativního dopadu infekce toxikogenními houbami r. Fusarium v obilovinách a odvozených produktech, financovaného Národní agenturou pro zemědělský výzkum. Použitá literatura 1. DARWIN R., KENNEDY D., 2000: Economic effects of CO 2 fertilization of crops: transforming changes in yield into changes in supply. Environmental Modeling and Assessment, 5(3):

20 2. HRSTKOVÁ P., STŘEDA T., 2009: Hodnocení adaptability vybraného sortimentu odrůd pšenice ozimé na odlišné vláhové podmínky v půdě. In: BLÁHA L. (Ed.): Vliv abiotických a biotických stresorů na vlastnosti rostlin Sborník příspěvků z konference, března VÚRV v.v.i., Praha-Ruzyně, s REILLY J.M., SCHIMMELPFENNIG D., 1999: Agricultural Impact Assessment, Vulnerability, and the Scope for Adaptation. Climatic Change, 43(4): SVOBODA J., BROTAN J., 2006: Selected agroclimatical characteristics of Žabčice region for period Acta Universitatis Agriculturae et Silviculturae Mendelianae Brunensis, LIV(4): TRNKA M., 2008: Využití agroklimatických metod při posuzování biofyzikálních předpokladů udržitelného hospodaření. Habilitační práce. Mendelova zemědělská a lesnická univerzita v Brně, Brno. 20

21 STUDIUM VLIVU ROZDÍLŮ V MORFOLOGICKÝCH A VEGETAČNÍCH ZNACÍCH NA AKUMULACI MYKOTOXINŮ V ZRNĚ JEČMENE Study of differences in the morphological and vegetative traits on accumulation of the mycotoxins in the barley grain 1 Vaculová K., 1 Milotová J., 1 Balounová M., 1 Matušinsky P., 2 Zachariášová M., 2 Hajšlová J., 2 Džuman Z., 3 Smutná P. 1 Agrotest fyto, s.r.o., 2 Vysoká škola chemicko-technologická v Praze, 3 Mendelova univerzita v Brně Kontaktní adresa 1. autora: Ing. Kateřina Vaculová, CSc., Agrotest fyto, s.r.o., Havlíčkova 2787/121, Kroměříž Abstrakt V roce 2011 byly založeny pokusy se souborem 29 vybraných odrůd a genetických zdrojů ječmene jarního, pěstovaných ve dvou pěstebních lokalitách (Kroměříž, Žabčice) a na dvou variantách inokulace (přirozená kontaminace a umělá inokulace F. culmorum) s cílem vyhodnotit vliv rozdílů v morfologických a vegetačních znacích klasu, rostliny a obilky na akumulaci mykotoxinů v zrně. U jednotlivých genotypů byla zjištěna různá míra i frekvence napadení porostů houbami rodu Fusarium a rovněž odlišný výskyt i obsah sledovaných mykotoxinů v rozdílných pěstebních podmínkách. Dílčí výsledky ukazují, že u genotypů ječmene s různými stupni morfologických deskriptorů existuje tendence k odlišné úrovni citlivosti vůči napadení fuzárii a následné akumulaci mykotoxinů. Klíčová slova ječmen, Fusarium, mykotoxiny, pěstební podmínky, morfologické a vegetační znaky Abstract Experiments with set of 29 selected spring barley cultivars and genetic resources were carried out at two locations (Kroměříž, Žabčice) in two variants of inoculation (naturally infected or artificially inoculated barley by F. culmorum) in the year 2011 with the aim to evaluate the influence of differences in the morphological and vegetative traits of the spike, plant and the caryopsis on the accumulation of mycotoxins in the barley grain. Various rate and frequency of the genus Fusarium infection and also different occurrence and content of the observed mycotoxins were detected in the individual genotypes from different growing conditions. Our results indicate that is tendency to dissimilar levels of sensitivity to Fusarium infection and the subsequent mycotoxins accumulation in barley genotypes with various degrees of morphological descriptors. Key words barley, Fusarium, mycotoxins, growing conditions, morphological and vegetative traits 21

22 Úvod K významným polním patogenům s nepříznivým vlivem na výnos a kvalitu zrna ječmene patří houby rodu Fusarium, jejichž metabolické produkty (mykotoxiny) představují potenciální nebezpečí pro lidi i hospodářská zvířata. Míra výskytu i stupeň napadení ječmene těmito patogeny je ovlivněn řadou environmentálních i genetických faktorů. Významný vliv má volba vhodné předplodiny, mezi rizikové patří kukuřice nebo pšenice. Průběh počasí je důležitý z hlediska šíření choroby optimální je vysoká vzdušná vlhkost a vyšší teplota vzduchu 1. Nejúčinnějším opatřením, které by zamezilo napadení porostů fuzárii, jejich šíření a současně kontaminaci zrna, je pěstování rezistentních odrůd. Podle údajů zahraničních autorů 1 existují dva typy rezistence. Typ I vyjadřuje odolnost vůči penetraci houby do klasu, zatímco Typ II odolnost vůči šíření infekce v klasu. U ječmene existuje přirozená rezistence Typu II a proto je šlechtění na vyšší odolnost fuzáriím směrováno k rezistenci Typu I a odolnosti vůči akumulaci mykotoxinů v zrnu. Doposud nebyla ve světovém sortimentu detekována ani jedna zcela rezistentní odrůda, nicméně některé odrůdy s vyšší odolností těmto patogenům již byly vyšlechtěny 2. I mezi nešlechtěnými odrůdami nebo genetickými zdroji ječmene však existují zřejmé rozdíly v náchylnosti napadení, akumulaci a metabolismu mykotoxinů 3. V příspěvku jsme se zaměřili na studium vlivu rozdílů v hospodářských, morfologických a vegetačních znacích a vlastnostech jednotlivých genotypů schopnost akumulace širokého spektra mykotoxinů v zrnu ječmene jarního, přirozeně kontaminovaného nebo po cílené inokulaci houbou F. culmorum. Materiál a metody Materiál: odrůdy a genetické zdroje ječmene jarního (celkem 29), registrované k pěstování v ČR nebo vedené v Genové bance - viz. níže Tab. 2) byly vybrány na základě deklarované rozdílné odolnosti vůči napadení fuzárii. Tyto materiály se lišily jak v hospodářských, tak morfologických znacích (zejména klasu, ale i rostliny) a také v chemickém složení zrna (diference ve složení škrobu). Pěstební technologie a ošetření v průběhu vegetace: materiály ječmene byly pěstovány na lokalitách Kroměříž a Žabčice ve vegetačním roce 2011 v maloparcelních pokusech (výměra parcel 2,5-4,5 m 2 ), jak za podmínek přirozené, tak umělé infekce patogenem F. culmorum. Inokulace F. culmorum byla provedena postřikem ve vhodném vývojovém stádiu (BBCH 61-64), kdy je 50% rostlin v počátku květu (koncentrace 0,5 mil. konidií F. culmorum /1 ml inokula, postřiková dávka 200 l/1 ha) v termínech 27.5., 1.6. a V průběhu vegetace bylo provedeno hodnocení deskriptorů morfologických znaků u všech materiálů ječmene (Tab. 1) podle klasifikátoru rodu Hordeum 4 a v lokalitě Kroměříž rovněž stupeň napadení fuzárii podle metodiky autorů Tvarůžek a kol. (2012) 5. Po sklizni byl vyhodnocen výnos zrna (t.ha -1 ) a hmotnost 1000 zrn (HTZ, g). 22

23 III.11 IV.11 V.11 VI.11 VII.11 III.11 IV.11 V.11 VI.11 VII.11 teplota ( C) srážky (mm) Tab. 1: Přehled hodnocených znaků experimentálních materiálů ječmene Znaky stupeň popis stupeň popis stupeň popis stupeň popis stupeň popis Typ klasu 3 dvouřadý 7 šestiřadý Barva klasu* 1 žlutozelená 2 světlezelená 5 sivozelená 6 modrozelená Tvar klasu 1 jehlancovitý 3 hranolovitý 7 vřetenovitý AK - osiny** 1 velmi slabé 3 slabé 5 střední 7 silné 9 velmi silné AK - stébla** 1 světle zelené 5 zelené 7 nachové (báze) 9 nachové (>1/2) Obilka-pluchatost 1 nahá 9 pluchatá Hustota klasu 1 velmi řídký 3 řídký 5 střední 7 hustý Typ škrobu*** 1 standardní 2 waxy * - po vymetání; ** - AK= anthokyanové zabarvení; *** - standardní = cca 25% amylózy : 75% amylopektinu, waxy = snížený podíl amylózy (do 1-3%) Popis pokusných lokalit: Kroměříž (49 17 severní šířky, východní délky, 235 m nad mořem): výrobní oblast řepařská, půdní typ černozem luvická (ČMl), půdní druh prachová hlína, průměrná roční teplota 8,7 C, průměrný roční úhrn srážek 559 mm. Žabčice (49 01 severní šířky, východní délky, 184 m nad mořem) výrobní oblast kukuřičná, podoblast K2, půdní typ fluvizem glejová (FLg), půdní druh jílovitohlinitá až jílovitá, s obsahem jílnatých částic 55 až 65 %, průměrná roční teplota 9,2 C, průměrný roční úhrn srážek 480 mm. Průběh počasí ve vegetačním období na obou lokalitách je uveden na Obr Lokalita Kroměříž úhrn srážek 2011 prům. teplota 2011 Lokalita Žabčice dlouhodobý úhrn srážek dlouhodobá prům. teplota Obrázek 1: Průběh počasí ve vegetačním roce 2011 na lokalitách Kroměříž a Žabčice Analytická metoda: Mykotoxiny byly analyzovány metodou ultra-účinné kapalinové chromatografie (ultra-účinný kapalinový chromatograf Acquity (Waters) a chromatografická kolona HSS T3, 100 x 2.1 mm; 1,8 µm (Waters) s tandemovou hmotnostně-spektrometrickou detekcí (hmotnostní analyzátor typu lineární iontová past, qtrapms/ms (AB Sciex) na pracovišti VŠCHT v Praze. Kvantifikace byla prováděna s pomocí nejintenzivnějšího (kvantifikačního) iontového přechodu metodou externí kalibrace na kalibrační řadu matričních standardů. Výsledky byly korigovány na výtěžnost metody, která byla zjištěna pomocí analýzy vzorků s přidaným známým množstvím mykotoxinů (tzv. spiky ). 23

24 Analyzované mykotoxiny: Nivalenol (NIV), deoxynivalenol (DON), deoxynivalenol-3- glukosid (D3G), 3-acetyldeoxynivalenol (3-ADON), 15-acetyldeoxynivalenol (15-ADON), fusarenon-x (FUS-X), HT-2 toxin (HT-2), T-2 toxin (T-2), diacetoxyscirpenol (DAS), neosolaniol (NEO), enniatin A (EnnA), enniatin A1 (EnnA1), enniatin B (EnnB), enniatin B1 (EnnB1), beauvericin (BEA), zearalenon (ZEA), fumonisin B1 (FB1), fumonisin B (FB2), fumonisin B3 (FB3), alfa-zearalenol (alfa-zol), beta-zearalenol (beta-zol), altenuen (Ate), alternariol (Aol), alternariol monomethyleter (Amet), aflatoxin B1 (AFB1), aflatoxin B2 (AFB2), aflatoxin G1 (AFG1), aflatoxin G2 (AFG2), sterigmatocystin (STE), ergokristin (Ekristin), ergokristinin (E-kristinin), ergokornin (E-kornin), ergokorninin (E-korninin), ergokryptin (E-kryptin), ergokryptinin (E-kryptinin), ergosin (E-sin), ergotamin (E-tamin), agroklavin (Agro), penitrem A (PenA), roquefortin C (RoqC), tentoxin (Tentox), tenuazonová kyselina (TenAc), penicilliová kyselina (PenAc), mykofenolová kyselina (MPAc) stachybotrylaktam (STACH), meleagrin (MEL), paxilline (PAX), gliotoxin (Glio), citrinin (CIT), patulin (PAT). vše v μg.kg -1. Výsledky a diskuze Testovaný soubor materiálů ječmene (Tab. 2) byl velmi různorodý, jak z hlediska původu, tak i úrovně sledovaných hospodářských, morfologických a vegetačních znaků i přesto, že původní výběr byl směrovaný zejména na genotypy s deklarovanou rozdílnou odolností vůči napadení houbami rodu Fusarium. Navíc se experimentální materiály lišily i z hlediska složení škrobu. Kromě genotypů se standardním složením (25), kde podíl hlavních polysacharidů odpovídá poměru cca 25% amylózy : 75 % amylopektinu, byly zde materiály (4) s tzv. waxy typem škrobu, t.j. sníženým podílem polysacharidu amylózy (až do úrovně cca 1-3%). Ověření deklarovaného typu škrobu bylo provedeno analytickým hodnocením poměru obou polysacharidů před výběrem do souboru. Vybrané odrůdy a genetické zdroje ječmene zastupovaly nejfrekventovanější typy hodnocených deskriptorů (viz. Tab. 1), i když vzhledem k možnému rozsahu pokusu, nebyly dané znaky prezentovány ve všech možných úrovních (dle klasifikátoru rodu Hordeum). Základní hospodářské znaky - výnos zrna a HTZ, byly u jednotlivých odrůd ovlivněny působením patogenů rozdílně. Výnos zrna byl u inokulované varianty oproti variantě s přirozenou kontaminací v průměru o 3,7% nižší a u HTZ byl zaznamenán průměrný pokles o 5,6%. Vliv inokulace se významně projevil u odrůd s deklarovanou vysokou náchylností fuzáriím, zejména u odrůd Cebada Capa, Ricardo a Chevron, kde byl pokles výnosu o 22,9, 18,7 a 10,9 %. Snížení HTZ kolísalo od 1,3 do 10,7%, přičemž k odrůdám s největším poklesem patřily jak materiály s pluchatým (Ricardo, Waggon, Prosa - 10,7; 10,0 a 9,8%), tak i bezpluchým typem zrna (KM 1057, KM ,8 a 9,3%) bez ohledu na deklarovanou náchylnost napadení. Je zajímavé, že u některých odrůd byl paradoxně pozorován vyšší výnos zrna (Taiga, 6NDRFG-1, Annabell, Krasnodarskij 95, Rolfi, Druvis, Pejas od 6,9 po 0,6%) nebo dokonce i mírně vyšší HTZ (genetický zdroj 6NDRFG-1 a odrůda Diplom) v inokulované variantě. 24

25 Tab. 2: Charakteristika odrůd a rozdíly v hospodářských znacích experimentálních materiálů ječmene mezi přirozeně kontaminovanou a inokulovanou variantou (v %) Odrůda Diference, %** Diference, %** Výnos Odrůda Původ Obilka* Typ Typ Původ Obilka* Typ Typ Výnos klasu škrobu HTZ klasu škrobu HTZ zrna zrna 6NDRFG-1 USA pl 6ř. stand KM 2551 CZE n 2ř. waxy AC Klinck CAN pl 6ř. stand Kompakt SVK pl 2ř. stand AF Lucius CZE n 2ř. stand Krasnodarskij 95 SUN pl 2ř. stand Amulet CZE pl 2ř. stand Madeira DEU pl 2ř. stand Annabell DEU pl 2ř. stand Merlin CAN n 2ř. waxy Arra FIN pl 6ř. stand Nitran SVK pl 2ř. stand CDC Rattan CAN n 2ř. waxy Nordus DEU pl 2ř. stand Cebada Capa ARG pl 6ř. stand Pejas CSK pl 2ř. stand Diplom DEU pl 2ř. stand Primus CSK pl 2ř. stand Druvis LVA pl 6ř. stand Prosa AUT pl 2ř. stand Henrike DEU pl 2ř. stand Ricardo URY pl 6ř. stand Chevron CHE pl 6ř. stand Rolfi SWE pl 6ř. stand KM 1057 CZE n 2ř. stand Taiga DEU n 2ř. stand KM 2084 CZE n 2ř. stand Waggon GBR pl 2ř. stand KM 2460 CZE pl 2ř. waxy * - pluchatost obilky: pl = pluchatá, n = nahá; ** - diference inokulované varianty vůči přirozeně kontaminované Hladina sledovaných mykotoxinů ve vzorcích ječmene kolísala podle typu mykotoxinu od úrovně pod detekčním limitem (<LOQ) až po obsah více jako μg.kg -1 (DON, inokulovaná varianta, lokalita Kroměříž). Při hodnocení souboru ve dvou lokalitách (Kroměříž a Žabčice) a dvou variantách napadení fuzárii (přirozená kontaminace a umělá inokulace F. culmorum) se projevily jak genotypové vlastnosti experimentálních materiálů, tak i odlišnosti pěstebních lokalit dané rozdíly ve složení půdy a zejména průběhu teploty a srážek v období vegetace (viz. Obr. 1). Podíl na odlišném výskytu a hladinách analyzovaných mykotoxinů mělo zřejmě i odlišné přirozené spektrum původců chorob. V roce 2011 byl průběh počasí v Žabčicích odlišný od lokality Kroměříž. V květnu a červnu 2011 byl celkový úhrn srážek v Žabčicích nižší než dlouhodobý normál a teplota byla naopak vyšší. V Kroměříži byly zaznamenány silné srážky již v květnu (o cca 20 mm oproti normálu) při teplotě na úrovni normálu a koncem května a začátkem června vyšší než dlouhodobý průměr. Podmínky pro napadení a rozšíření infekce F. culmorum v době provedení umělé inokulace, tedy ve vývojovém stádiu porostů BBCH 61-64, byly v obou lokalitách odlišné. Jak v Kroměříži, tak i v Žabčicích byly srážky v měsíci červenci (zejména v 1. dekádě) silné, avšak při rozdílné teplotě oproti normálu. V Žabčicích byla průměrná teplota až o 2 C vyšší, což nahrává domněnce, že mohlo dojít k množení dalších druhů a pozdějšímu napadení "čistých" porostů (varianty s přirozenou kontaminací). Naopak v Kroměříži došlo ke snížení teploty pod dlouhodobý průměr a tedy další vlna šíření spor fuzárií zde zřejmě nenastoupila. Je rovněž možné, že rozdíly v úrovni napadení přirozeně kontaminovaných a uměle inokulovaných porostů byly ovlivněny vzájemnou kompeticí producentů různých typů mykotoxinů. Navíc v lokalitě Žabčice je v okolí stanice podstatně vyšší podíl kukuřice (riziková předplodina) v osevních postupech než v lokalitě Kroměříž. Z důvodu nízkého napadení porostů v lokalitě Žabčice bylo vizuální hodnocení míry napadení klasů ječmene fuzárii provedeno pouze v Kroměříži. Zde se úroveň infekce klasů pohybovala od hodnoty % (Chevron, KM 2460, Taiga, Prosa, Amulet, Primus) až po 49,6-49,9 % (Druvis, Ricardo). Mezi mírou napadení klasu a koncentrací trichothecenů B na inokulované variantě byly vypočteny vysoce průkazné korelace (P 0,05), které kolísaly od r=0,58 (15- ADON) až po r=0,79 (ZEA). Toto vypovídá i o chemotypu inokula a svědčí ve prospěch 25

26 poznatku, že použitý kmen F. culmorum patří především k producentům DON a jeho acetylovaných izomerů, zejména 3-ADON a 15-ADON. c[μg.kg -1 ] c[μg.kg -1 ] Kroměříž, přiroz. kontaminace Ricardo Cebada Capa Waggon AF Lucius KM 2084 KM 2551 Annabell Prosa Henrike Diplom Nitran Kompakt Pejas CDC Rattan Merlin Amulet Nordus Krasnodarskij 95 Chevron Madeira Primus AC Klinck Rolfi Druvis Taiga KM 2460 KM 1057 Arra 6NDRFG-1 Kroměříž, inokulace F. culmorum Ricardo Cebada Capa Waggon AF Lucius KM 2084 KM 2551 Annabell Prosa Henrike Diplom Nitran Kompakt Pejas CDC Rattan Merlin Amulet Nordus Krasnodarskij 95 Chevron Madeira Primus AC Klinck Rolfi Druvis Taiga KM 2460 KM 1057 Arra 6NDRFG-1 c[μg.kg -1 ] c[μg.kg -1 ] Žabčice, přiroz. kontaminace Ricardo Cebada Capa Waggon AF Lucius KM 2084 KM 2551 Annabell Prosa Henrike Diplom Nitran Kompakt Pejas CDC Rattan Merlin Amulet Nordus Krasnodarskij 95 Chevron Madeira Primus AC Klinck Rolfi Druvis Taiga KM 2460 KM 1057 Arra 6NDRFG-1 Žabčice, inokulace F. culmorum Ricardo Cebada Capa Waggon AF Lucius KM 2084 KM 2551 Annabell Prosa Henrike Diplom Nitran Kompakt Pejas CDC Rattan Merlin Amulet Nordus Krasnodarskij 95 Chevron Madeira Primus AC Klinck Rolfi Druvis Taiga KM 2460 KM 1057 Arra 6NDRFG-1 Aol Amet MPAc TenAc Tentox Obr. 2 Složený graf obsahu alternáriových mykotoxinů u jednotlivých odrůd na 2 lokalitách a 2 variantách inokulace Analýza vzorků ječmene prokázala přítomnost zejména fuzáriových, dalších fuzáriových, ale i alternáriových mykotoxinů (Obr. 2), přičemž nejnižší frekvence a obsahy (<LOQ a u několika málo do výše cca v obou lokalitách a variantách inokulace byly stanoveny pro EnnA, BEA a Amet. V obou variantách na lokalitě Kroměříž byly pod detekčním limitem obsahy HT-2, T-2 (kromě odrůdy Kompakt v inokulované variantě), TenAc a Tentox. V Žabčicích byly nižší než LOQ nebo nízké hladiny naměřeny pro trichotheceny B (NIV, alfa-zol, beta- ZOL, 15 ADON) i alternáriové mykotoxiny (AOL, MPAc a Tentox). V obou lokalitách byly v inokulované variantě naměřeny vyšší hladiny obsahu DON, 3-ADON, D3G a v Kroměříži byly navíc detekovány rozdíly mezi přirozeně kontaminovanou a inokulovanou variantou v obsahu beta-zol, ZEA a 15-ADON (kde byla přirozená kontaminace <LOQ). V Naopak vyšší hladiny EnnB a EnnB1 byly stanoveny v obou lokalitách ve variantě s přirozenou kontaminací. Z alternáriových mykotoxinů stojí za zmínku rovněž kyselina tenuazonová (TenAC), jejíž obsah se v lokalitě Žabčice (inokulovaná varianta) pohyboval od <LOQ až po hodnoty v řádu několika tisíc μg.kg -1 (Ricardo 7418, AC Klinck 3377 μg.kg -1 ). Podle posudku výboru pro kontaminanty v potravinách (CONTAM) úřadu EFSA byla prahová toxikologická hodnota TenAc (treshold toxicological concern =TTC) stanovena jako 1500 ng/kg tělesné hmotnosti 6, což vzorky některých odrůd několikanásobně překračovaly. 26

27 Tab. 3: Průměrná koncentrace nejčetněji detekovaných trichothecenů v zrně materiálů ječmene podle hodnocených znaků u přirozeně kontaminované a uměle inokulované varianty Znak / Mykotoxin* Typ škrobu Typ klasu Barva klasu po vymetání Tvar klasu Osiny-AK Stéblo-AK Hustota klasu Stupeň ** n Obilkapluchatost 15- NIV DON ZEA 3-ADON D3G HT-2 T-2 ADON N*** I*** N I N I N I N I N I N I N I * - koncentrace v μg.kg -1 ; ** - stupeň znaku - viz. Tab. 1; *** - N = varianta s přirozenou kontaminací, I = varianta inokulovaná Podrobné průměrné výsledky koncentrace jednotlivých mykotoxinů v obou lokalitách na přirozeně kontaminované a uměle inokulované variantě jsou uvedeny v příspěvku autorů Hajšlová et al. "Vliv genetických a agrotechnických faktorů na výskyt širokého spektra mykotoxinů v ječmeni" (zařazeném v totožném sborníku), stejně jako nálezy trichothecenů u jednotlivých odrůd po umělé inokulaci v lokalitě Kroměříž a Žabčice. Sumární obsah mykotoxinů s nejvyšší průměrnou hladinou, DON a jeho vázané formy D3G, kolísal od 58 μg.kg -1 po μg.kg -1, přičemž v lokalitě Kroměříž byly naměřeny v průměru 18 x vyšší hodnoty než v Žabčicích. Vzhledem k možné biologické dostupnosti vázané formy DONu (glykosidická vazba je štěpitelná některými bakteriálními kmeny v gastrointestinálním traktu savců 7 ) je nezbytné věnovat pozornost oběma formám. Studované genotypy se lišily ve schopnosti akumulovat vázaný D3G, takže i materiály s relativně "nižší" hladinou volného mykotoxinu DON překonaly v sumě obou forem odrůdy s vyšším obsahem DON (viz. např. 2-řadá odrůda sladovnického ječmene Annabell vs. 6-řadá krmná odrůda Druvis). V aktuálním příspěvku byla pozornost zaměřena především na diference v obsahu mykotoxinů mezi jednotlivými stupni deskriptorů a dalšími hodnocenými znaky experimentálních materiálů ječmene. Z dosažených výsledků je zřejmé, že i když zvolená lokalita (a pravděpodobně také průběh počasí v roce 2011) hrála v naměřeném spektru i výši hladin jednotlivých mykotoxinů rozhodující roli, bylo možné vysledovat určité závislosti, vztahující se k jednotlivým hodnoceným znakům. Přesto, že způsob inokulace ovlivnil hladiny zejména trichothecenů B (kromě NIV a D3G) tak, že pro většinu deskriptorů i typ škrobu byly maximální koncentrace naměřeny v odlišných skupinách, bylo možné zaznamenat stupně jednotlivých deskriptorů, kde byl obsah všech nebo většiny mykotoxinů pokaždé nejnižší (Tab. 3). 27

28 Tab. 4: Průměrná koncentrace nejčetněji detekovaných trichothecenů u materiálů ječmene podle hodnocených znaků v jednotlivých lokalitách Znak / Mykotoxin* Typ škrobu Typ klasu Barva klasu po vymetání Tvar klasu Osiny-AK Stéblo-AK Hustota klasu Stupeň ** n NIV DON ZEA 3-ADON D3G HT-2 T-2 Obilkapluchatost 15- ADON KM Z *** *** KM Z KM Z KM Z KM Z KM Z KM Z KM Z * - koncentrace v μg.kg -1 ; ** - stupeň znaku - viz. Tab. 1; *** - obě varianty inokulace; KM = lokalita Kroměříž, Z = lokalita Žabčice Z doposud dosažených výsledků plyne, že materiály ječmene s nejnižšími průměrnými koncentracemi mykotoxinů byly charakterizovány žlutozelenou barvou klasu po vymetání (stupeň 1), jehlancovitým tvarem klasu (stupeň 1), velmi silným výskytem anthokyanového zabarvení osin (stupeň 9), nachovým zabarvením báze stébla do výše větší než polovina stébla (stupeň 9) a střední hustotou klasu (stupeň 5). Zjištěné zařazení genotypů koresponduje s poznatky některých zahraničních autorů, kteří zjistili vyšší citlivost víceřadých odrůd 8,9 a naopak vyšší míru odolnosti houbovým chorobám u odrůd ječmene se zvýšeným obsahem polyfenolických látek 10. Nejvyšší hladiny D3G, trichothecenů A a NIV byly v průměru naměřeny u těch stupňů deskriptorů, kde byla ve variantě s přirozenou kontaminací současně zjištěna i nejvyšší koncentrace ostatních mykotoxinů. Zjištěné rozdíly mezi oběma variantami inokulace mohou být důsledkem skutečnosti, že forma F. culmorum, použitá k provedení inokulace, je více agresivní a zřejmě se odlišuje nejen způsobem napadení klasů, ale i rozdílnou schopností k akumulaci mykotoxinů, resp. jejich zabudování do tzv. vázaných forem. Mezi genotypy s pluchatou nebo nahou obilkou a standardním nebo waxy typem škrobu nebyla nalezena jednoznačná tendence k akumulaci mykotoxinů, i když rozdělení podle lokalit (Tab. 4) ukazuje, že vyšší koncentrace většiny mykotoxinů byly naměřeny u materiálů s pluchatým zrnem. Přesto pro odlišné stupně těchto znaků nebyly zjištěné rozdíly v hladinách mykotoxinů nijak vysoké a je otázkou, jaký vývoj akumulace mykotoxinů bude možné vysledovat v analýzách tohoto experimentálního souboru v následujících letech. Rozdělení podle lokalit potvrdilo výsledky získané z pohledu obsahu mykotoxinů v různých variantách inokulace s tím, že zvýraznilo skupiny deskriptorů s vyšší koncentrací mykotoxinů po umělé 28

29 inokulaci. Navíc podtrhlo ještě jednu skutečnost a to, že i v případě mykotoxinů s nízkou frekvencí výskytu (pouze u jednotlivých odrůd) byly nálezy právě u těch genotypů, které patřily do skupin s vyšší citlivostí fuzariózám. Uvedená závislost se potvrdila v obou lokalitách a nejzřetelněji byla demonstrovaná například u HT-2 a T-2 toxinů nebo 15-ADONu i přesto, že koncentrace těchto mykotoxinů byly velmi nízké. Na rozdíl od výsledků podle způsobu inokulace, ukázalo členění průměrného obsahu volných mykotoxinů podle lokalit jednoznačnou převahu ječmene s bezpluchým zrnem nad genotypy pluchatými. Závěr Dosažené výsledky studia vlivu rozdílů v morfologických a vegetačních znacích potvrdily významný vliv lokality a průběhu počasí na spektrum a akumulaci jednotlivých mykotoxinů u odrůd a genetických zdrojů ječmene jarního, pěstovaných ve dvou variantách inokulace. I přes několikanásobné rozdíly v koncentraci, zejména fuzáriových mykotoxinů, mezi lokalitami Kroměříž a Žabčice byly nalezeny shodné "vzorce chování" genotypů, lišících se ve stupni hodnoceného morfologického nebo vegetačního znaku. Doposud získané výsledky ukazují, že s určitou pravděpodobností by bylo možné, na základě znalosti morfologického popisu odrůdy, zhruba odhadovat citlivost genotypů vůči akumulaci mykotoxinů. Vyšší náchylnost napadení fuzárii a vyšší obsah mykotoxinů byl zjištěn u materiálů ječmene s pluchatým zrnem, víceřadých nebo 2-řadých s hustým vřetenovitým klasem, se sivozelenou barvou klasu po vymetání (s vyšší mírou ojínění) a nižším stupněm anthokyanového zabarvení osin a stébla. Vzhledem k tomu, že v daném příspěvku byla hodnocena pouze data z jednoho ročníku (bez ohledu na určité analogie s dostupnými poznatky zahraničních autorů), bude možné činit praktická doporučení ohledně výběru odrůd pro patogenně více exponované lokality nebo šlechtění odrůd s vyšší mírou rezistence houbám r. Fusarium až po ukončení víceletých pokusů. Dedikace Příspěvek byl vypracovaný za podpory Ministerstva zemědělství v rámci projektu č. QI111B044 s využitím genetických zdrojů ječmene vedených v Kolekci jarního ječmene v rámci Národního programu konzervace a využívání genetických zdrojů rostlin a agrobiodiverzity (NP GZR). Použitá literatura 1. McMullen M., Zhong S., Neate S. Fusarium Head Blight (Scab) of Small Grains. (2008) PP-804, September New barley variety has improved Fusarium head blight resistance FFCROPS 3. January 07, /farmforum/ _1_barley-variety-american-malting-barley-associationbarley-acres# 4. Chrpová J., Šíp V., Štočková L., Stemberková L., Tvarůžek L. (2011). Resistance to Fusarium Head Blight in Spring Barley. Czech J. Genet. Plant Breed., 47, 2011 (2): Lekeš J., Zezulová P., Bareš I., Sehnalová J., Vlasák M. (1986). Klasifikátor genus Hordeum L., VÚRV Praha-Ruzyně, Genové zdroje č. 27, 46 s. 29

30 6. Tvarůžek L., Matušinsky P., Vyšohlídová M. (2012). Metodika pro zakládání a hodnocení pokusů s umělou inokulací obilnin fuzariózami klasů. Kroměříž, 2012,16 s. 7. Rychlik M Tenuazonic acid in baby food A health hazard? Zentralinstitut Ernährungs- und Lebensmittelforschung - ZIEL 8. e=98&no_cache=1&chash=283a65d58c057c7f288ffc62ea1c Berthiller F., Krska R., Domig K.J., Kneifel W., Juge N., Schuhmacher R., Adam G. (2011). Hydrolytic fate of deoxynivalenol-3-glucoside during digestion. Toxicology Letters 206: Buerstmayr H., Legzdina L., Steiner B., Lemmens M., Variation for resistance to Fusarium head blight in spring barley Euphytica 137: Yoshida M., Kawada N., Tohnooka T. (2005). Effect of row type, flowering type and several other spike characters on resistance to Fusarium head blight in barley Euphytica 141: Lattanzio V., Lattanzio V.M.T., Cardinali A.. (2006). Role of phenolics in the resistance mechanisms of plants against fungal pathogens and insects. Phytochemistry: Advances in Research, 2006:

31 ZHODNOCENÍ VÝSKYTU MYKOTOXINŮ V KRMIVECH Occurrence of mycotoxins in feedstuffs Zachariášová M., Džuman Z., Hájková K., Vepříková Z., Hajšlová J. Vysoká škola chemicko-technologická v Praze Kontaktní adresa 1. autora: Ing. Milena Zachariášová, Ph.D., VŠCHT Praha, Technická 3, Praha 6, , Abstrakt Kontaminace drobnozrnných obilovin mykotoxiny, toxickými sekundárními metabolity vláknitých hub, představuje celosvětový problém, ovlivňující zdraví lidí i zvířat. Nejdůležitější představitelé mykotoxinů vyskytujících se v obilovinách, jsou aflatoxiny, trichotheceny, zearalenony, fumonisiny a enniatiny. Z hlediska kontroly těchto nebezpečných látek je nezbytné disponovat příslušnými analytickými metodami schopnými analyzovat mykotoxiny nejen v cereáliích, ale i v obtížných matricích jako jsou siláže a komplexní krmné směsi. Metoda vyvinutá na Ústavu analýzy potravin a výživy VŠCHT Praha spočívá v jednoduché a rychlé přípravě vzorku na bázi principu QuEChERS, separaci pomocí vysokorozlišovací kapalinové chromatografie a hmotnostně-spektrometrické detekci (U- HPLC MS/MS). Metoda byla optimalizována a validována pro stanovení širokého spektra mykotoxinů v krmivech. Pomocí této metody pak byl proveden průzkum obsahu mykotoxinů v široké škále krmiv. Klíčová slova Mykotoxiny, krmiva, kapalinová chromatografie s hmotnostně spektrometrickou detekcí. Abstract Contamination of small grain cereals with mycotoxins, toxic secondary metabolites of filamentous fungi, represents a worldwide problem influencing both the animal and human health. The most important representatives of mycotoxins occurring in cereals are aflatoxins, trichothecenes, zearalenons, fumonisins and enniatins. To control this serious problem, relevant analytical methods able to analyze mycotoxins not only in cereals, but also in difficult matrices as silages, and complex feeding samples, are needed. The method developed at the Department of Food Analysis and Nutrition (ICT Prague) consists in a simple, fast, sensitive and high-throughput procedure based on QuEChERS sample preparation, ultra-high performance liquid chromatographic separation, and tandem mass spectrometric detection (U- HPLC MS/MS). It was optimized and validated for determination of multi-mycotoxins in a wide range of feedstuffs. Using this method, a large survey of mycotoxins in varied feeds was conducted. Key words Mycotoxins, feedstuffs, liquid chromatography coupled with mass spectrometry 31

32 Introduction Occurrence of mycotoxins in feedstuffs has an adverse effect on animal health. Supposing the transfer of parent toxins and/or their metabolites into edible tissues, eggs or milk, also the consumers health might be indirectly influenced. 1,2 Generally, the quality and toxicological safety of the majority of commonly produced feedstuffs is closely linked with processing practices. It can be significantly worsened under the incorrect agricultural practice conditions. For example, the poor anaerobic conditions during silage making can lead to instability of low ph and follow-up growth of fungi, including the toxinogenic species. As another example, wet weather conditions during crops harvest and insufficient aeration during its storage often lead to the secondary spreading of fungi and mycotoxins production. As far as these raw crop cereals are used for further complex mixtures and granulates production, mycotoxins are of course co-transferred into these products, as well. Beside this, number of industry by-product proceeding crops within their technology are enabled as feeds or feed supplements. Then, the quality of input crop is again the key parameter for keeping the animal health. Although several studies concerned with mycotoxins in feed have been already published, 3,4,5 the overall knowledge on mycotoxins in feedstuffs is fairly less extensive in comparison with cereal grains (wheat, barley, maize) which represent one of the key trade commodities. Moreover, their analysis is not as complicated as in the case of fermented feed and complex feeding mixtures. Recently, a sensitive LC MS based method for analysis of multiple mycotoxins in silagebased feedstuffs and complex feeding matrices was optimized and validated at the Department of Food Analysis and Nutrition of ICT Prague. More than 50 mycotoxins such as trichothecens, zearalenones, aflatoxins, alternaria toxins, ergot alkaloids, enniatins, beauvericin, fumonisins, citrinin, ochratoxins, sterigmatocystin, verrucarol, gliotoxin, roquefortin C, penitrem A, penicilic acid, and mycophenolic acid are extracted and partially purified by means of the modified QuEChERS (Quick, Easy, Cheap, Rugged and Safe) principle. Materials and methods Samples analyzed: Samples of silages, dry feedstuffs as hay, feeding wheat, barley, maize, rye and oat, soya, sugar beet, complex feeding mixtures for pigs, chickens and layers, diary cows, birds and rodents, and extracted oil plants as sunflower, rape or soya were collected in cooperation with farms and agricultural cooperatives in the Czech Republic and United Kingdom. Materials were sampled by the trained stuff in compliance with European legislative (No 401/2006 EC). Part of samples was provided by the Central Institute for Supervising and Testing in Agricultural in the Czech Republic. Technological by-proucts as malt rootlets, spent malt grains were obtained from Czech malt and beer producers, the dried distillers grains with soluble were gained from English bioethanol makers. Analytical method: For sample preparation, analytical procedure based on QuEChERS principle was used. The QuEChERS extraction/purification technique consists in the acetonitrile / water extraction. Because in the matter of silages, the highly fungi contaminated spots with ph >7 often occur, for extraction of acidic analytes typically occurring in silages (e.g. fumonisins, mycophenolic acid, penicillic acid), extraction with 1% formic acid was optimized as the best choice. After extraction, addition of the inorganic salts (MgSO 4 and NaCl) is performed to salt out the analytes into the non-polar acetonitrile phase, which is 32

33 separated from the aqueous one after centrifugation. The polar matrix components (sugars, amino acids, polar peptides, etc.) remain in water, thereby some purification effect is reached. The sample extract is further analysed by using of the ultra high performance liquid chromatography coupled with tandem mass spectrometric detection (U-HPLC MS/MS). For the chromatographic separation, the HSS T3, 100 x 2.1 mm; 1,8 µm analytical column was enabled. Elution of analytes was carried out by using the gradient of methanol and water containing acetate and formate buffers. Analytes ionization was done in the electrospray ion source, and ions were analysed in the multiple reaction monitoring mode of the triple quadrupole MS analyzer (QTRAP 5500, AB Sciex). For quantification of results, external matrix matched calibration method was used. Results were corrected for the method recovery, which was found out during the method validation, and verified by means of analysis of spikes. The matrix effect ranged between -56 and 37%, recoveries of most of analytes lied between 76 and 122%. Repeatability of the method calculated as the relative standard deviation (RSD) from nine repeated analyses of artificially contaminated silage and complex feeding mixture lied below 8%. Mycotoxins analyzed: Nivalenol (NIV), deoxynivalenol (DON), deoxynivalenol-3-glucoside (D3G), 3-acetyldeoxynivalenol (3-ADON), 15-acetyldeoxynivalenol (15-ADON), fusarenone-x (FUS-X), HT-2 toxin (HT-2), T-2 toxin (T-2), diacetoxyscirpenol (DAS), neosolaniol (NEO), enniatine A (EnnA), enniatine A1 (EnnA1), enniatine B (EnnB), enniatine B1 (EnnB1), beauvericine (BEA), zearalenone (ZEA), fumonisin B1 (FB1), fumonisin B (FB2), fumonisin B3 (FB3), alfa-zearalenol (alfa-zol), beta-zearalenol (beta-zol), altenuene (Ate), alternariol (Aol), alternariol monomethyleter (Amet), aflatoxin B1 (AFB1), aflatoxin B2 (AFB2), aflatoxin G1 (AFG1), aflatoxin G2 (AFG2), sterigmatocystine (STE), ergocristine (E-cristin), ergocristinine (E-cristinine), ergocornine (E-cornine), ergocorninine (E-corninine), ergocryptine (E-cryptine), ergocryptinine (E-cryptinine), ergosine (E-sine), ergotamine (E-tamine), agroclavine (Agro), penitrem A (PenA), roquefortin C (RoqC), tentoxin (Tentox), mycofenolic acid (MycAc), penicillic accid (PenAc), tenuazonic accid (TenAc), stachybotrylaktam (STACH), meleagrine (MEL), paxilline (PAX), gliotoxin (Glio), cirinin (CIT), patulin (PAT). Results and Discussion During the last three years, an extensive monitoring research was conducted in order to reveal and assess the mycotoxins contamination of particular feeding commodities. A large set of fermented feedings (silages), and technological by-products of processes where fermentation take place (roasted green malt rootlets as a by-product of malting, spent malt grains as a byproduct of beer brewing, and the dried distillers grains with solubles (DDGS) as by-products of bio-ethanol production) was voluntarily provided by producing plants. Further, dry feedstuffs as hay, feeding wheat, barley, maize, rye and oat, soya, sugar beet, and complex feeding mixtures for pigs, chickens and layers, dairy cows, birds and rodents, and extracted oil plants as sunflower, rape or soya were collected. Generally, the overall incidence of mycotoxins in feedstuffs analysed was high. As seen in Figure 1, in majority of the samples, at least one mycotoxin was detected. To the feedings with less incidence of mycotoxins belonged the clover, grass, and alfalfa silages (only one from four investigated samples was contaminated with enniatins and alternariol), and malt spent grains. In the later case, low concentrations of enniatins and beauvericin were detected. Polar type B trichothecenes (DON and its glycosylated form) usually occurring in malt were not detected in the spent grains because of their effective (undesirable) extraction into beer. Concerning other groups of feedstuffs, frequency of contamination with at least one 33

34 mycotoxin ranged between 79 and 100%. However, in this context it should be emphasized that the reason was often the sensitivity of analytical instrumentation enabled. The quantification limits of the U-HPLC qtrapms/ms method were often as low as units of ppb. The contamination levels of mycotoxins strongly depends on technological process (raw vs. pre-concentrated material, glycosylated DON in germinated barley), and botanical origin (e.g. fumonisins in corn). The highest contamination levels in non-fermented feedstuffs were found for type B trichothecenes. The mean levels of deoxynivalenol (DON) were 213, 264, 624, and 102 µg/kg for feeding wheat, barley, maize, and rye. Deoxynivalenol-3-glucoside (DON-3- Glc) levels reached up to 7 20% of the original DON levels. In feeding maize, also nivalenol (153 µg/kg in average), zearalenone (30 µg/kg in average) and fumonisins (52 µg/kg of FB1 and 16 µg/kg of FB2 in average) were quantified. In all these crop feeding samples, enniatins and beauvericin were found at tents up to hundreds of µg/kg. In the rye and oat samples, also rather high levels of alternaria toxins occurred (295 and 223 µg/kg for alternariol and alternariolmonomethylether in average). The soya beans contained relatively high levels of nivalenol (100 µg/kg in average), whereas DON levels found were very low (7 µg/kg in average). Enniatins at levels of tents of ppb and trace levels of alternaria toxins were quantified in soya beans, as well as sugar beet samples. Concerning the complex feeding mixtures, their mycotoxins contamination depended on the mixture composition. The highest concentration levels were quantified for DON, nivalenol, enniatins and alternaria toxins. In some samples, also the mycophenolic acid, ochratoxin A, and ergot alkaloids occurred. Maize and clover-grass silages and are special groups of feedings, where the forage is preserved by volatile fatty acids (acetic, propionic, lactic, butyric) produced by the fermentative bacteria. This process should increase the digestibility and utilization of nutrient by ruminants. Low ph present helps to keep the silage fresh and allow using it for feeding of ruminants during the winter. The most frequent mycotoxins detected in the silage samples were NIV, DON, DON-3-Glc, ADONs, FUS-X, HT2, ZEA, fumonisins, enniatins, alternaria toxins, and roquefortin C, which were quantified approximately in tents up to hundreds of ppb levels. In most quantities, the mycophenolic acid occurred, up to 3236 µg/kg. Figure 1: Frequency of occurrence of mycotoxins in the feed samples investigated (% of positive samples). The sample was classified as positive when at least one mycotoxin was quantified. The total number of samples investigated is presented in parentheses. 34

35 % Another group of feedstuffs for horses, pigs, and cattle were the technological by-products from malt, beer, and bio-ethanol production. Concerning the malt production, as a significant feed composition is considered to be the roasted green malt rootlets. They are separated from the green malt in the final stage of malt production. The malt rootlets are valued especially because of the high protein content, and high amount of minerals, vitamins and enzymes present. However, as we found out, also the mycotoxins content is usually rather high, especially in the case of DON and its glucosylated and acetylated derivates. During germination of barley, new fungi biomass spreads and mycotoxins are produced de novo. Another reason of the increased DON and its conjugates occurrence is their possible release from the pool bound on starch inside the grains. 6 During our monitoring study we quantified DON, DON-3-Glc and ADONs at average levels of 154, 229, and 153 µg/kg, respectively. Another largely used feeding component is spent barley grains, which originate as the biproduct within the beer brewing. After the mashing phase (heating the malt with water to produce beer), the malt spent grains are separated and are usually preserved as a feedstuff rich on proteins and calcium. As concerns mycotoxins, the polar ones (as DON and its conjugates) are undesirably transferred into beer, whereas the less polar ones (enniatins) remain in the spent grains. The mean enniatine levels found in the collected spent grains samples were 79, 112, 36, and 14 µg/kg for enniatins B, B1, A, and A1, respectively. To the very important and interesting sources of feedstuffs supplements belongs also the dried distillers grains with solubles (DDGS) based on maize and other crops, the main by-product within the bio-ethanol production. The crop is fermented to product ethanol, which is distilled to be a bio-fuel, and the rest of the crop biomass full of proteins and other nutrients is dried and used as a feed. When considering the mass balance during the production technology, DDGS are approximately three times more concentrated when compared to original cereal 35

36 grains. That is why high levels of potentially occurring mycotoxins in input material are expected to be found in DDGS. 7,8 Our results confirmed the huge contamination with DON and its glucosylated and acetylated derivates (1675, 128, and 297 µg/kg of DON, DON-3-Glc, and ADONs, respectively), zearalenone and fumonisins (101, 675, 170, and 74 µg/kg for ZEA, FB1, FB2, and FB3, respectively). Rather lower contamination levels were noticed for enniatines and beauvericine, alternaria toxins, ergot alkaloids, ochratoxin A, and aflatoxin B1. Conclusions As results from the above mentioned paragraphs, spectrum of mycotoxins detected in feedstuffs was really broad. In spite of the fact that some groups of feeding commodities contained relatively high mycotoxins levels, only few of the samples investigated exceeded the recommended legislative levels (2006/576/EC). Nevertheless, these very complex data summarizing the overall mycotoxins contamination may provide a new view on this problematic, and suggest the new toxicological research considering the synergistic effect of multiple mycotoxins in cocktail. The data will be provided to European Food Safety Authority (EFSA) as a request on its last call in October Acknowledgement This work was financially supported by the Ministry of Education, Youth and Sports of the Czech Republic (projects MSM and MSM 2B0849), Ministry of Agriculture of the Czech Republic (projects QI 111B044), European Cooperation in Science and Technology (COST Action FA0802, MSMT OC 10059), and and the Seventh framework program (QSAFFE). References 1. Duca R.C., Bravin F., Delaforge M., Vladescu L., Badea I.A., Criste R.D. J. Agric Food Chem. 57, (2009) 2. Beltran EIbanez M., Sancho J.V., Cortes M.A., Yusa V., Hernandez F. Food Chem. 126, 737 (2011) 3. Schollenberger M., Müller H.M., Rüfle M., Suchy S., Plank S., Drochner W. Mycopathologia, 161, 43 (2006) 4. Rasmussen R.R., Storm I.M.L.D., Rasmusen P.H., Smedsgaard J., Nielsen K.F. Anal. Bioanal. Chem. 397, 765 (2010) 5. Mol H.G.J., Plaza-Bolanos P., Zomer P., de Rijk T.C., Stolker A.A.M., Mulder P.P.J. Anal. Chem., 80, 9450 (2008) 6. Zach Zhang Y., Caupert J., Imerman P.M., Richard J.L., Shurson G.C. J. Agric. Food Chem. 57, (2009) 8. Rodriguez I., Chin L.J.. World Mycotoxin J. 5, (2012) 36

37 OSUD MYKOTOXINŮ V GASTROINTESTINÁLNÍM TRAKTU PŘEŽVÝKAVCŮ, STUDIE IN VITRO Fate of mycotoxins in gastrointestinal tract of ruminants, in vitro study 1 Džuman Z., 1 Vepříková Z., 1 Fenclová M., 1 Hajšlová J., 2 Pozdíšek J., 2 Křížová L., 3 Stryk J., 1 Zachariášová M. 1 Vysoká škola chemicko-technologická v Praze 2 Agrovýzkum Rapotín s.r.o. 3 Delacon Biotechnik, spol. s.r.o. Kontaktní adresa 1. autora: Ing. Zbyněk Džuman, VŠCHT Praha, Ústav analýzy potravin a výživy, Technická 3, , Praha 6 Dejvice Abstrakt Mykotoxiny a jejich maskované formy představují značné zdravotní riziko pro lidi i hospodářská zvířata. Potřebu výzkumu zaměřeného na výskyt toxických sekundárních metabolitů v krmivech akcentuje i Evropský úřad pro bezpečnost potravin (EFSA). Jednou z klíčových strategií eliminace toxicity krmiv je aplikace vyvazovačů mykotoxinů nebo biotransformačních činidel do krmiv. Cílem experimentu je ověření funkčnosti testovaného aditiva, a to nejen pro jeden deklarovaný (cílový) mykotoxin, ale i pro širší spektrum mykotoxinů detekovaných v krmivu použitého při kultivaci. Interakce sorbentu byla studována za simulovaných podmínek gastrointestinálního traktu přežvýkavců i) bachor, ii) slez a iii) tenké střevo. Pro stanovení mykotoxinů byla využita technika ultra-účinné kapalinové chromatografie s tandemovou hmotnostní spektrometrií (UPLC-MS/MS). Klíčová slova mykotoxiny, deoxynivalenol, aditiva, kultivace in vitro, detoxifikace, LC-MS Abstract Mycotoxins and their masked forms represents a significant health risk to both human and livestock. The need for research studies focused on the occurrence of toxic secondary metabolites in feed is also emphasized by European Food Safety Authority (EFSA). One of possible key strategies for the elimination of toxic effects of contaminated feed is the use of feed additives. The aim of this experiment is to verify the functionality of tested additive for declared mycotoxin and also for other mycotoxins detected in feed used for cultivation. The efficiency of the used sorbent was tested under conditions simulating conditions of gastrointestinal tract of ruminants i) rumen, ii) abomasus and iii) small intestine. For the determination of mycotoxins technique was used ultra-performance liquid chromatography with tandem mass spectrometry (UPLC-MS/MS). Keywords mycotoxins, deoxynivalenol, feed additives, in vitro cultivation, detoxification, LC-MS 37

38 Úvod Mykotoxiny jsou nízkomolekulární toxické produkty sekundárního metabolismu vláknitých mikromycet, jež mohou kontaminovat nejen široké spektrum rostlinných potravin ale často kontaminují i významný vstupní článek potravního řetězce - krmiva. 1,2 Přibližně 25% veškerých obilovin je dle odhadu Organizace pro zemědělství a výživu spojených národů (Food and Agriculture Organization, FAO) kontaminováno mykotoxiny. 1 Nejvýznamnější skupinou mykotoxinů vyskytující se především v cereáliích mírného pásu jsou fusariové toxiny produkované rodem Fusarium. Kromě základních faktů o existenci volných mykotoxinů bylo zjištěno, že ty mohou být rostlinami částečně metabolizovány za vzniku maskovaných forem, nejčastěji glykosidů. Jak bylo potvrzeno v rámci posledního výzkumu, glykosid může být v gastrointestinálním traktu částečně rozštěpen za vniku mateřského mykotoxinu a konzument je tak vystaven i částečně metabolizovaným formám mykotoxinů. 3,4 Jednou z možných strategií minimalizace negativních dopadů mykotoxinové kontaminace krmiv na hospodářská zvířata je aplikace tzv. vyvazovačů mykotoxinů do krmiv. Rigidní komplex sorbent mykotoxin je bez vstřebání vyloučen z těla zvířete. V rámci zvýšení informovanosti odborné veřejnosti bylo Evropským úřadem pro bezpečnost potravin (EFSA) v prosinci 2009 vydáno obsáhlé zhodnocení veškerých současných vědeckých poznatků o krmných aditivech. 5 Pravdou je, že jednoznačně směrodatné informace o účinnosti daného aditiva je možné zjistit pouze přímým testováním aditiva in vivo na konkrétním druhu, což je sice značně komplikované, ale v dnešní době to tvoří jedinou záruku standardnosti daného výrobku. Samotnému in vivo testování však předchází testování na úrovni laboratorních pokusů (in vitro), které v dnešní době standardně probíhá v systému interakce standardu mykotoxinu a sorbentu s čistým rozpouštědlem. V souvislosti s mírou vyvázání příslušného mykotoxinu in vitro byla definována hodnota tzv. BC50, neboli množství aditiva, které je nutné použít pro snížení hladiny cílového mykotoxinu o polovinu. Cílem našeho současného výzkumu (na úrovni in vitro) je však snaha o větší přiblížení se reálným podmínkám gastrointestinálního traktu polygastrů. Simulace sorpce mykotoxinů tedy není realizována pouze na úrovni standardů a čistých rozpouštědel, ale v systému reálného gastrointestinálního prostředí s využitím reálných bachorových tekutin a slinných roztoků. Dalším podnětem k realizaci této pilotní studie je fakt, že většina komerčně dostupných vyvazovačů mykotoxinů je deklarována pouze pro jeden mykotoxin nejčastěji deoxynivalenol, zearalenon, aflatoxiny a fumonisiny. S ohledem na široké spektrum mykotoxinů vyskytujících se současně v krmivech je však vysoce žádoucí identifikovat vyvazovače, které disponují schopností simultánně vyvázat a tak detoxifikovat co nejvyšší počet těchto toxinů najednou. Z tohoto důvodu byly experimenty provedeny na reálných vzorcích krmiv na bázi siláží, ve kterých byl předchozí analýzou zjištěn výskyt širšího spektra mykotoxinů na vyšších hladinách. Materiál a metody Design pilotního experimentu V rámci experimentu bylo testováno komerčně dostupné krmné aditivum na bázi hydratovaného sodnovápenatého aluminosilikátu HSCAS (Hydrated Sodium Calcium Aluminosilicate). Pro kultivaci za standardizovaných podmínek in vitro v laboratoři Agrovýzkum Rapotín, byly použity dva vzorky siláže, které byly před vlastním experimentem analyzovány na Ústavu analýzy potravin a výživy, VŠCHT Praha. Kontaminace siláží 1 a 2 je shrnuta v tabulce I. 38

39 Siláže vybrané pro kultivaci se šťávami gastrointestinálního traktu přežvýkavců byly kultivovány v médiu simulujícím prostředí i) bachoru (pufrovaná bachorová tekutina, ph 7), ii) slezu (pufrovaná bachorová tekutina + pepsin, ph 2,5) a iii) tenkého střeva (pufrovaná bachorová tekutina + pepsin + pankreatin + amyloglukosidáza, ph 6,8). Množství kultivovaného vzorku i kultivačního média byly propočteny tak, aby odpovídaly reálným podmínkám v bachoru dojnic a reálnému dennímu příjmu daného krmiva. Experiment byl proveden ve dvou kombinacích, a to bez přídavku a s přídavkem absorbentu v množství odpovídajícím doporučené denní dávce 20 g/ks a den, a ve třech opakováních. Během simulace procesů v bachoru i) byl sledován i vliv délky kultivace 0, 6, 12 a 24 hod za podmínek anaerobního prostředí, stabilní teploty 39 C a kontinuálního protřepávání. V případě simulace trávení ve slezu ii) a tenkém střevě iii) vliv času nebyl uplatněn, byla zvolena identická doba kultivace v bachorové tekutině v délce 12 hod., s následnou kultivací s pepsinem v délce 0,5 hod ii) a iii) a poté s pankreatinem a amyloglukosidázou dle Meunier et al. (2008) po dobu dalších 4 hod iii). Po ukončení inkubací byly vzorky zpracovány dle Avantaggiato et al. (2003) 6 a uchovány zamražené do analýz na obsah mykotoxinů. Tab. I: Kontaminace vstupních siláží hladina mykotoxinu [µg/kg] mykotoxin siláž 1 siláž 2 nivalenol 689 < 10 deoxynivalenol DON-3-glukosid 150 < 5 HT-2 toxin 58 < 2 zearalenon 314 < 1 beauvericin 90 < 50 enniatin B 50 < 10 < LOQ... hodnota pod limitem kvantifikace Metoda analýzy mykotoxinů: Vzorek pro analýzu mykotoxinů v krmivech po kultivaci s bachorovými tekutinami za různých podmínek byl po rozmrazení nejprve vytemperován na laboratorní teplotu, důkladně promíchán a odstředěn v PTFE kyvetách za vysokých otáček ( RPM) po dobu 5 minut. Centrifugát byl dále přečištěn přes mikrofiltr (0,2 µm) a poté analyzován s využitím ultraúčinného kapalinového chromatografu s tandemovým hmotnostním spektrometrem (UPLC MS/MS). Pro chromatografickou separaci byl použit ultra-účinný kapalinový chromatograf Acquity (Waters) a chromatografická kolona HSS T3, 100 x 2.1 mm; 1,8 µm (Waters). Eluce mykotoxinů probíhala za podmínek gradientové eluce, mobilní fáze byly na bázi metanolu a vody s obsahem mravenčanu a octanu amonného. Teplota kolony byla udržována na 40 C, nástřikový objem byl 2 µl. Detekce byla prováděna prostřednictvím a tandemové hmotnostníspektrometrie s hmotnostním analyzátorem typu lineární iontová past, qtrapms/ms (AB Sciex). Ionizace analytů probíhala elektrosprejem v obou ionizačních modech (positivní / negativní). Separace a detekce iontů byla realizována prostřednictvím MRM (multiple reaction monitoring) modu. Kvantifikace byla prováděna s pomocí nejintenzivnějšího (kvantifikačního) iontového přechodu metodou externí kalibrace na kalibrační řadu matričních standardů. 39

40 Analyzované mykotoxiny: Celkem bylo v silážích a jejich kultivátech se šťávami gastrointestinálního traktu přežvýkavců analyzováno 57 mykotoxinů: 3- a 15-acetyldeoxynivalenol, aflatoxin B1, B2, G1 a G2, agroklavin, alternariol, alternariol-methylether, beauvericin, citrinin, cyklopiazonová kyselina, deoxynivalenol, deoxynivalenol-3-glukosid, diacetoxyscirpenol, enniatin A, A1, B a B1, ergokornin, ergokorninin, ergokristin, ergokristinin, ergokryptin, ergokryptinin, ergometrin, ergotamin, ergotaminin, fumonisin B1, B2 a B3, fusarenon X, gliotoxin, HT-2 toxin, meleagrin, mykofenolová kyselina, neosolaniol, nivalenol, ochratoxin A, patulin, paxilin, peniciliová kyselina, penitrem A, phomopsin A, rokfortin C, stachybotrylaktam, sterigmatocystin, T-2 toxin, tenuazonová kyselina, tentoxin, verrucarol, verruculogen, zeralenon, α-zearalenon, β-zearalenon. Výsledky a diskuze Kultivace testovaných vzorků siláží v prostředí bachoru způsobila se vzrůstajícím časem částečný nárůst hladin deoxynivalenolu u obou testovaných siláží a nivalenolu v případě siláže č. 1 (tab. II, obr. 1 a 2). Je možné, že tento trend souvisí s uvolněním těchto mykotoxinů z polysacharidů buněčných stěn zelených rostlin po působení celuláz a celobiáz, které jsou v bachorových šťávách polygastrů přirozeně přítomny. Co se týká zearalenonu, v případě bachorové kultivace siláže č. 1 se jeho hladina nepatrně snížila. V kyselém prostředí sleze došlo k redukci hladin nivalenolu i deoxynivalenolu, zatímco hladina zearalenonu zůstala takřka nezměněna. Zvýšení ph během kultivace simulující prostředí tenkého střeva způsobilo další pokles hladin deoxynivalenolu u obou testovaných vzorků a nivalenolu ve vzorku siláže č. 1, hladina zearalenonu se v tomto případě naopak částečně zvýšila. Po srovnání hladin mykotoxinů detekovaných ve šťávách gastrointestinálního traktu přežvýkavců s a bez použití mykosorbentu lze konstatovat, že v případě nivalenolu a deoxynivalenolu nebyl vliv absorbentu na snížení jejich hladin prokázán. V případě zearalenonu lze říci, že vlivem sorbentu došlo k částečné redukci jeho hladiny v tenkém střevě. Nicméně koncentrace zearalenonu v siláži byla poměrně nízká a pro potvrzení vlivu přítomnosti krmného aditiva bude nutné provedení dalších experimentů s více kontaminovaným krmivem. Další mykotoxiny detekované v siláži č. 1 (DON-3-glukosid, beauvericin a enniatin B) již v kultivátech detekovány nebyly. Důvodem je zředění jejich koncentrace kultivační tekutinou pod limit detekce metodiky. Z tohoto důvodu není jejich procentuální bilance diskutována. 40

41 změna hladin mykotoxinů vzhledem k původní siláži [%] Tab. II.: Změny hladin mykotoxinů při kultivaci testovaných siláží vzorek poměr koncentrací mykotoxinu vztažený na kultivát v čase 0 [%] siláž č. 1 siláž č. 2 popis vzorku doba inkubace nivalenol deoxynivalenol zearalenon deoxynivalenol VZ 0 hod VZ + sorbent 0 hod VZ (bachor) 6 hod VZ + sorbent (bachor) 6 hod VZ (bachor) 12 hod VZ + sorbent (bachor) 12 hod VZ (bachor) 24 hod VZ + sorbent (bachor) 24 hod VZ + PEPSIN (slez) ,5 hod VZ + sorbent + PEPSIN (slez) VZ + PEPSIN + PANKR+AG (tenké střevo) VZ + sorbent + PEPSIN + PANKR+AG (tenké střevo) ,5 hod ,5+4 hod ,5+4 hod Obr. 1: Vliv absorbentu na hladiny mykotoxinů během kultivace siláže č. 1 se šťávami gastrointestinálního traktu NIV NIV+sorbent DON DON+sorbent ZON ZON+sorbent bachor bachor bachor bachor slez tenké střevo 0 hod 6 hod 12 hod 24 hod ,5 hod 12+0,5+4 hod 41

42 změna hladinmykotoxinů vzhledem k původní siláži [%] Obr. 2: Vliv absorbentu na hladiny mykotoxinů během kultivace siláže č. 2 se šťávami gastrointestinálního traktu DON DON+sorbent bachor bachor bachor bachor slez tenké střevo 0 hod 6 hod 12 hod 24 hod ,5 hod 12+0,5+4 hod Závěr Výsledky experimentu poskytují podklady k posouzení absorpce mykotoxinů v zažívacím traktu polygastrů. Přispívají tak k řešení otázek jejich užitkovosti, ale i k prevenci přenosu mykotoxinů do potravin živočišného původu. V nadcházejících navazujících pokusech bude nezbytné provedení dalších in vitro studií s dalšími typy mykosorbentů, čímž postupně získáme informace nezbytné pro komplexní posouzení vlivu přítomnosti krmných aditiv na soubor širokého spektra mykotoxinů vyskytujících se krmivech. Dedikace Financováno v rámci projektu NAZV QI111B044 a dále z účelové podpory na specifický vysokoškolský výzkum MŠMT ČR (rozhodnutí č. 21/2011) a z institucionální podpory na dlouhodobý koncepční rozvoj výzkumné organizace (rozhodnutí MZe ČR č. RO0312 ze dne ). Použitá literatura 1. Placinta C.M., D Mello J.P.F., MacDonald A.M.C.: Anim. Feed Sc. and Tech. 78 (1999), Hussein H.S., Brasel J.M.: Tox. 167 (2001), Berthiller F., Schuhmacher R., Adam G., Krska R.: Anal. Bioanal. Chem. 395 (2009), Berthiller F., Krska R., Domig K.J.: Tox. Lett. 206 (2011), Scientific report submitted to EFSA: Review of mycotoxin-detoxifying agents used as feed additives: mode of action, efficacy and feed/food safety, Avantaggiato G., Havenaar R., Visconti A.: Food Chem. Toxicol. 41 (2003),

43 DETEKCE EXPRESE VYBRANÝCH GENŮ SYNTÉZY TRICHOTHECENŮ U FUSARIUM CULMORUM PO INFEKCI JEČMENE Detection of changes in Fusarium culmorum trichothecenes synthesis gene expression after barley infection. Faltusová Z., Ovesná J., Chrpová, J., Havránková H. Výzkumný ústav rostlinné výroby, v.v.i. Kontaktní adresa 1. autora: RNDr. Zuzana Faltusová, Ph.D., Výzkumný ústav rostlinné výroby, v.v.i., Drnovská 507, Praha 6, , Abstrakt Fusarium culmorum je jednou z fytopatogenních hub, které negativně ovlivňují nejen produkci obilnin, ale též její kvalitu díky kontaminaci produkovanými mykotoxiny. Významným mykotoxinem produkovaným tímto patogenem je trichothecen deoxynivalenol (DON). Naše práce byla zaměřena na vytvoření postupu sledování změn exprese genů účastnících se biosyntetické dráhy trichothecenů po infekci rostlin ječmene F. culmorum. Pro sledování byly vybrány geny Tri4, Tri5, Tri6, Tri10 a Tri13DON. Geny Tri4, Tri5 a Tri13DON kódují enzymy účastnící se biosyntetické dráhy trichothecenů. Tri6 a Tri10 byly popsány jako geny regulační kódující transkripční faktory. Klíčová slova Fusarium culmorum, ječmen, RT-PCR, Tri geny, trichotheceny, deoxynivalenol Abstract Fusarium culmorum is one of phytopathogenic fungi, which negatively affect not only cereals production, but also its quality due to the contamination produced mycotoxins. An important mycotoxin produced by this pathogen is trichothecene deoxynivalenol (DON). Our work was focused on the creation of a monitoring procedure changes the expression of genes involved in trichothecene biosynthetic pathway after infection with F. culmorum barley plants. For monitoring were selected genes Tri4, Tri5, Tri6, TRI10 and Tri13DON. Genes Tri4, Tri5, Tri13DON encode enzymes involved in the biosynthetic pathway trichothecenes. Tri6 and Tri10 were described as regulatory genes encoding trancsription factors. Key words barley, deoxynivalenol, Fusarium culmorum, mycotoxines, RT-PCR Úvod Trichotheceny jsou sesquiterpenoidní mykotoxiny produkované parazitickými houbami, mezi které patří i rod Fusarium, který způsobuje chorobu klasu FHB (Fusarium Head Blight) u obilnin. Právě kontaminace obilnin mykotoxiny, které negativně ovlivňují zdraví zvířat a lidí je, vedle snížení produkce, hlavním negativním dopadem infekce plodin houbami rodu Fusarium. Trichotheceny působí jako inhibitory proteosyntézy a dle chemické 43

44 struktury se řadí do skupin typu A (např. toxin T2 ) a typu B (např. deoxynivalenol-don). Po infekci F. graminearum či F. culmorum je u plodin jako je pšenice, ječmen, oves a žito a kukuřice běžnější nález DON než toxinu T-2 (Moss, 2002). Agresivita těchto patogenů závisí na jejich schopnosti produkovat DON a nivalenol (Mesterházy 2002). To je ve shodě se zjištěním, že významné meziroční změny v kontaminaci DON přímo souvisí s výskytem choroby klasu v oblastech postižených fusariovou infekcí (Moss, 2002). Bai a kol. (2001) nalezli korelaci mezi obsahem DONu, příznaky FHB a kvalitou zrn pšenice. Obsah DONu u pšenice mimo to zřetelně odráží podmínky prostředí, hladinu odolnosti odrůd a patogenitu izolátů Fusarium (Šíp a kol. 2008). Biosyntetická cesta trichothecenů již byla důkladně prostudována a byly identifikovány téměř všechny geny, označené jako Tri geny, spojené s touto biosyntézou (Desjardins et al., 1993; Foround a Eudes, 2009). Na počátku biosyntetické dráhy trichothecenů je TRI5, kódující trichodiensyntázu (Hohn and Beremand 1989). TRI4 kóduje multifunkční cytochrom P450 monooxygenázu, účastnící se následujícího kroku biosyntézy (McCormick et al., 2006). Tri13 kóduje cytochrom P450 monooxygenázu (Kimura et al. 2007). Produkty genů Tri 6 a Tri 10 mají v biosyntéze trichothecenů regulační úlohu (Tag et al. 2001). Sledováním změn exprese Tri genů v závislosti na obsahu trichothecenů a stupni napadení obilnin má za cíl zjistit způsob snížení kontaminace produkce. Pro sledování exprese genů trichothecenů po napadení obilnin je nezbytné vybrat vhodné primery a referenční geny. Materiál a metody Nejprve byly vybrány geny biosyntetické dráhy trichothecenu DON. Primery pro amplifikaci úseků těchto genů byly převzaty buď z literatury, nebo navrženy s využitím database NCBI a Primer3 software: Tri4-F, Tri4-R -délka produktu 95 bp (Ponts et al. 2007); Tri13DON-F, Tri13DON-R- délka produktu 282 bp (Chandler et al. 2003). Tri5-F, Tri5-R -délka produktu 244 bp (gdna), 184 bp (cdna); Tri6-F, Tri6-R- délka produktu180 bp; Tri10 F, Tri10-Rdélka produktu 195 bp (gdna), 105 (cdna). Jako referenční byly použity geny βtub, Ef2 a UBC. Použity byly primery: βtub-f, βtub-r -délka produktu 296 bp (gdna), 250 bp (cdna) (Ponts et al. 2007); Ef2- délka produktu 387 bp (Boutigny et al. 2009); UBC-PS.1 a UBC- PS.2 délka produktu 104 bp (Lysøe et al. 2006). RNA a DNA byly izolovány z 0,1 g zmražených zrn odrůdy ječmene Pedant infikované izolátem F. culmorum, pro který je charakteristická vysoká schopnost produkovat mykotoxin deoxynivalenol (DON), která byla homogenizována pomocí tekutého dusíku. RNA byla dále izolována phenol-chloroformovou metodou za použití TRIzol Reagent (Invitrogen, USA) dle pokynů výrobce. Takto vyizolovaná RNA byla přečištěna pomocí RNeasy Mini Kit a RNase-Free DNase Set (Qiagen, Germany) a skladována při -80 C. Koncentrace získané RNA byla změřena na spektrofotometru (Nano-Photometer TM, Implen GmbH+Co.KG, Germany) při vlnové délce 260 nm. Čistota RNA byla ověřena zhodnocením poměru A 260 / A 280 (hodnota čisté RNA v rozmezí 1,9-2,1) a A 260 /A 230 (hodnota>1,8). Integrita RNA byla ověřena vyhodnocením kvality signálu pro velkou a malou ribozomální podjednotku na electroforeogramu. Vyizolovaná a přečištěná RNA byla přepsána do komplementární cdna pomocí TaqMan Reverse Transcription Reagents v termocykleru Verity (Applied Biosystems, Inc., USA). Složení reakční směsi a podmínky termálního cyklu byly připraveny dle pokynů výrobce. Pro reakci byl použit objem templátové RNA, který odpovídal výsledné koncentraci 20 ng/μl. Získaný roztok cdna byl uchováván při -20 C. Teplotní profil PCR reakce byl následující: inkubace při 25 C (10 min), reverzní transktipce při 48 C (30 min), inaktivace reverzní transkriptázy při 95 C (5 min), zchlazení při 4 C ( ). Takto získaná cdna byla uchována při -20 C a dále použita pro RT- PCR (real-time PCR). Reakční směs pro RT-PCR byla připravena s využitím Power SYBR Green PCR Master Mix dle návodu 44

45 výrobce (Applied Biosystems, Inc.). Pro zjištění optimální teploty nasedání primerů byla použita gradientová PCR. Gradient teplot (56; 57; 58; 59 a 61 C) byl zvolen na základě teplot nasedání vybraných primerů, které jsou uvedeny v již zmíněných literárních zdrojích (Lysøe, 2006; Ponts a kol., 2007; Boutigny, 2009). Délka výsledných amplifikačních produktů byla stanovena elektroforetickou separací na agarózovém gelu porovnáním se známým standardem. Specificita reakce byla ověřena pomocí kontroly křivky teploty tání PCR produktů. Pro každou dvojici primerů byly zhotoveny kalibrační přímky z real-time PCR naředěného vzorku, který vykazoval nejnižší hodnoty CT z hodnoceného souboru. Směrnice těchto přímek byly použity k výpočtu efektivit reakcí. DNA byla izolována pomocí DNeasy Plant Mini Kit (Qiagen, Germany). Nárůst patogena byl určen pomocí RT -PCR s využitím Tag Man sondy a dvou specifických primerů (Leišová et al. 2006). Výsledky a diskuse Práce byla zaměřena na optimalizaci real- time PCR reakce pro studium vybraných genů biosyntézy trichothecenů F. culmorum ve vzorcích infikovaného ječmene (Hordeum vulgare L.) a výběr vhodných referenčních genů. Pomocí gradientové PCR jsme stanovili optimální teplotní profil real-time PCR reakce pro geny biosyntetické dráhy trichothecenů: Tri4, Tri5, Tri6, Tri10 a Tri13DON. Pro nasedání primerů byly vybrány teploty, při kterých nedocházelo ke vzniku nespecifických produktů (Tab. 1). Specificita reakce byla ověřena kontrolou křivky tání PCR produktů a jejich elektroforetickou separací na agarózovém gelu, pomocí které bylo ověřeno, že délka výsledných amplifikačních produktů odpovídá předpokládaným velikostem. Efektivita PCR reakcí stanovená na základě naměřených kalibračních přímek se pro jednotlivé dvojice primerů pohybovala kolem doporučených 90% (Applied Biosystems 2008) a to v rozmezí od 86% do 97%. Opakovatelnost optimalizované real-time PCR reakce byla testována několika pracovníky na shodných materiálech a byly nalezeny pouze statisticky nevýznamné odchylky mezi měřeními. Vzhledem k tomu, že v hodnocených vzorcích není konstantní koncentrace RNA patogena, bylo nutné nalézt referenční gen, který tento nárůst odráží. Nárůst patogena byl ověřen metodou real-time PCR s využitím Tag Man sondy (Leišová et al. 2006). Jako nejlepší referenční gen byl vyhodnocen UBC, u kterého byla zjištěna efektivita reakce 96,7% a jehož exprese odrážela nárůst patogena ve vzorcích infikovaného ječmene během 4 týdnů, který byl naměřen pomocí real-time PCR s Tag Man sondou. O vhodnosti použití toho referenčního genu vypovídá též skutečnost, že byl vyhodnocen jako jeden ze dvou nejstabilnějších referenčních genů při normalizaci exprese funkčních genů biosyntézy trichothecenů v izolátech F. graminearum (Havránková et al. 2011). Tab.1- Optimální teploty nasedání primerů primery teplota nasedání primerů Tri4-F, Tri4-R 57 C Tri5-F, Tri5-R 60 C Tri6-F,Tri6-R 58 C Tri10-F, Tri10-R 58 C Tri13DON-F, Tri13DON-R 58 C 45

46 β-tub-f, β-tub-r 57 C Ef2-F, Ef2-R 57 C UBC-PS.1, UBC-PS.2 57 C Závěr Námi vyvinutý postup je možno dále využít pro studium exprese genů syntézy trichothecenů po infekci různě odolných odrůd ječmene patogenem F. culmorum. Dedikace Tento výzkum byl realizován za finanční podpory MZe, projekt NAZV QI111B044 a výzkumného záměru CZ Použitá literatura 1. Bai, G.-H., Plattner, R., Desjardins, A., Kolb, F. (2001). Resistence to Fusarium head blight and deoxynivalenol accumulation in wheat. Plant Breeding 120, Boutigny, A.L., Barreau, Ch., Atanasova-Penichon, V., Verdal-Bonnin, M.N., Pinson- Gadais, L., Richard-Forget, F. (2009). Ferulic acid, an efficient inhibitor of type B trichothecene biosynthesis and Tri gene expression in Fusarium liquid cultures. Myco. Res. 113, Hohn T. M., Beremand P. D. (1989). Isolation and nucleotide sequence of a sesquiterpene cyclase gene from the trichothecene-producing fungus Fusarium sporotrichioides. Gene. vol. 79 (1), Chandler, E.A., Simpson, D.R., Thomsett, M.A., Nicholson, P. (2003). Development of PCR assays to TRI7 and TRI13 trichothecene biosynthetic genes, and characterization of chemotypes of Fusarium graminearum, Fusarium culmorum and Fusarium cerealis. Physiological and Molecular Plant Pathology 62: Kimura, M., Tokai, T., Takahashi-Ando, N., Ohsato, S., Fujimura, M. (2007). Molecular and genetics studies of Fusarium trichothecene biosynthesis: pathways, gene and evolution. Biosci., Biotechnol., Biochem. 71, Leišová, L., Kučera, L., Chrpová, J., Sýkorová, S., Šíp, V., Ovesná, J. (2006). Quantification of Fusarium culmorum in wheat and barley tissues using real-time PCR in comparison with DON content. J. Phytopathology 154, Lysøe, E., Klemsdal, S.S., Bone, K.R., Frandsen, R.J.N., Johansen, T.,Thrane, U., Giese, H.(2006). The PKS4 Gene of Fusarium graminearum is essential for zearalenone production. Appl. Environ. Microbiol. 72, McCormick, S. P., Alexander, N. J., Proctor, R. H. (2006). Fusarium Tri4 encodes a multifunctional oxygenase required for trichothecene biosynthesis. Can. J. Microbiol.52,

47 9. Mesterházy, A. (2002). Role of deoxynivalenol in aggressiveness of Fusarium graminearum and F. culmorum and resistance to Fusarium head blight. European Journal of Plant pathology 108: Moss, M.O. (2002). Mycotoxin review- 2. Fusarium. Mycologist, vol. 16, part 4: Ponts, N., Pinson-Gadais, L., Barreau, Ch., Richard-Forget, F., Oullet, T (2007). Exogenous H2O2 and catalase treatments interfere with Tri genes expression in liquid cultures of Fusarium graminearum. FEBS Letters 581, Šíp, V., Chrpová, J., Sýkorová, S. (2008). Assessing resistance to head blight in wheat cultivars inoculated with different Fusarium isolates. Czech J. Genet. Plant Breed. 44: Tag, A. G., Garifullina, G. F., Peplow, A. W., Ake, Jr. C., Phillips, T. D., Hohn, T. M., Beremand, M. N. (2001). A novel regulatory gene, Tri10, controls trichothecene toxin production and gene expression. Applied and environmnetal microbiology. vol. 67 (11),

48 KONTAMINACE OVSA SKLIZENÉHO V ČR FUZÁRIOVÝMI MYKOTOXINY Contamination of Czech oats by Fusarium mycotoxins 1 Polišenská I., 2 Václavíková M., 1 Jirsa O., 3 Z. Štěrba, 2 Hajšlová J. 1 Agrotest fyto, s.r.o. 2 Vysoká škola chemicko-technologická v Praze 3 Jihočeská univerzita v Českých Budějovicích Kontaktní adresa 1. autora: RNDr. Ivana Polišenská, Ph.D., Agrotest fyto, s.r.o., Havlíčkova 2787, Kroměříž Abstrakt Celkem bylo na obsah fuzáriových mykotoxinů analyzováno 119 vzorků ovsa sklizených v České republice v letech Nejčastěji byly vzorky pozitivní na obsah HT-2 toxinu, nejvyšší koncentrace byly zjištěny pro obsah NIV. Všechny vzorky ovsa splnily v současné době platné limity pro maximální obsah DON v ovsu určeném pro potravinářské zpracování ve výši 1750 µg/kg (podle nařízení Komise (ES) č. 1881/2006), maximální zjištěná hodnota obsahu DON činila 892 μg/kg. Dva vzorky (tj. 2 % ze sledovaných 119 vzorků) přesáhly limit pro obsah ZEA ve výši 100 μg/kg, maximální zjištěná hodnota obsahu ZEA činila 165 μg/kg. Všechny vzorky by splnily navržený limit pro sumu obsahů T-2 a HT-2 toxinů ve výši 1000 µg/kg. Klíčová slova oves, mykotoxiny, DON, deoxynivalenol, T-2, HT-2, Fusarium Abstract In total, 119 oat samples harvested in the Czech Republic during were analysed for the content of Fusarium mycotoxins. Most oat samples were positive in the content of HT-2 toxin, followed by NIV and T-2 toxin. Nivalenol was found at the highest concentrations from all mycotoxins analysed. All samples complied with the maximum limit for DON content in oats for food purposes (1750 µg/kg, according to Commission Regulation No. 1881/2006), the highest estimated DON value was 892 μg/kg. Two samples (2 % from 119 samples analysed) exceeded the maximum limit for ZEA (100 μg/kg), the highest estimated ZEA value was 165 μg/kg. All samples would comply with proposed limit for the sum of T-2 and HT-2 toxins (1000 µg/kg). Key words oats, mycotoxins, DON, deoxynivalenol, T-2, HT-2, Fusarium Úvod Mezi houbové choroby obilovin s velkým potenciálem škodlivosti patří klasová fuzária, způsobená komplexem patogenů Fusarium. Napadají zejména pšenici, ječmen, žito, kukuřici a také, jak ukázala nedávná zjištění, oves. Kromě toho, že důsledkem napadení může 48

49 být redukce výnosu a pokles zpracovatelské kvality, kontaminují původci klasových fuzarióz obiloviny svými toxickými produkty, mykotoxiny. Některé patogenní druhy vyskytující se v rámci tohoto komplexu mykotoxiny produkují (druhy Fusarium spp.), jiné ne (Microdochium spp. dříve Fusarium nivale spp.) a situace je dále komplikována tím, že různé druhy Fusarium produkují různé toxiny. Je také známo, že variabilita v produkci mykotoxinů existuje i mezi různými izoláty stejného druhu. Také samotné složení komplexu patogenů Fusarium vyskytujících se na klasech je variabilní a může jej ovlivňovat počasí, lokalita a také druh hostitelské obiloviny. Obecně nejznámějšími a v Evropě nejčastěji se vyskytujícími druhy jsou F. graminearum a F. culmorum (Mesterházy, 2003), které jsou odpovědné za produkci deoxynivalenolu (DON), který je nejčastěji nalézaným fuzáriovým mykotoxinem v obilovinách a obilných výrobcích v celosvětovém měřítku (Schwake-Anduschus et al., 2010). Ačkoliv se i na ovsu mohou vyskytovat druhy běžné na pšenici, jako je F. culmorum a F. graminearum, v evropských podmínkách se na ovsu častěji prosazují druhy jako jsou F. poae, F. langsethiae a F. sporotrichioides. Druh F. langsethiae byl identifikován poprvé na obilovinách v Evropě před několika lety (Torp a Langseth 1999). Symptomy napadení obilovin druhem F. langesthiae jsou vizuálně pozorovatelné pouze vzácně, a to i po provedení umělých infekcí v poli nebo ve skleníku (Imathiu et al., 2009) a obecně je považován za slabého patogena (Divon et al., 2012). Dosavadní zjištění ukazují, že tento druh preferuje z obilovin jako hostitele oves, případně ječmen. Ve Velké Británii je F. langsethiae je považováno za příčinu vysokého obsahu T-2 a HT-2 toxinů, které jsou často zjišťovány v tamních ovsech Edwards (2007; 2009). Vysoké hladiny obsahu T-2 a HT-2 v ovsu byly zjištěny i v Norsku, Finsku a dalších skandinávských zemích (Pettersson et al., 2008; Pettersson et al., 2011). Zatímco společnou vlastností známějších druhů F. culmorum a F. graminearum je produkce trichothecenů typu B (např. DON, nivalenol a další) a produkce zearalenonů, mezi společné toxické metabolity druhů F. poae, F. langsethiae a F. sporotrichioides patří T-2 a HT-2 toxiny a další jejich deriváty, patřící do skupiny trichothecenů typu A. U F. poae se uvádí, že je možná koprodukce nivalenolu (trichothecen B) a T-2 toxinu (trichothecen A). Společným bodem je produkce diacetoxyscirpenolu, který je znám jako biosyntetický prekurzor obou těchto toxinů (Desjardins, 2006). T-2 a HT-2 toxiny jsou účinnými inhibitory syntézy proteinů a jejich toxicita je mnohonásobně vyšší než DON (Tu et al., 1993). Současná legislativa EU limitující obsah kontaminantů v potravinách (nařízení Komise (ES) č. 1881/2006) již T-2 a HT-2 toxiny uvádí mezi limitovanými, avšak bez konkrétních hodnot. Definitivní výše limitu je stále v pracovní skupině pro zemědělské kontaminanty expertního výboru Evropské Komise diskutována. Problémem je mj. nedostupnost rychlých detekčních metod a není také dostatečně znám vliv jednotlivých agrotechnických faktorů, který by umožnil vypracovat strategii správné zemědělské praxe pro prevenci obsahu těchto mykotoxinů v ovsu. Z vědeckého stanoviska EFSA, vyplývá relativně nízká expozice evropského spotřebitele k T-2 a HT-2 toxinům (EFSA 2011). V současné době je na základě nařízení Komise (ES) č. 1881/2006 z fuzáriových mykotoxinů limitován v nezpracovaném ovsu určeném pro potravinářské využití obsah DON (max limit 1750 µg/kg) a obsah ZEA (100 µg/kg). Podle posledního návrhu Evropské Komise ze dne je pro nezpracovaný potravinářský oves navržen maximální limit pro sumu T-2 a HT-2 toxinů ve výši 1000 µg/kg, pro nezpracovanou pšenici 50 µg/kg, pro ječmen 200 µg/kg a pro kukuřici 150 µg/kg. Existují také návrhy limitů pro zpracované mlýnské výrobky z jednotlivých druhů obilovin. Cílem prezentovaného výzkumu bylo zjistit celkovou úroveň kontaminace ovsa sklizeného v ČR vybranými fuzáriovými mykotoxiny a srovnat zjištěné výsledky s legislativními limity resp. návrhy limitů. 49

50 Materiál a metody Vzorky ovsa byly získávány přímo od farmářů z běžných provozních ploch. Byly odebírány reprezentativním způsobem bezprostředně po kombajnové sklizni. Celkem bylo získáno 119 vzorků ovsa sklizených v ČR v letech Z toho bylo 87 vzorků pluchatých odrůd (Atego, Neklan, Pogon, Auron, Azur, Raven, Ardo, Corneil, Flamingskrone, Flamingsnova, Max, Pan, Polar, Rozmar, Vendelín, Vok, Zlaťák) a 32 vzorků nahých odrůd (Saul, Avenuda, Izak, Abel). U všech vzorků byl analyzován obsah T-2 a HT-2 toxinů, deoxynivalenolu (DON), DON-3-glucosidu (DON-3-Glc), nivalenolu (NIV), acetyldeoxynivalenolů (ADONs), fusarenonu X (FUS-X) a zearalenonu (ZEA). Analýzy byly provedeny v laboratoři Ústavu analýzy potravin VŠCHT Praha metodou vysokoúčinné kapalinové chromatografie spojené s hmotnostní spektrometrií s vysokým rozlišením (UPLC-TOFMS), podle postupu popsaného v práci Zachariasova et. al (2010). Pracovní charakteristiky metody jsou uvedeny v Tabulce 1. Data byla zpracována s využitím statistického software Statistica Cz, verze 8.0 (Statsoft CR s.r.o.). Tabulka 1. Pracovní charakteristiky metody UPLC-TOFMS použité pro analýzu obsahu fuzáriových mykotoxinů (T-2 and HT-2 toxins, DON, DON-3-Glc, NIV, ADONs, FUS-X and ZEA) v ovsu Parametr DON DON-3- Glc Mycotoxin (µg/kg) ADONs NIV FUS-X HT-2 T-2 ZEA LOD LOQ Výtěžnost (%) , RSD (%) 7,6 8,7 9,1 8,3 5,5 4,8 5 6,2 Výsledky a diskuze Z hlediska frekvence výskytu pozitivních vzorků byl dominantním mykotoxinem HT-2 toxin, z hlediska absolutních hodnot koncentrací byl dominantním mykotoxinem NIV (Tabulka 2). V průměru let bylo 73 % sledovaných vzorků ovsa pozitivních na obsah HT-2 toxinu, v jednotlivých letech se podíl pozitivních vzorků pohyboval mezi 42 % v roce 2011 až po 96 % v roce Absolutně nejvyšší hodnota obsahu HT-2 toxinu byla zjištěna v roce 2008, a to 501 μg/kg. Průměrná hodnota mediánu koncentrace HT-2 činila 21 μg/kg a pohybovala se od hodnoty < LOQ v roce 2011 po 31 μg/kg v roce Tabulka 2. Výskyt mykotoxinů (T-2, HT-2, DON, DON-3-Glc, NIV, ADONs, FUS-X a ZEA) v ovsu sklizeném v České republice v letech , 119 vzorků. Vzorky nad LOQ Koncentrace mykotoxinů (µg/kg) (%)* Průměr Medián 90% 95% Max T HT DON < DON < 10 <

51 Glc NIV ADONs < 10 < Fus-X 4 < 5 < 5 < 5 < 5 23 ZEA 9 < 5 < 5 < *ročníkový průměr Druhým nejčastěji detekovaným mykotoxinem byl NIV. U tohoto mykotoxinu byly zjištěny nejvyšší koncentrace výskytu. V průměru sledovaných let bylo 63 % všech sledovaných vzorků ovsa pozitivních na obsah NIV, v jednotlivých letech se podíl pozitivních vzorků pohyboval od 38 % v roce 2008 po 84 % v roce Hodnoty mediánu obsahu NIV se pohybovaly od hodnoty < LOQ v roce 2008 a 2009 po 85 μg/kg v roce Nejvyšší koncentrace NIV byla zjištěna také v roce 2007, a to 2202 μg/kg. Třetím nejčastěji se vyskytujícím mykotoxinem byl T-2 toxin. Průměrný ročníkový podíl pozitivních vzorků činil 54 %, přičemž se pohyboval od 21 % v roce 2011 po 69 % v roce Hodnoty mediánu obsahu T-2 se pohybovaly v závislosti na ročníku od hodnoty < LOQ v roce 2011 po 18 μg/kg v roce Nejvyšší koncentrace T-2 byla zjištěna ve výši 474 μg/kg v roce Přítomnost T-2 toxinu ve vzorcích ovsa statisticky průkazně souvisela s přítomností HT-2 toxinu. Byla zjištěna statisticky průkazná závislost mezi koncentracemi těchto dvou mykotoxinů (Obr. 1). Pro vzorky s pozitivním obsahem (nad LOQ) těchto dvou mykotoxinů byla také sledována hodnota podílu jejich obsahu (HT-2/T-2), který se pohyboval od 0,15 to 8,13, přičemž pro většinu vzorků (92 %) byl tento podíl 1, tj. obsah HT-2 toxinu u jednotlivých vzorků byl většinou vyšší, než obsah T-2 toxinu. Obr.1. Vztah mezi koncentrací HT-2 a T-2 toxinu ve vzorcích ovsa sklizeného v České republice v letech Jsou hodnoceny pouze vzorky s obsahem obou mykotoxinů nad LOQ (5 μg/kg), log-log graf. 2,8 Zahrnout jestliže: "HT-2">0,835 and "T-2">0,835 Log10(T-2) = 0,0537+0,7454*x 2,6 2,4 2,2 2,0 Log10(T-2) 1,8 1,6 1,4 1,2 1,0 0,8 0,6 0,6 0,8 1,0 1,2 1,4 1,6 1,8 2,0 2,2 2,4 2,6 2,8 Log10(HT-2) Čtvrtým nejčastěji se vyskytujícím mykotoxinem byl DON, v průměru sledovaných let bylo na obsah tohoto mykotoxinu pozitivních 48 % všech sledovaných vzorků. V jednotlivých 51

52 letech se podíl pozitivních vzorků pohyboval od 11 % v roce 2011 až po 68 % v roce Maximální zjištěná hodnota obsahu DON činila 892 μg/kg, jednalo se o vzorek ze sklizně Průměrné hodnoty mediánu se pohybovaly od < LOQ v letech 2008, 2010 a 2011 po 27 μg/kg v roce Pozitivní hodnoty obsahu ZEA se vyskytly jen u 9 vzorků ovsa ze třech sklizňových let (1 vzorek v roce 2011, 2 vzorky v roce 2009 a vzorků v roce 2010). Nejvyšší zjištěná koncentrace ZEA činila 165 μg/kg. Dva vzorky však měly obsah ZEA vyšší než 100 μg/kg a přesáhly tak legislativní limit pro obsah ZEA v potravinářských obilovinách podle nařízení č. 1881/2006. Dedikace Prezentované výsledky byly získány v rámci řešení projektu MZe QH Použitá literatura 1. Desjardins, A., E. (2006): Fusarium Mycotoxins. Chemistry, Genetics, and Biology. The American Phytopathological Society. 2. Divon, H., H., Razzaghiah, J., Udnes-Aamot, H., Klemsdal, S., S. (2012): Fusarium langsethiae (Torp and Nirenberg), investigation of alternative infection routes in oats. Eur J Plant Pathol 132: Edwards, S.G. (2007): Investigation of Fusarium mycotoxins in UK barley and oat production. HGCA Project Report No London: HGCA. 4. Edwards, S.G. (2009): Fusarium mycotoxin content of UK organic and conventional oats. Food Additives and Contaminants, 26: EFSA (2011): Scientific Opinion on the risks for animal and public health related to the presence of T-2 and HT-2 toxin in food and feed. EFSA Journal 9 (12): Imathiu, S.M., Ray, R.V., Back, M., Hare M.C., Edwards, S.G. (2009): Fusarium langsethiae pathogenicity and aggressiveness towards oats and wheat in wounded and unwounded in vitro detached leaf assays. Eur J Plan Pathol 124: Mesterházy, A. 2003: Breeding wheat for Fusarium head blight resistance in Europe. In: Fusarium Head Blight of Wheat and Barley. Ed. Leonard, K., J., Bushnell, W.R., The American Phytopathological Society, St. Paul, Minnesota, USA, 312 pp. 8. Pettersson, H., Borjesson, T., Persson, L., Lerenius, C., Berg, G., Gustafsson, G. (2008): T-2 and HT-2 toxins in oats grown in northern Europe. Cereal Research Comminications 36: Pettersson, H., Brown, C., Hauk, J., Hoth, S., Meyer, J., Wessels, D. 2011: Survey of T-2 and HT-2 toxins by LC-MS/MS in oats and oat products from European mills in Food Addit Contam Part B Surveill June; 4(2): Schwake-Anduschus, C., Langenkamper, G., Unbehend, G., Dietrich R., Martlbauer E., Munzing, K. (2010): Occurence of Fusarium T-2 and HT-2 toxins in oats from cultivar studies in Germany and degradation of the toxins during grain cleaning treatment and food processing. Food Additives and Contaminants, 27: Torp, M., Langseth, (1999): Production of T-2 toxin by a Fusarium resembling Fusarium poae. Mycopathologia 147: Zachariasova M., Lacina O., Malachova A., Kostelanska M., Poustka J., Godula M., Hajslova J.: Novel approaches in analysis of Fusarium mycotoxins in cereals employing ultra performance liquid chromatography coupled with high resolution mass spectrometry. Analytica Chimica Acta, 662 (2010),

53 TECHNOLOGICKÁ JAKOST A OBSAH DEOXYNIVALENOLU V ZRNU OBILOVIN S RŮZNOU INTENZITOU KONTAMINACE FUSARIUM SPP. Technological quality and deoxynivalenol content in grain of cereals with different intensity of Fusarium spp. contamination 1 Capouchová I., 2 Konvalina P., 3 Stehno Z., 4 Václavíková M., 1 Prokinová E., 1 Škeříková A., 3 Janovská D. 1 Česká zemědělská univerzita v Praze 2 Zemědělská fakulta Jihočeské univerzity v Českých Budějovicích 3 Výzkumný ústav rostlinné výroby Praha, v.v.i. 4 Vysoká škola chemicko-technologická v Praze Kontaktní adresa 1. autora: Doc.Ing. Ivana Capouchová,CSc., ČZU Praha, Kamýcká 129, Praha 6-Suchdol, Abstrakt U souboru vzorků ozimých a jarních druhů a odrůd obilovin s různou úrovní kontaminace zrna Fusarium spp. (varianta s umělou inokulací x varianta přirozeně kontaminovaná), pocházejících z ekologického a konvenčního způsobu pěstování, jsme sledovali obsah deoxynivalenolu a hodnoty základních jakostních ukazatelů zrna. U varianty s umělou inokulací byla zjištěna nejen vysoká hladina deoxynivalenolu, ale i negativní ovlivnění ukazatelů technologické jakosti, zejména Zelenyho testu a čísla poklesu. U obsahu N-látek a mokrého lepku v sušině zrna naproti tomu došlo u varianty s umělou inokulací k navýšení hodnot těchto znaků oproti přirozeně kontaminované kontrole, což lze přičíst výrazně nižším hodnotám objemové hmotnosti a HTS uměle inokulovaných variant. Vliv způsobu pěstování (ekologický x konvenční) na jakostní ukazatele byl vyšší na méně úrodné lokalitě v Českých Budějovicích. Klíčová slova ozimé a jarní obilniny, Fusarium spp., DON, technologická jakost, ekologické a konvenční pěstování Abstract Collection of winter and spring cereals species and varieties with different intensity of Fusarium spp. infestation (variant with artificial inoculation x variant with natural contamination), from organic and conventional cropping systems, was used for determination of DON content and values of basic parameters of technological quality. High level of DON and negative affecting of technological quality parameters, especially of Zeleny test and falling number values were estimated in variants with artificial inoculation. On the other hand, higher values of crude protein content and wet gluten content in variants with artificial inoculation were estimated, probably due to lower values of the test weight and TKW (thousand kernels weight). Effect of cropping system (organic and conventional) on quality parameters was higher in less fertile locality České Budějovice. 53

54 Key words winter and spring cereals, Fusarium head blight, DON, technological quality, organic and conventional cropping system Úvod Druhy rodu Fusarium patří mezi polní houby, produkující řadu mykotoxinů. Deoxynivalenol (DON) je mykotoxin, který patří k nejčastěji detekovaným a vyskytuje se i ve velmi vysokých koncentracích (Clear, Patrick, 2000). Na jeho produkci se nejčastěji podílí F. graminearum a F. culmorum. Malé množství deoxynivalenolu, které se může dostat do potravního řetězce, je možné očekávat i když je výskyt Fusarium spp. v průběhu vegetace nízký (Berleth et al., 1998). Infekce Fusarium spp. může vést ke snížení hmotnosti zrna a ke tvorbě scvrklých zrn, častý je rovněž výskyt hluchých klásků, případně celých klasů (Beck et al., 1997). Současně zpravidla dochází i ke snížení jakosti zrna. Např. Boyacioglu a Hettiarachchy (1995) uvádí, že při napadení zrna pšenice F. graminearum dochází k destrukci škrobových zrn a zásobních proteinů. Cílem naší práce bylo zhodnotit ukazatele technologické jakosti různých druhů ozimých i jarních obilnin s různou úrovní kontaminace Fusarium spp. a různou koncentrací deoxynivalenolu v zrnu, vypěstovaných v podmínkách ekologického a konvenčního zemědělství. Materiál a metody Vzorky ozimé a jarní pšenice seté, ozimé a jarní pšenice špaldy, jarní pšenice dvouzrnky, ozimého žita a jarního ječmene nahého, použité pro jakostní hodnocení, pocházely z přesných polních pokusů, vedených v ekologickém a konvenčním systému pěstování na pokusných pozemcích Katedry rostlinné výroby FAPPZ ČZU v Praze Uhříněvsi a Zemědělské fakulty JU v Českých Budějovicích. V rámci těchto pokusů byly využity jednak varianty přirozeně kontaminované, jednak varianty s umělou inokulací kvetoucích klasů obilnin Fusarium spp. Po sklizni byly odebrány z jednotlivých variant vzorky zrna pro jakostní hodnocení. V rámci hodnocení technologické jakosti byl stanoven obsah N-látek v sušině zrna (ČSN ISO 1871), obsah mokrého lepku v sušině zrna (ČSN ISO 5531), číslo poklesu (ČSN ISO 3093) a sedimentační index Zelenyho test (ČSN ISO 5529); dále byla stanovena objemová hmotnost zrna (ČSN ISO 7971) a HTS. Identifikace a kvantifikace deoxynivalenolu ve vzorcích pšenice byla provedena metodou HPLC-MS/MS, tedy kapalinovou chromatografií ve spojení s tandemovým hmotnostním detektorem. V práci jsou uvedeny výsledky ze sklizně roku Výsledky a diskuze Výsledky hodnocení zrna ozimých obilnin jsou uvedeny v tab. č. 1. Rozdíl v obsahu deoxynivalenolu mezi uměle inokulovanou variantou a přirozeně kontaminovanou kontrolou byl výrazný, a to u všech hodnocených druhů ozimých obilnin. U žita však navíc byla zaznamenána poměrně vysoká hladina deoxynivalenolu i u přirozeně kontaminované kontroly, která přesáhla u obou hodnocených odrůd i u obou způsobů pěstování limit deoxynivalenolu pro nezpracované zrno. U všech hodnocených druhů i odrůd ozimých obilnin byl rovněž patrný dopad různé intenzity kontaminace zrna Fusarium spp. na ukazatele technologické jakosti varianty s umělou inokulací se vyznačovaly vyšším obsahem N-látek v sušině zrna a pšenice i vyšším obsahem mokrého lepku v sušině zrna ve srovnání 54

55 s kontrolou. Toto navýšení nejspíše souvisí s výrazně nižší objemovou hmotností (OH) a hmotností tisíce semen (HTS) vzorků uměle inokulovaných Fusarium spp. u drobnějšího zrna můžeme vyšší obsah N-látek a mokrého lepku očekávat. K obdobným závěrům dospěli např. Beck et al. (1997). Vzorky pšenice z variant s umělou inokulací Fusarium spp. se dále vyznačovaly, v souladu se závěry Dextera et al. (1996) a Pawelzika et al. (1998), ve srovnání s kontrolou nižšími hodnotami Zelenyho sedimentačního testu - to by naznačovalo narušení lepkového komplexu inokulované varianty. Ve srovnání s kontrolou se inokulované varianty vyznačovaly zpravidla i nižšími hodnotami čísla poklesu. Určité rozdíly byly zjištěny i mezi oběma způsoby pěstování - v případě ekologického systému byly hodnoty sledovaných jakostních znaků ve většině případů nižší ve srovnání s konvenčním systémem pěstování, avšak jen mírně na úrodném, vyrovnaném stanovišti, jakým je VS Praha Uhříněves dosahují i obilniny z ekologického systému velmi dobrých výsledků. Tab. 1 Obsah deoxynivalenolu a základní jakostní ukazatele zrna ozimých obilnin (ČZU Praha-Uhříněves) Způsob pěstování Odrůda Ošetření (inokulace) DON v zrnu (μg/kg) Obsah N-látek v sušině zrna (%) Obsah mokrého lepku v sušině zrna (%) Zeleny test (ml) Číslo poklesu (s) OH (kg/hl) Pšenice setá EKO Bohemia Fusarium ,00 29,44 30, ,26 25,24 Bohemia kontrola ,78 26,00 51, ,01 51,54 KONV Bohemia Fusarium ,27 29,98 22, ,32 21,65 Bohemia kontrola ,27 27,99 62, ,87 55,11 EKO Darwin Fusarium ,65 26,46 31, ,06 27,68 Darwin kontrola ,84 22,15 40, ,94 47,41 KONV Darwin Fusarium ,15 33,81 31, ,81 24,58 Darwin kontrola ,86 26,95 46, ,13 52,78 Pšenice špalda EKO Ceralio Fusarium ,30 53,08 22, ,47 23,68 Ceralio kontrola 7 15,29 40,64 34, ,12 42,92 KONV Ceralio Fusarium ,19 53,66 21, ,11 21,43 Ceralio kontrola ,55 47,41 28, ,92 43,26 EKO Rubiota Fusarium ,93 48,73 23, ,98 22,36 Rubiota kontrola 5 17,25 45,88 31, ,43 52,24 KONV Rubiota Fusarium ,69 48,55 23, ,11 26,67 Rubiota kontrola ,64 47,02 31, ,98 50,10 Žito seté EKO D.Diament Fusarium , ,21 33,57 D.Diament kontrola , ,45 38,36 KONV D.Diament Fusarium , ,66 34,79 D.Diament kontrola , ,80 36,96 EKO Askari Fusarium , ,01 33,67 Askari kontrola , ,75 36,34 KONV Askari Fusarium , ,09 32,76 Askari kontrola , ,09 34,64 Výsledky hodnocení zrna jarních obilnin jsou uvedeny v tab. č. 2. Stejně jako u ozimých obilnin jsme i u jarních druhů na pokusné lokalitě JU v Českých Budějovicích zaznamenali výrazné rozdíly v obsahu deoxynivalenolu v zrnu mezi variantou s umělou inokulací Fusarium spp. a přirozeně kontaminovanou kontrolou ve srovnání s ozimými obilninami na lokalitě ČZU v Praze-Uhříněvsi však dosahoval u varianty s umělou inokulací Fusarium spp. obsah deoxynivalenolu nižších hodnot a u přirozeně kontaminované kontroly byla hladina HTS (g) 55

56 deoxynivalenolu pod detekčním limitem dané metody. Obdobně jako u ozimých obilnin jsme i zde zaznamenali u varianty s umělou inokulací vyšší obsah N-látek v sušině zrna oproti kontrole a rovněž u pšenice vyšší obsah mokrého lepku; dále i nižší hodnoty Zelenyho testu a čísla poklesu. Ve srovnání s lokalitou Praha Uhříněves byly na lokalitě České Budějovice větší rozdíly v úrovni sledovaných jakostních znaků (zejména N-látek a mokrého lepku) mezi ekologickým a konvenčním způsobem pěstování (u pšenice seté a pšenice dvouzrnky vyšší hodnoty v konvenčním systému, ale pšenice špalda naopak dosáhla vyšších hodnot obsahu N-látek v systému ekologickém). Tab. 2 Obsah deoxynivalenolu a základní jakostní ukazatele zrna jarních obilnin (JU České Budějovice) Způsob pěstování Odrůda Ošetření (inokulace) DON v zrnu (μg/kg) Obsah N-látek v sušině zrna (%) Obsah mokrého lepku v sušině zrna (%) Zeleny test (ml) Číslo poklesu (s) Pšenice setá EKO SW Kadrilj Fusarium ,00 21,74 28,8 189 SW Kadrilj kontrola < 5 10,43 14,65 29,4 221 KONV SW Kadrilj Fusarium ,08 30,58 32,0 186 SW Kadrilj kontrola < 5 12,65 28,09 38,0 215 Pšenice špalda EKO PRO-BIO Fusarium ,62 46,80 30,8 211 PRO-BIO kontrola < 5 15,59 41,85 30,8 297 KONV PRO-BIO Fusarium ,87 42,40 22,8 246 PRO-BIO kontrola < 5 14,83 38,38 26,1 293 Pšenice dvouzrnka EKO Rudico Fusarium ,29 34,51 13,0 330 Rudico kontrola < 5 14,21 30,26 15,0 413 KONV Rudico Fusarium ,07 49,52 15,9 226 Rudico kontrola < 5 16,46 39,18 16,9 396 Ječmen nahý EKO AF Lucius Fusarium , AF Lucius kontrola < 5 9, KONV AF Lucius Fusarium , AF Lucius kontrola 71 9, Závěr Kontaminace zrna pšenice Fusarium spp. vedla nejen k výskytu deoxynivalenolu, ale i k negativnímu ovlivnění jakostních ukazatelů, zejména Zelenyho testu a čísla poklesu.u obsahu N-látek a mokrého lepku v sušině zrna naproti tomu došlo u varianty s umělou inokulací k navýšení hodnot těchto znaků oproti přirozeně kontaminované kontrole, což nejspíše souvisí s výrazně nižšími hodnotami objemové hmotnosti a HTS uměle inokulovaných variant.. Dedikace Podpořeno projektem NAZV QI111B154. Použitá literatura 1. Beck, R., Lepschy, J., Obst, A. (1997): Fusarien schon im Herbst aufs Korn nehmen. Deutsche Landwirtschaftszeitung, 9:

57 2. Berleth, M., Backes, F., Krämer, J. (1998): Schimmelpilzspektrum und Mykotoxine (Deoxynivalenol und Ochratoxin A) in Getreideproben aus ökologischem und integriertem Anbau. Agrobiological Research 51: Boyacioglu, D., Hettiarachchy, N.S. (1995): Changes in some biochemical components of 4. wheat grain that was infected with Fusarium graminearum. J. of Cereal Science, 21, Clear, R.M., Patrick, S.K. (2000): Fusarium head blight pathogens isolated from 6. Fusarium-damaged kernels of wheat in western Canada, 1993 to Canad. J. of Plant 7. Pathology 22: Dexter, D.E., Clear, R.M., Preston, K.R. (1996): Fusarium head blight: Effect on milling and baking of some Canadian wheats. Cereal Chemistry, 73: Pawelzik, H.H., Permady, J., Weinert, J., Wolf, G.A. (1998): Untersuchungen zum Einflus einer Fusarien-Kontamination auf ausgewählte Qualitätsmerkmale von Weizen. Getreide Mehl und Brot 52:

58 ZHODNOCENÍ KOMERČNĚ DOSTUPNÝCH RYCHLOTESTŮ PRO STANOVENÍ OBSAHU DEOXYNIVALENOLU V CEREÁLIÍCH Critical assessment of commercially available rapid tests for determination of deoxynivalenol in cereals 1 Vepříková Z., 2 Novotná D., 1 Džuman Z., 1 Václavíková M., 1 Hajšlová J. 1 Vysoká škola chemicko-technologická v Praze 2 Unimills a.s., Českomoravská 2420/15, Praha 9, Kontaktní adresa 1. autora: Ing. Zdenka Vepříková, Ústav analýzy potravin a výživy, VŠCHT Praha, Technická 5, Praha 6, Abstrakt Deoxynivalenol (DON) je obecně nejčastěji se vyskytujícím fusariovým mykotoxinem v cereáliích pěstovaných v oblastech mírného podnebí, a bývá proto považován za marker mykotoxinové kontaminace obilovin. Pro rychlé a snadné stanovení mykotoxinů v obilovinách jsou v posledních letech na trhu dostupné screeningové rychlotesty různých firem. V rámci této studie byly testovány dva imunochemické rychlotesty pro stanovení DON. Jednalo se o testy R-Biopharm AG (Německo) a Charm Sciences, Inc. (USA). Výsledné hodnoty koncentrací DON v pšenici, ječmeni a žitu získány pomocí těchto testů, byly srovnány s hodnotami DON stanovenými akreditovanou metodou kapalinové chromatografie s hmotnostní detekcí (LC-MS/MS). Klíčová slova deoxynivalenol, mykotoxiny, rychlo-screeningové testy, LC-MS/MS Abstract Deoxynivalenol (DON) is the most frequently occurring Fusarium mycotoxin that contaminates cereals grown under the mild climate conditions. Therefore it is commonly considered to be a marker of mycotoxin contamination of cereals. Nowadays, fast and costeffective rapid screening tests for determination of DON are commercially available. For the purpose of this study, two different rapid screening tests produced by R- Biopharm AG (German) and Charm Sciences, Inc. (USA) were tested. Results obtained by both of these tests were compared with those obtained by LC-MS/MS method. Keywords deoxynivalenol, mycotoxins, rapid screening assays, LC-MS/MS Úvod Kvalita zemědělské produkce je z hlediska její nezávadnosti významně ovlivňována výskytem mikroskopických vláknitých hub a jejich produktů, mykotoxinů. Mezi nejvíce náchylné komodity patří především cereálie, které mohou být kontaminovány mykotoxiny jak v průběhu vegetace, tak při nevhodném skladování. Toxiny produkované rodem Fusarium patří v našich klimatických podmínkách k těm nejběžnějším. DON je celosvětově nejčastěji 58

59 se vyskytující zástupce fusariových toxinů v cereáliích a cereálních výrobcích, a bývá proto považován za marker mykotoxinové kontaminace obilovin. Značnou oblibu v posledních letech získávají různé rychlotesty založené na principu plošné imunochromatografie (Lateral Flow Immuno-Assays) sloužící především pro screeningové vyšetření přítomnosti mykotoxinů. Tyto testy se čím dál častěji začínají využívat v potravinářské praxi pro rutinní a rychlou kontrolu surovin i finálních výrobků. Jejich hlavními přednostmi jsou zejména rychlost, relativně nízká cena a snadnost použití v běžném provozu (terénu), a to bez nutnosti speciálního vybavení a podmínek. U těchto testů navíc odpadá potřeba obsluhy odborným personálem. Stejně jako u jiných imunoafinitních metod, i zde je velmi pravděpodobné riziko nadhodnocení získaných výsledků vůči přesným instrumentálním metodám jako je např. LC- MS, a to především díky křížové reaktivitě (cross-reaktivita) se strukturně podobnými látkami matrice nebo samotnými mykotoxiny. Testovací strip je složen ze dvou pružných plastových proužků, které jsou vzájemně slisovány do sebe. Mezi tyto proužky jsou umístěny savé vložky se specifickými protilátkami (označeny barvivem), další látky potřebné pro provedení stanovení a membrána s imobilizovanými protilátkami či deriváty analytů. V nabídce firem jsou ke stripům obvykle nabízeny i různá digitální čtecí zařízení, díky kterým je zajištěno stanovení bez subjektivního vlivu pracovníka (Krska R, Molinelli A., 2009; Stejskal V. et al. 2008). Prezentovaná studie byla zaměřená na stanovení DON v obilovinách dvěma rychlotesty RIDA QUICK DON a Charm ROSA. Současně byla ke stanovení DON, dále jeho dvou acetylovaných forem 3-ADON/15-ADON a glukosilované formy DON-3-glukosidu (D3G), využita metoda vysokoúčinné kapalinové chromatografie ve spojení s tandemovým hmotnostním spektrometrem typu iontová past (U-HPLC-MS/MS), která je považovaná za kontrolní, přesnou a citlivou metodu pro stanovení mykotoxinů v cereáliích. Materiál a metody Standardy mykotoxinů DON, D3G, 3-ADON a 15-ADON byly zakoupeny u firmy Dynex s.r.o. (Česká republika). Organická rozpouštědla (acetonitril, methanol) použitá při přípravě vzorků a separaci analytů byly dodány firmou Sigma Aldrich (Německo). Komerční imunochromatografické testy určené pro stanovení DON jsou vyráběny firmami: R- Biopharm AG (Německo), testy RIDA QUICK DON a Charm Sciences, Inc. (USA), test Charm ROSA. Vzorky infikovaného ječmene (1-5) pocházeli z Žabčic. Vzorky pšenice (6-19) a žita (20-21) byly poskytnuty firmou Unimills a.s. v rámci projektu: QI111B154 Bezpečnost cereálních bioproduktů z pohledu výskytu alternáriových a fusariových mykotoxinů. U-HPLC-MS/MS Izolace analytů z cereálních matric (navážka 2 g) byla provedena modifikovanou metodou QuEChERS (zkratka anglických slov: Quick, Easy, Cheap, Effective, Rugged, Safe, popisujících přednosti této extrakční metody), která je založena na extrakci analytů směsí acetonitrilu a vody a následném vysolení cílových analytů pomocí MgSO 4 a NaCl do horní acetonitrilové vrstvy, zatímco polární matriční ko-extrakty zůstaly ve fázi vodné. Alikvotní podíl takto přečištěného extraktu byl přefiltrován za pomoci mikrofiltru a převeden do vialky. Takto připravený vzorek byl připraven k analýze. Identifikace a kvantifikace byla provedena pomocí ultra-účinné kapalinové chromatografie s využitím kapalinového chromatografu Acquity U-HPLC (Waters), k detekci analytů byl použit tandemový hmotnostní spektrometr QTRAP 5500 (AB Sciex). Podmínky metody stanovení uvedeny v publikaci Lacina O. et al., RIDA QUICK DON 59

60 Tento test může díky RIDA QUICK SCANU (digitální čtecí zařízení) fungovat ve dvou režimech: 1. Cut Off určený pro vzorky s kontaminací v rozsahu µg/kg. 1g homogenizovaného vzorku s přídavkem 15 ml extrakčního pufru (součást balení) byl po dobu 3 minut intenzivně třepán v ruce. Po centrifugaci bylo 100 µl supernatantu naneseno do aplikační oblasti testovacího proužku. Po 5 min inkubace při laboratorní teplotě se strip vložil do kalibrované digitální čtečky pro odečtení výsledku. 2. Sens DON určený pro vzorky s kontaminací v rozsahu µg/kg. Navážka vzorku byla v tomto případě 2 g a zbytek postupu je shodný s postupem popsaným výše add.1. Celková časová náročnost obou testů je cca 20 min. Charm ROSA Metoda je určená pro vzorky s kontaminací v rozsahu µg/kg. 2g homogenizovaného vzorku byly extrahovány 10 ml deionizované vody. 100 µl extraktu bylo rozředěno 1 ml pufru. 300 µl rozředěného extraktu je po dobu 10 min inkubováno při 45 C. Následně je pomocí kalibrované refraktenční čtečky zjištěna koncentrace analytu ve vzorku. Celková časová náročnost cca 1 hod. Výsledky a diskuze V rámci uvedené studie byly testovány dva komerčně dostupné screeningové rychlotesty pro stanovení DON v cereáliích. Získané výsledky byly porovnány s hodnotami získanými pomocí akreditované metodiky LC-MS/MS. V Tab. I jsou uvedeny výsledné koncentrace stanovovaných toxinů, grafické porovnání výsledků je uvedeno na Obr. 1. Uvedené hodnoty koncentrací získané pomocí rychlotestů byly stanoveny jako průměr tří po sobě odečtených hodnot z příslušných digitálních čteček a srovnány vždy s hodnotou DON stanovené pomocí LC-MS/MS. V případě testu RIDA QUICK DON byly u vzorků s označením 13 a 16 (koncentrace DON v rozsahu µg/kg) měřeny jak v režimu Cut Off, tak v režimu Sens DON. Režim Sens DON vykazoval lepší shodu s naměřenými LC- MS/MS výsledky. Vybrané vzorky cereálií byly u obou metod měřeny v paralelních opakováních. Lepší shoda paralelních měření byla zjištěna pro test RIDA QUICK DON, kdy odchylka měření činila méně než 10% (stanoveno jako RSD). Procentuální bilance hodnot získaných pomocí rychlotestů vztažených na data získaná LC-MS/MS metodou (bráno jako referenční hodnota 100%) je graficky vyjádřena na Obr. 2. V případech, kdy hodnoty koncentrací DON určené pomocí rychlotestů přesahují hodnoty získané metodou LC-MS/MS, je možné toto nadhodnocení vysvětlit výskytem a možnou křížovou rekcí testů s konjugáty DON, tedy D3G a 3-ADON. U obou komerčně dostupných rychlotestů byla křížová reaktivita protilátek s 3-ADON, 15-ADON a D3G testována pomocí uměle kontaminovaných vzorků pšenice na hladině 500 µg/kg, stanovení bylo provedeno ve třech paralelních opakováních. Křížová reaktivita byla prokázána u rychlotestu RIDA QUICK DON s 3-ADON a D3G (výtěžnost 160% a 69%) a u Chram ROSA s 3- ADON (výtěžnost 150%) a minoritně s 15-ADON a D3G (výtěžnost 10% a 15%). Výsledky jsou podrobně uvedeny v Tab. II. Tab.I: Koncentrace DON, D3G, 3-ADON a 15-ADON stanovené pomocí testovaných rychlotestů RIDA QUICK DON, Charm ROSA a konvenční metodou LC-MS/MS (koncentrace jsou uvedeny v µg/kg). 60

61 RIDA QUICK DON Charm ROSA LC-MS/MS Označení vzorku DON DON DON DON v D3G DON v 3-ADON DON v 15-ADON suma Metoda [µg/kg] [µg/kg] [µg/kg] [µg/kg] [µg/kg] [µg/kg] [µg/kg] 1* DON Sens < DON Sens 217 DON CutOff <500 DON CutOff 2* DON CutOff < DON CutOff * DON CutOff < DON CutOff 133 4* DON CutOff < DON CutOff 633 5* DON CutOff < DON CutOff DON Sens <12.5 < DON Sens < <12.5 <12.5 < DON Sens <12.5 <12.5 < DON Sens <12.5 < ** DON Sens <12.5 <12.5 < DON Sens DON Sens < <12.5 <12.5 < ** DON CutOff <12.5 < DON CutOff ** DON Sens <12.5 <12.5 < DON Sens 860 DON CutOff 1010 DON CutOff ** DON CutOff <12.5 < DON CutOff ** DON Sens < <12.5 <12.5 < DON Sens <250 16** DON Sens <12.5 < DON Sens 670 DON CutOff 840 DON CutOff ** DON CutOff <12.5 < DON CutOff ** DON CutOff 2050 neměřeno <12.5 < DON CutOff ** DON CutOff 2350 neměřeno <12.5 < DON CutOff DON Sens < <12.5 <12.5 < DON Sens <12.5 <12.5 < * Vzorky měřené rychlotesty Chram ROSA ve dvou paralelních opakováních ** Vzorky měřené rychlotesty RIDA QUICK DON ve dvou paralelních opakováních Tab. II Výtěžnosti analytů použitých metodik, spike pšenice 500 µg/kg (n=3). DON Výtěžnost % RSD % LOQ [µg/kg] LC-MS/MS RIDA QUICK DON Charm Rosa D3G Výtěžnost % RSD % LOQ [µg/kg] LC-MS/MS RIDA QUICK DON x Charm Rosa ADON Výtěžnost % RSD % LOQ [µg/kg] LC-MS/MS RIDA QUICK DON x Charm Rosa x 15-ADON Výtěžnost % RSD % LOQ [µg/kg] LC-MS/MS RIDA QUICK DON x x x Charm Rosa

62 µg/kg Obr. 1 Výsledné koncentrace DON ve vzorcích získaných pomocí metod LC-MS/MS, RIDA QUICK DON a Charm ROSA LC-MS/MS RIDA QUICK DON Charm Rosa RIDA QUICK DON Charm Rosa % Obr. 2 Procentuální bilance hodnot koncentrací DON získaných pomocí obou rychlotestů vztažených k LC-MS/MS výsledkům DON (=100%) Závěr V rámci srovnávací studie bylo testováno 21 vzorků cereálií dvěma komerčně dostupnými rychlotesty: (i) RIDA QUICK DON firmy R- Biopharm AG a (ii) Charm ROSA firmy Charm Sciences. Hodnoty těchto testů byly porovnány s daty získanými akreditovanou metodou LC-MS/MS, která byla brána jako referenční. Pro celkové srovnání testů je nutno uvést, že časově méně náročná byla práce s testy RIDA QUICK DON a to cca 20 min k získání finální hodnoty koncentrace DON ve vzorku cereálií. Tento test také vykazoval lepší shodu s referenčními hodnotami LC-MS/MS a vyšší výtěžnost DON (71%), která byla testována pomocí uměle kontaminovaných vzorků. U tohoto testu byla navíc zjištěna významná křížová reakce k metabolitům DON, tedy 3-ADON (160%) a D3G (69%). 62

63 Nevýhodou testu je, že jím není možné stanovit koncentrace DON nižší než 250 µg/kg v cereáliích. U rychlotestu Charm ROSA je možné stanovovat koncentraci DON v rozmezí µg/kg. Tento test navíc vykazuje vyšší křížovou reaktivitu pouze s 3-ADON (výtěžnost 150%). Závěrem lze shrnout, že oba rychlotesty jsou vhodnou variantou při screeningovém monitoringu mykotoxinu DON v cereáliích a jsou dále vhodné k rutinnímu využití v praxi, jako např. ve mlýnech a provozech, kde je třeba kontinuálně testovat kvalitu zpracovávaných cereálních surovin a kde není možné využívat náročnější instrumentální techniky. Dedikace Financováno z účelové podpory na specifický vysokoškolský výzkum (MŠMT č.21/2012) a z projektu QI111B154. Použitá literatura 1. Krska, R.; Molinelli, A. Rapid test strips for analysis of mycotoxins in food and feed. Anal Bioanal Chem 2009, 393, Stejskal, V.; Hajšlová, J.; Kocourek, V. Bioanalytické metody pro hodnocení bezpečnosti zemědělských surovin a produktů; VŠCHT Praha: VÚRV, Lacina, O.; et al Critical assessment of extraction methods for the simultaneous determinationof pesticide residues and mycotoxins in fruits, cereals, spices and oil seeds employing ultra-high performance liquid chromatography tandem mass spectrometry. Journal of Chromatography A 2012, 1262 (2),

64 VLIV FUNGICIDNÍHO OŠETŘENÍ NA INFEKCI OBILEK JEČMENE HOUBAMI RODU FUSARIUM Influence of fungicidal treatment on barley grains infection by Fusarium Kmoch M., Šafránková I., Pokorný R., Cerkal R. Mendelova univerzita v Brně Kontaktní adresa 1. autora: Ing. Martin Kmoch, Ph.D., Mendelova univerzita v Brně, Zemědělská 1/1665, Brno, Abstrakt Cílem práce bylo identifikovat spektrum hub rodu Fusarium v obilkách vybraných odrůd jarního ječmene ošetřeného různými fungicidními programy a stanovit vliv fungicidního ošetření a odrůdy ječmene na infekci obilek. Pro identifikaci byla použita mikrobiologická metoda, determinace vybraných izolátů byla ověřena PCR metodou. Z 1275 izolátů hub r. Fusarium bylo nejčastěji identifikováno F. poae (41,1 %), F. graminearum (29,5 %) a F. tricinctum (11,4 %). Zastoupení druhů F. avenaceum, F. culmorum, F. sporotrichioides, F. verticillioides a F. oxysporum se pohybovalo v rozmezí 1,6 6,3%. Z výsledků analýz vyplývalo, že nejvyšší vliv na snížení průměrné úrovně infekce obilek odrůd jarního ječmene mělo fungicidní ošetření Hutton + Zantara (snížení průměrné infekce o 31,4 41,8 % oproti neošetřené kontrole). Nejvyšší vliv fungicidně ošetřených variant na zastoupení druhů byl zjištěn u patogenu F. graminearum. Jako nejvnímavější k napadení houbami r. Fusarium se jevila odrůda Gladys. Klíčová slova Fusarium spp., jarní ječmen, fungicidy Abstract A spectrum of fungi was identified in ten spring barley varieties treated by various fungicides. The presence of the Fusarium spp. was determined and the effect of a fungicide treatment and a variety on the grain infection was evaluated. A microbiological method was used for fungi identification. In selected isolates, the identification of Fusarium spp. was verified by the PCR method. The Fusarium genus was represented by the following species: F. poae (41.9%), F. graminearum (25.1%), F. avenaceum (14.7%), F. tricinctum (10.0%), F. sporotrichioides (3.8%), F. verticillioides (1.9%), F. culmorum (1.6%), and F. oxysporum (1.0%). Varieties Gladys and Sebastian were most infected by fungi of the Fusarium spp.; Bojos and Radegast were the least infected varieties. The occurrence of pathogens of the Fusarium spp. was reduced by % by the combination of fungicides Hutton (active substances prothioconazole, spiroxamine, tebuconazole; application in the BBCH 39 growth stage) + Zantara (bixafen, tebuconazole; BBCH 65). Treatment by Hutton, Zantara, and Prosaro 250 EC had an influence on the percentage of F. graminearum in the microflora was completely eliminated from the pathogen spectrum. Key words Fusarium spp., spring barley, fungicides 64

65 Úvod Na obilninách bylo popsáno několik druhů rodu Fusarium, z nichž pouze některé (F. graminerarum, F. culmorum, F. avenaceum a F. poae) se podílejí na běloklasosti (Boshoff et al., 1999). V Evropě došlo nejen k výrazným změnám v zastoupení jednotlivých druhů rodu Fusarium (Bottalico et Perrone, 2002), ale i nárůstu běloklasosti (Parry et al., 1995). Xu et al. (2005) uvádějí významné rozdíly ve výskytu patogenů podílejících se na běloklasosti mezi jednotlivými zeměmi. I když jsou přirozené infekce houbami r. Fusarium většinou velmi slabé, v oblastech, kde jsou vhodné podmínky pro epidemický výskyt nebo jsou infekce vyvolány druhy s nízkou patogenitou, které zejména u ječmene nezpůsobují typické symptomy (běloklasost), mohou ztráty na výnose dosahovat až 40 %. Snížení kvality zrna je výsledkem schopnosti některých druhů r. Fusarium, produkovat mykotoxiny, které negativně ovlivňují zdraví lidí i zvířat (Jurado et al., 2005). Výskyt hub r. Fusarium lze omezit aplikací fungicidů, jejichž účinnost závisí nejen na účinné látce, ale také na způsobu a termínu aplikace (Parry et al., 1995, Homdork et al., 2000), na meteorologických podmínkách (Mesterhazy et Bartok, 1996) a na přítomných druzích hub (Parry et al., 1995). Jednotlivé druhy r. Fusarium vykazují specifickou citlivost vůči účinným látkám (Simpson et al., 2001). Cílem práce bylo identifikovat spektrum hub r. Fusarium v obilkách jarního ječmene ošetřeného fungicidy s různými účinnými látkami v rozdílných termínech, dále zjistit úroveň infekce obilek patogeny r. Fusarium a stanovit vliv fungicidního ošetření a odrůdy ječmene na infekci obilek. Materiál a Metody Pro pokusy na lokalitě Žabčice (jižní Morava, 178 m n. m., kukuřičná výrobní oblast) byly v roce 2011 vybrány odrůdy ječmene jarního Aksamit, Bojos, Gladys, Kangoo, Malz, Prestige, Sebastian, Radegast, Tocada a Xanadu s variantami ošetření (kontrola, Hutton + Zantara, Hutton 1 + Prosaro a Hutton 2 + Prosaro) a uměle inokulované F. culmorum a neinokulované. Ošetření Fungicid BBCH Účinná látka 1. Kontrola H+Z Hutton 39 prothioconazole, spiroxamine, tebuconazole Zantara 65 tebuconazole, bixafen 3. H2+P Hutton 39 prothioconazole, spiroxamine, tebuconazole Prosaro 250 EC 65 prothioconazole, tebuconazole 4. H1+P Hutton prothioconazole, spiroxamine, tebuconazole Prosaro 250 EC 65 prothioconazole, tebuconazole K vyhodnocení napadení zrn jednotlivých variant (odrůd ječmene) houbami rodu Fusarium byla použita metoda rolád. Sto zrn každé odrůdy ječmene bylo povrchově desinfikováno (5% hypochlorid sodný, s), následně propláchnuto sterilní destilovanou vodou a osušeno. Zrna byla fixována škrobnatým přírodním vodním lepidlem na pás filtračního papíru ( mm) a překryta proužkem filtračního papíru ( mm). Filtrační papír, podložený fólií PVC, byl smotán do rolády, a vertikálně umístěn do kontejneru s vodním roztokem (50 ppm iprodione) tak, aby docházelo k plynulému vzlínání roztoku ke klíčícím zrnům. Po 6 dnech inkubace v laboratorních podmínkách (t C, 12/12 hod.) byl hodnocen počet kolonií hub rodu Fusarium prorůstajících z jednotlivých zrn. Z infikovaných zrn byly odebrány vzorky mycelia a na živné půdě vypěstovány čisté kultury pro identifikaci jednotlivých druhů r. Fusarium dle morfologických znaků makrokonidií a mikrokonidií. K identifikaci jednotlivých druhů byl použit optický mikroskop (Olympus BX41, zvětšení ) a stereomikroskop (Olympus SZX12). Identifikace byla provedena podle Leslie et 65

66 Summerell (2006). Správnost identifikace jednotlivých vybraných druhů rodu Fusarium (F. avenaceum, F. graminearum, F. poae a F. culmorum) mikrobiologickou metodou byla ověřena (potvrzena nebo vyvrácena) PCR-metodou. Izolace DNA byla provedena ze 100 mg mycelia houby pomocí DNeasy Plant Minikit (Qiagene, Německo) podle standardního protokolu. Kvalita a kvantita DNA byla stanovena pomocí spektrofotometru (NanoDrop 2000c). Čistota DNA byla hodnocena na základě stanovení poměru absorbance při 260 a 280 nm. Pro amplifikaci DNA byly použity vybrané páry primerů, pro F. avenaceum primery JIAf/r (Turner et al., 1998), pro F. graminearum primery Fg16F/R (Nicholson et al., 1998), pro F. poae primery Fp82F/R (Parry et Nicholson, 1996) a pro detekci F. culmorum primery OPT18F470/OPT18R470 (Schilling et al. (1996). Do PCR-reakcí byl použit Taq PCR Core Kit (Qiagene, Německo). Reakce probíhaly v objemu 25 µl. Pro jednotlivé PCR reakce byly zvoleny reakční podmínky pro termocykler (Apollo TM ATC401) a koncentrace reagencií (pufry, nukleotidy, primery, Taq-polymeráza) podle výše citovaných publikací. Do reakcí byla zařazena pozitivní (standard) a negativní kontrola (bez templátu). Separace výsledných fragmentů DNA byla provedena na horizontální elektroforéze (zdroj napětí Consort EV265, vana Cleaver MSMAXI0) na 1 1,5% tris-acetate-edta-agarózovém gelu. Vizualizace amplifikované DNA po obarvení 1% ethidium bromidem byla realizována pomocí UVtransiluminátoru (Foto/UV 21). Výsledky a diskuze Z výsledků vyplývá, že nejvyšší účinek na potlačení infekce obilek houbami r. Fusarium mělo ošetření přípravky Hutton (BBCH 39) a Zantara (BBCH 65), u kterého je účinnou látkou bixafen. Výskyt patogenů r. Fusarium byl touto fungicidní kombinací redukován o 41,8 (neinokulované varianty), resp. o 31,4 % (varianty uměle inokulované F. culmorum). U přípravků Hutton a Prosaro 250 EC s účinnými látkami prothioconazole, tebuconazole a spiroxamine se výrazný fungicidní efekt neprojevil, výskyt patogenů r. Fusarium byl oproti kontrolní variantě bez ošetření nižší jen o 4 18 % (viz Obr. 1). Chemická ochrana obilnin proti houbám r. Fusarium je v současnosti předmětem mnoha studií, ve kterých je shodně akcentována závislost účinnosti fungicidu na termínu a frekvenci aplikací i aktivní látce [Parry et al. 1995, Homdork et al. 2000, Ioos et al. 2005]. Ke snížení infekce Fusarium spp. je podle Chala et al. [2003] a Mesterhazy et al. [2003] nejúčinnější ošetření v období květu. Vysoká citlivost byla v uměle inokulovaných porostech prokázána u tebuconazole [Homdork et al. 2000, Mesterhazy et al. 2003], účinek propiconazole se od účinku tebuconazole nelišil. 66

67 Průměrná infekce obilek (%) Obr. 1 Infekce obilek ječmene jarního houbami rodu Fusarium (v %; Žabčice, 2011) neinokulováno inokulováno 5 0 K Z H1+P H2+P Varianta Vysvětlivky: H fungicid Hutton, Z Zantara, P Prosaro 250 EC; 1 růstová fáze BBCH 25 30, 2 BBCH 39, 3 BBCH 65. Obecně byly v roce 2011 přirozené infekce obilek ječmene jarního houbami r. Fusarium velmi slabé, pozorována byla ale výrazná odrůdová citlivost na napadení. V rámci pokusné série patřily k nejvíce infikovaným odrůdám Gladys > Sebastian > Aksamit > Kangoo > Malz, nejméně napadené byly Bojos < Radegast < Xanadu < Tocada < Prestige. Identifikace druhů r. Fusarium u fungicidně neošetřených variant odhalila následující zastoupení patogenů: F. poae (41,9 %), F. graminearum (25,1 %), F. avenaceum (14,7 %), F. tricinctum (10,0 %), F. sporotrichioides (3,8 %), F. verticillioides (1,9 %) F. culmorum (1,6 %) a F. oxysporum (1,0 %). Tyto výsledky korespondují se studiemi autorů, kteří se zabývají analýzou mykoflóry obilek ječmene [např. Flannigan 1996]. Ještě počátkem tohoto tisíciletí uváděli Hýsek et al. [1999] jako nejčastěji izolované druhy na ječmeni v České republice F. culmorum a F. poae. Nyní začíná převládat teplomilnější druh F. graminearum, který je spolu s F. avenaceum dlouhodobě uváděn jako nejčastější druh v sousedním Německu i Holandsku [Schilling et al., 1997]. Fungicidní ošetření přípravky Hutton, Zantara a Prosaro 250 EC mělo největší vliv na přítomnost patogenů F. graminearum, výskyt houby byl menší na obilkách fungicidně ošetřených variant (viz Obr. 2). Simpson et al. [2001] uvádí, že F. graminearum je citlivé na skupinu triazolů, do kterých účinné látky námi použitých fungicidů patří. Také v pokusech in vitro, které provedl Jones [2000], bylo F. graminearum citlivé na benomyl, tebuconazole a mankozeb. Ošetření pšenice látkou tebuconazole provedené Ioos et al. [2005] výrazně snížilo úroveň infekce F. graminearum a F. culmorum. Účinnost ošetření se ale lišila mezi roky a každý druh hub rodu Fusarium reagoval na fungicidní ošetření rozdílně. 67

68 Obr. 2 Spektrum druhů rodu Fusarium v obilkách ječmene jarního (v %, Žabčice, 2011) Kontrola Hutton (BBCH 39) + Zantara (BBCH 65) Fsp; 3,8 Fo; 1,0 Fv; 1,9 Fc; 1,6 Fsp; 5,4 Fc; 5,4 Ft; 10,0 Fa; 14,7 Fp; 41,9 Ft 21,7 Fp; 39,5 Fg; 25,1 Fa; 10,9 Fg; 17,0 Hutton (39) + Prosaro 250 EC (BBCH 65) Hutton (25 30) + Prosaro 250 EC (BBCH 65) Fsp; 2,9 Fo; 1,8 Fc; 5,9 Fo; 1,5 Fc; 3,8 Fsp; 4,8 Ft; 11,8 Fp; 42,2 Ft; 12,6 Fp;39,2 Fa; 14,7 Fa; 15,8 Fg; 20,6 Fg; 22,3 Vysvětlivky: Fp F. poae, Fg F. graminearum, Fa F. avenaceum, Ft F. tricinctum, Fsp F. sporotrichioides, Fo F. oxysporum, Fv F. verticillioides, Fc F. culmorum Závěr Kontrola mykotoxigenních hub rodu Fusarium je soubor opatření, kterými lze zabránit průniku mykotoxinů do potravního řetězce a tím chránit zdraví člověka i hospodářských zvířat. Pěstitelská praxe zná několik efektivních způsobů, jak výskyt toxinů v rostlinných produktech regulovat: výběrem vhodné odrůdy a zajištěním dobrého zdravotního stavu rostlin fungicidním ošetřením. Situaci v současné fungicidní ochraně ječmene ale komplikuje široké spektrum patogenů a prokázaný výskyt dříve absentujících či minoritních druhů r. Fusarium. Výsledky pokusu prokázaly, že vhodná kombinace účinných látek některých fungicidů (Hutton + Zantara) spolu s optimálním termínem aplikace (BBCH 39 a 65) mohou významně eliminovat výskyt patogenů r. Fusarium (až o 40 %), a to i při umělé inokulaci F. culmorum. Kombinace účinných látek může mít za následek také změnu spektra a zastoupení patogenů, jak bylo pozorováno na všech fungicidně ošetřených variantách u F. graminearum nebo F. verticillioides. Ze souboru deseti testovaných odrůd ječmene jarního patřily k nejvíce náchylným na infekci houbami r. Fusarium odrůdy Gladys a Sebastian, naopak nejméně napadané byly Bojos a Radegast. Tržní situace v komoditě ječmen bohužel v ČR dlouhodobě neumožňuje respektovat biologické přednosti některých odrůd, a proto budou otázky jeho fungicidní ochrany stále aktuální. 68

69 Dedikace Výzkum byl finančně podpořen projektem č. QI111B044 Komplexní strategie pro minimalizaci negativního dopadu infekce toxikogenními houbami r. Fusarium v obilovinách a odvozených produktech. Použitá literatura 1. Boshoff, W., H., P., Swart, W., J., Pretorius, Z., A., Isozyme characterisation of F. graminearum isolates associated with head bligh torirrigated wheat in South Africa S. Afr. J. Bot., 65 (4): Bottalico, A., Perrone, G., Toxigenic Fusarium species and mycotoxins associated with head blight in small-cereals in Europe. European Journalof Plant Pathology 108: Flannigan, B., The mikroflora of barley and malt. In: Priest FG, Campbell (eds), Brewing mikrobiology. 2nd edn. Chapman and Hall, London: from 2000 to Mycopathologia 158: Homdork, S,; Fehrmann, H.; Beck, R., Effects of field application of tebuconazole on yield, yield components and the mycotoxin content of Fusariuminfected wheat grain. J Phytopathol 148: Homdork, S., Fehrmann, H., Beck, R., Effects of field application of tebuconazole on yield, yield components and the mycotoxin kontent of Fusariuminfected wheat grain, J. Phytopathol. 148: Chala, A.; Weinert, J.; Wolf, G., A., An integrated approach to the evaluation of the efficacy of fungicides against Fusarium culmorum, the cause of head blight of wheat. J Phytopathol 151: Ioos, R., Belhadj, A., Menez, M., Occurrence and distribution of Microdochium nivale and Fusarium species isolated from barley, durum and soft beat grains in France 9. Jones, R., K., Assessments of fusarium head blight of wheat and barley in response to fungicide treatment, Plant Disease 84: 9, Jurado, M., Vázquez, C., Patiño, B., Gonzáles-Jaén M., T PCR detection assays for the trichothecene-producing species Fusarium graminearum, Fusarium culmorum, Fusarium poae, Fusarium equiseti and Fusarium sporotrichioides. Syst. Appl. Microbiol. 28: Krmenčík, P., Kysilka, J Jedy nižších hub (mykotoxiny) [online]. [cit ]. Dostupné na World Wide Web: 12. Langseth, W., Bernhoft, A., Rundberget, T., Kosiak, B., Gareis, M Mycotoxin production and cytotoxicity of Fusarium strains isolated from Norwegian cereals. Mycopathologia 144: Leslie, J., F.; Summerell, B., A.; Bullock, S The Fusarium Laboratory Manual. Oxford: Blackwell Publishing. 388 s. 14. Mesterhazy, A., Bartok, T Control of Fusarium head blight of beat by fungicides and its effect on the toxin contamination of the, Pflanzenschutz- Nachrichten Bayer 49 (2): Mesterhazy, A.; Bartok,T.; Lamper, C Influence of wheat cultivar, species of Fusarium, and isolate aggressiveness on the efficacy of fungicides for control of Fusarium head blight. Plant Dis 87:

70 16. Nicholson, P., Chandler, E., Draeger, R., C., Gosman, N., E., Simpson, D., R., Thomsett, M., Wilson, A., H., Molecular tools to study epidemiology and toxicology of fusarium head blight of cereals. European Journal of Plant Pathology 109 (7): Nicholson, P., Simpson, D., R., Weston, G., Rezanoor, H., N., Lees, A., K., Parry, D., W., Joyce, D Detection and quantification of Fusarium culmorum and Fusarium graminearum in cereals using PCR assay. Physiol. Mol. Plant Pathol. 53: Parry, D., W, Jenkinson, P., McLeod, L., Fusarium ear blight in small grain cereals-a review. Plant Pathology, 44: Parry, D., W.; Nicholson, P., Development of a PCR assay to detect Fusarium poae in wheat. Plant Pathology, 45: Schilling, A., G., Miedaner, T., Geiger, H., H., Molecular variation and genetic structure in field populations of Fusarium species causing head blight in wheat. Cereal Research Communications 25: 3, Schilling, A., G., Möller, E., M., Geiger, H., H., Polymerase chain reactionbased assays for species-specific detection of Fusarium culmorum, F. graminearum, and F. avenaceum. Phytopathology 86: Simpson, D., R., Weston, G., E., Turner, J., A., Jennings, P., Nicholson, P Differential control of head blight pathogens of wheat by fungicides and consequences for mycotoxin contamination of grain, European Journal of Plant Pathology 107: Turner, A., S.; Lees, A., K.; Rezanoor, H., N.; Nicholson, P., Refinement of PCR-detection of Fusarium avenaceum and evidence from DNA marker studies for phenetic relatedness to Fusarium tricinctum. Plant Pathology, 47: Xu, X., M., Parry, D., W., Nicholson, P., Thomsett, M., A., Simpson, D., Edwards, S., G., Cooke, B. M., Doohan, F., M., Brennan, J., M., Moretti, A., Tocco, G., Mule, G., Hornok, L., Giczey, G., Tatnell, J., Predominance and association of pathogenic fungi causing Fusarium ear blight in wheat in four European countries. European Journal of Plant Pathology 112 (2):

71 GENETICKY MODIFIKOVANÉ ORGANISMY - HODNOCENÍ BEZPEČNOSTI A MOŽNOSTI NOVÝCH TECHNOLOGICKÝCH POSTUPŮ Genetically modified organism - safety assessment and possibility of new technological processes Ovesná J. Výzkumný ústav rostlinné výroby, v.v.i. Kontaktní adresa 1. autora: RNDr. Jaroslava Ovesná, CSc. Výzkumný ústav rostlinné výroby, v.v.i. Drnovská 507 PSČ: Praha Ruzyně Abstrakt Vývoj v oblasti molekulární biologie přinesl řadu technik, které je možné využít ve šlechtění rostlin. V předkládaném článku se zaměřuji na metody, které se v současné době projednávají v EU. Klíčová slova GMO, šlechtění rostlin, nové techniky Abstract Development in Plant Molecular biology has brought numerous new techniques that allow successfull manipulation with plant genome and could be exploited as a breeding tools. Methods are discussed in the article that are discussed currently in EU Key words GMO, plant breeding, new techniques Úvod Geneticky modifikované organismy a z nich odvozené produkty se ve světě široce využívají jako potraviny a krmiva. Jejich uvolňování do oběhu a do životního prostředí je celosvětově do větší či menší míry regulováno. V EU vychází jejich legislativní zázemí ze směrnice EU 18/2001, která je transponována do národních legislativ. Nakládání s GM se pak mimo oblast výzkumu řídí nařízením EU 1829/2004, které upravuje, která GMO mohou vstoupit do potravního řetězce a eventuelně mohou být komerčně pěstována. Všechny takové produkty musí projít vědeckým hodnocením panelu GMO, který pracuje při EFSA (European Food Safety Authority). Hodnotí se možná rizika pro konzumenty, hospodářská zvířata a environment. GMO s pozitivním hodnocením, u kterých nebyla zjištěna možná rizika ve výše uvedených oblastech, pak mohou být na úrovni EU uvolněna do oběhu nebo pro pěstování. Tento proces může být poněkud zdlouhavý. GMO obecně vznikají vnesením cizorodé DNA do organismu, resp. cílové buňky. U rostlin se obvykle využívá systému odzbrojených binárních vektorů půdní bakterie Agrobacterium tumefaciens, které mohou vést k přenosu rekombinační molekuly DNA do buňky a její stabilní integrace do jaderné DNA (van Montagu, 2011). Jako příklad lze uvést GM sóju pod označením Roundup Ready. Alternativou jsou částicové střely, které dopravují do buňky na 71

72 sebe nabalenou DNA. Často pak dochází k transientní expresi genů v cytoplasmě, ale i stabilní integraci DNA do jádra (Li et al,. 2012). Příkladem může být GM kukuřice GA21. Někdy lze využít elektroporace či přenos zprostředkovaný PEG (polyetylen glykol) do protoplastů, ze kterých můžeme regenerovat celistvé rostliny. Ve všech případech se jedná o přenos rekombinantních molekul, které jsou sestaveny z promotoru, funkčního genu a terminátoru. Konstrukt obvykle obsahuje i selekční markér opatřený vlastními regulačními oblastmi.(meier, 2005) Uvedenými postupy byly v principu odvozeny všechny GM produkty na trhu v EU (celkem 42 GM produktů), převážně sója, kukuřice, řepka, řepa nebo bavlník a celá řada dalších GM pěstovaných a spotřebovávaných v dalších částech světa. Tyto postupy mohou využívat genů z celé škály organismů i nižších struktur jako viry, bakterie, kvasinky, různé rostlinné druhy rostlin a živočichů. Nejvíce se modifikace soustředily na odolnost rostlin k herbicidům jako je glyfosát (složka Roundupu), fosfinotricin (složka herbicidu Basta) (Sanderman et al. 2006). Velmi rozšířené jsou modifikace vůči hmyzím škůdcům. Jedná se o tzv. Bt plodiny, které mají vnesen gen a jeho modifikace odvozené od delta-endotoxinu bakterie Bacillus thuringiensis. Jsou to zejména plodiny jako jsou bavlník nebo kukuřice. (Meissle et al. 2011). Využívají se jako součást integrované ochrany rostlin. Význam GM ve světovém měřítku roste (Davison, 2010). V současné době se diskutuje znění legislativního rámce, zjm. směrnice 18/2001 a jejích příloh. Směrnice totiž definuje jako GMO i mutagenezi, která je však vyňata, vzhledem k tomu, že v delším historickém čase se neprojevila jako metoda, jejíž produkty jsou pro spotřebitele rizikové. Nové moderní metody jsou podobně jako mutageneze směřovány k cílené záměně jednotlivých nukleotidů. Jiné jsou cíleny na epigenom, který se ukazuje jako významný. Proto je třeba nové metody pečlivě posoudit a rozhodnout, jak k nim přistupovat. Materiál a metody Lze konstatovat, že novými technikami lze modifikovat všechny typy organismů, i když nejvíce se diskutují v souvislosti se šlechtitelskými postupy. Lze využít protoplasty, rostlinné buňky, celistvé rostliny i živočichy, Specifické nukleázy. Jsou enzymy, které jsou schopny štěpit vybrané sekvence DNA a vnášet jednobodové a další mutace. Takovými nukleázami jsou např. zinkové prsty (ZNF). Bylo jich identifikováno mnoho typů v každé buňce a lze je cíleně využívat nejen při jednobodové záměně, ale i pro vnášení větších úseků DNA do cílové sekvence Oligonukleotidy: Pomocí specifických oligonukleotidů lze vnášet specifické bodové mutace a to pomocí homologní rekombinace. Do buňky se vnese homologní oligonukleotidová sekvence, která ve svém těle nebo na 3 konci nese mutaci. Reparační systém buňky pak mutaci fixuje. Cisgenoze je metoda, která vnáší geny v sense orientaci z identického druhu. Variantou je intragenoze, kdy se vnese gen z příbuzného, vzájemně křižitelného druhu. Jinak odpovídá GMO. RNA - dependentní DNA metylace: Využívá specifického enzymu, který metyluje vybrané oblasti genů. Navozuje zřejmě stabilní epigenetické změny. Roubování: Využívá tradičních postupů roubování, kde však odnož je transgenní, modifikovaná a představuje tradiční GMO. Agroinflitrace: využívá alternativních metod pro infekci pletiv pomocí A. tumefaciens, kdy pak dochází k transientní expresi konstruktu z plasmidu bakterie Reverzní šlechtění: využívá irna pro manipulaci meiózy 72

73 Výsledky a diskuse Výše uvedené metodické postupy se začínají ve světě hojně využívat. Zinkové prsty se hojně využívají v medicíně Zinkové prsty a syntetické oligonukleotidy jsou využívány pro cílené navození mutací v genech rostlin i živočichů a jedná se o velmi potentní postup. Každá z nich využívá odlišný postup na stejném principu. Oligonukleotidy se již využívají ve šlechtění rostlin. Cisgenoze se používá zejména u vegetativně množených druhů jako je jabloň nebo brambora. Jsou přenášeny zejména geny odolnosti k chorobám virům a plísním, jejichž využití tradičními přístupy by bylo obtížné, ale uskutečnitelné. Např. RNA - dependentní DNA metylace bude moci být využita pro přípravu rostlin se změněnou expresí genů díky vneseným metylacím. Jedná se o velmi perspektivní přístup. Roubování: jedná se o běžný šlechtitelský postup. Předpokládá se, že pokud se využije transgenní podnož, výhony budou např. více odolné k virovým chorobám a produkty nebudou odlišné od konvečních potravin. Někdy toto nemusí být pravda, díky přesunu informačních molekul. Reverzní šlechtění je metoda, pomocí které lze odvodit homozygotní linie z dobře prosperujících heterozygotů (hybridů). Lze tak jednoduše získat parentální linie pro produkci hybridů. Jedná se o pomoc velmi dobře známému šlechtitelskému procesu (Dirks at al. 2009). Může mít rozsáhlé aplikace. Značně se zkrátí čas pro testování kombinačních schopností a stabilizaci linií. Výsledný produkt neobsahuje vnesený genetický materiál. Metoda by mohla být vyňata z legislativy GMO Agroinfiltrace Touto metodou může být v rostlinách dosaženo, stabilní nebo přechodné exprese rekombinantního proteinu. Přechodná exprese rekombinantních proteinů v rostlinách může rychle poskytnout velké množství bílkovin pro detailní charakterizaci nebo využití. To je velmi jednoduché a flexibilní. Agroinfiltrace využívá A. tumefaciens. Používá se jednak pro ověření funkce genů nebo pro tzv. molekulární farming (Fischer et al. 1999). Závěr Uvedené techniky mohou být užitečnými nástroji ve šlechtění a záleží na úhlu pohledu evropské legislativy, jaké najdou uplatnění. Dedikace Příspěvek byl připraven s přispěním řešených projektů MZE VZ a MŠMT OC09031 Použitá literatura 1. Davison, J (2010): GM plants: Science, politics and EC regulations, Plant Science, 178: Dirks, R; van Dun, K; de Snoo, C. ; (2009): Reverse breeding: a novel breeding approach based on engineered meiosis, Plant Biotechnology Journal 7 : Fischer, R; Vaquero-Martin, C; Sack, M (1999): Towards molecular farming in the future: transient protein expression in plants, Biotechnology And Applied Biochemistry, 30:

74 4. Li, J.; Ye, X.; An, B. (2012) Genetic transformation of wheat: current status and future prospects Plant Biotechnology Reports, 6: Lusser, M.; Parisi, C.; Plan, D. (2012).Deployment of new biotechnologies in plant breeding nature biotechnology 30 : Meier, I (2005): Global plant biotechnology and the need for an educated public, Minerva Biotecnologica 17: Meissle, M.; Romeis, J.; Bigler, F. (2011) Bt maize and integrated pest management - a European perspective, Pest Management Science, 67 : Sandermann, H (2006): Plant biotechnology: ecological case studies on herbicide resistance, Trends in Plant Science, 11: Van Montagu, M. (2011): It Is a Long Way to GM Agriculture, eds. Merchant, SS; Briggs, WR; Ort, Annual Review of Plant Biology, 62,

75 REZIDUA PESTICIDŮ V OVOCI A ZELENINĚ V SYSTÉMECH INTEGROVANÉ PRODUKCE A MOŽNOSTI JEJICH REGULACE Rezidues of pesticides in fruit and vegetable in integrated systems of pruduction and possibilities of their regulation Kocourek F. 1, Falta, V. 1, Hajšlová J. 2, Holý K. 1, Hrbek V. 2, Kocourek V. 2, Stará, J. 1, Urbanová J. 2 1 Výzkumný ústav rostlinné výroby, v.v.i. 2 Vysoká škola chemicko technologická Kontaktní adresa 1. autora: Prof. RNDr. ing. František Kocourek, CSc., Výzkumný ústav rostlinné výroby, v.v.i. Drnovská 507 PSČ: Praha Ruzyně Abstrakt V letech byla hodnocena rezidua pesticidů v 56 vzorcích ovoce dodávaných na trh od pěstitelů ze systému integrované produkce zeleniny, v 96 vzorcích zeleniny z výzkumných experimentů a v 321 vzorcích jablek z experimentálního sadu, kde probíhala ochrana podle zásad integrované produkce ovoce v ČR. Na zelenině bylo hodnoceno 28 účinných látek pesticidů a v jablkách 24 účinných látek pesticidů. Pro všechny hodnocené účinné látky byl stanoven nelineární model degradace pesticidů podle rovnice: y = a*exp(b*x), kde y je množství účinné látky v mg/kg a x je počet dnů od aplikace. Podle uvedených modelů lze stanovit různé ochranné lhůty pesticidů pro předem definované akční prahy, jako je procento maximálního limitu reziduí pesticidů v produktu před sklizní. Klíčová slova rezidua pesticidů, ovoce, zelenina, nízkoreziduální produkce, bezreziduální produkce, maximální limit reziduí pesticidů Abstract In , residues of pesticides were evaluated in 56 samples of vegetables from integrated production systems, 96 samples of vegetables from research experiments and 321 samples of fruits from experimental orchard in regime of integrated production. In the samples, residues of 28 and 24 active substances were evaluated in vegetable and fruit, respectively. Nelinear model of pesticide degradation were established for all active substances with equation y = a*exp(b*x), where y is amount of active substance in mg/kg and x is number of days from application. According to the models it is possible to establish different pre-harvest periods for defined action limits as percentage of maximum residue limit in product before harvest. Key words Residues of pesticides, fruit, vegetable, low-residual production, no-residual production, maximum residue limit of pesticides 75

76 Úvod Systémy integrované produkce ovoce a zeleniny se v ČR stávají převažující technologií v pěstování těchto komodit. Technologie integrované produkce umožňují produkovat ovoce a zeleninu s nízkým výskytem reziduí pesticidů, ve světě nazývané jako Low Residue Strategy. Z toxikologického hlediska je zvláště závažnou skutečností, že ve vyšetřovaných vzorcích ovoce se často setkáváme se současným výskytem reziduí několika aplikovaných přípravků. S ohledem na dosud neuzavřenou diskuzi, zda lze v takovéto situaci předpokládat aditivní toxické efekty nebo dochází k jejich synergismu, legislativní předpisy tuto situaci zatím neřeší. Odborníci nicméně poukazují na zvýšené akutní i chronické riziko pro konzumenty, jehož charakterizace je předmětem intenzivního toxikologického výzkumu na mezinárodní úrovni. Přestože pro převážnou většinu ovoce ze systémů integrované produkce jsou limity reziduí pesticidů hluboce pod maximálními limity reziduí (MLR) podle nařízení Evropského parlamentu a Rady (ES) č. 396/2005, jsou v této práci také vyhodnoceny vzorky, ve kterých je vyšší počet reziduí pesticidů, z nichž každý jednotlivý se vyskytuje v podlimitním množství. Lze očekávat, že v souladu s pokroky ve výzkumu a vývoji bude možné zdokonalovat systémy integrované produkce a dále zpřísňovat požadavky na výskyt reziduí v ovoci a v zelenině. Cílem práce bylo zhodnotit výskyt reziduí pesticidů v jablkách pěstovaných v systému integrované produkce ovoce a v integrovaném systému produkce zeleniny a získat podklady pro návrhy opatření umožňující další stupeň minimalizace výskytu reziduí pesticidů v ovoci a zelenině z těchto systémů. Pracovní hypotéza vychází z předpokladu, že lze z experimentálních dat sestavit modely degradace reziduí pesticidů, podle kterých lze zhodnotit rizika výskytu reziduí jednotlivých účinných látek pesticidů a předpovídat prodloužení ochranné lhůty pesticidů pro předem stanovené limity reziduí v ovoci a v zelenině k termínu sklizně. Materiál a Metody V letech byla hodnocena rezidua pesticidů v 56 vzorcích zeleniny dodávaných na trh od pěstitelů ze systému integrované produkce zeleniny, v 96 vzorcích zeleniny z výzkumných experimentů a v 321 vzorcích jablek z experimentálního sadu, kde probíhala ochrana podle zásad integrované produkce ovoce v ČR. Na zelenině bylo hodnoceno 28 účinných látek pesticidů a v jablkách 24 účinných látek pesticidů. Analýzy reziduí v odebraných vzorcích byly provedeny v akreditované laboratoři Vysoké školy chemicko-technologické v Praze (Ústav chemie a analýzy potravin). K analýzám byla použita jednak multireziduální metoda LC-MS/MS (v souladu s ČSN EN 15662:2008) umožňující stanovení až 267 pesticidů v rámci jedné analýzy a dále metoda GC-MS (stanovení účinné látky captan a jeho degradačního produktu THPI) a SPME-GC-MS (stanovení účinné látky thiram po rozkladu na CS2). Použité metody umožnily provést stanovení reziduí pro většinu účinných látek pesticidů registrovaných do jádrovin a do polní zeleniny v EU. Všechny tyto metody jsou v souladu s požadavky DG SANCO na metody používané pro úřední kontrolu reziduí pesticidů v potravinách a kvalita výsledků laboratoře je pravidelně ověřována v rámci mezilaboratorních testů organizovaných referenčními laboratořemi společenství (EU-RL). Pro všechny hodnocené účinné látky byl stanoven nelineární model degradace pesticidů podle rovnice: y = a*exp(b*x), kde y je množství účinné látky v mg/kg a x je počet dnů od aplikace. 76

77 Výsledky a diskuze Ovoce Pro všechny pesticidy a účinné látky registrované do jablek uvedené v tabulce č. 1 byly stanoveny degradační křivky reziduí pesticidů v produktech. V tabulce č. 1 je také uvedeno množství účinných látek fungicidů a zoocidů stanovených v jablkách podle modelů v termínu odpovídajícím ochranné lhůtě dle Registru povolených přípravků a stanovení ochranné lhůty (OL) pro dosažení množství reziduí odpovídající limitu 0,01 mg/kg. Příklady modelů degradace pesticidů v jablkách jsou uvedeny v grafu č. 1. Podle modelů degradace reziduí pesticidů v jablkách byla zjištěna vysoká variabilita v průběhu degradace mezi roky, odrůdami a variantami pokusu pro phosalone, diflubenzuron a captan. Pro tyto účinné látky vykazuje model nízkou spolehlivost pro stanovení ochranné lhůty. Naproti tomu pro účinné látky dodine, kresoxim-methyl, indoxacarb, methoxyfenozide, chlorpyrifos-methyl, cyprodynil a dithianon byla zjištěna nízká variabilita v průběhu degradace a vytvořené modely mají vysokou spolehlivost pro stanovení ochranné lhůty. Množství účinné látky v jablkách při sklizni se při dodržení ochranné lhůty pohybuje podle modelu většinou do 20% MLR, u fungicidů dokonce do 10% MLR. Vyšší množství účinné látky (54 % MLR) bylo podle modelu vypočteno pro acetamiprid. Stanovené ochranné lhůty v Registru tedy u všech povolených a hodnocených účinných látek spolehlivě zaručují dodržení MLR. Pro integrovanou produkci ovoce, pro kterou je v ČR v současnosti ve směrnicích uváděna garance 75% MLR bude garance spolehlivě dodržena, nepřekročí-li hodnota výsledku laboratorního vyšetření reziduí pesticidu 50% MLR (při rozšířené nejistotě výsledku stanovení ±50%). Rozšířená nejistota 50% byla stanovena DG SANCO pro úřední kontrolu laboratoří na základě rozsáhlých a mezilaboratorních studií (SANCO, 2009). Výhledově je reálné pro integrovanou produkci ovoce nebo pouze pro pokročilejší část pěstitelů v tomto systému garantovat dokonce 25% limit MLR. Zelenina Přehled přípravků, u nichž byla analyzována rezidua, které jsou a které dosud nejsou (označeny x) v ČR v jednotlivých do zeleniny registrovány, je uveden v tabulce č. 2. Pro všechny pesticidy a účinné látky uvedené v tabulce č. 2 byly stanoveny degradační křivky reziduí pesticidů v produktech. Příklad modelů degradace pesticidů v květáku ve srovnání s jablky je uveden v grafu č. 2. Žádný z hodnocených 56 vzorků zeleniny ze systému IP dodávaných na trh nepřekročil povolený maximální limit reziduí pesticidů. Zjištěné hodnoty reziduí pesticidů byly hluboko pod povoleným limitem. U 43% vzorků zeleniny nebyla zjištěna žádná rezidua pesticidů. 20% vzorků zeleniny by splnilo velmi přísné limity pro potraviny pro kojence a malé děti. U 37% vzorků byl detekován převážně výskyt 1 nebo 2 účinných látek pesticidů nepřesahující 1/4 MLR. Regulace reziduí pesticidů v ovoci a v zelenině a v IP v ČR Pro regulaci reziduí pesticidů lze využít tzv. akční prahy. Akční práh představuje určité procento z maximálního limitu reziduí pesticidů, které může garantovat pěstitel při dodávce na trh, zejména do sítě obchodních řetězců. V současnosti odpovídá akční práh pro zeleninu z integrovaného systému produkce zeleniny v ČR 100% MLR a pro jablka ze systému integrované produkce ovoce v ČR 75% MLR. Podle modelů degradace reziduí v produktech lze předpovídat vývoj nízkoreziduální produkce. Na základě výsledků výzkumu budou vypracovány metodiky ochrany ovoce a zeleniny, které umožní pěstiteli volbu akčního prahu. Například akčního prahu 75% nebo 33% MLR, nebo v součtu bez omezení, nebo v součtu max. 80% MLR, nebo s variantami jako je počet reziduí neomezen, nebo omezen nad limitem detekce pro určitý počet reziduí, např. 3 nebo 5. Budoucnost bezreziduální produkce by 77

78 odpovídala současným požadavkům na produkty pro dětskou výživu. Bude se jednat o pěstební systémy a systémy ochrany rostlin, které umožňují dodržení limitu 0,01 mg/kg v produktu při sklizni a přitom se nejedná o produkty z ekologického zemědělství. Závěr Převážná většina účinných látek pesticidů degraduje v zelenině rychleji než v jablkách. Podle modelů degradace reziduí pesticidů lze regulovat výskyt reziduí v konkrétních produktech ovoce a zeleniny. Zavedení tzv. akčních prahů, jako procenta MLR v produktu při sklizni, je předpokladem pro budoucí nízkoreziduální produkci ovoce a zeleniny v systémech integrované produkce v ČR. Dedikace Výsledky byly získány na základě řešení projektů MZe ČR č. QH81292, 1G58081, QH92179 a QJ Použitá literatura 1. Anonymus 2011: Seznam registrovaných přípravků a dalších prostředků na ochranu rostlin 2011, Věstník Státní rostlinolékařské správy 8(3), SRS, Praha, 397 pp. 2. SANCO 2009: Method validation and quality control procedures for pesticide residues analysis in food and feed. Document SANCO/10684/ Nařízení Evropského parlamentu a Rady (ES) č. 396/

79 Přílohy Tab. č. 1 Přehled účinných látek hodnocených reziduí pesticidů v jablkách, s uvedením množství účinných látek fungicidů a zoocidů stanovených podle modelů v termínu odpovídajícím ochranné lhůtě dle Registru povolených přípravků a stanovení ochranné lhůty (OL) pro dosažení množství reziduí odpovídající limitu 0,01 mg/kg. účinná látka MLR (mg/kg) OL Registr model (mg/kg)* % MLR OL na limit 0,01 mg/kg Fungicidy Thiram , Flusilazole ,014 0,28 40 Pyrimethanil ,121 2,4 106 Dodine ,225 4,5 102 Dithianon ,087 1,7 39 Captan ,041 1,4 88 Cyprodinil ,027 2,7 67 Kresoximmethyl 0,2 35 0,002 1,0 20 Zoocidy Diflubenzuron ,118 2,4 153 Methoxyfenozide ,17 8,5 85 Pirimicarb 2 7 0,083 4,2 107 Fenoxycarb ,014 1,4 71 Teflubenzuron , Chlorpyrifosmethyl 0,5 28 0,008 1,6 25 Indoxacarb 0,5 7 0,082 16,4 70 Acetamiprid 0,1 14 0, Triflumuron** 0,5*** 28*** 0, Phosalone** 0,05*** 21*** 0,

80 Tab. č. 2 Přehled přípravků, u nichž byla analyzována rezidua, které jsou a které dosud nejsou (označeny x) v ČR v jednotlivých do zeleniny registrovány. Přípravek pek. zelí zelí květák salát mrkev petržel pór Vertimec 1,8 EC x x x x x x x Mospilan 20 SP x x x x x x x Vaztak 10 SC x x x x x Bulldock 25 EC x x x x x Apacz 50 WG x x x x x x x Decis Mega x x Score 250 EC x x x x x x x Acrobat MZ x x x x x x Steward x x x x x Revus x x x x x x x Integro x x x x x x x Chess 50 WG x x x x Sanmite 20 WP x x x x x x x Spintor x x x x Horizon 250 EW x x x x x x x Calypso 480 SC x x x Actara 25 WG x x x x x x x 80

81 mg/kg mg/kg Graf č. 1 Model degradace pesticidů v jablkách (1A-dodine, 1B chlorpyrifos-methyl) 1A 0,6 0,5 MLR dospělí =5 mg/kg MLR kojenci: 0,01 mg/kg 0,4 0,3 0,2 0,1 1B 0 0,07 0,06 0,05 0, počet dnů od aplikace MLR dospělí = 0,5 mg/kg MLR kojenci = 0,01 mg/kg 0,03 0,02 0,01 OL DV počet dnů od aplikace 81

82 mg/kg mg/kg Graf č. 2 Model degradace pesticidu indoxacarbu (Steward) v květáku (1A) ve srovnání s jablky (1B) 1A 0,14 0,12 0,1 0,08 0,06 0,04 0, počet dnů od aplikace 1B 0,14 0,12 0,1 0,08 0,06 0,04 0, počet dnů od aplikace 82

83 DETEKCIA ALERGÉNNYCH ZLOŽIEK V POTRAVINÁCH METÓDOU REAL-TIME PCR Real-time PCR method for allergen detection in food Piknová Ľ., Janská V., Siekel P. Výskumný ústav potravinársky, Bratislava Kontaktná adresa 1.autora: RNDr. Ľubica Piknová, PhD., Výskumný ústav potravinársky, Priemyselná 4, P.O.Box 25, Bratislava 26, Slovenská republika, Abstrakt Alergie na určité zložky potravinárskych výrobkov sa vyskytujú u detí i dospelých osôb. Môžu spôsobovať zdravotné problémy rôzneho stupňa. Jediným spoľahlivým spôsobom ako predísť ohrozeniu zdravia citlivého jedinca je vylúčiť konzumáciu rizikových potravín. S cieľom zistenia prítomnosti niektorých alergénnych zložiek potravín boli vyvinuté metódy na detekciu lieskových, vlašských, pekanových, para, makadamových, pistáciových a kešu orechov a ďalej arašidov a sóje. U všetkých metód sa určila inkluzivita, exkluzivita, teoretický a praktický detekčný limit. Metódy prešli vnútrolaboratórnou validáciou. Štyri z nich (lieskové a vlašské orechy, arašidy, sója) sa ďalej využili pri výrobe detekčných súprav určených na kontrolné účely. Kľúčové slová real-time PCR, DNA, alergén, lieskové orechy, potravina, cukrovinky Abstract Food allergies are present in children as well as in adult persons. They could be a reason of the helath injury of different intensity. The only way how to avoid the health problems is to exclude the consumption of risk food. The real-time PCR methods for some allergen food detection were designed. The target food components were mainly nuts (hazelnuts, walnuts, pecan nuts, brazil nuts, macadamia nuts, pistachios, cashew, peanuts and soy). The inclusivity, exclusivity, theoretical and practical detection limits were gained for all mentioned methods and also the inralaboratory validation was performed. Four of them (hazelnuts, walnuts, peanuts and soy) were chosen for design of kits usable in food controling. Key words real-time PCR, DNA, allergen, hazelnut, food, confectionery Úvod Požitie určitých druhov potravín môže u určitého percenta ľudí spôsobiť zdravotné ťažkosti rôznej závažnosti. Problémy môžu byť spôsobené intoleranciou alebo alergiou na niektorú zložku potraviny. Alergia je špecifický prípad intolerancie, ktorá zasahuje imunitný systém. Potravinové alergie sú zväčša mierne, ale vyskytujú sa aj život ohrozujúce anafylaxie. Súčasné údaje uvádzajú, že potravinové alergie postihujú 6-8 % kojencov, 3-5 % malých detí 83

84 a 2-4 % dospelých osôb. Klinické prejavy môžu mať rôznu intenzitu, od mierneho svrbenia v ústnej dutine až po plne rozvinutú anafylaxiu s opuchmi, obštrukciou dýchacích ciest a obehovým zlyhaním. Najčastejšie sú potravinové alergie vyvolané niektorým z 12 druhov alergénnych potravín, ktoré sú uvedené v prílohe IIIa smernice Európskeho parlamentu a rady č. 2000/13/ES. Patria sem: obilniny obsahujúce lepok (t.j. pšenica, raž, jačmeň, ovos, kamut alebo iné hybridné odrody), kôrovce, vajcia, ryby, arašidy, sójové bôby, mlieko, orechy (mandle, lieskovce, vlašské orechy, kešu, para orechy, pekanové orechy, pistácie, makadamové orechy), zeler, horčica, sezamové semená a kysličník siričitý a tiež výrobky zo všetkých týchto potravín. Jediným účinným spôsobom liečby potravinovej alergie je vyhýbanie sa rizikovým potravinám. Povinnosť označovať všetky zložky potravinárskych výrobkov určuje smernica 2000/13/EC Európskeho parlamentu a doplňujúce smernice 2003/89/EC a 2007/68/EC. Prípadnú krížovú kontamináciu je povinný výrobca označiť slovným spojením môže obsahovať stopy. V záujme ochrany zdravia spotrebiteľa je potrebná spoľahlivá kontrola dodržiavania predpisov o zložení a označovaní výrobkov, ktorú je možné zabezpečiť účinnými analytickými metódami. V súčasnosti je pomerne široká škála týchto metód, avšak líšia sa medzi sebou výhodami i nevýhodami. Detekčné metódy na zistenie prítomnosti alergénnych zložiek sú založené na princípe detekcie proteínov alebo nukleových kyselín. Proteínové analýzy sú imunoanalytické, alebo separačné. Najznámejšie a validované sú metódy typu ELISA aplikovateľné v potravinárskych a kontrolných laboratóriách. Metódy využívajúce nukleové kyseliny sú nepriame metódy, ktoré sú špecifické a vysoko citlivé. Materiál a metódy Na našom pracovisku sme vyvinuli niekoľko molekulárno-biologických metód založených na princípe real-time PCR, resp. klasickej PCR. Metódy sú zamerané na detekciu orechov, ktoré sú potenciálnymi alergénmi. Vyvinuli sme detekčné metódy na lieskové, vlašské, kešu, para, pekanové, makadamové a pistáciové orechy. Pri navrhovaní všetkých detekčných metód sme zachovali určitý štandardný postup. V prvom kroku sa vybrala sekvencia DNA, ktorá je špecifická pre daný druh a pritom dostatočne odlišná od sekvencií prítomných v príbuzných druhoch. Na základe tejto sekvencie sa navrhol real-time PCR systém primery a sonda. Používali sme systém tzv. hydrolyzačných (Taqman) sond s označením fluorescenčnými farbivami. Pre každý real-time PCR systém sme určili inkluzivitu. Získali sme všetky dostupné odrody daného druhu a zisťovali sme, či sa so všetkými získajú pozitívne výsledky. Podobne sme určovali exkluzivitu systémov, teda neprítomnosť špecifickej sekvencie vo vzorkách DNA príbuzných druhov a surovín používaných v potravinárskych výrobkoch súčasne s nami sledovaným druhom orechov. Kvalitu izolovanej DNA (v zmysle amplifikovateľnosti) sme overovali v každej vzorke DNA extrahovanej z potravín real-time PCR s univerzálnymi eukaryotickými primérmi TR03, TR04 a sondou TRPb orientovanými na gén 18S rrna. Ďalej sme určili teoretický detekčný limit real-time PCR riedením extrahovanej DNA na najnižšiu detegovateľnú koncentráciu. Detekčný limit pre jednotlivé druhy orechov bol stanovený v rozmedzí od 1,25 do 240 pg. Na modelových vzorkách sme určili praktický detekčný limit. Posledným krokom bolo vnútrolaboratórna validácia metódy na dostupnom počte reálnych potravinárskych výrobkov. 84

85 Výsledky a diskusia Detekcia lieskových orechov Lieskové orechy (Corylus avellana) sú známe jadrá plodov Liesky obyčajnej. Hlavnými producentami sú Taliansko, Španielsko, Turecko a USA. Používajú sa v cukrovinkárstve a oriešková pasta je veľmi častou náhradou mandľovej pasty. Primery a sonda na detekciu lieskových orechov boli orientované na gén hsp1 kódujúci tzv. nízkomolekulový heat-shock proteín. Metóda bola pozitívna pre 5 odrôd lieskových orechov získaných na Slovensku a negatívna pre 20 druhov orechov a surovín používaných súčasne s lieskovými orechami (tabuľka 1). Dosiahol sa teoretický detekčný limit 13 pg DNA (obrázok 1 A, B) a praktický detekčný limit 0,01 % (obrázok 2). Praktická využiteľnosť metódy sa testovala na 20 reálnych potravinových vzorkách (tabuľka 2). Tabuľka 1. Inkluzivita real-time PCR systému Nocc1 na detekciu lieskových orieškov v potravinách na dostupných odrodách, ktoré sú u nás registrované Druh odroda výsledok PCR Corylus avellana Hallská obrovská + Corylus avellana Lombardská biela + Corylus avellana Webbova + Corylus avellana Contorta + Corylus maxima Purpurea + Exkluzivita real-time PCR Nocc1 na detekciu lieskových orieškov v potravinách. Potravinová matrica výsledok PCR podzemnica olejná - vlašské orechy - mandle - gaštan jedlý - pistácie - kešu oriešky - sója - sezam - slnečnica - pšenica - jačmeň - raž - ryža - zemiak - ovsené vločky - alfaalfa - figy - sušené mlieko - čokoláda - kakao - 85

86 Obrázok 1. A/ Priebeh real-time PCR na určenie teoretického detekčného limitu pre liskové orechy (20 pg DNA) B/ Kalibračná čiara na určenie detekčného limitu real-time PCR pre lieskové orechy. Obrázok 2. Praktický detekčný limit real-time PCR na detekciu lieskových orechov systémom Nocc1. Obsah lieskových orechov v plnke: 10 %, 5 %, 1 %, 0,5 %, 0,1 %, 0,05 %, 0,01 % Ct Obsah lieskových orechov vo vzorke (%) Tabuľka 2. Reálne vzorky potravín analyzované metódou real-time PCR na detekciu lieskových orechov (LO lieskové orechy; S a označenie môže obsahovať stopy orechov ; S b označenie môže obsahovať stopy lieskových orechov ) Potravinová vzorka krajina pôvodu deklarácia lieskových výsledok PCR orechov oblátky s nápňou z LO 1 SR + + oblátky s nápňou z LO 2 ČR + + nugátová čokoláda 1 SR + + nugátová čokoláda 2 Rakúsko + + müsli tyčinka s LO 1 SR + + müsli tyčinka s LO 2 ČR + + sušienky s LO 1 SR + + sušienky s LO 2 Španielsko + + müsli 1 SR + + müsli 2 Španielsko

87 ovsené vločky s LO Španielsko + + oblátky s arašidovou náplňou 1 SR S a - oblátky s arašidovou náplňou 2 SR S b - čokoláda s kokosom 1 SR S a + čokoláda s kokosom 2 SR S b - sušienky s čokoládovou náplňou 1 SR S a - sušienky s čokoládovou náplňou 2 Španielsko - - sušienky 1 Poľsko - - sušienky 2 Španielsko - - ovsené vločky Španielsko - - Podobným spôsobom ako u lieskových orechov sme vyvinuli metódy pre ďalšie druhy orechov: vlašské, pekanové, para, makadamové, pistáciové, kešu orechy, arašidy a tiež sója. Na základe uvedených metód boli navrhnuté a vyrobené dve súpravy určené na analýzu potravinových vzoriek špecifickými real-time PCR metódami. Prvá súprava je určená na detekciu vlašských orechov, lieskových orechov a sóje. Obsah súpravy postačuje na analýzu 48 vzoriek každého z uvedených druhov a pre každú vzorku tiež na analýzu amplifikovateľnosti DNA na princípe real-time PCR širokošpecifickej pre eukaryotické organizmy. Druhá súprava je určená pre arašidy Súprava je určená na kvalitatívnu detekciu v potravinárskych surovinách a potravinárskych výrobkoch, vrátane rôzne mechanicky a tepelne opracovaných. Postačuje na analýzu 48 vzoriek na prítomnosť arašidov a tiež pre každú vzorku na analýzu amplifikovateľnosti DNA použitím real-time PCR širokošpecifickej pre eukaryotické organizmy. Záver Boli navrhnuté metódy na detekciu alergénnych zložiek v potravinách pre lieskové orechy, vlašské, pekanové, para, makadamové, pistáciové, kešu orechy a arašidy. Metódy na zistenie prítomnosti vlašských orechov, lieskových orechov, sóje a arašidov v potravinách boli použité na výrobu detekčných súprav použiteľných v oblasti kontroly kvality výrobkov. Dedikácia Práca bola podporená zo Štrukturálnych fondov EÚ z projektu : Efektívne metódy kontroly pre bezpečné potraviny a z projektu : Využitie vedeckých poznatkov pre kvalitné a zdravé potraviny. Použitá literatura 1. Sicherer, S. H., Sampson H. A. Food allergy." Journal of Allergy and Clinical Immunology 125(2 SUPPL. 2), Smernica Európskeho parlamentu a Rady 2003/89/ES z 10. novembra 2003, ktorou sa mení a dopĺňa smernica 2000/13/ES pokiaľ ide o označovanie zložiek prítomných v potravinách. Úradný vestník EÚ 15/zv. 7, Piknová, Ľ., Pangallo, D., Kuchta, T. (2008) A novel real-time polymerase chain reaction (PCR) method for the detection of hazelnuts in food. European Food Research and Technology, 226, Allman, M., Candrian, U., Höfelein, C., Lüthy, J. (1993) Polymerase chain reaction (PCR): a possible alternative to immunochemical methods assuring safety and quality of food. Zeitschrift für Lebensmittel-Untersuchung und Forschung, 196, ,, L., Kuchta, T. (2005) Detection of peanuts in food products by real-time polymerase chain reaction Archiv fur Lebensmittelhygiene, 56 (5),

88 AFLP (AMPLIFIED FRAGMENT LENGHT POLYMORPHISM) ANALÝZA KMENŮ LISTERIA MONOCYTOGENES AFLP (Amplified Fragment Lenght Polymorphism) analysis of Listeria monocytogenes 1 Hodek J., 2 Purkrtová S., 3,4 Karpíšková R., 2 Pazlarová J., 2 Demnerová K., 1 Kučera L., 1 Ovesná J. 1 Výzkumný ústav rostlinné výroby, V.v.i. Praha 2 Vysoká škola chemicko-technologická v Praze 3 Státní zdravotní ústav, Brno 4 Veterinární a farmaceutická univerzita Brno Kontaktní adresa 1. autora: Mgr. Jan Hodek Výzkumný ústav rostlinné výroby, v.v.i., Drnovská 507, Praha 6, Abstrakt Metodou AFLP byla provedena fylogenetická analýza 106 izolátů bakterie Listeria monocytogenes, shromážděných během let sběrem z potravinářských provozů, potravin a z humánních izolátů. U analyzovaných vzorků byl určen jejich sérotyp. Výsledné AFLP shluky byly testovány, jestli jsou charakteristické pro rok sběru, sérotyp či komoditu, ze které byly získány. Přestože nedošlo k jednoznačnému rozdělení vzorků ani v jednom z testovaných případů, určité korelace byly zaznamenány a bylo potvrzeno, že AFLP je vhodná metoda pro takovýto druh analýz. Klíčová slova AFLP, Listeria monocytogenes, listerióza, sérotyp Abstract Phylogenetic analysis of 106 isolates of Listeria monocytogenes bacterium was performed using AFLP method. Bacteria were collected during the years from the food operating areas, food and human isolates. There was determined serotype of analysed bacteria. The resulting AFLP clusters were tested, whether they are specific to the year of collection, serotype or commodity from which they were obtained. Although there is no clear separation of samples in either of the tested cases, certain correlations have been observed and it was confirmed that AFLP is a suitable method for this kind of analysis. Key words AFLP, Listeria monocytogenes, listeriosis, serotype Úvod Infekce a intoxikace, které jsou způsobené požitím potravin kontaminovaných bakteriemi nebo jejich toxiny, jsou i v současné době často se vyskytujícími onemocněními. Mezi významné původce těchto alimentárních onemocnění patří bakterie Salmonella spp., Campylobacter spp. a Listeria monocytogenes. Salmonelózy a kampylobakteriózy patří v České republice podle statistických údajů Státního zdravotního ústavu České republiky (SZÚ ČR) dlouhodobě mezi nejčastěji se vyskytující onemocnění způsobené požitím kontaminovaných potravin. V porovnání se salmonelózami a kampylobakteriózami lze výskyt listeriózy označit za vzácný (http://www.szu.cz/publikace/data/infekce-v-cr-2007-aktualni- 88

89 mesic). Výběr z přehledu výskytu hlášených infekcí v České republice v letech je uveden v Tabulce 1. Sběr údajů byl proveden vždy v říjnu daného roku, infekční choroby jsou řazeny od nejvyššího počtu případů v roce Z důvodu zkrácení tabulky zde nejsou uvedeny všechny zaznamenané choroby, výčet končí počtem zaznamenaných hlášení listeriózy, vynechaná část tabulky je označena. Tabulka 1. Výskyt vybraných hlášených infekcí v České republice v letech (zdroj SZÚ, 2012) Diagnóza Kampylobakterióza Salmonelózy Varicella Herpes zoster Jiné bakter. střevní infekce Lymeská borrelióza Svrab Virové střevní infekce Růže Spála Gastroenteritida vs. infekční Infekční mononukleóza Jiné virové exantem. infekce Dermatofytóza Pertusse Klistova encefalitida Parotitida Shigelóza Hepatitida C Enterovirová meningitida Hepatitida A Virová Meningitida Toxoplazmóza Herpes simplex

90 Akutní hepatitida B Streptokoková septikémie Hepatitida E Bakteriální meningitida Parapertusse Dengue Meningokoková onemocnění Legionelóza Giardióza Tularémie Paratyfus A Leptospiróza Listerióza Význam nebezpečí listeriózy není tedy závažný z hlediska četnosti výskytu, ale především z hlediska vysoké míry její smrtelnosti. Nejvíce ohroženou skupinou jsou kojenci, těhotné ženy, staří lidé a lidé s oslabeným imunitním systémem. Průměrná úmrtnost v důsledku listeriózy se pohybuje v případě vnímavých skupin obyvatel mezi 20 až 30 %, u pacientů starších 60ti let se blíží 60 %. Neléčená encefalická forma listeriózy může vést ke smrti až u 70 % případů (Lorber, 2005). Bakterie kmenů L. monocytogenes mají navíc schopnost růst i za nízkých teplot, mají schopnost adheze na velkou škálu povrchů a mají schopnost adaptace na dezinfekční prostředky (Frank and Koffi., 1990; Lundén et al., 2003). Poslední významný výskyt listeriózy se odehrál během podzimu roku 2011 ve Spojených státech amerických. Zdrojem epidemie byly kantalupské melouny. Podle Úřadu pro kontrolu potravin a léků (FDA) byla za nákazu zodpovědná firma, která melouny produkovala. Rozšíření bakterie bylo způsobeno špatným skladováním, zároveň se bakterie snáze šířila díky tomu, že firma přestala používat chlor pro omývání melounů. Bakteriální onemocnění se rozšířilo do 28 států americké unie. Podle federální agentury Centers for Disease Control and Prevention bylo listeriózou nakaženo celkem 147 osob, úmrtí na následky onemocnění bylo prokázáno u 33 osob, jedna žena pak v důsledku onemocnění prodělala potrat (http://www.cdc.gov/listeria/outbreaks/cantaloupes-jensen-farms/082712/index.html). Výbor amerického Kongresu vydal zprávu, že počet obětí této epidemie listeriózy byl nejvyšší (ve srovnání s jinými infekčními onemocněními ze závadných potravin) za posledních 25 let. Virulence jednotlivých kmenů L. monocytogenes se může lišit, navíc se ukazuje, že je ovlivněna řadou dalších faktorů, jako je místo výskytu, sérotyp či zdravotní dispozice pacienta (Hain et al., 2007; Orsi et al., 2011). U sporadických případů nemocných pacientů i v případě epidemického výskytu se nejčastěji setkáme se sérotypy 1/2a, 1/2c, 1/2b a 4b (Clark et al., 2010; O Connor et al., 2010). Poznání a charakterizace kultivarů Listeria monocytogenes v kontrolovaném prostředí je důležitý nástroj, který by měl být nápomocen epidemiologickému dohledu nad výskytem těchto bakterií. Jednou z metod, která je pro charakterizaci bakteriálních kmenů L. monocytogenes vhodná a byla využita v řadě vědeckých studií, je metoda AFLP (Amplified Fragment Lenght 90

91 Polymorphism) (Guerra et al., 2002; Autio et al., 2003; Ripabelli and McLauchlin, 2004; Gormley et al., 2010; Sammarco et al., 2011). Cílem naší práce bylo analyzovat 106 kmenů L. monocytogenes získaných ze sbírky Národní referenční laboratoře pro listérie (Státní zdravotní ústav, Brno). Prvním krokem analýzy bylo určení sérotypu analyzovaných izolátů, poté provedení AFLP a následné vyhodnocení vztahů mezi izoláty, rozdělenými na základě AFLP analýzy do skupin - jejich sérotypem a dalšími informacemi, které se ke vzorkům vztahují. Materiál a Metody Kmeny L. monocytogenes: Izoláty kmenů L. monocytogenes byly získány ze sbírky Národní referenční laboratoře pro listérie (Státní zdravotní ústav, Brno). Sběr izolátů probíhal v letech , zdrojem byly potravinářské provozy, potraviny a humánní izoláty. Celkem bylo získáno 106 izolátů, které byly uchovávány v glycerinovém médiu při -80 C. Sérotypizace: Před provedením typizace byly kmeny oživeny vyočkováním na krevní agar (Bio-Rad, USA) a inkubovány při 37 C po dobu 24 hodin za aerobních podmínek. Sérotyp byl určen metodou sklíčkové aglutinace za použití komerčně dostupných antisér (Denka Seiken, Japonsko) a následně byl potvrzen metodou multiplex PCR (polymerázové řetězové reakce) (Doumith et al., 2004). Extrakce DNA: Extrakce DNA byla provedena podle protokolu pro Gram-pozitivní bakterie s použitím komerční soupravy GenElute Bacterial Genomic DNA kit (Sigma, USA). AFLP: AFLP analýza byla provedena podle protokolu komerční soupravy AFLP Microbial Fingerprinting Kit (Applied Biosystems, USA) s použitím restrikčních enzymů EcoRI (Fermentas, Kanada) a MseI (NEB, USA). Kapilární elektroforéza a fluorescenční detekce restrikčních fragmentů byla provedena na přístroji pro genetickou analýzu ABI PRISM 310 (Applied Biosystems, USA). Vyhodnocení restrikčních fragmentů bylo provedeno s použitím počítačového programu Genotyper (Applied Biosystems, USA), binomická tabulka pro další analýzu dat byla vytvořena na základě přítomnosti/nepřítomnosti píku, reprezentujícího DNA fragment s použitím programu Excel (Microsoft, USA). Fylogenetické vyhodnocení míry odlišnosti/podobnosti jednotlivých izolátů a sestavení dendrogramu na základě Neighbour-Joining algoritmu s využitím Jaccardova koeficientu podobnosti bylo provedeno s použitím počítačového programu DARwin (Perrier a Jacquemoud-Collet, 2006). Testování důvěryhodnosti větví v dedrogramu bylo provedeno metodou bootstrap. Výsledky a diskuze Pro analýzu kmenů bakterie L. monocytogenes bylo získáno 12 humánních izolátů, 6 izolátů z polotovarů, 14 izolátů ze syrových potravin, 64 izolátů z RTE (ready-to-eat) potravin, 9 izolátů ze stěrů z potravinářských provozů a 1 izolát sbírkového kmene (Přírodovědecká fakulta, Univerzita Karlova v Praze). U všech vzorků byl určen jejich sérotyp. Celkem bylo zaznamenáno 8 sérotypů. Nejvíce byl zastoupen sérotyp 1/2a (61 případů), dále pak 1/2b (14 případů), 4ab a 4b (každý ze sérotypů byl zastoupen v deseti izolátech), 1/2c (8 případů) a sérotypy 3a, 4c a 4d byly zastoupeny pouze v jednom případě. Seznam získaných izolátů, jejich původ, sérotyp a rok odběru je uveden v Tabulce 2. 91

92 Tabulka 2. Seznam, původ, sérotyp a rok odběru izolátů L. monocytogenes Pořadí Číslo Komodita Vzorek Identifikace Sérotyp Rok vzorku vzorku izolace 1 L253 olomoucké tvarůžky RTE food mléčný výrobek 1/2 b L352 zmrzlina vanilková RTE food mléčný výrobek 1/2 a L391 sýr kozí RTE food mléčný výrobek 1/2 b L392 sýr kozí RTE food mléčný výrobek 1/2 b L393 sýr kozí RTE food mléčný výrobek 1/2 b L394 sýr kozí RTE food mléčný výrobek 1/2 b L658 králík syrová potravina syrové maso 4:00 dop L687 olomoucké tvarůžky RTE food mléčný výrobek 1/2 a L943 Niva RTE food mléčný výrobek 1/2 a L1019 salát z bílého zelí RTE food zelenina 4 b L1037 olomoucké tvarůžky RTE food mléčný výrobek 1/2 a L1046 mraž. zelenina RTE food zelenina 4 b L1057 salám trvanlivý RTE food masný výrobek 1/2 c L1069 Niva RTE food mléčný výrobek 1/2 a L1081 sýr Eidam RTE food mléčný výrobek 1/2 a L1152 gorgonzola RTE food mléčný výrobek 1/2 a L1202 vepř. játra RTE food syrové maso 4 b L1225 olomoucké tvarůžky RTE food mléčný výrobek 1/2 a L1280 kuře syrová potravina syrové maso 3:00 dop L1303 olomoucké tvarůžky RTE food mléčný výrobek 1/2 a L1425 Niva RTE food mléčný výrobek 1/2 a L1438 Niva RTE food mléčný výrobek 1/2 a L1441 dílo syrová potravina syrové maso 4 ab L1442 stěr z prostředí stěr masná výroba 4 ab L1444 stěr z prostředí stěr masná výroba 4 ab L1457 Čermáková humánní izolát sporadický případ 1/2 b L1459 Kalivoda humánní izolát epidemie 1/2 a L1484 okurkový salát RTE food zelenina 4 b L1497 olomoucké tvarůžky RTE food mléčný výrobek 1/2 a L1499 olomoucké tvarůžky RTE food mléčný výrobek 1/2 a L1537 hermelínový salát RTE food lahůdky 4 b L1543 Baladur RTE food mléčný výrobek 1/2 a L1551 Krupařová humánní izolát sporadický případ 1/2 b L1556 vlašský salát RTE food lahůdky 1/2 b L1561 hermelínový salát RTE food lahůdky 1/2 a L1585 Baladur RTE food mléčný výrobek 1/2 a L1591 tlačenka RTE food masný výrobek 4 ab L1594 syrové kravské mléko syrová potravina syrové mléko 1/2 a L1600 hermelínový salát RTE food lahůdky 1/2 a L1610 Valentová humánní izolát epidemie 1/2 a

93 41 L1619 kuře syrová potravina syrové maso 1/2 a L1625 olomoucké tvarůžky RTE food mléčný výrobek 1/2 a L1655 topinková pomazánka RTE food lahůdky 4 ab L1661 slepice syrová potravina syrové maso 1/2 b L1679 mraž. zelenina RTE food zelenina 1/2 a L1698 pařížský salát RTE food lahůdky 1/2 a L1699 krůta syrová potravina syrové maso 1/2 b L1708 Plhalová humánní izolát sporadický případ 1/2 a L1743 jitrnice RTE food masný výrobek 4 b L1752 niva RTE food mléčný výrobek 1/2 a L1769 pařížský salát RTE food lahůdky 4 ab L1789 bramborový salát RTE food lahůdky 4 ab L1791 kráječ vajec stěr výroba lahůdek 4 ab L1793 Bujok Petr humánní izolát sporadický případ 1/2 a L1796 Baladur RTE food mléčný výrobek 1/2 a L1798 losos uzený RTE food rybí výrobek 4 ab L1807 masný polotovar syrová potravina masný polotovar 1/2 c L1810 romadur - polotovar polotovar mléčný výrobek 1/2 a L1820 Romadur RTE food mléčný výrobek 1/2 a L1824 romadur - polotovar polotovar mléčný výrobek 1/2 a L1826 romadur - polotovar polotovar mléčný výrobek 1/2 a L1827 kuře v aspiku RTE food lahůdky 1/2 a L1829 Baladur RTE food mléčný výrobek 1/2 a L1835 Baladur RTE food mléčný výrobek 1/2 a L1836 Romadur RTE food mléčný výrobek 1/2 a L1837 niva RTE food mléčný výrobek 1/2 a L1845 Wicherek humánní izolát sporadický případ 1/2 a L1885 špenát RTE food zelenina 1/2 a L1895 maso mleté syrová potravina syrové maso 1/2 c L1916 stěr z prostředí stěr mléčná výroba 1/2 a L1944 olomoucké tvarůžky RTE food mléčný výrobek 1/2 a L1977 špekáčky RTE food masný výrobek 1/2 c L1995 stěr z prostředí polotovar mléčná výroba 1/2 a L1998 tlačenka RTE food masný výrobek 1/2 c L2002 Gothajský salám RTE food masný výrobek 1/2 c L2006 stěr z prostředí stěr mléčná výroba 1/2 a L2023 stěr z prostředí stěr mléčná výroba 1/2 a L2032 maso kuřecí syrová potravina syrové maso 1/2 a L2050 Andrejko humánní izolát sporadický případ 4 b L2059 Sliwka humánní izolát sporadický případ 1/2 a L2060 Voráček humánní izolát sporadický případ 4 b

94 82 L2061 kont. vzorek sbírkový kmen UK - 4 c L2065 stěr z prostředí stěr mléčná výroba 1/2 a L2067 kapr-filety RTE food čerstvá ryba 1/2 a L2087 tatarák RTE food masný výrobek 4 b L2153 stěr z prostředí stěr mléčná výroba 1/2 a L2156 šunka RTE food masný výrobek 4 ab L2162 stěr z prostředí stěr mléčná výroba 1/2 b L2175 Niva RTE food mléčný výrobek 1/2 a L2177 syrové mléko syrová potravina syrové mléko 1/2 a L2178 špenátový protlakzmrazený RTE food zelenina 1/2 a L2180 špekáčky RTE food masný výrobek 1/2 b L2182 stěr z prostředí polotovar mléčná výroba 1/2 a L2185 stěr z prostředí polotovar mléčná výroba 1/2 a L2186 Niva RTE food mléčný výrobek 1/2 a L2187 Remeš humánní izolát sporadický případ 1/2 a L2188 Kratochvíl humánní izolát sporadický případ 1/2 a L2202 vepřová játra syrová potravina syrové maso 1/2 a L2209 kroupové jelito RTE food masný výrobek 1/2 b L2219 zelenina s košťálem RTE food zelenina 4 b L2220 salám trvanlivý tep. opr. RTE food masný výrobek 1/2 a L2224 šunka vepřová RTE food masný výrobek 1/2 b L2233 kuřecí klobása RTE food masný výrobek 1/2 a L2260 výrobní vepřové maso syrová potravina syrové maso 1/2 c L2261 výrobní vepřové maso syrová potravina syrové maso 1/2 c L2264 čabajská klobása RTE food masný výrobek 1/2 a 2008 AFLP analýza byla provedena s použitím kombinace desíti selektivních primerů pro amplifikaci fragmetů DNA, ohraničených specifickým restrikčním místem pro enzymy MseI a EcoRI (Tabulka 3). Na základě hodnocení fluorescenčních signálů DNA fragmentů byly u jednotlivých vzorků vytvořeny specifické AFLP profily. Na základě analýzy těchto profilů bylo vyhodnoceno 147 restrikčních fragmentů. Tabulka 3. Použité kombinace selektivních primerů specifických pro adaptorové sekvence na restrikčních místech MseI a EcoRI. U primerů EcoRI je uvedena použitá fluorescenční barva pro detekci AFLP fragmetu (FAM nebo NED). Nukleotidový přesah MseI Nukleotidový přesah EcoRI primeru primeru FAM NED T A C C A C G A C bez přesahu AC AT bez přesahu TG bez přesahu 94

95 Na základě AFLP dat byl vytvořen dendrogram. Došlo v něm k rozdělení izolátů do dvou hlavních skupin. Barvou jsou odlišeny jednotlivé roky sběru (Obrázek 1). C B A Obrázek 1. Grafické znázornění genetické podobnosti izolátu L. monocytogenes. Barvou jsou odlišeny roky sběru izolátů: 1999 (žlutá), 2001 (černá), 2002 (šedá), 2003 (modrá, 2004 (zelená), 2005 (tyrkysová), 2006 (hnědá), 2007 (růžová), 2008 (červená) Z obrázku je patrné, že rozdělení izolátů do skupin nebylo výrazně ovlivněno rokem sběru izolátu. Na Obrázku jsou označeny 3 skupiny vzorků, které vykazují jistou podobnost korelující s rokem sběru. Skupina A obsahuje vzorky odebrané v roce 2007 (10 izolátů) a 2008 (2 izoláty), skupina B obsahuje vzorky odebrané v roce 2008 (3 izoláty) a 2007 (jeden izolát) a skupina C, která obsahuje vzorky odebrané v roce 2008 (12 izolátů), v roce 2007 (2 izoláty) a jeden izolát z roku Při hodnocení rozdělení izolátu z pohledu jejich sérotypu nejvíce vymezují další 3 skupiny vzorků- skupina D, ve které jsou zastoupeny pouze izoláty se sérotypem 1/2a, skupina E, 95

96 obsahující izoláty se sérotypy 1/2b, 4b a 4ab, a skupina s označením F, která obsahuje izoláty se sérotypy 1/2a a 1/2c (Obrázek 2). F D E Obrázek 2. Znázornění jednotlivých sérotypů a jejich rozmístění v dendrogramu. Barevné odlišení je následující: sérotyp 1/2a (červená); 1/2b (růžová); 1/2c (fialová); 4b (hnědá); 4ab, 3a, 4c a 4d (zelená) Zajímavý je především vznik skupiny E, do které byly zařazeny takřka všechny izoláty (kromě 1 vzorku) se sérotypem 4ab. Tento sérotyp nepatří (ještě spolu se sérotypy 3a, 4c a 4d, jejichž nositelé byly v analyzované sadě vzorků také zastoupeny) mezi kmeny, které jsou významné z hlediska své virulence a výskytu u sporadických i epidemických případů listeriózy (Clark et al., 2010; O Connor et al., 2010). Skupiny D a F jsou naopak tvořeny výhradně izoláty se sérotypy, které jsou z hlediska lidského zdraví významné. Ve skupině D je to výhradně sérotyp 1/2a a ve skupině F sérotyp 1/2a a 1/2c. Z obrázku je také patrný vyšší stupeň genetické heterogenity izolátů se sérotypem 1/2a a naopak vyšší homogenita izolátů, které jsou nositelem sérotypu 1/2c. Tato zjištění jsou ve shodě i s dalšími autory (den Bakker et al., 2008; Ragon et al., 2008; Sammarco et al., 2011). 96

97 Poslední obrázek (Obrázek 3) ukazuje pohled na rozdělení izolátu z hlediska matrice, ze které byl odběr proveden. Barevně jsou odlišeny jednotlivé sérotypy. Obrázek 3. Znázornění matrice, ze které byl odběr proveden. Barevně jsou odlišeny sérotypy izolátů: sérotyp 1/2a (červená); 1/2b (růžová); 1/2c (fialová); 4b (hnědá); 4ab, 3a, 4c a 4d (zelená) Z obrázku je možné odečíst, že u kmenů získaných z humánních izolátů není zastoupen žádný z méně nebezpečných sérotypů 4ab, 3a, 4c ani 4d. Nebyl u nich určen ale ani sérotyp 1/2c, který je naopak s vývojem listeriózy spojován (Clark et al., 2010; O Connor et al., 2010). Dále je z dendrogramu vidět, že sérotypy 4ab, 3a, 4c a 4d byly určeny takřka výhradně u vzorků odebraných z živočišných produktů (masná výroba, výrobky z ryb, syrové maso), žádný z izolátů, charakterizovaný těmito sérotypy, nebyl odebrán z mléčného výrobku. Závěr AFLP analýza kmenů L. monocytogenes ukázala značnou divergenci mezi jednotlivými izoláty. Obdobná situace byla zaznamenána i u dalších studií, které se zabývaly AFLP analýzou bakterií rodu L. monocytogenes (Guerra et al., 2002; Autio et al., 2003; Sammarco et 97

98 al., 2011) Přesto bylo možné vypozorovat v sadě vzorků vznik několika skupin, které měly vztah k roku odběru vzorku, k určenému sérotypu či k matrici, ze které byl vzorek odebrán. Tato práce potvrdila, že AFLP je vhodná metoda pro takovýto druh analýz, jak už bylo naznačeno v jiných studiích (Faltusová et al., 2011). Hlavní předností AFLP je, že získaná data (přítomnost/nepřímnost restrikčního fragmentu) je možné testovat z hlediska korelace s libovolným množstvím dalších informací či experimentálních dat, která se k analyzovaným vzorkům vážou. Dedikace Tato práce byla podporována projektem MŠMT 2B08050 a MZE Použitá literatura 1. Autio T., Keto-Timonen R., Lundén J., Björkroth J., Korkeala H. (2003) Characterisation of persistent and sporadic Listeria monocytogenes strains by pulsedfield gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP). Syst. Appl. Microbiol., 26 (4), Clark CG., Farber J., Pagotto F., Ciampa N., Doré K., Nadon C., Bernard K., Ng LK. (2010) Surveillance for Listeria monocytogenes and listeriosis, Epidemiol. Infect. 138, den Bakker HC., Didelot X., Fortes ED., Nightingale KK., Wiedmann M. (2008) Lineage specific recombination rates and microevolution in Listeria monocytogenes. BMC Evol. Biol. 8, Doumith M., Buchrieser C., Glaser P., Jacquet C., Martin P. (2004) Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. J Clin Microbiol., 42, Faltusová Z., Kučera L., Ovesná J. (2011) Genetic diversity of Brassica oleracea var. capitata gene bank accessions assessed by AFLP. Electronic Journal of Biotechnol., 14 (3), DOI: /vol14-issue3-fulltext-4 6. Frank JF. & Koffi RA. (1990) Surface-adherent growth of Listeria monocytogenes is associated with increased resistance to surfactant sanitizers and heat. J. Food Protection, 53 (7), Gormley FJ., Little CL., Grant KA., de Pinna E., McLauchlin J. (2010) The microbiological safety of ready-to-eat specialty meats from markets and specialty food shops: a UK wide study with a focus on Salmonella and Listeria monocytogenes. Food Microbiol. 27, Guerra MM., Bernardo F., McLauchlin J. (2002) Amplified fragment length polymorphism (AFLP) analysis of Listeria monocytogenes. Syst. Appl. Microbiol. 25, Hain T., Chatterjee SS., Ghai R., Kuenne CT., Billion A., Steinweg C., Domann E., Kärst U., Jänsch L., Wehland J., Eisenreich W., Bacher A., Joseph B., Schär J., Kreft J., Klumpp J., Loessner MJ., Dorscht J., Neuhaus K., Fuchs TM., Scherer S., Doumith M., Jacquet C., Martin P., Cossart P., Rusniock C., Glaser P., Buchrieser C., Goebel W., Chakraborty T. (2007) Pathogenomics of Listeria spp. Int. J. Med. Microbiol. 297 (7-8), staženo

99 12. Lorber B. Listeria monocytogenes. In: Mandell GL, Bennett JE, Dolin R, eds. Mandell, Douglas, and Bennett s principles and practice of infectious diseases. 6th ed. Philadelphia: Elsevier, Churchill Livingstone, 2005, Lundén J., Autio T., Markkula A., Hellström S., Korkeala H. (2003) Adaptive and cross-adaptive responses to persistent and nonpersistent Listeria monocytogenes strains to disinfectants. Int. J. Food Microbiol. 82, O Connor L., O Leary M., Leonard N., Godinho M., O Reilly C., Egan J., O Mahony R. (2010) The characterization of Listeria spp. isolated from food products and the foodprocessing environment. Lett. Appl. Microbiol. 51, Orsi RH., den Bakker HC., Wiedmann M. (2011) Listeria monocytogenes lineages: Genomics, evolution, ecology, and phenotypic characteristics. Int. J. Med. Microbiol. 301 (2), Perrier X.,Jacquemoud-Collet JP. (2006). DARwin software 17. Ragon M., Wirth T., Hollandt F., Lavenir R., Lecuit M., Le Monnier A., Brisse S. (2008) A new perspective on Listeria monocytogenes evolution. PLoS Pathog. 4, e Ripabelli, G., McLauchlin, J. Amplified fragment length polymorphism (AFLP) analysis for DNA fingerprinting. In: Fuchs, Jürgen, Podda, Maurizio, Encyclopedia of Diagnostic Genomics and Proteomics. Marcel Dekker Inc., New York, 2004, Sammarco ML., Vitullo M., Tamburro M., Pontello M., Ripabelli G. (2011) Amplified fragment length polymorphism analysis of Listeria monocytogenes by Experion(TM) automated microfluidic electrophoresis. J. Microbiol. Met., 87 (1),

100 MOŽNOSTI VYUŽITÍ MATEMATICKÝCH MODELŮ PŘEDPOVĚDNÍ MIKROBIOLOGIE Possibilities of predictive models mathematical models utilization Erban V., Eichlerová E., Landfeld A., Čírtková V., Houška M. Výzkumný ústav potravinářský Praha, v. v. i. Kontaktní adresa 1. autora: RNDr. Vladimír Erban, CSc. Výzkumný ústav potravinářský Praha, Radiová Praha 10, Abstrakt Cílem práce bylo vytvořit matematický předpovědní model růstu různých kmenů Listerií, za různých podmínek prostředí ( teplota, vodní aktivita a ph). Z porovnání vyplývá, že různé kmeny se liší ve svých fyziologických charakteristikách. Proto je nekorektní vytvářet obecné modely pro všechny kmeny téhož druhu. Ze získaných dat je možné různé kmeny rozdělit do skupin s podobnými vlastnostmi. Klíčová slova: matematický předpovědní model, Listeria, podmínky prostředí Abstract The goal of this study was formation of mathematical predictive model of growing various Listeria under influence various surroundings as temperature, water activity and ph. Different strains have different physiological characteristics by comparing. It is uncorrected to construct general predictive models for general type of microorganism therefore. On the base of gained data it is possible divide them to different groups with similar characteristics. Key words mathematical predictive model, Listeria, conditions of surroundings Úvod Jako u všech mikroorganismů jsou podmínky růstu dány jednak zdrojem živin a jednak fyzikálně chemickými podmínkami prostředí jako je ph, aktivita vody (Aw), teplota, a podobně. Pro růst mikroorganismů jsou významné pouze některé. Je možné předpokládat, že pro růst mikroorganismů potřebné minimální množství živin je v prostředí dostatečné množství a je možné je modelově nahradit živnými medii. Závislost růstu mikroorganismu na kritických hodnotách fyzikálních faktorů uvádějí různé tabulky. Ty však předpokládají, že ostatní faktory mají optimální hodnotu pro růst. Chování mikroorganismů je však významně ovlivněno kombinací hodnot těchto faktorů. Na základě modelových růstových křivek pro různé kombinace hlavních faktorů (ph, Aw a teplota) v předpokládaném rozsahu výskytu v prostředí, ovlivňujících růst mikroorganismů jsou vytvořeny modely růstové modely růstu popisující růst mikroorganismů i pro hodnoty prostředí pro další kombinace těchto faktorů. Tyto modely jsou demonstrovány na přikladu Listerií, které svými fyziologickými 100

101 charakteristikami růstu, vysokou adaptabilitou na prostředí a specifickou patogenitou kmenů L.monocytogenes jsou významným rizikem pro zdravotní bezpečnost potravin. Obecně je možné takovéto modely vytvořit pro každý mikroorganismus Materiál a metody Pro studium podmínek růstu Listerií je nutné porovnávat jejich růstové parametry za různých podmínek prostředí. Tyto parametry jsou klíčovou odpovědí na nebezpečí růstu Listerií v konkrétním výrobku za konkrétních provozních a skladovacích podmínek. Vytváření modelů se skládá z následujících kroků: 1. Odhad rozsahu fyzikálních podmínek růstu (ph, Aw a teplota). 2. Naměřit soubor růstových křivek (primární modely). 3. Ze souboru primárních modelů se vytváří sekundární modely, které charakterizují fyziologické vlastnosti mikroorganismu (lag fáze, rychlost růstu, maximální nárůst a další fyziologické charakteristiky) 4. Vytvoření vlastního matematického modelu (terciárního modelu) 5. Na základě tohoto modelu jednak hodnotit adaptační schopnosti modelového organismu a vytipovat kritické oblasti, ve kterých je nutné hodnotit získané izoláty tak, aby bylo možné zjistit, zda různé izoláty mají i různé fyziologické charakteristiky a tím i různou míru nebezpečí pro výrobek ve kterém se vyskytují. Na základě výchozích úvah byly měřeny růstové křivky v mediu tryptose phosphate broth TPB (Oxoid). Při přípravě medií bylo vycházeno z dvojnásobné koncentrace surovin, které byly upravovány na vhodnou hodnotu aktivity vody Aw pomocí přídavku solí. Konečná Aw byla kontrolována měřením. Poté byla media rozdělena na alikvotní objemy upravené pomocí HCl a NaOH na požadované ph. Hotová media byla sterilována 15min při 121 C. Médium bylo rozplněno do mikro destiček po 0,2ml, inokulováno 1% různých kmenů Listeria. Inkubace probíhala v Bioscreenu za nepravidelného třepání při širokopásmové vlnové délce, odečty optické denzity OD probíhaly jednou za hodinu. Výsledky a diskuze Matematické modely Vzhledem ke značnému množství dat a obtížné orientaci v přehledových grafech s malou přesností odečtu byl po statistickém vyhodnocení vytvořen matematický model růstu pro každý kmen Listerie. Pro odhad růstu patogenů slouží počítačové terciární modely předpovědní mikrobiologie (PM). Jejich podstatou je matematický popis růstu počtu mikrobů v potravinách za specifických podmínek prostředí, které zahrnuje vnitřní faktory (ph, a w ) a vnější, faktory, (teplota, inhibiční látky). K inhibici růstu patogenů dochází i při kombinaci těchto faktorů, z nichž žádný sám o sobě nemá dostatečnou úroveň samostatné inhibice. Matematické modely nejlépe zajišťují dosažení realistické předpovědi růstu mikroorganismu při různé kombinaci těchto faktorů. Byl vytvořen Excelový soubor, ve kterém se zadá teplota, Aw, ph, čas pro který má být spočtena OD, a výchozí OD. Model nabízí hodnotu OD k zadanému času, dobu lag fáze, čas, kdy je růst kultury nejrychlejší, dobu zdvojení OD kultury a maximální nárůst OD až pro 6 Gompertzův růstový model křivek zároveň. Pro modely byl použit Gompertzův růstový model s parametry A, B, C a M, (Tabulka 1) log(od) = A + C.exp(-exp (-B.(t-M))) A parametr Gompertzova modelu - inoculum log (OD) B parametr Gompertzova modelu růstová rychlost log (OD)/t C parametr Gompertzova modelu maximální přírůstek (OD max -Od o ) log (OD) M parametr Gompertzova modelu čas maximální růstové rychlosti t 101

102 Z těchto parametrů matematického modelu je možné spočítat parametry růstových křivek pomocí následujících vztahů:trvání fáze lagu (TFL) = M - [ 1/B]. Exponenciální růstová rychlost (ERR)=BC/e. Generační čas (GT)=Log 10 (2) e/bc) (McMeekin T.A. a spol. 1993) Z důvodu velkého počtu dat bylo využito makro ve VBA pro výpočet nelineární regrese v rámci Excelu. Byly tak určovány parametry Gompertzova modelu B, C a M pro každou růstovou křivku (viz označení). Parametry B, C, M pak byly korelovány k teplotě, aktivitě vody a ph Vztahy byly použity při tvorbě matematického modelu růstu Listeria monocytogenes a Listeria innocua. Získané parametry B, C a M (Parametr A byl zvolen -1 pro všechny růstové křivky) byly použité pro výpočet zjednodušených kvadratických modelů v transformaci přirozených logaritmů pro Gompertzovy parametry B, M a C použité pro předpověď TFL, ERR a GT, tak jak jsou ovlivněny teplotou, ph a Aw pro každý kmen rostoucí v BHI. Tabulka 1: Tabulka ovládání předpovědního růstového modelu Růstový model L. monocytogenes 2219: (platnost modelu: a w = < 0,92-0,98 >, ph = < 4,5-6,5 >, t = < 5-37 C >) Přepočítej tabulku Vytvo ytvoř ř graf teplota ( C) a w (-) ph (-) čas (hodiny) výchozí OD OD (v čase) lagfáze (hodiny) čas do GT (hodiny) GT (hodiny) ODmax 25 0,92 6,5 48 0,1 0,50 32,17 35,67 3,97 0, , ,1 0,58 29,37 32,58 3,41 0, ,92 5,5 48 0,1 0,50 26,44 29,76 3,87 0, , ,1 0,33 23,29 27,18 6,19 0, ,92 4,5 48 0,1 0,16 19,20 24,83 22,02 0,16 Získané modely byly použity pro porovnání růstu jednotlivých kmenů L. mon. a L. inn. Byla zvolena kritická hodnosta růstu při Aw = 0,92, při různých ph a teplotě 25 C. Pro každý kmen byly vygenerovány růstové křivky při zvolených parametrech a ty byly následně porovnávány (Graf č. 1, 2, 4, 5, 6, 7 a 8). Inokula byla použita se stejnou historií Graf č. 1: Růstové křivky L. monocytogenes 2219 při 25 C, Aw = 0,92, a ph = 4,5-6,5 Graf č. 2 Růstové křivky L. monocytogenes 2182 při 25 C, Aw = 0,92, a ph = 4,5-6,5 102

103 Graf č. 3: Modelové růstové křivky L. monocytogenes 2023 při 25 C, Aw = 0,92, a ph = 4,5-6,5 Graf č. 4: Modelové růstové křivky L. monocytogenes 2002 při 25 C, Aw = 0,92, a ph = 4,5-6,5 Graf č. 5: Modelové růstové křivky L. monocytogenes 1225 při 25 C, Aw = 0,92, a ph = 4,5-6,5 Graf č. 6: Modelové růstové křivky L. innocua 4549 při 25 C, Aw = 0,92, a ph = 4,5-6,5 Graf č. 7: Modelové růstové křivky L. innocua 4030 při 25 C, Aw = 0,92, a ph = 4,5-6,5 Z porovnání maximálních hodnot D pro jednotlivé kmeny vyplývá, že kromě kmene L. mon a L. inn dosahují všechny kmeny maximálního nárůstu při hodnotě ph 6. To naznačuje, že pro nárůst listerií je tato hodnota optimální. Z porovnání je zřejmé, že různé kmeny L. mon. se chovají odlišně, mají různou TFL, ERR i max. OD. Podobně se chovají i testované kmeny L. inn. 103

104 To znamená, že nelze vybrat typový kmen ani zvolit průměrnou směsnou kulturu pro testování podmínek růstu v konkrétním případě technologického procesu. Testované kmeny listerií je možné rozdělit do dvou hlavních podskupin podle TFL; kmeny s krátkou dobou TFL do 5-ti hodin (Graf č. 2, Graf č. 4, Graf č. 5 a Graf č. 8) a do skupiny s dlouhou dobou TFL mezi 20 a 30 hodinami (Graf č. 1, Graf č. 6 a Graf č. 7). Je zajímavé, že kmeny L.mon s krátkou dobou TFL citlivěji reagují růstovou rychlostí na snižování ph. Kdežto kmeny s dlouhým TFL mají ERR mnohem vyrovnanější a odpovídají maximální ERR listerií ze skupiny s krátkým TFL. To je ve shodě s představou, že čím delší TFL tím lepší adaptace na prostředí tím a tím rychlejší růst. Závěr Pro kvalifikovaný odhad předpovědi růstu listerií v konkrétních podmínkách je nutno vždy volit konkrétní model pro daný kmen listerií nebo alespoň z odpovídající skupiny podle TFL. Tento fakt je také nutno zohlednit při testování růstu listerií na konkrétním potravinářském produktu a modely využívat s velkou opatrností pouze mikrobiology jako podklad pro další analýzy. Z uvedených příkladů vyplývá význam a nutnost bližší identifikace kmenů a k nim vytvářet prediktivní modely. Dedikace Práce byla podpořena grantovou agenturou MŠMT č. 2B08050 Použitá literatura 1. McMeekin T.A., Olley J.N., Ross T., Ratkowsky D.A., Predictive mikrobiology theory and application, Reseach Studies Press LTD, ANON1991: Recommendations by The National Advisory Committee on microbiological criteria for foods: The pathogenesis and virulence of Listeria monocytogenes, N7/2/efb5c39e5bc64991b40c25af075906b1 3. Aarnisalo,K., Vihavainen,E., Rantala,L., Maijala,R., Suihko,M. L., Hielm,S., Tuominen,P., Ranta,J., Raaska,L., Use of results of microbiological analyses for riskbased control of Listeria monocytogenes in marinated broiler legs, International Journal of Food Microbiology, 3, , Angelidis,A., Boutsiouki,P., Papageorgiou,D.,: Loss of viability of Listeria monocytogenes in contaminated processed cheese during storage at 4, 12 and 22 C. Food Microbiology, 27, , Augustin,J. Ch., Rosso,L., Carlier,V.: A model describing the effect of temperature history on lag time for Listeria monocytogenes International Journal of Food Microbiology 57, , 2000, 104

105 APLIKÁCIA INTERNÉHO ŠTANDARDU V KVANTIFIKÁCIÍ ALERGÉNNYCH ZLOŽIEK POTRAVÍN POLYMERÁZOVOU REŤAZOVOU REAKCIOU Application of internal standard at quantification of food allergens by pcr Janská V., Piknová Ľ., Kuchta T., Siekel P. Výskumný ústav potravinársky, Bratislava Kontaktná adresa 1.autora: Ing. Veronika Janská, Výskumný ústav potravinársky, Priemyselná 4, Bratislava 26, Abstrakt Vyvinuli sme metódu pre kvantifikáciu orechov z pekárenských výrobkov. Ako interný štandard sme použili makadámové orechy. Real-time polymerázovú reťazovú reakciu v duplexnom usporiadaní s 5 - nukleazou (TaqMan) s použitím farbív FAM pre analyzovaný orech a JOE pre makadamové orechy. Pre zostrojenie kalibračnej čiary sú potrebné rozdiely hodnôt prahových cyklov analytu a interného štandardu k logaritmu hmotnosti vzorky. 5 % z celkovej hmotnosti vzorky sa ukázalo ako vhodné množstvo interného štandardu. Predkladanou metódou sme analyzovali pekárenské výrobky s orechovou plnkou získané z maloobchodnej siete. Výsledky potvrdili vhodnosť využitia interného štandardu pridaného ku analyzovanej vzorke ešte pred homogenizáciou, ktorý tak koriguje výsledky, nepresnosti vznikajúce pri príprave vzorky. Kľúčové slová orechy, interný štandard, polymerázová reťazová reakcia Abstrakt A method for absolute quantification of walnuts in fillings of bakery products was developed. Macadamia nuts were used as an internal standard material. A duplex real-time polymerase chain reaction (PCR) with 5 -nuclease (TaqMan) probes labelled with FAM and JOE for walnuts and the internal standard, respectively, was used. Difference between threshold cycle values (ΔCt) for the analyte and the internal standard, plotted against logarithm of contents, was used to construct the calibration line. A level of 5 % (w/w) of the internal standard material was found to be suitable for quantification of walnuts in nut fillings, the calibration line being linear. The present study demonstrates that quantification of walnuts in the fillings of bakery products should be achievable by realtime PCR with an internal standard material when the reference filling, which is used for calibration, is comparable to the fillings of the samples, and the sample material is properly homogenized before weighing the analytical sample. Keywords Walnut, Internal standard, Polymerase chain reaction 105

106 Úvod Polymerázová reťazová reakcia (PCR) je molekulárno-biologická metóda, ktorá umožňuje identifikáciu špecifických úsekov DNA v rôznych vzorkách vrátane potravín. Aplikáciu PCR na analýzu potravín komplikuje nízka výťažnosť amplifikovateľnej DNA z potravinových vzoriek a obsah látok, ktoré môžu inhibovať PCR. Amplifikovateľnosť izolovanej DNA sa môže stanoviť použitím univerzálnej eukaryotickej PCR alebo použitím exogénneho templátu (napr. plazmidovej DNA) a naň orientovanej PCR. V našej práci sme preskúmali využiteľnosť PCR orientovanej na gén alergénu podobného vicilínu vo vlašských orechoch a gén prekurzora vicilínu v makadámových orechoch pri analýze pekárenských výrobkov. V týchto potravinových vzorkách sa DNA z makadámových orechov prakticky nenachádza a dá sa predpokladať, že bude spĺňať požiadavky na exogénny interný štandard v tomto type analytických aplikácií. Materiál a metódy Vzorky pekárenských výrobkov obsahujúce orechy sme získali z maloobchodnej siete zo Slovenska, z Čiech, Rakúska, Maďarska a zo Slovinska. Z potravinových vzoriek sme odobrali plnku s obsahom orechov a pridali pomleté makadamové orechy v koncentrácií 5 % z celkovej hmotnosti. DNA sme izolovali chaotropickou extrakciou na tuhej fáze. Použili sme súpravu NucleoSpin Food kit (Macherey-Nagel, Düren, Nemecko). Z homogenizovanej zmesi (orechovej plnky a makadamových orechov) sme navážili 200 mg, pridali sme 550 µl lyzačného roztoku CF zahriatého na 65 C, opatrne sme miešali po dobu 15 s, pridali 10 µl roztoku proteinázy K a premiešali počas 3 s. Zmes sme inkubovali počas 60 min v termobloku pri teplote 65 C. Centrifugovali sme 10 min pri g. K 300 µl supernatantu sme pridali 300 µl tlmivého roztoku C4 a 200 µl etanolu. Zmes sme dôkladne vortexovali počas 30 s. Objem zmesi 750 µl sme naniesli na minikolónku vloženú do mikroskúmavky o objeme 1,5 ml. Centrifugovali sme počas 1 min pri g a eluát sme odstránili. Objem 400 µl tlmivého roztoku CQW sme naniesoli na minikolónku, centrifugovali počas 1 min pri g a eluát sme odstránili. Objem 700 µl tlmivého roztoku C5 sme naniesli na minikolónku, centrifugovali počas 1 min pri g a eluát sme odstránili. Objem 200 µl tlmivého roztoku C5 sme naniesli na minikolónku a centrifugovali počas 2 min. pri g. Minikolónku sme vložili do novej mikroskúmavky o objeme 1,5 ml a naniesli sa na ňu 100 µl elučného roztoku CE zahriateho na teplotu 70 C. Po inkubácii pri laboratórnej teplote počas 5 min sme centrifugovali počas 1 min pri g. Získaný roztok DNA sme uchovávali pri teplote -10 C. Koncentráciu izolovanej DNA sme stanovili fluorometricky s použitím farbiva PicoGreen. Použili sme súpravu Quant-iT PicoGreen dsdna Assay Kit (Invitrogen, Carlsbad, California, USA). Na kalibráciu sme použili λ DNA. Pripravili sme štvorkové riedenia λ DNA zo zásobného roztoku s koncentráciou 100 µg/ml v tlmivom roztoku TE. Pripravili sme vzorky DNA s neznámou koncentráciou riedením v tlmivom roztoku TE. Roztok farbiva PicoGreen sme pripravili 200-násobným riedením v tlmivom roztoku TE. Do mikrotitračných platničiek sme pipetovali po 100 µl roztoku farbiva PicoGreen a po 100 µl zriedených roztokov λ DNA a vzorky s neznámou koncentráciou DNA. Zmes sme premiešali jednotlivo pipetovaním. Florescenciu sme merali vo fluorometri (Safire 2; Tecan, Grödig bei Salzburg, Rakúsko) pri excitačnej vlnovej dĺžke 492 nm a emisnej vlnovej dĺžke 520 nm. Real-time PCR sme vykonali v objeme 25 μl v štandardnej reakčnej zmesi s 1,5 U Taq polymerázou (Tab. 1). Objem jednotlivých vzoriek DNA bol 2 μl. Použili sme priméry a 5'-nukleázové sondy typu TaqMan špecifické pre vlašské orechy a makadámové orechy (Tab. 2). Použili sme real-time PCR cyklér model 7900 (Applied Biosystems) so štandardným teplotným programom pozostávajúcim z aktivácie pri 106

107 95 C počas 10 min, 55 cyklov (denaturácia pri 95 C počas 15 s, priľnutie a polymerizácia pri 60 C počas 60 s). Reakcia prebiehala vo formáte duplex, ktorá kvantifikovala vlašské orechy + makadámové orechy. Tabuľka 1. Reakčná zmes real-time PCR zložka konc. objem na konc. na reakciu zás.roztoku reakciu (µl) dodávateľ Tlmivý roztok 10x 1x 2,5 Qiagen Mg mm 2,5 mm 1 Qiagen dntp(dutp) 10 mm 0,4 mm 1 ABI Primer Forward 5 µm 500 nm (0,5 µm) 2,5 eurofins/mwg operon Primer Reverse 5 µm 500 nm (0,5 µm) 2,5 eurofins/mwg operon polymeráza 5 U/µl 1,5 U/µl 0,3 Qiagen sonda 10 µm 200 nm (0,2 µm) 0,5 eurofins/mwg operon Tabuľka 2. Použité priméry a sondy Cieľový gén názov sekvencia Jug (vlašské JuglF primér GCGCAGAGAAAGCAGAG (17- mét) orechy) JuglR primér CTCATGTCTCGACCTAAT GCT (21-mér) JuglP sonda ATTGTGCCTCTGTTGCTCCTCTTCCCG (27-mér) Makadamové orechy macf1 primér macr1 primér macpb1 sonda CCTCGAGTGTGGAGACGTAA (20-mér) CTCGTTGTTGTCCGGTTGA (19-mér) TCAGAATCCCAGCTGGAACCACA (23-mér) Výsledky a diskusia Z pekárenských výrobkov sa podarilo izolovať DNA v rôznych koncentráciach (Tab. 3). DNA sa analyzovala duplexnom systéme real-time PCR. Získané výsledky prahových cyklov sa odčítali podľa vzťahu: ΔCt = Ct (vlašské orechy) Ct (makadámové orechy). A zostrojili sme kalibračnú čiaru ΔCt /log konc. (vlašské orechy). Pre optimalizáciu výsledkov sme extrakciu DNA robili v dvoch paralelkách. Paralelné extrakty sa analyzovali vo viacerých paralelných PCR analýzach. Niektoré hodnoty ΔCt pre jednotlivé pekárenské výrobky z dvoch extrakcii boli veľmi podobné, iné sa vyznačovali veľkými rozptylmi hodnôt pre paralelné analýzy. Tieto rozdiely nie sú spôsobené real-time PCR, ale skôr poukazujú na rôznorodosť odrôd orechov, na rozdienu hrubosť mletia a technologické opracovanie orechov. Real-time PCR orientovaná na makadamové orechy umožňuje zlepšenie parametrov extrakcie DNA (Obr. 1). 107

108 Ct log c (% (w/w)) Obrázok 1: Kalibračná čiara pre vzorky s obsahom vlašských orechov a s pridaním 5 % exogénneho interného štandardu. Prerušovaná čiara vyznačuje interval spoľahlivosti pri 95 % pravdepodobnosti. Tabuľka 3. Hodnoty kvantifikácie vlašských orechov z pekarenských výrobkov názov výrobku orechový závin 1 orechový závin 2 krajina pôvodu CZ SR 1. extrakcia 2. extrakcia deklarácia na obsah VO v % ΔCt obsah VO v obale ΔCt (1) SD1 (1) (2) SD2 % (2) orechová plnka 0,61 0,37 20 % 2,56 orechová plnka 25 % 0,63 orechový hrebeň SR orechy -0,69 orechový závin 3 orechový závin 4 SR SR vlašské orechy 40 % 1,26 orechová plnka 48 % -0,19 0,47 0,22 0,19 1,25 19,81±1,12 0,83 52,93±1,08 103,67±1,08 38,40±1,08 80,36±1,09-1,64-0,87-0,84-1,61 0,18 0,45 0,24 0,08 47,80±1,08 168,19±1,17 113,62±1,14 111,90±1,13 165,64±1,17 orehova potica Slovinsko orechy 20 % 1,97 0,55 26,75±2,00 0,34 0,19 61,35±1,08 jemné orechové pečivo orechový závin 5 orechové mini záviny CZ SR SR orechová plnka 45 % 3,84 orechová plnka 40 % 1,90 vlašské orechy 7 % 0,65 0,92 0,38 0,06 10,32±1,19 1,63 27,72±1,09 1,89 52,39±1,08 0,53 0,12 0,08 0,11 31,80±1,09 27,86±1,09 55,69±1,08 orechový koláč s Rakúsko vlašské orechy 2,45 0,09 20,95±1,12 2,74 0,36 18,07±1,13 108

109 posýpkou 2 % orechová štóla Rakúsko lieskové a vlašské orechy 0,71 0,23 11 % 3,25 13,94±1,15 5,20 5,16±1,27 orechová štrúdľa Rakúsko vlašské orechy 0,72 0,23 11 % 4,75 6,49±1,24 1,72 30,38±1,09 lieskovorieškové Rakúsko lieskové orechy 0,58 6,73 1,61 minipusinky 8 % 3,44 12,65±1,16 2,37±1,37 Záver Orechy patria medzi potencionálne alergénne zložky potravín. Preto je veľmi dôležité vyvinúť spoľahlivú metódu na ich detekciu a kvantifikáciu. Nami predkladaná metóda využíva vhodne zvolený interný štandard, ktorý zlepšuje parametre extrakcie DNA a umožňuje kvantifikáciu pomocou real-time PCR. Použitá literatura 1. Brežná B, Hudecová L, Kuchta T (2006) Eur Food Res Technol, 223: Piknová Ľ, Kuchta T (2006) Eur Food Res Technol 223: Janská V, Piknová Ľ, Kuchta T (2011) Eur Food Res Technol 232: Hirao T, Hiramoto M, Imai S, Kato H (2006) J Food Prot 69:

110 DETEKCE PŘÍTOMNOSTI SÓJI V MLÉČNÝCH VÝROBCÍCH Detection of the presence of soy in dairy products Tesařová Z., Vráblík A, Hodek J., Šídová D., Ovesná J. Výzkumný ústav rostlinné výroby, v.v.i. Kontaktní adresa 1. autora: Ing. Zuzana Tesařová, VÚRV, v.v.i., Drnovská 507, Praha 6, Abstrakt Mléčné výrobky mohou být předmětem falšování. Dražší suroviny (např. smetana) jsou v těchto případech nahrazovány přídavkem rostlinných tuků. Mléko obecně pak může být ve výrobcích nahrazeno např. výluhem ze sójových bobů. Jelikož se sója řadí mezi silné alergeny a alergie na sóju je poměrně častá, kromě klamání spotřebitele hrozí také v případě falšování mléčných výrobků sójou alergické reakce. Je tedy důležité disponovat vhodnou metodou pro její detekci. Vývojem a verifikací metody pro detekci sóji v mléčných výrobcích na základě detekce její DNA metodou polymerázové řetězcové reakce (PCR) se zabývá tato práce. V této práci byly navrženy primery pro amplifikaci krátkého úseku DNA, specifického pro gen sójového lektinu. Byla ověřena specifičnost navržených primerů a optimalizována realtime PCR s použitím SYBR Green detekce na testovaných vzorcích mléčných výrobků a jejich alternativ s deklarovaným obsahem sóji. Dále byly vzorky testovány metodou High Resolution Melting (HRM). Klíčová slova mléčné výrobky, detekce sóji, real-time PCR, High Resolution Melting Abstract Dairy products may be subject to adulteration, where there is a relatively expensive raw material (e.g. cream) replaced by the addition of vegetable fats. Milk can be replaced in dairy products for example by soybean extract. Because soy belongs among strong allergens and the incidence of allergy is rather high. Therefore it is necessary to have a method for its detection. Aim of this work is to develop and verify the method for detection of soy in dairy products based on DNA detection via Polymerase Chain Reaction (PCR). The new primer set for amplification of short DNA region specific for the soy lectin gene was developed in this work. Real-time PCR with SYBR Green detection was optimized and specificity of new primers was verified. This method was tested on samples of dairy products and their alternatives with declared presence of soya. The samples were also tested by method high resolution melting (HRM). Key words dairy products, detection of soy, real-time PCR, High Resolution Melting Úvod Mléčné výrobky bývají často předmětem falšování. Při falšování mléčných výrobků bývá nahrazována smetana (mléčný tuk) jakožto drahá surovina např. přídavkem rostlinných tuků (http://www.szpi.gov.cz/docdetail.aspx?docid= &doctype=art&nid=11342). Výrobky označované jako smetanové tak mohou obsahovat nižší podíl smetany, než je deklarováno na obale či nařízeno vyhláškou 77/2003 Sb., kterou se stanoví požadavky pro mléko a mléčné výrobky, mražené krémy a jedlé tuky a oleje. Mléko obecně může být ve 110

111 výrobku nahrazeno např. výluhem ze sójových bobů nebo přídavkem nejrůznějších aditiv (barviv, stabilizátorů, emulgátorů, plnidel) k zajištění požadovaných technologických a organoleptických vlastností. Sója je jednou z nejvýznamnějších potravin z hlediska výživy, ale zároveň ji lze zařadit mezi nejsilnější alergeny. Alergie na sóju patří rovněž mezi ty s nejčastějším výskytem (Savage et al. 2009). Nevědomá konzumace falšovaných potravin, kdy je ve výrobku nahrazena dražší surovina sójou nebo sójovým produktem, může být proto zdrojem nežádoucích alergických reakcí, ke kterým u alergiků dochází i při konzumaci potraviny s jen nepatrnou příměsí sóji (Gryson et al. 2007). Podle vyhlášky 113/2005 Sb, o způsobu označování potravin a tabákových výrobků, musí být rovněž výrobek, který obsahuje alergenní složku řádně označen. Jednou ze základních metod pro detekci přítomnosti určité matrice v potravinách je metoda polymerázové řetězové reakce (PCR). Pro ověření přítomnosti DNA sóji (Glycine max L.) metodou PCR se používají např. specifické primery, které amplifikují část genu pro sójový lektin (Wurz et al. 1999). Pro ověření přítomnosti DNA z mléčných produktů (s obsahem kravského mléka od 0,5 %) a její vhodnosti pro PCR, se používají např. primery amplifikující část hovězího genu pro podjednotku 1 cytochrom oxidázy (COI) (Feligini et al. 2007). DNA v potravinových výrobcích, které prošly procesem významného technologického zpracování (např. výrazné změny teploty, tlaku, ph), bývá ve větší míře degradována (Gryson 2010). Pro takovouto DNA je výhodnější použití primerů amplifikujících kratší úseky cílové DNA, což umožní zvýšení citlivosti dané PCR (Mitsuhashi 1996). Tato práce je zaměřena na zavedení vhodné metody pro detekci sóji v mléčných výrobcích, která spočívá v navržení PCR amplifikace vhodného úseku DNA a ověření reakce na reálných vzorcích. PCR amplikon byl rovněž testován metodou High Resolution Melting (HRM), která umožňuje sledování rozdílu teploty tání produktu u jednotlivých analyzovaných vzorků. Pomocí této metody lze vzorky rozřadit do jednotlivých variant podle teplot tání specifických produktů bez nutnosti použití sekvenčně specifických značených sond (Wittwer 2009). Materiál a Metody Potravinářské výrobky: sójový kysaný nápoj (A), sójový dezert vanilka (B), krajanka vaječný likér (C), pribináček kakaový (D), tvarohový jogurtový dezert (E), Florián (F), Pacholík (G), Cottage sýr (H), jogurt bílý (I), Cavalier (J), jogurt s jahodovou složkou (K), kefír (L), dětská kaše (M). Extrakce DNA: DNA byla extrahována metodou CTAB (cetyltrimethyl amonium bromid) dle platné ISO normy (EN ISO 21571:2005). Extrakce proběhla ve dvou nezávislých opakováních z 200 mg homogenizovaného vzorku. Získaná DNA byla rozpuštěna v 60 µl ultračisté DNA a RNA free H 2 O. Stanovení kvality DNA: Integrita získané DNA byla zkontrolována elektroforetickou separací na 0,8 % agarózovém gelu, barveném přídavkem ethidium bromidu. Pro měření koncentrace získané DNA byl použit spektrofotometr Nanophotometer (Implen GmBH, Munich, Germany). Množství DNA bylo spočteno z absorpce při délce 260 nm, čistota DNA byla ověřena použitím poměru absorbancí A 260 /A 280. Navržení primerových párů: Pro navržení oligonukleotidových sekvencí byl použit volně dostupný software Primer3Plus (Untergasser et al. 2007). Primery byly navrženy podle DNA sekvence sójového lektinu (K ). Specificita navržených primerů byla ověřena in silico ve veřejně dostupné internetové databázi NCBI s použitím Basic Local Alignment Search 111

112 Tool (BLAST). Navržené primery jsou označeny jako Lec69 a Lec118 a jsou uvedeny v tab. 1. Real-time PCR: Real-time PCR probíhala v přístroji 7900HT Fast Real-Time PCR (Applied Biosystems, Carlsbad, USA). Všechny reakce byly provedeny ve dvojím opakování s použitím detekce SYBR Green (Applied Biosystems, Carlsbad, USA). Použité oligonukleotidové sekvence jsou uvedeny v Tab. 1. Konečné koncentrace komponentů pro PCR byly následující: SYBR Green 1x, primery 250 nm, celkový objem byl doplněn vodou pro PCR do 15 µl a bylo přidáno 5 µl roztoku DNA. Teplotní profil real-time PCR se sestával z 10-ti minutové inkubace při 95 C a dále ze 40 cyklů: 95 C 15 s, 60 C 45 s. Fluorescenční signál byl odečítán během fáze 60 C po dobu 45 s. Tab. 1 Použité primerové páry primer nukleotidová sekvence (5 3 ) velikost produktu zdroj COI-F GAACTCTGCTCGGAGACGAC 134 bp Feligini et al. (2007) COI-R AGCACCAATTATTAGGGGAAC Lec181-F GACGCTATTGTGACCTCCTC 181 bp Wurz et al. (1999) Lec181-R TGTCAGGGGCATAGAAGGTG Lec69-F TGGGACAAAGAAACCGGTAG 69 bp tato práce Lec69-R GTCAGGGGCATAGAAGGTGA Lec118-F GTGACCTCCTCGGGAAAGTT 118 bp tato práce Lec118-R CGGTTTCTTTGTCCCAAATG HRM: Metoda High Resolution Melting (HRM) probíhala v přístroji StepOnePlus Real-Time PCR systems (Applied Biosystems, Carlsbad, USA) s použitím detekce MeltDoctor (Applied Biosystems, Carlsbad, USA) a s oligonukleotidovými sekvencemi, uvedenými v Tab. 1. Konečné koncentrace PCR komponentů byly následující: MeltDoctor 1x, primery 300 nm, celkový objem byl doplněn vodou pro PCR do 15 µl a bylo přidáno 5 µl roztoku DNA. Výsledky a diskuze Z testovaných vzorků mléčných výrobků či jejich alternativ s deklarovaným obsahem sóji byla extrahována DNA potřebné kvality a čistoty. Čistota se pohybovala v rozmezí 1,7 1,9 poměru absorbancí 260/280 nm. Koncentrace extrahované DNA dle spektrofotometrického stanovení odpovídala hodnotě cca 20 ng µl -1. CTAB metoda (Murray & Thompson 1980) se tedy ukázala jako metoda vhodná k extrakci DNA z vybraných matric. Pro ověření, že je extrahovaná DNA vhodná jako templát pro PCR, byly vzorky podrobeny reakci s primerovými páry COI (Feligini et al. 2007) a primerovými páry Lec181 (Wurz et al. 1999) metodou real-time PCR s použitím SYBR Green detekce. V případě použití primerů COI byl očekáván pozitivní signál u všech mléčných výrobku, v případě primerů Lec181 byl pozitivní signál očekáván u sóji a výrobků s deklarovaným obsahem sóji. Pro ověření specifičnosti signálu získaného real-time PCR se u jednotlivých vzorků sledovala rovněž teplota tání produktů (Ririe et al. 1996; Wittwer et al. 1997). Očekávaná teplota tání byla vypočítána s použitím programu Oligo Calc (Kibbe 2007). Pro výpočet teploty tání byly použity očekávané DNA sekvence PCR produktů po PCR se zde prezentovanými primery s vybranou referenční templátovou DNA dle databáze NCBI: v případě primerů COI - JX a v případě primerů Lec181; Lec69 a Lec118 - K (Tab 2). 112

113 Tab. 2 očekávané sekvence a očekávaná teplota tání jednotlivých produktů označení primeru očekávané sekvence (5 3 ) očekávaná teplota tání gaactctgctcggagacgaccaaatctacaacgtagttgtaac COI cgcacacgcatttgtaataatcttcttcatagtaataccaatcata 76,4 C attggaggattcggtaactgacttgttcccctaataattggtgct gacgctattgtgacctcctcgggaaagttacaactcaataagg ttgacgaaaacggcaccccaaaaccctcgtctcttggtcgcgc Lec181 cctctactccacccccatccacatttgggacaaagaaaccg gt 83,2 C agcgttgccagcttcgccgcttccttcaacttcaccttctatgcc cctgaca tgggacaaagaaaccggtagcgttgccagcttcgccgcttcct Lec69 tcaacttcaccttctatgcccctgac 77, 7 C gtgacctcctcgggaaagttacaactcaataaggttgacgaaa Lec118 acggcaccccaaaaccctcgtctcttggtcgcgccctctactcc 81,1 C acccccatccacatttgggacaaagaaaccg Pozitivní signál, tedy důkaz amplifikovatelné DNA, byl zaznamenán u všech vzorků, u nichž byl očekáván, přičemž specifický produkt reakcí s COI primery vykazovaly všechny analyzované vzorky (Tab. 3). Teploty tání a jednotlivé Ct hodnoty jsou uvedeny v Tab. 3. Negativní signál s COI primery byl pak zaznamenán u přiřazených negativních kontrol (konvenční kukuřice, konvenční sóji a negativní kontroly MasterMixu) S použitím primerů Lec181 byl zaznamenán pozitivní specifický signál pouze u vzorků A, B, C a u vzorku pozitivní kontroly konvenční sóji. Hodnoty teplot tání a Ct u jednotlivých vzorků jsou uvedeny v Tab. 4 Tab. 3 Průměrné hodnoty Ct a teplot tání u jednotlivých vzorků s použitím primerů COI Vzorek hodnota Ct SYBR teplota tání SYBR [ C] teplota tání HRM [ C] kukuřice sója A 28,61 76,0 76,1 B 35,15 76,1 76,1 C 20,43 75,7 76,0 D 20,75 75,5 75,9 E 21,17 75,2 76,1 F 22,06 76,3 76,0 G 20,65 76,2 76,0 H 21,18 76,0 76,0 I 27,64 75,4 75,2 J 21,05 75,7 75,9 K 27,65 75,2 75,5 L 23,61 76,5 76,1 M 24,66 76,2 76,0 CTRL NEG Tab. 4 Průměrné hodnoty Ct a teplot tání u jednotlivých vzorků s použitím primerů Lec 181 Vzorek hodnota Ct SYBR teplota tání SYBR [ C] kukuřice sója 23,98 83,2 A 23,20 83,1 B 27,47 82,9 C 37,14 82,8 113

114 D E F 36,91 84,0 G H I J K L M 37,22 80,8 CTRL NEG Dále byla stejným způsobem ověřena amplifikace extrahované DNA v reakci s primerovými páry navrženými v této práci - Lec69 pro amplifikaci 69 bp dlouhého fragmentu a Lec118 pro amplifikaci 118 bp dlouhého fragmentu DNA specifické pro sójový lektin. S použitím SYBR Green detekce vykazovaly primery Lec69 signál u vzorků konvenční sóji a vzorků A, B a C (Tab. 5). Primery Lec69 však poskytly pozitivní signál také u vzorků, u nichž nebyla přítomnost sóji očekávána (např. vzorku konvenční kukuřice) a ani nebyla potvrzena žádným z dalších použitých primerových párů (Lec181, Lec118). Tyto signály byly vyhodnoceny jako nespecifické. Tab. 5 Průměrné hodnoty Ct a teplot tání u jednotlivých vzorků s použitím primerů Lec69 Vzorek hodnota Ct SYBR teplota tání SYBR [ C] teplota tání HRM [ C] kukuřice 35,34 83,0 79,7 sója 22,90 79,0 79,7 A 22,37 79,1 79,7 B 26,43 79,0 79,6 C 36,57 78, D E 37,57 78, F G 36,08 78, H 36,81 87, I J K L 39,12 80, M 38,60 81, CTRL NEG S použitím primerů Lec118 byly získány pomocí SYBR Green detekce výsledky pozitivních signálů u vzorku konvenční sóji a dále u vzorků A, B a C (Tab. 6). Tab. 6 Průměrné hodnoty Ct a teplot tání jednotlivých vzorků s použitím primerů Lec118 Vzorek hodnota Ct SYBR teplota tání SYBR [ C] teplota tání HRM [ C] kukuřice sója 22,41 81,5 81,1 A 22,36 81,2 81,0 B 26,52 81,2 81,1 C 35,75 81, D E F G H I

115 J K L M 38,74 76, CTRL NEG Analyzované vzorky byly dále testovány metodou HRM a byly tak přesněji určeny teploty tání jednotlivých PCR produktů. S použitím COI primerů (Obr. 1) byly vzorky metodou HRM rozděleny do tří skupin, přičemž ve společné skupině skončily vzorky s označením I a K. Do druhé skupiny byly zařazeny zbývající vzorky s pozitivním signálem (Tab 3). Třetí skupinu tvořily negativní kontroly bez specifického signálu (konvenční kukuřice, konvenční sója a negativní kontrola MasterMixu). Obr. 1 Křivky teplot tání HRM s použitím COI primerů Metoda HRM s použitím primerů Lec69 (Obr. 2) potvrdila, že primery Lec69 nejsou pro tento typ testování vhodné. Primery Lec69 vykazovaly řadu nespecifických signálů (Tab 5). Obr. 2 Křivky teplot tání HRM s použitím Lec69 primerů 115

116 Metoda HRM s použitím primerů Lec118 (Obr. 3) rozdělila na základě teploty tání PCR produktů analyzované vzorky do dvou skupin. Do jedné skupiny byla zařazena konvenční sója společně se vzorky A a B, což byly vzorky s deklarovaným obsahem sóji. Do druhé skupiny byly pak zařazeny zbývající vzorky, které neposkytly v reakci pozitivní signál (Tab. 6). Obr. 3 Křivky teplot tání HRM s použitím Lec118 primerů Závěr V této práci byla představena metoda využívající High Resolution Melting (HRM) s použitím nově navržených primerových párů pro amplifikaci 118 bp dlouhého úseku genu pro sójový lektin. Metoda byla ověřena na reálných vzorcích mléčných výrobků či jejich alternativ a byla ověřena její vhodnost pro tento typ testování. Byla ověřena hodnota specifické teploty tání, která je v případě očekávaného produktu vzniklého použitím COI primerů 76,4 C (Tab. 2). U většiny testovaných vzorků byla zjištěna odpovídající teplota tání, naproti tomu u vzorků I a K byla zjištěna teplota v průměru 75,4 C, což by mohlo být způsobeno přítomností SNP (single nucleotide polymorphism) v cílové sekvenci. Takováto mutace by měla za následek změnu teploty tání specifického produktu a byla by detekovatelná metodou HRM. V případě primerů Lec181 vzniká specifický produkt s teplotou tání 83,2 C (Tab. 2), což odpovídá i získaným hodnotám z testování na reálných vzorcích v případech konvenční sóji a vzorků A, B a C. U vzorků F a M vznikl produkt, který svou teplotou tání neodpovídá očekávané hodnotě. Opět se tedy může jednat o výskyt případného SNP oproti očekávané sekvenci. Při použití primerů Lec69 neodpovídá ani jeden z testovaných vzorků očekávané hodnotě teploty tání specifického produktu (Tab. 5). Primery Lec118 naproti tomu vykázaly shodu s očekávanou hodnotou teploty tání a ukázaly se jako specifické a zcela vyhovující pro tento typ testování mléčných výrobků. Dedikace Tato práce byla podporována projekty MZe a NAZV QI101B

117 Použitá literatura 1. EN ISO (2005): Foodstuffs Methods of analysis for the detection of genetically modified organisms and derived products Nucleic acid extraction. ISO Copyright Office, Geneva. 2. Feligini M., Alim N., Bonizzi I., Enne G., Aleandri R. (2007): Detection of Cow Milk in Water Buffalo Cheese by SYBR Green Real-Time PCR: Sensitivity Test on Governing Liquid Samples. Pakistan Journal of Nutrition, 6 (1): Gryson N. (2010): Effect of food processing on plant DNA degradation and PCR-based GMO analysis: a review. Analytical and Bioanalytical Chemistry, 396 (6): Gryson N., Messens K., Dewettinck K. (2007): PCR detection of soy ingredients in bread. European Food Research and Technology, 227: Kibbe W. A. (2007): OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Research, 35: Mitsuhashi M. (1996): Technical Report: Part 2. Basic Requirements for Designing Optimal PCR Primers. Journal of Clinical Laboratory Analysis, 10: Murray H. G., Thompson W. F. (1980): Rapid isolation of high molecular weight DNA. Nucleic Acids Research Journal, 8: Ririe K. M., Rasmussen R. P., Wittwer C. T. (1996): Product Differentation by Analysis of DNA Melting Curves during the Polymerase Chain Reaction. Analytical Biochemistry, 254: Savage, J., Kaeding, A., Matsui, E., Wood, R. (2009): The Natural History of Soy Allergy. Journal of Allergy and Clinical Immunology, 123 (2): SZPI (2009): Podvody v oblasti potravin, dostupné z: 11. <http://www.szpi.gov.cz/docdetail.aspx?docid= &doctype=art&nid=11342 > 12. Untergasser A., Nijveen H., Rao X., Bisseling T., Geurts R., Leunissen J.A.M. (2007): Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Research, 35: W71 W Vyhláška č. 113/2005 Sb. ze dne , o způsobu označování potravin a tabákových výrobků. In Sbírka zákonů České republiky Částka 37/ Vyhláška č. 77/2003 Sb. ze dne , kterou se stanoví požadavky pro mléko a mléčné výrobky, mražené krémy a jedlé tuky a oleje. In Sbírka zákonů České republiky Částka 32/ Wittwer C. T. (2009): High-Resolution DNA Melting Analysis: Advancements and Limitations. Human Mutation, 30 (6): Wittwer C. T., Herrmann M. G., Moss A. A., Rasmussen R. P. (1997): Continuous fluorescence monitoring of rapid cycle DNA amplification. Biotechniques, 22 (1): Wurz A., Bluth A., Zeltz P., Pfeifer C., Willmund R. (1999): Quantitative analysis of genetically modified organisms (GMO) in processed food by PCR-based methods. Food Control 10:

118 VYUŽITIE ITS OBLASTI A 16S rdna GÉNU PRI IDENTIFIKÁCII BAKTÉRIÍ Z HROZNOVÝCH BOBÚĽ A Z MUŠTU Detection of bacteria in grape and must using ITS region and 16S rdna gene. Godálová Z. 1, Sallay B. 2, Brežná B. 1, Siekel P. 1 1 Výskumný ústav potravinársky, Bratislava 2 Univerzita Komenského, Prírodovedecká fakulta, Bratislava Kontaktná adresa 1.autora: Mgr. Zuzana Godálová, Priemyselná 4, Bratislava 26, Abstrakt Mikroorganizmy (kvasinky, baktérie a huby) sa prirodzene vyskytujú vo víne a ovplyvňujú jeho charakter ako napr. znižujú kyslosť vína, určujú vôňu a chuť. Cieľom našej práce bolo vytvoriť spoľahlivý systém, ktorý rýchlo a efektívne deteguje baktérie v bobuliach a v mušte, bez kultivačnej analýzy. Na detekciu sme si zvolili medzerníkovú oblasť (ITS) medzi génmi pre 16S rrna - 23S rrna a časť génu 16S rdna. Pomocou klonovania a sekvenovania ITS oblasti medzi 16S rdna - 23S rdna sme na povrchu bobúľ detegovali octové baktérie rodu Gluconobacter a zástupcov z čeľade Enterobacteriaceae. V mušte bol výskyt druhov oveľa rôznorodejší a okrem Gluconobacter a Enterobacteriaceae boli prítomné rody Lauconostoc, Pseudomonas, a Exiguobacterium sp. Ako alternatívnu metódu sme si zvolili detekciu prostredníctvom génu 16S rdna. Abstract Microorganisms (various yeasts, bacteria, fungal) are closely associated with the production of wines, for example bacteria are part of the natural microbial ecosystem of wine. They are reducing wine acidity and contributing to aroma and flavour. Our goal was to develop the culture - independent method for the detection of bacteria in grape and must. We used universal bacterial primers to detect ITS (internal transcribed spacer) between 16S rrna - 23S rrna genes or the 16S rdna gene. The use of ITS region 16S rdna - 23S rdna led to detection on the surface of grape of acetic acid bacteria Gluconobacter sp. and family Enterobacteriaceae. In must the diversity of the detected bacteria was higher. Apart from Gluconobacter and Enterobacteriaceae, the genera Lauconostoc, Pseudomonas, and Exiguobacterium were present. As an alternative method we used 16S rdna detection. Úvod Kvalitu vína do veľkej miery ovplyvňujú mikroorganizmy, ktoré sa do vína dostávajú už na stanovisku (vinohrad) a časť prenikne aj pri výrobe zo strojov (Pavloušek, 2010). Úlohou mikroorganizmov vo víne je premieňať cukor na alkohol- kvasinky (rod Saccharomyces, Candida, Hanseniaspora, Torulaspora, Pichia, Issatchenkia, Metschnikowia) alebo redukovať kyseliny, určovať vínu vôňu a chuť- baktérie (rod Lactococcus, 118

119 Lactobacillus, Acetobacter, Gluconobacter, Pediococcus). V prípade vláknitých húb ide hlavne o negatívny prejav na kvalite vína (napr. rod Rhizopus, Aspergilus, Penicillium) (Bartowsky, 2009; Gȍ rner, Valík, 2004; Chovanová a kol., 2011; Zott a kol., 2010; Kraková a kol., 2012; Pavloušek, 2010; Lopez a kol., 2003). Mliečne baktérie (Laxtobacillus sp., Pediococcus sp., Leuconostoc sp.) vo víne zohrávajú významnú funkciu pri jablčno-mliečnom kvasení, kde dochádza k vzniku kyseliny mliečnej a oxidu uhličitého z kyseliny jablčnej a tým sa zlepšujú chuťové vlastnosti vína (Renouf a kol., 2007; Bartowsky, 2009). Rozdeľujú sa na hemofermentatívne (Pediococcus), premieňajúce glukózu/fruktózu na kyselinu mliečnu, a heteromentatívne, ktoré okrem kyseliny mliečnej tvoria aj ďalšie produkty ako kyselinu octovú, etanol a oxid uhličitý (Pavloušek, 2010). Maslové tóny sú vyvolané produkciou diacetylu (2,3-butandion), ktorý vzniká pri jablčno-mliečnej fermetácií. Vyššia koncentrácia diacetylu 5-7 mg/l negatívne vplýva na senzorickú kvalitu vína. Rod Pediococcus v primeranom množstve sa podieľa na jablčno-mliečnej fermentácii, avšak pri väčšom počte môže produkovať acetoín, ktorý sa premieňa na neželaný diacetyl (Bartowsky, 2009; Delaherche a kol., 2004). Mliečne baktérie v niektorých prípadoch (vysoké ph, zbytkový cukor, vysoká teplota pri kvasení, oxidácia, nízky obsah kyselín) môžu spôsobiť chorobu vína myšinu, ktorá znehodnocuje víno po chuťovej aj aromatickej stránke a je neodstrániteľná (Pavloušek, 2010). Octové baktérie (Acetobacter sp., Gluconobacter sp.) vo víne majú skôr negatívny dopad. Produkujú kyselinu octovú, acetaldehyd a etylacetát, čo má negatívny dopad na celkovú senzoriku vína a za prístupu vzduchu vzniká choroba vína - octovatie, sprevádzaná nepríjemnou octovou chuťou (Bartowsky, 2009). Materiál a Metódy Pracovali sme s odrodou hrozna Veltlín zelený (Stredná odborná škola vinársko-ovocinárska v Modre), pozostávajúcou z výluhu hroznových bobúľ a čerstvo lisovaného muštu. Nekultivačná metóda Zmesná DNA z bobúľ a muštu bola extrahovaná pomocou kitu DNeasy tissue kit (Qiagen, Hieden, Nemecko), v prípade vzorky muštu sme pred extrakciou mušt prefiltrovali cez filter o veľkosti pórov 6 µm (Membrane filter, Advantec), aby sme odseparovali neželané produkty ako kal, časti hrozna a kvasinky. Identifikácia baktérii pomocou ITS oblasti Z extrahovanej DNA bola pomocou polymerázovej reťazovej reakcie (PCR) naaplifikovaná medzerníková oblasť (internal transcribed spacer, ITS) medzi génmi 16S rdna a 23S rdna. Reakcia prebiehala v objeme 50 µl a obsahovala 1x Cheetah reakčný pufor (Biotium, Hayward, CA, USA), 4 mmol.l -1 MgCl 2 (Biotium), 0.2 mmol.l -1 dntp, 500 nmol.l -1 primerov (G17/ 5 gtgaagtcgtaacaagg 3, G+-R/ 5 cgtccttcatcgsct), 2 U Cheetah Hot Star Taq DNA polymerázu (Biotium) a 1.5 µl.dna. PCR bola uskutočnená v cykléri AB Veriti 96 (Applied Biosystems, Foster City, Kalifornia, USA) s teplotným programom: úvodná denaturácia 95 C 5 min., 35 cyklov: denaturácia 94 C 1 min., anelácia 50 C 30 s., polymerizácia 72 C 1 min. a záverečná polymerizácia 72 C 5 min. Vizualizácia získaných fragmenov bola uskutočnená pomocou eketroforézy v agarózovom géli (2 %, GelRed farbička) (obr. 1) alebo pomocou kapilárnej elektroforézy na prístroji QIAxcel (Qiagen). Najvýraznejšie amlikóny boli z agarózového gélu vyrezané a prečistené QIAquick Gel Extraction kit (Qiagen). Takto pripravené fragmenty sme klonovali prostredníctvom PCR Cloning kitu (Qiagen) do vektora pdrive Cloning vector a transformovali do kompetentných buniek E.coli DH5alfa pripravených pomocou roztoku CaCl 2 (Sambrook a kol., 2001). Na základe konštruktu vektora sme zvolili pozitívnu selekciu klonov na prítomnosť kanamycínovej rezistencie a neutrálnu selekciu pre prítomný lac Z gén (kódujúci β-galaktozidázu). Biele kolónie 119

120 (baktérie s inzertom) sme preočkovali na LB pôdu s kanamycínom (100 μg/μl) a po narastení kolónií sme overovali prítomnosť vnesenej DNA prostredníctvom polymerázovej reťazovej reakcie (PCR) orientovanej na pdrive vector v objeme 20 µl: 1x Cheetah reakčný pufor (Biotium), 2.25 mmol.l -1 MgCl 2 (Biotium), 0.2 mmol.l -1 dntp, 500 nmol.l -1 primerov (M13F40 5 gttttcccagtcacgac 3, M13R 5 aacagctatgaccatg 3 ), 2 U Cheetah Hot Star Taq DNA polymerázu (Biotium) a odpichnutá kolónia. Reakcia sa uskutočnila na cykléri AB Veriti 96 (Applied Biosystems) v teplotnom programe: úvodná denaturácia 95 C 5 min., 35 cyklov: denaturácia 94 C 2 min., anelácia 58 C 30 s., polymerizácia 72 C 1 min. a záverečná polymerizácia 72 C 5 min. PCR reakčnú zmes sme prečistili QIAquick PCR Purification kit (Qiagen) a dali sekvenovať. Získané sekvencie sme vyhodnotili prostredníctvom databázy BLAST (Basic Local Alignment Search Tool). 500 bp Gluconobacter sp. Klebsiella sp. Enterobacter sp. 200 bp Obr. 1 Profil ITS (internal transcribed spacer) oblasti v bobuliach Identifikácia baktérii pomocou génu 16S rdna Z extrahovanej zmesnej DNA bola pomocou polymerázovej reťazovej reakcie (PCR) naaplifikovaná oblasť génu 16S rdna, v objeme 50 µl. Reakčná zmes obsahovala tieto zložky: 1x Cheetah reakčný pufor (Biotium), 4 mmol.l-1 MgCl 2 (Biotium), 0.2 mmol.l -1 dntp, 500 nmol.l -1 primerov (341F 5 cctacgggaggcagcag 3, 985R 5 gtaaggttcttcgcgtt 3 ), 2 U Cheetah Hot Star Taq DNA polymerázu (Biotium), objem DNA 1.5 µl. PCR bola uskutočnená v cykléri AB Veriti 96 (Applied Biosystems) s teplotným programom: úvodná denaturácia 95 C 5 min., 35 cyklov: denaturácia 94 C 1 min., anelácia 56 C 30 s., polymerizácia 72 C 1 min. a záverečná polymerizácia 72 C 5 min.). Vizualizácia získaného fragmentu bola uskutočnená pomocou elektroforézy v agarózovom géli (2 %, GelRed farbička). Získaný amplikón bol z agarózového gélu vyrezaný a prečistený pomocou QIAquick Gel Extraction kitu (Qiagen). Takto pripravený fragment sme klonovali prostredníctvom PCR Cloning kitu (Qiagen) do vektora pdrive Cloning vector a transformovali do kompetentných buniek E.coli DH5alfa pripravených pomocou roztoku CaCl 2 (Sambrook a kol., 2001). Na základe konštruktu vektora sme zvolili pozitívnu selekciu klonov na prítomnosť kanamycínovej rezistencie a neutrálnu selekciu, pre prítomný lac Z gén. Biele kolónie (baktérie s inzertom) sme preočkovali na LB pôdu s kanamycínom (100 μg/μl) a po narastení kolónií sme overovali prítomnosť vnesenej DNA prostredníctvom polymerázovej reťazovej reakcie (PCR) orientovanej na pdrive vector v objeme 20 µl: 1x Cheetah reakčný pufor (Biotium), 2.25 mmol.l -1 MgCl2 (Biotium), 0.2 mmol.l -1 dntp, 500 nmol.l-1 primerov (M13F40 5 gttttcccagtcacgac 3, M13R 5 aacagctatgaccatg 3 ), 2 U Cheetah Hot Star Taq DNA polymerázu (Biotium), na cykléri AB Veriti 96 (Applied Biosystems) v teplotnom programe: úvodná denaturácia 95 C 5 min., 35 cyklov: denaturácia 94 C 2 min., anelácia 58 C 30 s., polymerizácia 72 C 1 min. a záverečná polymerizácia 72 C 5 min. PCR reakčnú 120

121 zmes sme prečistili QIAquick PCR Purification kit (Qiagen) a dali sekvenovať. Získané sekvencie sme vyhodnotili prostredníctvom databázy BLAST (Basic Local Alignment Search Tool). Výsledky a diskusia Cieľom našej práce bolo vytvoriť spoľahlivý systém, ktorý rýchlo a efektívne deteguje baktérie v bobuliach a v mušte, bez kultivačnej analýzy. V prvom rade bolo potrebné získať kvalitnú vyizolovanú zmesnú DNA. Použili sme extrakčný DNeasy tissue kit (Qiagen). V prípade muštu sme pred extrakciou mušt prefiltrovali cez filter o veľkosti pórov 6 µm (Membrane filter, Advantec). Tento postup nám umožnil eliminovať prípadné inhibítory PCR a konkurenčné kvasinky. Z extrahovanej DNA bola pomocou polymerázovej reťazovej reakcie (PCR) naaplifikovaná medzerníková oblasť (internal transcribed spacer, ITS) medzi génmi 16S rdna a 23S rdna. Pri tejto metóde sa využíva polymorfizmus dĺžky ITS amplikónov na prvotné orientačné odlíšenie rôznych druhov (Obr. 1). Získané sekvencie sme vyhodnotili v databáze BLAST (Basic Local Alignment Search Tool) (Tab. 1). Pri niektorých sme nezískali 100 % zhodu, pretože dané sekvencie sa v databáze ešte nenachádzajú. V bobuliach prevažovali octové baktérie rodu Gluconobacter sp. Okrem toho boli pozorované klony so sekvenciou na % zhodnou s rôznymi zástupcami čeľade Enterobacteriaceae, podobné rodom Klebsiella, Salmonella a Enterobacter (Tab. 1). Niektoré Enterobacteriaceae negatívne ovplyvňujú senzorické vlastnosti potravín a nápojov, v horšom prípade môžu byť patogénne, na základe našich dát však nie je možné presné určenie druhov ani ich vplyvu na vlastnosti vína. V mušte bol výskyt druhov oveľa rôznorodejší ako než na povrchu bobúľ. Zaznamenali sme napríklad prítomnosť gram pozitívnych baktérií, napr. klon s 99% zhodou voči Leuconostoc pseudomesenteroides, aj gram negatívnych baktérií, napr Pseudomonas syringae (99 % zhoda) a Gluconobacter cerinus (98 % zhoda) (Tab. 1). Leuconostoc sú baktérie mliečneho kvasenia, kým zástupcovia Gluconobacter patria medzi octové baktérie, pričom oba rody prispievajú ku kyslej chuti vína. Pseudomonas syringae je rastlinný patogén. Dve sekvencie vykazovali podobnosť s Enterobacteriaceae. Na základe nízkej zhody sekvencií s databázou (89%, 93%) opäť nie je možné určenie druhov ani ich vplyv na kvalitu vína, možno sa len vyjadriť k druhom na ktoré sa tieto klony najviac podobajú: Erwinia amylowora je rastlinný patogén, kým Klebsiella oxytoca je rastlinný endofyt a oportunistický ľuský patogén. Medzi klonmi z muštu sme detegovali aj sekvencie podobné bakteriálnym rodom, ktoré sa bežne vo víne nenachádzajú (Enterococcus, Haemophillus) a pri veľkom výskyte by mohli negatívne ovplyvniť kvalitu vína. Prekvapivým nálezom bola prítomnosť gram pozitívnej baktérie s 99% identitou voči Exiguobacterium sibiricum, ktorá sa bežne vyskytuje v oblasti Ruska / Sibíru a rastie pri teplote okolo -20 C (Vishnivetskaya a kol., 2009). Výskyt klonov s relatívne nízkou podobnosťou sekvencií oproti databázam DNA nás viedol k dvom možným záverom. Buď značná časť našich klonov skutočne pochádza z dosiaľ neznámych organizmov, alebo u mnohých známych druhov neboli osekvenované ITS medzerníkové oblasti a preto nie sú k dispozícii v databázach. Pre posúdenie situácie sme sa rozhodli použiť alternatívnu metódu založenú na analýze 16S rdna, pre ktorú bolo publikovaných viac sekvencií. V tomto prípade sme zachytili rôznorodé spoločenstvá baktérii z čeľade Enterobacteriaceae a Rhizobiaceae a boli prítomné dokonca aj Sinice (Cyanobacteria). 121

122 Tabuľka č.1 Identifikácia baktérii prostredníctvom ITS oblasti Vzorka Veltlín zelený Bobule Mušt Zhoda % pre amplikón bez primerov a s úpravou mnohoznačných báz Gluconobacter kondonii (99 %) Gluconobacter cerinus (99 %) Klebsiella pneumoniae (81 %) Salmonella enterica (80 %) Klebsiella pneumoniae (81 %) Salmonella enterica (80 %) Enterobacter fergusonii (84%) Salmonella enterica (84%) Enterobacter asburiae (87 %) Salmonella enterica (87 %) Gluconobacter cerinus (98 %) Pseudomonas syringae (99 %) Pseudomonas syringae (99 %) Leuconostoc pseudomesenteroides (99 %) Haemophilus ducreyi (83 %) Erwinia amylovora (89 %) Pantoea stewartii (88 %) Klebsiella oxytoca (93 %) Pantoea sp. (87 %) Clostridium sp. (86 %) Enterococcus silesiacus ( 93%) Exiguobacterium sibiricum (99 %) Veľkosť amplikónu (bp) 762 bp 595 bp 594 bp 450 bp 434 bp 762 bp 628 bp 452 bp 575 bp 456 bp 452 bp 353 bp 247 bp Použitá literatura 1. Bartowsky, E.J. Bacterial spoilage of wine and approaches to minimize it. Letters in Applied Microbiology. 2009, vol. 48, p Delaherche, A., Claisse, O., Lonvaud-Funel, A. Detection and quantification of Brettanomyces bruxellensis and 'ropy' Pediococcus damnosus strains in wine by realtime polymerase chain reaction. Journal of Applied Microbiology. 2004, vol. 97, p Görner, F., Valík, Ľ. Aplikovaná mikrobilógia poživatín. Malé centrum. 2004, ISBN , s Chovanová, K., Kraková, L., Ženišová, K., Turcovská, V., Brežná, B., Kuchta, T., Pangallo, D. Selection and identification of autochthonous yeasts in Slovakian wine samples using a rapid and reliable three-step approach. Letters in Applied Microbilogy. 2011, vol. 53, p Kraková, L., Chovanová, K., Ženišová, K., Turcovská, V., Brežná, B., Kuchta, T., Pangallo, D. Yeast diversity investigation of wine-related samples from two different Slovakian wine-producing areas through a multistep procedure. Food Science and Technology. 2012, vol. 46, p Lopez, I., Ruiz-Larrea, F., Cocolin, L., Orr, E., Phister, T., Marshall, M., VanderGheysnt, J., Mills, D.A. Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel 122

123 Electrophoresis. Applied and Environmental Microbiology. 2003, vol. 69, p Pavloušek. Výroby vína u malovinařů. Grada. 2010, ISBN , s Renouf, V., Claisse, O., Lonvaud-Funel, A. Inventory and monitoring of wine microbial consortia. Appl. Microbiol Biotechnol. 2007, vol. 75, p Sambrook, J., Russell, D.W., Molecular cloning a laboratory manual third. 2001, Vishnivetskaya, T.A., Kathariou, S., Tiedje, J.M. The Exiguobacterium genus: biodiversity and biogeography. Extremophiles. 2009, vol. 13, p Zott, K., Claisse, O., Lucas, P., Coulon, J., Lonvaud-Funel, A., Masneuf-Pomarede, I. Characterization of the yeast ecosystem in grape must and wine using real-time PCR. Food Microbiology. 2010, vol. 27, p

124 HODNOCENÍ ZMĚN GENOVÉ EXPRESE VYBRANÝCH ODRŮD JEČMENE STRESOVANÝCH SUCHEM S VYUŽITÍM DNA ČIPŮ Gene expression changes evaluation of selected barley varieties under drought stress using DNA microarrays 1 Svoboda P., 2 Spiwok V., 1 Jánská A., 1 Hodek J., 1 Ovesná J., 1 Prášil I. 1 Výzkumný ústav rostlinné výroby, v.v.i. 2 Vysoká škola chemicko technologická v Praze Kontaktní adresa I. autora: Ing. Pavel Svoboda, Výzkumný ústav rostlinné výroby, v.v.i., Oddělení molekulární biologie Drnovská 507, , Praha 6 Ruzyně, Abstrakt Práce měla za cíl zhodnocení změn genové exprese u dvou vybraných odrůd ječmene (Amulet a Tadmor) v odezvě na stres suchem. RNA izolovaná ze dvou rostlinných pletiv (listy a uzle) byla pro účely měření hybridizována na Affymetrix 22 K Barley1 GeneChip Genome Array. Celkem byla sledována exprese genů. Analýza genů se změněnou hladinou exprese ukázala rozdílnou reakci na stres jak v rámci testovaných odrůd, tak i rostlinných pletiv. Byly nalezeny geny společné všem variantám a stejně tak i geny odrůdově nebo orgánově specifické. Klíčová slova DNA čipy, sucho, ječmen, Tadmor, Amulet, listy, uzle Abstract The aim of this work was to evaluate changes in gene expression of two selected barley varieties in drought stress response. For this purpose, RNA was isolated from two plant tissues (leaves and crowns) and hybridized on Affymetrix 22 K Barley1 GeneChip Genome Array. Expression of genes was monitored. Analyses of genes with changes in expression level showed differences in the stress response for both tested varieties as well as for both plant tissues. Shared genes as well as genes with variety and tissue specifity were found. Key words DNA microarrays, drought, barley, Tadmor, Amulet, leaves, crowns 124

125 Úvod Abiotické stresy jsou primární příčinou celosvětových ztrát rostlinné produkce, redukující výnos většiny hlavních plodin z více než 50 % (Bray et al., 2000). Zároveň představují významnou překážku v rozšíření pěstování zemědělských plodin do celé řady oblastí (Blum, 1985). Ze všech abiotických stresů je sucho považováno za nejzávažnější (Seki et al., 2002). Je to dáno významem vody pro růst a vývoj rostlin, podílem aridních a semiaridních oblastí (tvoří přibližně 40 % zemského povrchu)(verón et al., 2006) a také narůstajícím počtem ploch postižených zasolením půd. Vysoká koncentrace solí v těchto půdách snižuje osmotický potenciál půdního roztoku a vytváří tak vodní stres pro rostliny (Sairam a Thiagi, 2004). Podíl těchto půd neustále narůstá a předpokládá se, že v příštích 40 letech dosáhne až 50% (Wang et al., 2003). Vlivem těchto skutečností a předpokládané aridizace klimatu v následujících letech lze očekávat, že dopad tohoto stresoru na rostlinnou produkci nadále poroste. Pro zajištění potravinové bezpečnosti při očekávaném nárůstu lidské populace, bude třeba vyvinout odrůdy tolerantní k abiotickým stresům a zejména k suchu. Ječmen je modelovým organismem pro genetické a fyziologické studie, vykazující širokou adaptibilitu k podmínkám prostředí (Nevo, 1992). Co do sklizňové plochy se jedná o 4. nejpěstovanější světovou obilninu (http://faostat.fao.org/site/567/default.aspx#ancor, 2012) se značným významem pro živočišnou výrobu, sladovnický a potravinářský průmysl. Je pěstován v mnoha rozvojových zemích, kde je často vystaven extrémnímu suchu, které významně ovlivňuje jeho produkci (Ceccarelli, 1994). Objasnění mechanismů tolerance k suchu u ječmene by mohlo pomoci k lepšímu porozumění genetických základů adaptability rostlin na tento stres a tak umožnit efektivnější využití genetických a genomických přístupů ke zlepšení tolerance k suchu (Guo et al., 2009). Jednou z možných cest k objasnění těchto mechanismů je expresní profilování s využitím DNA čipů. DNA čipy využívají od stovek do stovek tisíců fluorescenčně značených DNA sond k detekování molekul DNA nebo RNA. Jedná se o tzv. high-throughput (vysokopacitní) metodu, která umožňuje paralelní analýzu expresních změn tisíců genů. Zároveň lze touto technikou porovnat expresní diference genů při různých experimentálních podmínkách a v odlišných rostlinných pletivech (Jaypal a Mendelez, 2006). DNA čipy nalézají široké uplatnění v monitorování expresních změn stresovaných rostlin (Kawasaki et al., 2001; Seki et al., 2001; Thim et al., 2001; Kawaura et al, 2006; Ding et al., 2009). Bylo vydáno několik vědeckých publikací zaměřených na využití DNA čipů při studiu expresních změn ječmene stresovaného suchem (Ozturk et al., 2002; Talamè et al., 2006; Guo et al., 2009). Žádná z těchto prací však nehodnotila současně vliv genotypu a rostlinného pletiva na expresní profily, čímž postrádaly jistou míru komplexnosti. Materiál a Metody Rostlinný materiál a podmínky experimentu Jako rostlinný materiál byly použity 2 odrůdy jarního ječmene (Hordeum vulgare L.) s rozdílnou mírou tolerance k suchu. Syrská krajová odrůda Tadmor byla vybrána jako zástupce tolerantních genotypů ječmene. Kontrastem k ní byla k suchu citlivější odrůda Amulet. Předklíčené rostliny ječmene byly umístěny do klimatizovaného boxu s teplotním režimem 25 C ve dne a 20 C v noci, při fotoperiodě odpovídající 14 hodinám světla (intenzita osvětlení 350µmol.m -2.s -1 ) a 10 hodinám tmy. Pro každou odrůdu byly založeny 2 varianty. Obě tyto varianty byly zpočátku zavlažovány shodně. Ve fázi plně rozvinutého druhého listu byl na jednu z nich aplikován 9 denní vodní stres. Po 9 dnech následoval odběr vzorků, zvlášť z listové části a odnožovacího uzle, jak u kontrolní, tak i stresované varianty. 125

126 V další fázi byly vzorky rychle zmraženy v tekutém dusíku a dále skladovány při -80 C až do samotné izolace RNA. Expresní profilování Pro izolaci byl použit TRIZOL reagent (Invitrogen, CA, USA). RNA byla následně přečištěna pomocí izolační kolonky (RNeasy column) v přítomnosti DNázy (Qiagen, Hilden, Německo). Kvalita RNA byla stanovena jak gelovou elektroforézou, tak i pomoci bioanalyzátoru Agilent Každý vzorek byl reprezentován třemi biologickými opakováními. Všechny vzorky RNA byly hybridizovány na Affymetrix 22 K Barley1 GeneChip Genome Array (Close et al., 2004). Kvalita hybridizace byla ověřena pomocí standartních kontrol dodaných výrobcem. Ke každému hybridizačnímu komplexu byly přidány B2 oligonucleotidy. PolyA kontroly (lys, phe, thr, dap) a hybridizační kontroly (BioB, BioC, BioD a Cre) byly použity k monitoringu značení a hybridizace. K vyhodnocování dat byl použit volně dostupný software R a přidružené knihovny funkcí. Hrubá data z čipů byla v první fázi podrobena předběžné kontrole dat prostřednictvím funkcí z knihovny Affy (Methods for Affymetrix Oligonucleotide Arrays)(Irizzari et al., 2006). Jmenovitě šlo o boxové diagramy (box plot), diagramy hustot normálního rozdělení (density plot) a modifikaci Bland-Altmanova diagramu (MVA plot). Data byla následně normalizována aplikováním RMA (Robust Multi-array Average method)(irizzari et al., 2003) z téže knihovny. Již normalizované hodnoty intenzit byly poté znovu ověřeny funkcemi použitými v prvotní analýze. Pouze čipy splňující přípustná kritéria dle daných funkcí, byly použity k dalšímu hodnocení. K identifikaci rozdílně exprimovaných genů byla použita knihovna limma (Linear Models for Microarray Data)(Smyth, 2005). Tímto modelem byly jednotlivé varianty porovnány systémem každá s každou, čímž se získaly hodnoty expresí a zároveň byly určeny geny vykazující nárůst nebo pokles ve své aktivitě. Expresní diference byla považována za signifikantní, pokud její p hodnota nepřekročila Pro účely komplexní analýzy byla data z jednotlivých porovnání sloučena. Tím se pro každý gen a variantu získala jedna hodnota exprese. Tyto hodnoty byly podrobeny analýze hlavních komponent z knihovny amap (Another Multidimensional Analysis Package)(Lucas, 2010). Informace o funkcích rozdílně exprimovaných genů byly získány z webových stránek Affymetrixu a vyhledáváním na Výsledky a Diskuse Z analýzy hlavních komponent (Obr. 1) je patrné, že rozdíl mezi sledovanými variantami byl znatelnější než diference mezi biologickými replikáty. Analýza také jasně deklaruje, že na expresní profily mají vliv nejen zkoumané odrůdy a aplikovaný stres, ale zejména také typ rostlinného pletiva. Jak vyplývá z Obr. č. 2, počet genů s rozdílnou expresí odrůdy Amulet je vyšší než u odrůdy Tadmor, s výraznějším rozdílem v uzlovém pletivu. Pro obě odrůdy však platí, Obr. 1: Porovnání všech sledovaných variant mezi sebou. že v listech převažuje počet genů se zvýšenou expresí nad geny se sníženou expresí, zatímco Tad Tadmor, Amu-Amulet, D-stres, K-kontrola, L-list, U-uzel u uzlů je tomu naopak. 126

127 počet genů počet genů Co však není společné oběma sledovaným genotypům, je poměr genů se změněnou expresí mezi zkoumanými rostlinnými pletivy. V případě odrůdy Amulet je počet genů exprimovaných v uzlech vyšší než v listech Obr. 2: Počty diferenciálně exprimovaných genů při porovnání kontrolních a stresovaných variant jednotlivých odrůd v listovém pletivu a v odnožovacích uzlech AMULET list geny se zvýšenou expresí 952 TADMOR list uzel list uzel geny se zvýšenou expresí geny se sníženou expresí pozornost při studiu mechanismů adaptace k suchu. uzel geny se sníženou expresí Obr. 3: Počty diferenciálně exprimovaných genů při srovnání stresovaných variant jednotlivých odrůd v listovém pletivu a v odnožovacích uzlech U Tadmoru platí obrácený vztah. Kontrast mezi zkoumanými rostlinnými pletivy je ještě znatelnější, porovnáme-li stresované varianty jednotlivých odrůd mezi sebou (viz. Obr. 3). Počet diferenciálně exprimovaných genů (DEG) v uzlové části je potom téměř o 1/3 vyšší než v části listové. Tato skutečnost naznačuje, že tento rostlinný orgán má patrně značný význam pro toleranci k suchu a měla by mu být věnována zvýšená Ve všech sledovaných variantách vykazovaly nejvyšší expresi geny ze skupiny dehydrinů (viz Tabulka 1). Tyto proteiny se v rostlinách akumulují jako ohlas na prostředí s dehydratačními účinky jako je sucho, nízká teplota, zasolení nebo při zrání semen (Dokoupilová et al., 2004). Zvýšená exprese těchto proteinů je v souladu s dříve publikovanými studiemi (Tommasini et al., 2008; Choi et al., 1999). V případě odrůdy Tadmor však dehydriny dosahovaly vyšších expresních hladin v listech nežli v uzlech, zatímco odrůda Amulet se v tomto ohledu mezi jednotlivými pletivy téměř neměnila. Další hojně zastoupenou skupinou jsou proteiny indukované kyselinou abscisovou. Nalezli jsme je ve všech odrůdách a pletivech, avšak vyšší míry exprese i vyššího počtu těchto proteinů dosahoval Amulet. I tyto proteiny vykazovaly zvýšenou expresi. To potvrzuje práce Gua et al. (2009), který zkoumal vliv sucha na různé genotypy ječmene a u všech sledovaných variet zaznamenal nárůst v expresi proteinů indukovaných kyselinou abscisovou. Pouze v listové části obou sledovaných genotypů se exprimovali zástupci skupiny akvaporínů. Jedná se o integrální proteiny, které zprostředkovávají transport vody a molekul s nízkou molekulovou hmotností přes membránu (Tyerman et al. 2002). Snížená aktivita těchto proteinů je patrně zapříčiněna snahou rostliny zabránit ztrátám vody z buňek. Tuto hypotézu částečně potvrzuje práce Katsuhary et al. (2003), kteří zjistili, že transgenní rostliny rýže se zvýšenou expresí akvaporínů byly citlivější ke strestu zasolením. Dalšími specifitami listových variant byli β-glukosidáza a Δ1-pyrolin-5- karboxylát syntetáza. Zvýšená aktivita těchto genů v listech ječmene po stresu suchem byla pozorována Guem et al. (2009), Ozturkem et al. (2002) a dalšími. Na prokazatelný vliv Δ1- pyrolin-5- karboxylát syntetázy na odolnost k vodnímu stresu poukazují Zu et al. (1998), kteří popsali zvýšenou odolnost transgenní rýže vůči suchu a zasolení při stresem indukované zvýšené expresi tohoto proteinu. Podobný efekt sledovali Vendruscolo et al. (2007) u 127

128 transgenní pšenice. Choudhary et al. (2005) studovali vliv sucha na dva odlišně citlivé kultivary rýže a zaznamenali nárůst tohoto proteinu, jak v tolerantní, tak i v citlivé odrůdě. Zároveň detekovali vyšší úroveň proteinu v tolerantnějším genotypu. To se v tomto experimentu potvrdilo. Záležitostí výlučně odnožovacích uzlů byl inhibitor trypsinu, který v případě obou odrůd vykazoval sníženou aktivitu. Specifickými geny pro odrůdu Amulet byli zejména peroxidázy. Pokles aktivity těchto enzymů v citlivé odrůdě po aplikování vodního stresu je v souladu s prací Acara et al. (2001), kteří hodnotili aktivitu peroxidázy a dalších enzymů u tří genotypů ječmene s rozdílnou mírou tolerance k suchu. Tito autoři zaznamenali sníženou aktivitu peroxidázy u náchylnější odrůdy po 6 dnech sucha. Ke změně docházelo i u tolerantních odrůd, ale po 12 dnech sucha se u jedné z nich vrátila hladina tohoto enzymu na hodnotu před aplikováním stresu. Dalšími geny se zvýšenou aktivitou byly proteiny indukované jasmonáty, Hsp70 a gen označovaný photosystem II 10K protein precursor. Změny expresních hladin těchto genů potvrzuje práce Ozturka et al. (2002). Autoři však aplikovali podstatně kratší intervaly vodního stresu, v důsledku čehož jsou jimi naměřené hodnoty expresí na podstatně nižší úrovni. Z genů zaznamenaných pouze v Tadmoru se ve zvýšené míře exprimoval thionin a E1-α podjednotka pyruvát dehydrogenázy, zatímco aktivita oxalát-oxidázy poklesla. Mezi DEG s nejvyšší zaznamenanou aktivitou se také vyskytovali zástupci ze skupiny kináz, nukleáz, oxidáz, hydroláz a dalších skupin. Rovněž se exprimovala celá řada putativních a neznámých proteinů. Přehled těchto genů, včetně jejich aktivity genové exprese je zobrazen v Tabulce 1. AMULET TADMOR STRES x KONTROLA - UZEL logfc ANOTACE logfc ANOTACE 9.06 dehydrin dehydrin dehydrin putative protein 6.62 dehydrin dehydrin dehydrin putative protein 7.27 dehydrin dehydrin dehydrin dehydrin heat shock protein dehydrin dehydrin stress-induced membrane pore protein thionin putative 5.18 putative protein 6.72 putative protein CAA putative transketolase 5.04 putative abscisic acid-induced protein 6.56 ABA-induced protein WRAB ABA-induced protein WRAB abscisic acid-induced protein HVA ABA-induced plasma membrane protein PM P-rich protein Nt-SubC peroxidase physical impedance induced protein P-rich protein Nt-SubC trypsin inhibitor, WTI unnamed protein product putative Glucan 1,3-beta-glucosidase precursor oxalate oxidase P-rich protein Nt-SubC putative tonoplast membrane integral protein root-specific protein RCc trypsin inhibitor, WTI STRES x KONTROLA - LIST logfc ANOTACE logfc ANOTACE dehydrin dehydrin dehydrin dehydrin dehydrin abscisic acid-induced protein 7.59 Δ1-pyrroline-5-carboxylate synthetase 7.90 dehydrin dehydrin jasmonate-induced protein dehydrin abscisic acid-induced protein HVA dehydrin dehydrin photosystem II 10K protein precursor putative lipid transfer protein 6.49 putative aminotransferase bacterial-induced peroxidase precursor Δ1-pyrroline-5-carboxylate synthetase 6.20 endonuclease 6.76 photosystem II 10K protein precursor 6.05 abscisic acid-induced protein HVA bacterial-induced peroxidase precursor 6.69 putative aminotransferase 5.88 pyruvate dehydrogenase E1 α subunit 6.64 putative protein 5.81 nuclease I 6.59 putative protein 5.70 actin depolymerization factor-like protein putative protein 6.33 dehydrin putative aminotransferase 128

129 abscisic acid-induced protein 6.04 β -glucosidase putative glutaredoxin peroxidase 5.45 β -glucosidase physical impedance induced protein peroxidase OSJNBb0072N jasmonate-induced protein putative leucine rich repeat containing protein kinase aquaporin aquaporin bacterial-induced peroxidase precursor putative subtilase putative α/β hydrolase subtilisin-like protease herbicide safener binding protein putative cytokinin oxidase TABULKA 1: Přehled diferenciálně exprimovaných genů s nejvyšší zaznamenanou aktivitou při srovnání kontrolní a stresované varianty jednotlivých odrůd v uzlovém a listovém pletivu. Závěr V tomto experimentu se prokázalo, že na expresní profily ječmene stresovaného suchem neměly vliv pouze sledované odrůdy, ale také typ rostlinného pletiva. Při porovnání stresovaných variant jednotlivých odrůd se v uzlech exprimovalo podstatně více genů než v listech, což poukazuje na zvýšený význam tohoto pletiva při adaptování rostlin k suchu. Napříč sledovanými variantami byly nalezeny podobnosti ve spektru nejvíce exprimovaných genů, ale stejně tak se vyskytly odrůdově nebo pletivově specifické geny. První skupinu reprezentovaly dehidriny a proteiny indukované kyselinou abscisovou. Specifitou listových pletiv byla β-glucosidáza a Δ1-pyrolin-5-karboxylát syntetáza. V případě uzlů se jednalo o inhibitor trypsinu. Pouze v Amuletu se exprimovaly peroxidázy, Hsp70 a proteiny indukované jasmonáty. Změněné expresní hladiny u odrůdy Tadmor vykazovaly thionin, E1-α podjednotka pyruvát dehydrogenázy a oxalát-oxidáza. Dedikace Práce probíhá za podpory Projektu MZe NAZV QH81287 Použitá literatura 1. Blum A. (1985). Breeding crop varieties for stress environments. Critical Reviews in Plant Sciences. 2: Bray E. A., Bailey-Serres J., Weretilnyk E. (2000) Responses to abiotic stresses. In W Gruissem, B Buchannan, R Jones, eds, Biochemistry and Molecular Biology of Plants. American Society of Plant Physiologists, Rockville, MD, pp Ceccarelli S. (1994). Specific adaptation and breeding for marginal conditions. Euphytica.77: Close T. J., Wanamaker S. I., Caldo R. A., Turner S. M., Ashlock D. A.,Dickerson J. A., Wing R. A., Muehlbauer G. J., Kleinhofs A., Wise R. P. (2004) A new resource for cereal genomics: 22 K Barley GeneChip comes of age. Plant Physiol. 134: Ding D., Zhang L., Wang H., Liu Z., Zhang Z., Zheng Y. (2009). Differential expression of mrnas in response to salt stress in maize roots. Ann Bot. 103(1): Dokoupilová Z., Holková L., Chloupek O. (2004). Activation of dehydrin genes of germinate plants of barley to drought and cold. Ústav pěstování a šlechtění rostlin, Mendelova zemědělská a lesnická univerzita. 7 s. 7. Guo P., Baum M., Grando S., Ceccarelli S., Bai, G., Li R., et al. (2009). Differentially expressed genes between drought-tolerant and drought-sensitive barley genotypes in response to drought stress during the reproductive stage. Journal of Experimental Botany. 60:

130 8. Choi, D. W., Zhu B., Close T. J. (1999). The barley (Hordeum vulgare L.) dehydrin multigene family: sequences, allele types, chromosome assignments, and expression characteristics of 11 Dhn genes of cv. Dicktoo. Theor. Appl. Genet. 98: Choudhary N. L., Sairam R., Tyagi A. (2005). Expression of Δ1-pyrroline-5- carboxylate synthetase gene during drought in rice (Oryza sativa L.). Indian Journal of Biochemistry and Biophysics. 42: Irizarry R. A., Gautier L., Bolstad B. M., Miller C. with contributions from Astrand M., Cope L. M., Gentleman R., Gentry J., Halling C., Huber W., MacDonald J., Rubinstein B. I. P., Workman C., Zhang J. (2006). Affy: Methods for Affymetrix oligonucleotide arrays. R package version Irizarry R. A., Hobbs B., Colin F., Beazer-Barclay Y. D., Antonellis K., Scherf U., Speed T. P. (2003). Exploration, normalization and summaries of high density oligonucleotide array probe level data. Biostatistics. 4: Jayapal M, Melendez A. J. (2006). DNA microarray technology for target identification and validation. Clin Exp Pharmacol Physiol. 33(5-6): Katsuhara M., Koshio K., Shibasaka M., Hayashi Y., Hayakawa T., Kasamo K. (2003). Over-expression of a barley aquaporin increased the shoot/root ratio and raised salt sensitivity in transgenic rice plants. Plant & Cell Physiology. 44: Kawasaki S., Borchert C., Deyholos M., Wang H., Brazille S., Kawai K., Galbraith D., Bohnert H. J. (2001). Gene expression profiles during the initial phase of salt stress in rice. Plant Cell. 13: Kawaura K., Mochida K., Yamazaki Y., Ogihara Y. (2006). Transcriptome analysis of salinity stress responses in common wheat using a 22k oligo-dna microarray. Funct Integr Genomics. 6(2): Lucas A. (2011). amap: Another Multidimensional Analysis Package. R package version Nevo E (1992). Origin, evolution, population genetics and resources for breeding of wild barley, Hordeum spontaneum, in the Fertile Crescent. In: Shewry P (ed) Barley: genetics, molecular biology and biotechnology. CABI, Wallingford, pp Ozturk Z. N., Talame V., Deyhoyos M., Michalowski C. B., Galbraith D. W., Gozukirmizi N., Tuberosa R., Bohnert H. J. (2002). Monitoring large-scale changes in transcript abundance in drought- and salt-stressed barley. Plant Mol Biol. 48: Sairam R. K. and Tyagi A. (2004) Physiology and molecular biology of salinity stress tolerance in plants. Current Science. 86: Seki M., Narusaka M., Ishida J., Nanjo T., Fujita M., Oono Y., Kamiya A., Nakajima M., Enju A.,Sakurai T., Satou M., Akiyama K., Taji T., Yamaguchi-Shinozaki K., Carninci P., Kawai J., Hayashizaki Y. and Shinozaki K. (2002). Monitoring the expression profiles of 7000 Arabidopsis genes under drought, cold and high-salinity stresses using a full-length cdna microarray. Plant J. 31: Smyth G. K. (2005). Limma: linear models for microarray data. In:Bioinformatics and Computational Biology Solutions using R and Bioconductor, R. Gentleman, V. Carey, S. Dudoit, R. Irizarry, W. Huber (eds.), Springer, New York, pages Talamè V., Ozturk N. Z., Bohnert H. J., Tuberosa R. (2007). Barley transcript profiles under dehydration shock and drought stress treatments: a comparative analysis, Journal Experimental Botany. 58: Thimm O., Essigmann B., Kloska S., Altmann T., Buckhout T. J. (2001). Response of Arabidopsis to iron deficiency stress as revealed by microarray analysis. Plant Physiol. 127: Tommasini L., Svensson J. T., Rodriguez E. M., Wahid A., Malatrasi M., Kato K., Wanamaker S., Resnik J., Close T. J. (2008). Dehydrin gene expression provides an 130

131 indicator of low temperature and drought stress: transcriptome-based analysis of barley (Hordeum vulgare L.). Functional & Integrative Genomics. 8: (Refereed, Electronic) 25. Tyerman S. D., Niemietz C. M., Bramly H. (2002). Plant aquaporins:multifunctional water and solute channels with expanding roles. Plant Cell Environ. 25: Vendruscolo E. C., Schuster I., Pileggi M., Scapim C. A., Molinari H. B., Marur C. J., Vieira L. G. (2007). Stress-induced synthesis of prolineconfers tolerance to water deficit in transgenic wheat. Journal of PlantPhysiology. 164: Verón S. R., Paruelo J. M., Oesterheld M.(2006). Assessing desertification. Journal of Arid Environments. 66: Wang, W., Vinocur, B., Altman, A. (2003). Plant responses to drought, salinity and extreme temperatures: towards genetic engineering for stress tolerance. Planta. 218:

132 MOŽNOSTI IDENTIFIKACE ODRŮD ČESNEKU POMOCÍ ANALÝZY MIKROSATELITŮ Identification of garlic variety using microsatellites Leišová-Svobodová L., Mitrová K., Kučera L., Ovesná J. Výzkumný ústav rostlinné výroby, v.v.i. Kontaktní adresa 1. autora: RNDr. Mgr. Leona Leišová-Svobodová, Ph.D., Výzkumný ústav rostlinné výroby, v.v.i., Drnovská 507, Praha 6 Ruzyně; Abstrakt U 56 vzorků česneku bylo analyzováno 21 mikrosatelitních lokusů. Celkem bylo detekováno 108 alel. Z hlediska počtu detekovaných alel a hodnot míry informativnosti polymorfismu (PIC) jednotlivých lokusů bylo pro další analýzy vybráno 16 lokusů. Metoda analýzy mikrosatelitů se ukázala jako vhodná pro identifikaci odrůd česneku. Soubor 16 vybraných lokusů dokáže rozlišit české odrůdy česneku a odlišit je od zahraničních odrůd. Klíčová slova Allium sativum, variabilita, PCR Abstract Fifty six garlic samples were analyzed using 21 microsatellites. In total, 108 alleles were detected. Sixteen microsatellites were chosen for next studies based on the number of detected alleles and polymorphism information content values. The number of branches in dendrogram corresponded to the number of found genotypes. The analysis of microsatellites showed to be a suitable method for the identification of garlic varieties. A set of 16 microsatellites is able to distinguish between Czech varieties as well as differentiate them from foreign garlic varieties. Keywords Allium sativum, variability, PCR Úvod Česnek kuchyňský (Allium sativum L) je vytrvalá diploidní rostlina s téměř výhradně klonálním způsobem rozmnožování. Pochází z oblastí mongolských stepí a byl pěstován již ve starověkém Egyptě. Přestože nepatří mezi nutričně významné plodiny, jeho celosvětová spotřeba i produkce v posledních čtyřiceti letech dle statistiky FAO neustále roste (FAOSTAT, Český česnek, tedy české odrůdy česneku se díky své ostré chuti řadí ve světě mezi nejkvalitnější. Jejich nevýhodou je vyšší cena, která spolu s poptávkou po levném čínském česneku způsobila výrazný propad produkce českých odrůd česneku českými pěstiteli. V současné době se vyskytuje mnoho prodejců, kteří za český česnek vydávají různé zahraniční odrůdy ať už pěstované v České republice nebo přímo dovezené (Kozák, 2012). Identifikace odrůd hospodářsky významných plodin pro potřeby nejen semenářských podniků, šlechtitelských stanic a odrůdového zkušebnictví, ale též pro kontrolu pravosti odrůd je obecným problémem. S objevem polymerázové řetězové reakce (PCR) a jejím zavedením jako rutinní metody v laboratořích molekulární biologie se však značně zrychlil vývoj metod 132

133 pro studium genetické variability a tudíž se i problém charakterizace odrůd stal řešitelným. V současné době již existuje mnoho metod, které jsou vhodné pro detekci genetické variability. Jednou z metod, která se rutinně používá pro studium variability i pro forenzní účely je analýza mikrosatelitů. Mikrosatelity jsou úseky DNA s opakujícím se motivem nejčastěji dvou nukleotidů. Počet opakování daného motivu je dán mnoha faktory a je nutno ho chápat z fylogenetického hlediska. Vlastní příčinou je chromosomální dynamika: chromosomální aberace, nerovnoměrný crossing-over, amplifikace a neúplná replikace určitých segmentů chromosomální DNA (Ondřej, 1992; Goldstein et Schlötterer, 2000). Mikrosatelity se tudíž vyznačují vysokou mírou variability v počtu opakování jejich motivů, která se ve vlastní analýze projeví jako vysoká míra délkového polymorfismu amplifikovaných fragmentů DNA daného mikrosatelitního lokusu. Výhodou analýzy mikrosatelitů je hypervariabilita, kodominance alel, hojný výskyt v genomech eukaryot, potřeba pouze malého množství DNA, vysoká reproducibilita, možnost provádět analýzy jako multiplex, tj. v jedné reakci analyzovat více SSR lokusů, což výrazně zlevňuje cenu analýz (de Vienne et al., 1998). Z mnoha komparativních studií (např.: Russel et al. 1997; Nagaoka and Ogihara, 1997) se analýza mikrosatelitů ukazuje jako nejvhodnější metoda pro analýzy genetické variability v rámci druhu jinými slovy tato metoda nejlépe detekuje rozdíly mezi odrůdami téhož rostlinného druhu. Cílem této práce bylo nalézt soubor mikrosatelitních markerů použitelný pro jednoznačnou identifikaci vybraných odrůd česneku. Materiál a Metody Celkem bylo analyzováno 56 vzorků česneku (Allium sativum): 28 odrůd, 6 novošlechtění a 2 testovací vzorky koupené v obchodních řetězcích. Většina odrůd byla vyšlechtěna v České republice (J. Kozák, firma Moravoseed a Tagro), dvě odrůdy pocházejí ze Slovenska, čtyři odrůdy z Francie a jeden genotyp z Ruska. Dva vzorky pocházely z obchodních řetězců, jeden byl prodáván pod názvem Vekan a druhý bez uvedení názvu odrůdy. DNA byla extrahována jak z listových čepelí tak i ze stroužků pomocí detergentu CTAB (Saghai-Maroof et al., 1984) dle optimalizovaného protokolu. Kvalita a koncentrace extrahované DNA byly ověřeny elektroforeticky v 0,8% agarózovém gelu a vizualizaci pomocí ethidiumbromidu v UV světle srovnáním s velikostním a koncentračním standardem λhind III (Fermentas). K pilotní studii souboru odrůd česneku (Allium sativum) byl vybrán soubor 21 publikovaných mikrosatelitních markerů (Ma et al., 2009; Fischer &Bachmann, 2000; Lee et al., 2011; Cunha et al., 2012) a dvou vyvinutých na našem pracovišti (Tabulka 1). Jeden z dvojice primerů je značen fluorescenční barvou 6-fam, vic, ned nebo pet, což umožňuje multiplexovou analýzu produktů PCR reakce. PCR reakce s mikrosatelitními primery byla prováděna dle optimalizovaného protokolu. Reakční směs o objemu 15 μl obsahovala 0,5 μm příslušné dvojice primerů (tzv. forward a reverse), 0,2 mm dntp, 1x pufr, MgCl 2, Tth polymerázu Biotools firmy DYNEX a 100 ng vzorku DNA. Reakce byla prováděna v cykleru fy Sensoquest (Německo). Základní reakční cyklus se skládá z první denaturace 5 min při 95 C.; následuje 35 cyklů: 30 sec při 95 C, 30 sec při (tm), 30 sec při 72 C a závěrečná doba syntézy 5 min při 72 C. Separace produktů PCR reakce byla prováděna metodou kapilární elektroforézy v přístroji ABI PRISM 3130 firmy Life Technology (USA). Jako interní velikostní standard byla použit Liz500. Elektroforetogramy byly analyzovány pomocí programů GeneMapper a MS Excel a převedeny do podoby binárních tabulek. Ze získaných dat byly vypočteny genetické vzdálenosti mezi genotypy a sestrojen dendrogram pomocí programu Darwin (Perrier and Jacquemoud-Collet, 2006). Soubor dat byl 133

134 převzorkován 5000x (bootstrapping), aby byla získána struktura dendrogramu s definovanou mírou spolehlivosti. Hodnoty získané pomocí techniky bootstrappingu v % jsou uvedeny u každé větve dendrogramu (Obrázek 1). Genotypová diverzita byla počítána pomocí programu Multilocus v 1.3 jako (n/n-1)(1- p i 2 ), kde p i je frekvence i-tého genotypu a n je počet analyzovaných vzorků (Agapow and Burt 2001). Míra informativnosti daného polymorfismu byla vypočtena podle vzorce: kde p i je frekvence i-té alely. PIC = 1 - p i 2, Tabulka 1 Seznam mikrosatelitních lokusů použitých v práci Program PCR SSR primer-lokusznačka Kategorierozsah (bp) Počet alel PIC Reference ASM035-6-FAM M ,619 Ma et al., 2009 ASM040-VIC M ,748 Ma et al., 2009 ASM53-NED M ,854 Ma et al., 2009 ASM59-PET M ,765 Ma et al., 2009 ASM072-6-FAM M ,803 Ma et al., 2009 ASM078-VIC M ,576 Ma et al., 2009 ASM080-NED M ,344 Ma et al., 2009 ASM109-PET M ,561 Ma et al., 2009 Intron 1-6-FAM M ,606 VÚRV, v.v.i. Intron 3-NED M ,650 VÚRV, v.v.i. AMS025-PET M ,000 Fischer and Bachmann, 2000 GBAS001-6-FAM M ,000 Lee et al., 2011 GBAS027-VIC M ,000 Lee et al., 2011 GBAS089-NED M ,000 Lee et al., 2011 GBAS102-PET M ,000 Lee et al., 2011 ASA04-6FAM M ,035 Cunha et al., 2012 ASA06-VIC M ,000 Cunha et al., 2012 ASA07-NED M ,605 Cunha et al., 2012 ASA08-PET M ,909 Cunha et al., 2012 ASA10-6FAM M ,731 Cunha et al., 2012 ASA14-VIC M ,821 Cunha et al., 2012 ASA16-NED M ,430 Cunha et al., 2012 ASA17-PET M ,858 Cunha et al., 2012 Výsledky a diskuse Základní předností metody analýzy mikrosatelitů je, že je dobře aplikovatelná pro rutinní využití, je robustní a s vysokou mírou reprodukovatelnosti. Pomocí této metodiky lze rozlišit i velmi příbuzné genotypy v závislosti na počtu použitých lokusů. Zároveň vysoká míra 134

135 reprodukovatelnosti umožňuje využít tuto metodu pro forenzní účely, v našem případě pro identifikaci a ochranu odrůd česneku (určení pravosti, případně vyloučení pravosti deklarované odrůdy). Analýzou 23 mikrosatelitních lokusů u 56 vzorků bylo detekováno celkem 108 alel. Nejvyšší variabilitu vykazovaly lokusy ASM53 (9 alel), ASM072 (11 alel), ASA08 (18 alel) a ASA17 (11 alel). Lokusy AMS025, GBAS001, GBAS027, GBAS089 a ASA04 jsou u studovaného souboru monomorfní. Nejvyšší hodnoty PIC (polymorphism information content) vykazují lokusy ASM53, ASM72, ASA08 a ASA17 (Tabulka 1). Monomorfní lokusy mají hodnotu PIC 0 a budou z dalších analýz vyloučeny, stejně jako lokus ASA04, který má velmi nízkou hodnotu PIC (0,035). Pro další analýzy bude tedy používáno 16 mikrosatelitních lokusů, jejichž průměrná hodnota PIC je 0,68. Tato hodnota je srovnatelná s hodnotou PIC nelezenou u mikrosatelitních lokusů pšenice, která v práci Smithe a kol. (1997) činila 0,

136 Obrázek 1 Dendrogram sestrojený na základě matice párových genetických vzdáleností vypočtených z dat analýzy mikrosatelitů (červeně jsou označeny standardy alel) A12042_Vekan 97 A12012_Vekan 29 St-9_Vekan 43 A12009_Al II 30 A12006_BL A12046_Blanin A12019_Unikát 89 St-5_LAN A12008_LAN 86 A12037_Rusák 62 A12028_Dukát 99 A12015_Dukát St-2_Bjetin 100 A12014_Bjetin A12027_Bjetin 41 St-3_Havran 87 A12021_Havran 50 A12033_Havran 84 A12011_Jovan 100 St-4_Jovan A12045_Vinar 65 A12043_neznám z Ruska St-6_ZAH A12003_ZAH A12001_Záhorský 28 A12004_Lukan 100 A12002_Mojmír 32 A12035_Lukan A12041_Therador 21 A12032_Goulorose A12047_neznámý z Bily 17 A12034_Jolimont A12005_Anton St-1_Benátèan A12016_Benátèan 68 A12022_Japo II A12024_Matin A12023_Lumír A12044_Goulorose A12031_Goulorose A12030_Edenrose A12025_Vekan z obchodu A12017_Tantal 80 A12007_Staník St-8_Staník 74 A12036_Mirka 77 A12040_Tantal A12039_Staník A12020_Mirka A12018_Tristan 51 A12010_BL 183 St-7_Slavín 100 A12013_Slavín 96 A12038_Slavín A12029_Džambul 34 A12026_Anin

137 Na základě dat analýzy mikrosatelitů u studovaného souboru vzorků česneku byl sestrojen dendrogram (Obrázek 1). Třicet šest větví dendrogramu odpovídá 36 rozdílným sestavám identifikovaných alel 16 mikrosatelitních lokusů. Ne vždy určitá sestava alel odpovídá jedné odrůdě. Ve třech případech mají stejnou sestavu alel 2-3 odrůdy: Lukan a Mojmír, Tantal, Stanik a Mirka, Stanik a Mirka. Ve třech případech se různé vzorky téže odrůdy lišily v přítomnosti alel a byly pomocí aplikované analýzy přiřazeny do dvou větví dendrogramu: Goulorose, Stanik a Mirka. Jelikož byly tyto vzorky dodány od různých pěstitelů, je jistá míra odlišnosti mezi nimi možná (vliv chyb při deklaraci, vliv udržovacího množení). U všech problematických vzorků budou analýzy zopakovány s nově dodaným materiálem. Úskalím metody analýzy mikrosatelitů je, že bez použití standardů alel a referenčních odrůd není možné spolehlivě identifikovat danou odrůdu či detekovat hledanou alelu a porovnávat výsledky analýz prováděných v různou dobu či v různých laboratořích. Toto úskalí lze však snadno překonat zvolením tzv. standardů alel a ty pak analyzovat vždy s danými vzorky. V pilotní studii bylo navrženo 9 standardů alel. Jsou v Obrázku 1 vyznačeny červeně. Pro analýzy neznámých vzorků budou ještě doplněny o srovnávací odrůdy. V rámci této práce byly rovněž analyzovány dva vzorky česneku zakoupené v obchodních řetězcích. Jeden pod názvem odrůdy Vekan, který dle výsledků analýz neodpovídá deklarované odrůdě. Druhý vzorek prodávaný jako český česnek měl odlišnou sestavu mikrosatelitních alel od všech analyzovaných vzorků českých odrůd česneku a je na základě analýzy SSR markerů nejpodobnější francouzské odrůdě Jolimont. Pro spolehlivější identifikaci odrůd bude ještě třeba získat a analyzovat více zahraničních odrůd, což je předmětem dalších aktivit v rámci řešení výzkumného projektu. Závěr Metoda analýzy mikrosatelitů se ukázala jako vhodná pro identifikaci odrůd česneku. Soubor 16 vybraných lokusů dokáže rozlišit české odrůdy česneku a odlišit je od zahraničních odrůd. Dedikace Tento výzkum byl podpořen finančními prostředky projektu NAZV QJ Použitá literatura 1. AGAPOW PM, BURT A. (2001): indices of multilocus linkage disequilibrium. mol ecol notes 1: CUNHA C.P., HOOGERHEIDE E.S.S., ZUCCHI M.I., MONTEIRO M., PINHEIRO J.B. (2012): new microsatellite markers for garlic, allium sativum (alliaceae). american journal of botany: e17-e DE VIENNE D., SANTONI S. (1998): les principales sources de marqueur moléculaires. in: de vienne et al.: les marqueur moléculaire en génétique et biotechnologies végétales. inra, paris, 1998: FISCHER D., BACHMANN K. (2000): onion microsatellites for germplasm analysis and their use in assessing intra- and interspecific relatedness within the subgenus rhizirideum. theor. appl. genet. 101: GOLDSTEIN D.B., SCHLÖTTERER CH. (2000): microsatellites: evolution and application. oxford university press, new york, us,

138 6. KOZÁK J. (2012): 7. LEE G.A., KWON S.J., PARK Y.J., LEE M.C., KIM H.H., LEE J.S., LEE S.Y., GWAG J.G., KIM C.K., MA K.H. (2011): cross-amplification of ssr markers developed from allium sativum to other allium species. scientia horticulturae 128: MA K.H., KWAG J.G., ZHAO W., DIXIT A., LEE G.A., KIM H.H., CHUNG I.M., KIM N.S., LEE J.S., JI J.J., KIM T.S., PARK Y.J. (2009): isolation and characteristics of eight novel polymorphic microsatellite loci from the genome of garlic (allium sativum l.). scientia horticulturae 122: NAGAOKA T., OGIHARA Y. (1997): applicability o inter-simple sequence repeat polymorphisms in wheat for use as dna markers in comparison to rflp and rapd markers. theoretical and applied genetics 94: ONDŘEJ M. (1992): genové inženýrství kulturních rostlin. academia, praha PERRIER X, JACQUEMOUD-COLLET JP. (2006): darwin software 12. RUSSELL J., FULLER J., YOUNG G., THOMAS B., TARAMINO G., MACAULAY M., WAUGH R., POWELL W. (1997): discriminating between barley genotypes using microsatellite markers. genome 40: SAGHAI-MAROOF M.A., SOLIMAN K.M., JORGENSEN R.A., ALLARD R.W. (1984): ribosomal dna spacer-length polymorphisms in barley: mendelian inheritance, chromosomal location, and population dynamics. proc. natl. acad. sci. usa 81: SMITH J.S.C., CHIN E.C.L., SHU H., SMITH O.S., WALL S.J., SENIOR M.L., MITCHELL S.E., KRESOVICH S., ZIEGLE J. (1997): an evaluation of the utility of ssr loci as molecular markers in maize (zea mays l.) comparisons with data from rflp and pedigree. theoretical and applied genetics 95:

139 KOMPARATIVNÍ IN SILICO ANALÝZA SEKVENCÍ LAKÁZ U JEČMENE A PŠENICE In silico comparative analysis of sequences of the laccases in barley and wheat Kučera L., Tomková L. Výzkumný ústav rostlinné výroby, v.v.i., Praha Kontaktní adresa 1. autora: Ing. Ladislav Kučera, CSc., Výzkumný ústav rostlinné výroby, v.v.i., Drnovská 507, Praha 6 Ruzyně; Abstrakt V genomické sekvenci chromozomu 3B pšenice (FN564427) byly identifikovány s využitím komparativní in silico analýzy dva duplikované lokusy pro LCMO. TAA_ctg0079b a TAA_ctg0079b jsou pravděpodobnými orthologními lokusy sekvencí lakázy 7 a lakázy 8 na chromozomu 1 rýže (Oryza sativa). Predikované proteiny CBH a CBH jsou však chybně anotovány jako prekursory L-askorbát oxidázy. Výsledky naznačují, že tyto duplikované lokusy na chromozomu 3B pšenice jsou pozůstatky genomové přestavby, kterou lze datovat do období před miliony let, tj. před vznikem podčeledí Pooideae, Ehrhartoideae, Panicoideae. U ječmene byly identifikovány pravděpodobné orthologní sekvence fl-cdna AK (pro Lac7) a AK (pro Lac8). AK představuje pouze parciální sekvenci bez domény pfam Funkční analýzy různých forem LMCO a studium jejich biochemických charakteristik může identifikovat strukturální změny, které by mohly být významné z hlediska diversifikace substrátové aktivity a tím i potenciálu pro eliminaci škodlivých látek. Klíčová slova Hordeum vulgare, Triticum aestivum, rýže, lakáza, LMCO, bioinformační analýza Abstract Two duplicate LCMO loci were found in the genomic sequence of wheat chromosome 3B (FN564427) with using comparative in silico analysis. TAA_ctg0079b and TAA_ctg0079b are likely orthologous sequences of laccase 7 and laccase 8 on chromosome 1 of rice ( Oryza sativa ). The predicted proteins CBH and CBH are incorrectly annotated as precursors of L- ascorbate oxidase. The results suggest that these duplicated loci on chromosome 3B of wheat are the remains of genomic rearrangements, which can be dated to the period from 50 to 70 million years ago, ie before the divergence of the subfamilies Pooideae, Ehrhartoideae, Panicoideae. In the barley were identified probable orthologous fl-cdna sequences AK (for Lac7) and AK (for Lac8). AK represents only a partial sequence without domain pfam Functional analysis of various forms of LMCO and study of their biochemical characteristics can identify structural changes that could be significant in terms of diversification of substrate activity and therefore for elimination of harmful substances. Keywords Hordeum vulgare, Triticum aestivum, rice, laccases, LMCO, bioinformatics analyses 139

140 Úvod Lakáza (ES , p-difenol: O2 oxidoreduktáza) je jedním z enzymů katalyzující oxidaci široké škály substrátů, např. polyfenoly, substituované fenoly, diaminy, ale i některé anorganické sloučeniny při současné redukci kyslíku na vodu (Thurston 1994). Nejvíce popsané jsou převážně lakázy hub, které se projevují např. při degradaci ligninu (Hood et al. 2003), polymerizaci (Bailey 2004), v morfogenezi, patogenitě a ukládání pigmentu (Mayer 2005) a zajímavé je i možné využití lakáz při detoxikaci půdy (Sonoki 2004). Houbové lakázy jsou schopny degradovat nebo polymerovat chlorofenol (Leontievsky et al. 2000), bisfenol A (BPA) (Uchida et al. 2001; Fukuda et al. 2001) a nonylfenol (Tsutsumi et al. 2001) Lakáza byla z přírodního zdroje (Rhus vernicifera - škumpy fermežové) získána a popsána již koncem 19. století. Navzdory mnoha let výzkumu, fyziologické funkce rostlinných lakáz zůstávají většinou neznámé. Předpokládá se, že jsou spojeny s lignifikací a katalýzou široké škály enzymatických reakcí jakou jsou syntéza ligninu (Sterjiades 1992), regeneraci po poranění (McCaig 2005), získáváni železa (Hoopes 2004), reakci na stres (Liang 2006) a udržování struktury a integrity buněčné stěny (Ranocha 2002). Rostlinné lakázy jsou na molekulární úrovni charakterizované převážně u dvouděložných rostlin jako například javoru klenu (Acer pseudoplatanus) (Sterjiades 1992, 1996; LaFayette 1995), borovice kadidlové (Pinus taeda) (Sato 2001; Richardson 2000), tabáku (Nicotiana tabacum ) (Kiefer-Meyer 1997; Richardson 1997), huseníčku rolního (Arabidopsis thaliana) (Pourcel 2005; McCaig 2005), liliovníku tulipánokvětého (Liriodendron tulipifera ) (LaFayette 1999) a topolu kanadského (Populus euramericana) (Ranocha 1999). Z jednoděložných byly popsány lakázy u kukuřice, rýže, jílku, ale nebyly popsány u zemědělsky důležité plodiny jako je pšenice. Pokrok v oblasti studia genomů kulturních rostlin v poslední době umožňuje efektivní a cílené vyhledávání genů a dalších významných sekvencí DNA na základě přítomnosti analogických sekvencí u jiných, často evolučně příbuzných druhů, jednak pro jejich charakterizaci, či následně pro případnou izolaci genů (klonování). Ve VÚRV byla nedávno získána genomická sekvence DNA pro lakázu ječmene HvLac1 a byly stanoveny základní strukturální charakteristiky nukleotidové a předpokládané proteinové sekvence. Gen HvLac1 byl zamapován na chromozomu 4H ječmene (Tomková et al. 2012). Z analýz dostupných anotovaných i neanotovaných sekvencí je zřejmé, že v genomech rýže, ječmene i pšenice je možno identifikovat celou řadu orthologních i paralogních lokusů pro předpokládané multi-copper oxidázy (lakázy). V rámci evoluce genomů rostlin, včetně evoluce jednoděložných, docházelo k periodickým polyploidizacím, tj. celogenomovým duplikacím (WGD whole genome duplications) a následným diploidizacím genomů. S těmito jevy spojená strukturální a funkční diversifikace genomů přispívá ve většině případů k evolučním inovacím. Cílem této práce bylo s využití bioinformačních postupů porovnat vybrané lokusy pro vybrané multi-copper oxidázy (lakázy) na chromozomu 1 rýže a odpovídající orthologní sekvence u ječmene a pšenice. Materiál a Metody Pro jednotlivé lokusy kódující lakázy, případně MCO, v genomu rýže (Rice Genome Annotation Project - MSU Rice Genome Annotation (Osa1) Release 6.1) byly vyhledány odpovídající potenciální orthologní genomické sekvence pro pšenici a ječmen (veřejně dostupné databáze EMBL Nucleotide Sequence Database, GenBank NCBI, Protein Data Bank (PDB), Protein Information Resource (PIR) a Swiss-Prot Protein Database (Swiss- Prot)). Srovnávací analýzy genomických a proteinových sekvencí byly uskutečněny pomocí 140

141 bioinformačních nástrojů dostupných na NCBI, ExPasy a dalších portálech. Využity byly rovněž dostupné informace a nástroje hodnocení genomu rýže: Rice Annotation Project (RAP) MSU Rice Genome Annotation Project. a pšenice: Wheat annotation viewer, Pro identifikaci kolinearity a další analýzy syntenie a srovnávaných oblastí WGD pro vybrané lokusy byly využity sady nástrojů dostupné na serveru Plaza (http://bioinformatics.psb.ugent.be/plaza/). Výsledky a diskuse Vyhodnocení evoluce sekvencí pro LMCO u Poaceae (Tomková et al., 2012) ukázalo, že lze pro některé členy genové rodiny LMCO identifikovat pravděpodobné orthologní a paralogní lokusy. V genomu rýže je možné nalézt kompletní nebo parciální sekvence pro lakázy či LMCO celkem na 8 chromozomech (1, 2, 3, 5, 7, 10, 11 a 12). Z 30 lokusů jich je nejvíce (9) přítomno na chromozomu 1. Z pohledu evoluce genové rodiny LMCO je významné, že část LMCO lokusů na chromozomu 1 rýže se nalézá v oblasti genomu, která je pozůstatkem WGD polyploidizace (paleopolyploidizace) genomu (n=5) společného předka lipnicovitých (Poaceae). Sedm genů pro lakázy 3, 4, 5-6, 5, 6, 7, 8 leží v oblasti tzv. bloku os01_5_5 (Thiel et al. 2009). Tento duplikovaný segment zahrnující řadu paralogních lokusů na chromozomech 1 a 5 rýže (Fig. 1(a) a Fig. 2) patří mezi nejdelší a WGD, která je příčinou, je datována do období před přibližně 90 miliony let (Salse at al. 2008), Fig. 1(b). Prohledáním dostupných nukleotidových databází pomocí BLASTn (http://blast.ncbi.nlm.nih.gov) pro sekvence Lac7 a Lac8 rýže (LOC_Os01g63190 a LOC_Os01g63200) byly identifikovány potenciální orthologní sekvence pšenice a ječmene. V genomické sekvenci FN chromozomu 3B pšenice (Triticum aestivum chromosome 3B-specific BAC library, contig ctg0079b) byly nalezeny dva duplikované lokusy pro multi-copper oxidázy (lakázy), TAA_ctg0079b a TAA_ctg0079b (Fig 3), které jsou pravděpodobnými orthologními lokusy sekvencí lakázy 7 a lakázy 8 na chromozomu 1 rýže. Predikované proteiny CBH a CBH jsou však chybně anotovány jako prekursory L-askorbát oxidázy. V predikovaných proteinových sekvencích jsou přítomny všechny domény LMCO (Cu-oxidase_3:Multicopper oxidase; pfam07732, Cuoxidase: Multicopper oxidase; pfam00394, Cu-oxidase_2: Multicopper oxidase; pfam07731) a laccase, plant; TIGR03389). Sekvence fl-cdna AK ječmene je podle výsledku porovnání nukleotidové i proteinové sekvence (predikovaný protein BAJ91142) orthologní k Lac7 rýže a TAA_ctg0079b pšenice. Pro Lac8 byla u ječmene identifikována pravděpodobná orthologní sekvence AK365328, která po přepisu do proteinové sekvence (BAJ96531) však poskytuje neúplnou sekvenci LMCO s delecí centrální části, zahrnující Cu-oxidase_2: Multicopper oxidase; pfam07731, a je proto pravděpodobné, že se jedná o nefunkční protein. Pro genové duplikace, ať již tandemové, či blokové nebo dokonce celogenomové, je charakteristické, že řada genů je v průběhu evoluce postupně eliminována a u přetrvávajících duplikací dochází často ke změně jejich funkce (neofunkcinalizace, subfuncionalizace) nebo ke změně jejich expresních profilů. Tyto změny mohou přispívat k zvýšení adaptability organismu s novým genomem (Pont et al. 2011). Analýzy některých genových rodin však ukázaly, že u nich jsou kopie genů naopak po duplikaci zachovávány, zvláště v případech blokových duplikací, aby nebyla narušena genová rovnováha (například geny signálních drah). Tandemová duplikace sekvencí pro lakázu 7 a 8 na chromozomu 1 rýže, je zachována i genomu pšenice na chromozomu 3B a orthologní lokusy lze nalézt i v genomech Sorghum bicolor a Brachypodium distachyon (Fig. 4). V případě evoluce genomu pšenice dochází ke 141

142 ztrátě lokusu a k divergenci exprese u více než 80% genových duplikací z období před miliony let (Pont et al. 2011). Z tohoto pohledu je zajímavým zjištěním, že u LMCO je spíše tendence zachovávat duplikace po delší dobu. Fig 1 (a) Bloky kolineárních oblastí chromozomů rýže a (b) předpokládaný model evoluce genomů trav (Salse at al. 2008, upraveno) Fig. 2 Bloky kolineárních oblastí chromozomů 1 a 5 rýže Oryza sativa ssp. japonica (WGDotplot Chromosome mapping of colinear regions, Ks 0,05-1,6) 142

143 Fig. 3 Mapa oblasti sekvence 3B chromozomu pšenice s kandidátními geny pro LMCO, TAA_ctg0079b a TAA_ctg0079b , označeny šipkou (Wheat annotation viewer v2: 60 kbp from ctg0079b) Fig. 4 Schema syntenie v okolí lokusů rýže Os01g63190 (lakáza 7) a Os01g63200 (lakáza 8) (označeny šipkou) sbi - Sorghum bicolor bdi - Brachypodium distachyon osa - Oryza sativa ssp. japonica osa indica - Oryza sativa ssp. indica Závěr Výsledky prokázaly vhodnost bioinformačních postupů pro vyhledávání analogických sekvencí u ječmene a pšenice, zvláště v případě sekvencí mnohočetných genových rodin, mezi které náleží i lakázy. V genomické sekvenci FN chromozomu 3B pšenice (Triticum aestivum chromosome 3B-specific BAC library, contig ctg0079b) byly identifikovány dva duplikované lokusy pro LCMO, které jsou pravděpodobnými orthologními lokusy sekvencí lakázy 7 a lakázy 8 na chromozomu 1 rýže (Oryza sativa). Výsledky naznačují, že tyto duplikované lokusy na chromozomu 3B pšenice jsou pozůstatky genomové přestavby, kterou lze datovat do období před miliony let, tj. před vznikem podčeledí Pooideae, Ehrhartoideae, Panicoideae. Tento závěr podporují i výsledky porovnání mikrosyntenie v okolí uvedených lokusů. Výsledky rovněž ukázaly na některé problémy elektronických anotačních dedikací, které v případech zde studovaných lokusů mohou být zavádějící, neboť oba lokusy jsou u pšenice anotovány chybně jako prekustory L-askorbát oxidázy. Získané poznatky umožní detekci alternativních členů genové rodiny pro multi-copper oxidázy (lakázy) u genových zdrojů a odrůd ječmene a pšenice. Funkční analýzy různých 143

144 forem LMCO a studium jejich potenciálních biochemických charakteristik může identifikovat strukturální změny, které by mohly být významné z hlediska diversifikace substrátové aktivity a tím i jejich potenciálu pro eliminaci škodlivých látek. Dedikace Tento výzkum byl podpořen finančními prostředky projektu NAZV QH82277 (Poskytovatel: Ministerstvo zemědělství) a OC10017 (Poskytovatel: Ministerstvo školství, mládeže a tělovýchovy). Použitá literatura 1. Bailey, M.R., Woodard, S.L., Callaway, E., Beifuss, K., Magallanes-Lundback, M., Lane, J.R., Horn, M.E., Mallubhotla, H., Delaney, D.D., Ward, M., Van Gastel, F., Howard, J.A., Hood, E.E. (2004) Improved recovery of aktive recombinant laccase from maize seed, Appl. Microbiol. Biotechnol. 63: Fukuda, T., Uchida, H., Takashima, Y., Uwajima, T., Kawabata, T., Suzuki, M. (2001) Degradation of bisphenol A by purified laccase fromtrametes villosa. Biochem Biophys Res Commun 284: Hood, E.E., Bailey, M.R., Beifuss, K., Magallanes-Lundback, M., Horn, M.E., Callaway, E., Drees, C., Delaney, D.E., Clough, R., Howard, J.A. (2003) Criteria for high-level expression of a fungal laccase gene in transgenic maize, Plant Biotechnol. J. 1: Hoopes J.T., Dean J.F.D. (2004) Ferroxidase activity in a laccaselike multicopper oxidase from Liriodendron tulipifera. Plant Physiol Biochem 42: Kiefer-Meyer, M.C., Gomord, V., O Connell, A., Halpin, C., Faye, L. (1996) Cloning and sequence analysis of laccase-encoding cdna clones from tobacco, Gene 178: LaFayette, P.R., Ericsson, K.E., Dean J.F. (1995) Nucleotide sequence of a cdna clone encoding an acidic laccase from sycamore maple (Acer pseudoplatanus L.), Plant Physiol. 107: LaFayette, P.R., Ericsson, K.E., Dean, J.F. (1999) Characterization and heterologous expression of laccase cdnas from xylem tissues of yellow-poplar (Liriodendron tulipifera), Plant Mol. Biol. 40: Leontievsky, A.A., Myasoedova, N.M., Baskunov, B.P., Švand, C.S., Golovleva, L.A,. (2000) Transformation of 2,4,6-trichlorophenol by the white rot fungi Panus tigrinus and Coriolus versicolor. Biodegradation 11: Liang, M., Haroldsen, V., Cai, X., Wu, Y. (2006) Expression of a putative laccase gene, ZmLAC1, in maize primary roots under stress. Plant Cell Environ 29: DOI: / j x 10. Mayer, A.M., Staples, R.C. (2002) Laccase: new functions for an old enzyme. Phytochemistry 60: McCaig B.C., Meagher R.B., Dean J.F.D. (2005) Gene structure and molecular analysis of the laccase-like multicopper oxidace (LMCO) gene family in Arabidopsis thaliana. Planta 221: Pont C., Murat F., Confolent C., Balzergue S., Salse J. (2011): RNA-seq in grain unveils fate of neo- and paleopolyploidization events in bread wheat (Triticum aestivum L.). Dec 2;12(12):R119. doi: /gb r

145 13. Pourcel, L., Routaboul, J.M., Kerhoas, L., Caboche, M., Lepiniec, L., Debeaujona, I. (2005) TRANSPARENT TESTA10 encodes a laccase-like enzyme involved in oxidative polymerization of flavonoids in Arabidopsis seed coat, Plant Cell 17: Ranocha, P., Chabannes, M., Chamayou, S., Danou, S., Jauneau, A., Boudek, A.M., GoVner, D. (2002) Laccase down-regulation causes alterations in phenolic metabolism and cell wall structure in poplar. Plant Physiol 129: Ranocha, P., McDougall, G., Hawkins, S., Sterjiades, R., Borderies, G., Stewart, D., Cabanes-Macheteau, M., Boudet, A.M., Goffner, D. (1999) Biochemical characterization, molecular cloning and expression of laccases a divergent gene family-in poplar, Eur. J. Biochem Richardson, A., McDougall, G.J. (1997) A laccase-type polyphenol oxidase from lignifying xylem of tobacco, Phytochemistry 44: Richardson, A., Runcán, J., McDougall, G.J. (2000) Oxidase activity in lignifying xylem of taxonomically diverse range of trees: identification of a conifer laccase, Tree Physiol. 20: Salse J., Bolot S., Throude M., Jouffe V., Piegu B., Quraishi U.M., Calcagno T., Cooke R., Delseny M., Feuillet C. (2008): Identification and characterization of conserved duplications between rice and wheat provide new insight into grass genome evolution. Plant Cell 2008, 20: Sato, Y., Wuli, B., Sederoff, R., Whetten, R. (2001) Molecular cloning andexpression of eight laccase cdnas in Loblolly Pine (Pinus taeda), J.Plant Res. 114: Sonoki, T., Kajita, S., Ikeda, S., Uesugui, M., Tatsumi, K., Katayama, Y., Iimura, Y. (2004) Transgenic tobacco expressing fungal laccase promotes the detoxification of environmental pollutants, Appl Microbiol Biotechnol, 67: Sterjiades, R., Dean J.F.D., Eriksson K.E.L. (1992) Laccase from sycamore maple (Acer-pseudoplatanus) polymerizes monolignols. Plant Physiol 99: Sterjiades, R., Rasocha, P., Boudek, A.M., Goffner, D. (1996) Identification of specific laccase isoforms capable of polymerizing monolignols by an ingel procedure, Anal. Biochem. 242: Thiel T., Graner A., Waugh R., Grosse I., Close T.J., Stein N. (2009): Evidence and evolutionary analysis of ancient whole-genome duplication in barley predating the divergence from rice. BMC Evol Biol, 9:209, doi: / Thurston, F. CH., (1994) The structure and function of fungal laccase, Microbiology 140: Tomková, L., Kučera, L., Vaculová, K., Milotová, J. (2012) Characterization and mapping of a putative laccase-like multicopper oxidase gene in the barley (Hordeum vulgare L.) Plant Science 183:pp 77-85, doi: /j.plantsci Tsutsumi, Y., Haneda, T., Nishida, T. (2001) Removal of estrogenic activities of bisphenol A and nonylphenol by oxidative enzymes from lignin-degrading basidiomycetes. Chemosphere 42: Uchida, H., Fukuda, T., Miyamoto, H., Kawabata, T., Suzuki, M.,Uwajima, T. (2001) Polymerization of bisphenol A by purifiedlaccase from Trametes villosa. Biochem Biophys Res Commun 287: [http://www.ncbi.nlm.nih.gov/] webcite NCBI. OpenURL 29. [http://expasy.org/sprot/] webcite Expasy. OpenURL 30. The Rice Annotation Project Database (RAP-DB): 2008 update 31. Rice Annotation Project, Nucleic Acids Res., 36 (Database issue), D (2008) 145

146 NUTRIČNÍ A SENZORICKÉ VLASTNOSTI A OBSAH VYBRANÝCH KONTAMINANTŮ V PEKAŘSKÝCH VÝROBCÍCH Z KONVENČNĚ A EKOLOGICKY PĚSTOVANÝCH OBILOVIN Nutritive and sensory properties and content of selected contaminants in bakery products derived from cereals produced in conventional and ecological farming 1 Gabrovská D., 1 Fiedlerová V., 1 Rysová J., 1 Ouhrabková J., 1 Laknerová I., 1 Mašková E., 1 Winterová R., 1 Holasová M., 2 Hajšlová J., 2 Václavíková M., 3 Capouchová I. 1 Výzkumný ústav potravinářský Praha, v.v.i. 2 Vysoká škola chemicko-technologická v Praze 3 Česká zemědělská univerzita v Praze Kontaktní adresa 1.autora: Ing. Dana Gabrovská, Ph.D., VÚPP, Radiová 7, Praha 10, ČR, Abstrakt Zrno pšenice špaldy Ceralio (Triticum spelta L.), pšenice seté Bohemia (Triticum aestivum L.) a žita setého Askari (Secale cereale L.), pěstované za podmínek konvenčního a ekologického zemědělství, a dále mouky a pečivo z nich připravené, byly hodnoceny z hlediska obsahu nutričních faktorů a vybraných kontaminantů. Mezi obsahy základních nutrientů, vitaminů a antioxidačních parametrů u konvenční a ekologické varianty nebyl nalezen významný rozdíl. Obsah mykotoxinů byl ve všech případech vyšší u konvenčně pěstovaných produktů. Použití ekologicky pěstovaných surovin vedlo ke zvýšení měrného objemu modelového pečiva. Při senzorickém hodnocení vzorků modelového pečiva z pšeničných a špaldových mouk nebyl pozorován rozdíl organoleptických vlastností pečiva z ekologicky a konvenčně pěstovaných surovin. Klíčová slova nutrienty, kontaminanty, obiloviny, konvenční, ekologické pěstování Abstract Nutrients and selected contaminants were determined in spelt Ceralio (Triticum spelta L.), wheat Bohemia (Triticum aestivum L.) and rye Askari (Secale cereale L.) grown under the conventional and ecological farming conditions. Flours and corresponding model bakery products derived from both types of grains were evaluated as well. No significant differences in basic nutrient and vitamin contents and antioxidant parameters were found between conventional and ecological varieties. Mycotoxins contents in conventionally grown products were higher in all tested samples in comparison to those of organically grown. Model bakery products made from ecological flours resulted in higher specific volume. Sensory evaluation of wheat and spelt bakery products did not prove any significant differences in sensory properties of conventional and ecological varieties. Key words nutrients, contaminants, cereals, conventional, ecological farming 146

147 Úvod Kromě konvenčně pěstovaných plodin, je v posledních letech zvyšována i nabídka produktů ekologického zemědělství. Hodnocení kvality konvenčně a ekologicky pěstovaných plodin je předmětem řady studií, se snahou charakterizovat pozitivní, případně negativní aspekty jakosti. Při hodnocení kvality potravinářských surovin a následně i výrobků, je posuzována nutriční hodnota, hygienicko-toxikologická jakost, technologická kvalita a senzorická jakost. Nutriční hodnota vyjadřuje obsah a poměry látek příznivě působících na zdraví. Hygienickotoxikologická kvalita zahrnuje především hodnocení z pohledu výskytu reziduí pesticidů a přítomnost mykotoxinů, případně jiných přírodních toxinů. Technologická jakost charakterizuje vhodnost produktů pro průmyslové a kulinární zpracování. Senzorická jakost zahrnuje hodnocení vnějších vzhledových parametrů a dále senzorických deskriptorů při konzumaci produktů z nich (Hajšlová, Schulzová 2006). Prezentovaná práce je věnována hodnocení vybraných jakostních parametrů u mouk vyrobených ze tří různých obilovin pěstovaných za podmínek konvenčního a ekologického zemědělství a modelových pekařských výrobků z těchto obilovin připravených. Bylo provedeno hodnocení z hlediska obsahu nutričních faktorů a vybraných kontaminantů u mouk z pšenice špaldy Ceralio, pšenice seté Bohemia a žita setého Askari. Mouka z těchto obilovin byla použita při přípravě modelových pekařských výrobků. U těchto modelových výrobků byl stanoven obsah základních živin a kontaminantů, hodnocen měrný objem výrobku a provedeno senzorické hodnocení. Materiál a metody Ozimé odrůdy pšenice špaldy Ceralio, pšenice seté Bohemia a žita Askari byly v režimu konvenčního i ekologického zemědělství pěstovány na stanovišti ČZU v Praze-Uhříněvsi. Po dosušení, případně vyloupání byly vzorky předány k dalšímu využití. Vzorky zrna z uvedených odrůd byly semlety na laboratorním mlýnu Bühler a jednotlivé pasáže byly smíchány tak, aby co nejvíce odpovídaly běžným komerčním moukám u pšenice seté pšeničná mouka hladká speciál (T530), u žita setého žitná mouka chlebová (T930) a u pšenice špaldy špaldová mouka celozrnná, jemně mletá. Modelový pekařský výrobek byl připraven z mouky, droždí, soli, cukru a vody dle postupu doporučeného na VŠCHT (Laboratorní práce 2010). Měrný objem byl stanoven pomocí kalibrované nádoby a skleněných kuliček. Analytické metody: obsah sušiny byl stanoven gravimetricky sušením při 105 O C; obsah bílkovin podle Kjeldahla; popel žíháním při 545 O C; tuky po kyselé hydrolýze a extrakci chloroformem; vláknina potravy enzymově gravimetrickou metodou s použitím filtračního zařízení Fibertec; sacharidy a energie byly získány dopočtem; vitamin B1 metodou HPLC na reverzní fázi; vitamin B2 lumiflavinovou metodou; vitamin B6 mikrobiologickou metodou se Saccharomyces uvarum ATCC 9080; kyselina pantothenová mikrobiologickou metodou s Lactobacillus plantarum ATCC 8014; vitamin E metodou HPLC v extraktu po zmýdelnění; celkové karotenoidy spektrofotometrií v extraktu po zmýdelnění; celkový obsah polyfenolických látek (CPL) spektrofotometrickou metodou s využitím Folin-Ciocalteuova činidla; antioxidační aktivita (AOA) spektrofotometrickými metodami DPPH a FRAP. Metoda senzorického hodnocení: rozdílová metoda párová zkouška Mykotoxiny byly stanoveny metodou vysoko-účinné kapalinové chromatografie ve spojení s hmotnostní detekcí (UPCL-MS/MS) za použití tandemového hmotnostního spektrometru typu iontová past (QTRAP 5500, AB Sciex). 147

148 CPL (mg GAE/100g suš.) AOA (ug TROLOXU/1g suš.) obsah vitaminů (mg/100g suš.) Výsledky a diskuse Výsledky stanovení základních nutričních složek v zrnu pšenice špaldy Ceralio, pšenice seté Bohemia a žita Askari pěstovaných v režimu konvenčního i ekologického zemědělství jsou uvedeny v tabulce 1. Obsahy vitaminů B 1, B 2, B 6, kyseliny pantothenové, vitaminu E, celkových karotenoidů, celkových polyfenolů a antioxidační aktivita stanovená metodami DPPH a FRAP jsou uvedeny na obr. 1 a 2. Tabulka 2 uvádí výsledky stanovení mykotoxinů. Tabulka 1: Základní nutriční hodnocení zrna plodina (zrno) sušina popel bílkovina tuk vláknina sacharidy energie (g/100g) (g/100g sušiny) (kj/100g suš.) pšenice špalda-konvenční 88,4 2,1 18,3 2,8 18,6 58, pšenice špalda-ekologická 87,8 1,9 17,3 2,8 14,8 63, pšenice setá-konvenční 87,7 1,6 14,0 3,1 19,7 61, pšenice setá-ekologická 87,5 1,7 12,0 2,9 17,0 66, žito seté-konvenční 87,8 1,8 12,3 2,3 17,3 66, žito seté-ekologické 87,8 1,8 11,8 2,3 17,2 66, ,6 1,4 1,2 1 0,8 0,6 0,4 0,2 0 Obr.1: Obsah vitaminů v zrnu pšenice špalda-konvenční (Ceralio) pšenice špalda-ekologická (Ceralio) pšenice setá-konvenční (Bohemia) pšenice setá-ekologická (Bohemia) žito seté-konvenční (Askari) žito seté-ekologické (Askari) Obr.2: Obsah CPL a AOA v zrnu pšenice špalda-konvenční (Ceralio) pšenice špalda-ekologická (Ceralio) pšenice setá-konvenční (Bohemia) CPL DPPH FRAP pšenice setá-ekologická (Bohemia) žito seté-konvenční (Askari) 148

149 Tabulka 2: Obsah vybraných mykotoxinů v zrnu cereálií (ug/kg) plodina (zrno) DON D3G 3-ADON ZON AOH pšenice špalda-konvenční < 5 < 5 9 pšenice špalda-ekologická 7 20 < 5 < 5 20 pšenice setá-konvenční < 5 < 5 6 pšenice setá-ekologická < 5 < 5 9 žito seté-konvenční žito seté-ekologické Z porovnání obsahu základních nutrientů v konvenčně a ekologicky pěstovaných vzorcích lze konstatovat, že v konvenčně pěstované variantě byl stanoven mírně vyšší obsah bílkovin a u pšenice špaldy a pšenice seté též vyšší obsah vlákniny. Obsahy hydrofilních vitaminů jsou srovnatelné pro obě varianty. Rovněž u antioxidační aktivity a obsahu polyfenolových látek nabyly nalezeny významné rozdíly. Výjimkou je antioxidační aktivita zjištěná metodou FRAP a charakterizující redukční vlastnosti, která byla o cca 20% vyšší u ekologicky pěstovaného žita, ve srovnání s konvenčně pěstovaným. Vitamin E je u ekologické varianty nižší než u konvenční, u pšenice seté a žita činí rozdíl 30 a 20%, resp. Ze skupiny testovaných mykotoxinů byly všechny typy vypěstovaných plodin pozitivní na hlavní zástupce fusariových mykotoxinů, tedy deoxynivalenol (DON), jeho dvě konjugované ( maskované ) formy DON-3-glukosid (D3G) a 3-acetylDON (3-ADON). Z fusariových mykotoxinů byl navíc na vysokých hladinách detekován mykotoxin zearalenon (ZON), naopak na prakticky stopových hladinách byl detekován zástupce alternariových toxinů, alternariol (AOH). U pšenice seté, pšenice špaldy i žita byly hladiny DON většinou nižší v případě ekologického systému pěstování vzorků nebo rozdíly nebyly příliš významné. Hodnocené obiloviny byly zpracovány na laboratorním mlýnu Bühler a byly připraveny mouka pšeničná T530 (šrotové mouky 1, 2, 3 + vymílací mouka 1; výtěžnost cca 50 %), mouka špaldová celozrnná, jemně mletá (šrotové mouky 1, 2, 3 + vymílací mouky 1, 2, 3 + mouky vytlučené z hrubých a jemných otrub; výtěžnost cca 80 %) a mouka žitná T930 (vymílací mouky 2, 3 + mouky vytlučené z hrubých a jemných otrub; výtěžnost cca 40 %).. Výsledky jejich nutričního hodnocení a obsahu mykotoxinů jsou v tabulkách 3 a 4. Tabulka 3: Základní nutriční hodnocení mouk mouka sušina popel bílkoviny tuk vláknina sacharidy energie (g/100g) (g/100g sušiny) (kj/100g suš.) špaldová celozrn.konv. 86,8 0,8 13,0 2,5 4,2 70, špaldová celozrn.eko. 87,5 0,7 14,5 2,4 4,0 69, pšeničná T530 konv. 87,0 0,5 12,1 2,2 2,9 69, pšeničná T530 eko. 85,6 0,5 11,1 2,1 2,8 69, žitná T930 konv. 85,6 0,8 9,0 2,1 4,0 73, žitná T930 eko. 85,2 0,6 8,0 2,1 3,2 74, Tabulka 4 : Obsah mykotoxinů v moukách a v modelovém pečivu plodina mouka pečivo DON D3G ZON 3-ADON DON D3G ZON 3-ADON (ug/kg) (ug/kg) pšenice špalda-konvenční 276 <20 39 <5 239 <20 <5 15 pšenice špalda-ekologická <5 <20 <5 <5 10 <20 <5 22 pšenice setá-konvenční 221 <20 <5 <5 197 <20 <5 <5 pšenice setá-ekologická 76 <20 <5 <5 40 <20 <5 <5 žito seté-konvenční žito seté-ekologické

150 Z nutričního hodnocení vyplývá, že není významný rozdíl mezi moukami z konvenčního a ekologického pěstování. Obsah bílkovin je nejvyšší u mouky špaldové, nejnižší u mouky žitné. Ze skupiny testovaných mykotoxinů byly všechny typy mouk pozitivní na hlavní zástupce fusariových mykotoxinů. Z hlediska legislativy (Nařízení komise ES č. 1126/2007) nevyhověly svým obsahem žitné mouky a to jak z ekologické, tak i konvenční produkce. U žitné mouky z konvenčního pěstování byly překročeny limity pro DON (limit pro obiloviny určené k přímé lidské spotřebě 750 ug/kg) i pro ZON (limit pro obiloviny určené k přímé lidské spotřebě 75 ug/kg). Žitná mouka z ekologického pěstování nevyhovovala obsahem DON. Ve všech případech byl však zjištěn vyšší obsah mykotoxinů v moukách z konvenčně pěstovaných obilovin. Pekařské výrobky připravené z výše uvedených mouk z pšenice seté Bohemia, pšenice špaldy Ceralio a žita setého Askari byly připraveny jako modelové kynuté pečivo (Laboratorní práce 2010) vždy z jednoho druhu mouky. Modelové vzorky o hmotnosti cca 200g byly připraveny ve dvou nezávislých pokusech, pro analýzu nutričních faktorů byl připraven směsný vzorek z obou pečení. Výsledky jsou uvedeny v tabulce 5. Tabulka 4 uvádí obsahy mykotoxinů v použitých moukách a modelovém pečivu. U jednotlivých pekařských výrobků byl jako jeden z ukazatelů technologické jakosti stanoven měrný objem u 4-6 kusů modelového pečiva (tabulka 6). Z výsledků vyplývá, že z hlediska obsahu nutričních faktorů ani v případě pečiva není rozdíl v použití konvenčně a ekologicky pěstovaných obilovin. Obsah bílkovin odpovídá trendu obsahu v moukách. Z hodnocení obsahu mykotoxinů je patrné, že ani žitné pečivo nesplňuje předepsané hygienické limity. Rozdíly byly nalezeny při hodnocení měrného objemu pečiva. Pečivo z ekologicky pěstovaných obilovin vykazuje mírně vyšší měrný objem. Tabulka 5: Základní nutriční hodnocení modelových pekařských výrobků Pekařský výrobek na bázi mouky sušina popel bílkovina tuk celk.sacharidy energie (g/100g) (g/100g sušiny) (kj/100g suš.) špaldová mouka celozrn.konv. 65,2 2,4 15,9 2,1 44, špaldová mouka celozrn.eko. 65,9 2,3 15,2 2,5 45, pšeničná mouka T530 konv. 64,9 2,1 12,8 2,4 47, pšeničná mouka T530 eko. 64,4 2,1 11,4 2,6 48, žitná mouka T930 konv. 85,6 2,5 9,2 3,2 49, žitná mouka T930 eko. 85,2 2,4 8,9 3,1 50, Tabulka 6: Porovnání měrných objemů (ml/100g) všech modelových vzorků vzorek pšenice setá (Bohemia) pšenice špalda (Ceralia) žito seté (Askari) ekologická konvenční ekologická konvenční ekologické konvenční průměr 262,6 247,4 202,2 197,8 116,8 111,3 smodch. 4,2 4,6 9,7 7,3 4,2 1,8 cv.(%) 1,6 1,9 4,8 3,7 3,6 1,6 Pekařské výrobky z pšeničné a špaldové mouky byly hodnoceny též ze senzorického hlediska. Výrobky ze žitné mouky byly, vzhledem k překročeným limitům obsahu mykotoxinů, z tohoto hodnocení vyloučeny. K senzorickému hodnocení párovou rozdílovou zkouškou byly předloženy 2 vzorky pečiva připraveného ze surovin vypěstovaných v ekologickém zemědělství a 2 vzorky pečiva připraveného ze stejných surovin, vypěstovaných v konvenčním zemědělství. Úkolem hodnotitelů bylo rozhodnout, zda existuje, popř. neexistuje mezi dvěma vzorky rozdíl. Hodnocení se účastnilo 17 hodnotitelů. V případě pšeničného pečiva byl rozdíl mezi konvenčně a ekologicky pěstovanými surovinami označen 150

151 jedním hodnotitelem, v případě špaldového pečiva 10-ti hodnotiteli. Výsledky byly statisticky vyhodnoceny podle tabulky (Pokorný 1993), kde je uveden minimální počet odpovědí nutný pro zamítnutí nulové hypotézy (tzn. neexistuje rozdíl mezi vzorky). Počet shodných odpovědí nezbytných pro průkaz platnosti rozdílu na výše uvedené hladině pravděpodobnosti činí 15. Srovnáním výsledků s tabelární hodnotou na hladině pravděpodobnosti P = 99% byla u obou dvojic vzorků potvrzena nulová hypotéza, vzorky jsou shodné a není mezi nimi znatelný rozdíl, tzn. nebyl nalezen rozdíl v organoleptických vlastnostech mezi vzorky pečiva připraveného ze surovin vypěstovaných v ekologickém zemědělství a vzorky pečiva připraveného ze surovin vypěstovaných v konvenčním zemědělství. Závěr Při srovnání obsahů nutričních faktorů v zrnu a moukách z pšenice špaldy Ceralio, pšenice seté Bohemia a žita setého Askari nebyl nalezen rozdíl v základním složení mezi vzorky získanými z ekologicky a konvenčně pěstovaných obilovin. Hladiny hydrofilních vitaminů a antioxidační charakteristiky byly rovněž srovnatelné. Výjimkou byl obsah vitaminu E, který byl vyšší u konvenčně pěstované varianty. Obsah mykotoxinů byl vždy vyšší u produktů konvenčního pěstování. Zrno pšenice a špaldy a mouky pšeničná a špaldová obsahovaly DON a ZON pod hygienickým limitem v obou variantách, žito a mouka žitná nevyhověly hygienickým limitům pro DON a ZON ani v ekologické variantě. Rovněž modelové pečivo připravené z mouk z jednotlivých konvenčně a ekologicky pěstovaných obilovin vykázalo srovnatelné nutriční hodnocení, obsah mykotoxinů sledoval trend nalezený u zrna a mouk. Pečivo připravené z ekologicky pěstovaných variant vykázalo vyšší měrné objemy ve srovnání a konvenčně pěstovanými produkty. Při senzorickém hodnocení vzorků modelového pečiva z pšeničných a špaldových mouk nebyl shledán rozdíl organoleptických vlastností pečiva z ekologicky a konvenčně pěstovaných surovin. Dedikace Tato práce byla podporována z prostředků NAZV v rámci projektu QI111B154 Použitá literatura 1. Hajšlová J., Schulzová V. (2006): Porovnání produktů ekologického a konvenčního zemědělství. Odborná studie VŠCHT, Vysoka škola chemicko-technologická v Praze, ISBN Laboratorní práce z chemie a analytiky sacharidů Nařízení komise (ES) č. 1126/2007 ze dne 28. září Pokorný J. (1993): Metody senzorické analýzy potravin a stanovení senzorické jakosti. ÚZPI 5. Praha, str , ISBN

152 VYTVÁŘENÍ MODELŮ PŘEDPOVĚDNÍ MIKROBIOLOGIE Predictive microbial models forming Erban V., Eichlerová E., Landfeld A., Čírtková V., Houška M. Výzkumný ústav potravinářský Praha, v. v. i. Kontaktní adresa 1. autora: RNDr. Vladimír Erban, CSc. Výzkumný ústav potravinářský Praha, Radiová Praha 10 Abstrakt Cílem práce je charakterizace primárních a sekundárních předpovědních modelů růstu mikroorganismů na základě růstových křivek mikroorganismu Listeria innocua, za různých podmínek prostředí (teplota, aktivita vody a ph) Klíčová slova předpovědní modely, Listeria, podmínky prostředí Abstract The goal of this study characterization primary and secondary predictive models of microbial growth on the grounds of growth curves Listeria and under influence various surroundings as temperature, water activity and ph Key words predictive models, Listeria, surrounding conditions Úvod Jako u všech mikroorganismů jsou podmínky růstu dány jednak zdrojem živin a jednak fyzikálně chemickými podmínkami prostředí jako je ph, aktivita vody (Aw), teplota, a podobně. Pro růst mikroorganismů jsou významné pouze některé. Je možné předpokládat, že pro růst mikroorganismů je potřebné množství živin v prostředí dostatečné a je možné je modelově nahradit živnými medii. Závislost růstu mikroorganismu na kritických hodnotách fyzikálních faktorů uvádějí různé tabulky. Ty však předpokládají, že ostatní faktory mají optimální hodnotu pro růst. Chování mikroorganismů je však významně ovlivněno kombinací hodnot těchto faktorů. Na základě modelových růstových křivek pro různé kombinace hlavních faktorů (ph, Aw a teplota) v předpokládaném rozsahu výskytu v prostředí, jsou vytvořeny modely popisující růst mikroorganismů i pro další kombinace těchto faktorů. Tyto modely jsou demonstrovány na přikladu Listerií, které svými fyziologickými charakteristikami růstu, vysokou adaptabilitou na prostředí a specifickou patogenitou kmenů L. monocytogenes, jsou významným rizikem pro zdravotní bezpečnost potravin. Obecně je možné takovéto modely vytvořit pro každý mikroorganismus. Materiál a Metody Pro studium podmínek růstu Listerií je nutné porovnávat jejich růstové parametry za různých podmínek prostředí. Tyto parametry jsou klíčovou odpovědí na nebezpečí růstu Listerií v konkrétním výrobku za konkrétních provozních a skladovacích podmínek. 152

153 OD wideband OD wideband Vytváření modelů se skládá z následujících kroků: 6. Odhad rozsahu fyzikálních podmínek růstu (ph, Aw a teplota). 7. Naměření souboru růstových křivek pro vybrané kombinace těchto fyzikálních faktorů (primární modely). 8. Ze souboru primárních modelů se vytváří sekundární modely, které charakterizují fyziologické vlastnosti mikroorganismu (lag fáze, rychlost růstu, maximální nárůst a další fyziologické charakteristiky) 9. Vytvoření vlastního matematického modelu (terciárního modelu) tento typ modelu bude demonstrován v přednášce Možnosti využití matematických modelů předpovědní mikrobiologie 10. Na základě tohoto modelu je možné jednak hodnotit adaptační schopnosti modelového organismu a vytipovat kritické oblasti, podle kterých je možné zjistit míru nebezpečí pro výrobek, ve kterém se vyskytují. Na základě výchozích úvah byly měřeny růstové křivky v mediu tryptose phosphate broth TPB (Oxoid). Při přípravě medií bylo vycházeno z dvojnásobné koncentrace surovin, které byly upravovány na vhodnou hodnotu aktivity vody Aw pomocí přídavku solí. Konečná Aw byla kontrolována měřením. Poté byla media rozdělena na alikvotní objemy upravené pomocí HCl a NaOH na požadované ph. Hotová media byla sterilována 15min při 121 C. Médium bylo rozplněno do mikro destiček po 0,2ml, inokulováno 1% různých kmenů Listeria. Inkubace probíhala v Bioscreenu za nepravidelného třepání při širokopásmové vlnové délce, odečty optické denzity OD probíhaly jednou za hodinu. Výsledky a diskuze Primární modely (obr. 1 až 4) jsou souhrnem růstových křivek mikroorganismu při různých fyzikálních podmínkách prostředí: ph 4,5 až 8, Aw 0,92 až 0,998 při 30 C. Recalculated OD values G. curves L.i.; Aw=0,998;30 C 0,800 0,700 0,600 0,500 0,400 0,300 0,200 0,100 0, , , , ,5 0,400-0,500 0,300-0,400 Time (hours) 0,200-0,300 0,100-0,200 0,000-0,100 Experiment name Sample short name Obr. 1: Primární model pro ph 4,5; 5; 5,5; 6; 6,5; 7; 7,5 a 8 pro Aw 0,998, a teplotu 30 C. 0,700-0,800 0,600-0,700 0,500-0,600 Recalculated OD values Growth curves for Aw 0,96 0,500 0,450 0,400 0,350 0,300 0,250 0,200 0,150 0,100 0, Time (hours) 13 0,450-0,500 0,400-0,450 0,350-0,400 0,300-0,350 0,250-0,300 0,200-0,250 0,150-0,200 0,100-0,150 0,050-0,100 0,000-0,050 0,000 9 Experiment name , ,96-7, , ,96-6, , ,96-5, ,96-5 0,96-4,5 Well number + sample short name 153

154 OD wideband ,94-7, , ,94-6, , ,94-5, , ,94-4, ,94-8 OD wideband Obr. 2: Primární model pro ph 4,5; 5; 5,5; 6; 6,5; 7; 7,5 a 8 pro Aw 0,96, a teplotu 30 C. Recalculated OD values Growth curves for Aw 0,94 0,400 0,350 0,300 0,250 0,200 0,150 0,100 0,050 0, Time (hours) ,350-0,400 0,300-0,350 0,250-0,300 0,200-0,250 0,150-0,200 0,100-0,150 0,050-0,100 0,000-0,050 1 Experiment name Well number + sample short name Obr. 3: Primární model pro ph 4,5; 5; 5,5; 6; 6,5; 7; 7,5 a 8 pro Aw 0,94, a teplotu 30 C. Recalculated OD values Growth curves for Aw 0,92 0,120 0,100-0,120 0,100 0,080 0,060 0,040 0, Time (hours) 13 0,080-0,100 0,060-0,080 0,040-0,060 0,020-0,040 0,000-0,020 0, , , , ,5 0, , ,5 0, ,92-5 5,5 0,92-4,5 Experiment name Well number + sample short name Obr. 4: Primární model pro ph 4,5; 5; 5,5; 6; 6,5; 7; 7,5 a 8 pro Aw 0,92, a teplotu 30 C. Podobné primární modely byly naměřené i pro ostatní teploty. Při hodnotě Aw 0,998 (obr. 1) Listerie roste téměř při všech hodnotách ph, kromě ph 4,5, kdy je růst již inhibován a od ph 7 dochází ke zpomalování rychlosti růstu, prodlužování doby lag fáze tj. doby než začne mikroorganismus růst a snižuje se i maximální nárůst mikroorganismu. Při hodnotě Aw 0,96 (obr. 2) dochází k rychlému poklesu rychlosti růstu již od hodnoty ph 7,5 prodlužování doby lag fáze a maximální nárůst je pouze OD 0,5 oproti hodnotě OD 0,8 při Aw 0,998. Při hodnotě Aw 0,94 (obr. 3) a ph 8 narůstá Listerie pouze do hodnot OD 0,35 po delší době lag fáze a od hodnoty ph 7 je růst minimální. Při hodnotě Aw 0,92 je růst prakticky nulový. Na základě těchto primárních modelů je možné vytvářet sekundární modely. Z každé růstové křivky se odečtou fyziologické parametry růstu například: lag fáze - doba do začátku růstu minimální generační doba - doba potřebná pro zdvojnásobení počtu mikroorganismů a maximální OD při dané teplotě. Tyto hodnoty se poté vynáší do grafu v závislosti na Aw a ph pro danou teplotu. 154

155 0,94 0,96 0, GT[hod] lag.fáze Lag[hod] 38:24:00-43:12:00 33:36:00-38:24:00 28:48:00-33:36:00 24:00:00-28:48:00 19:12:00-24:00:00 14:24:00-19:12:00 9:36:00-14:24:00 4:48:00-9:36:00 0:00:00-43:12:00 38:24:00 33:36:00 28:48:00 24:00:00 19:12:00 14:24:00 9:36:00 4:48:00 0:00:00 5 5,5 6 6,5 7 7,5 8 ph 0,94 0,96 0,98 1 Obr. 4:48:00 5: Délka lag fáze pro různé hodnoty ph a Aw při teplotě 30 C Aw mingt Obr. 6: doba minimální generační doby pro různé hodnoty ph a Aw při teplotě 30 C Na základě těchto modelů je možné při znalosti vstupních podmínek ph a Aw z modelu odečíst a odhadnout pro danou teplotu dobu, po které začne Listerie růst a jaká bude její rychlost růstu, popřípadě další parametry. Tyto modely však vyjadřují danou charakteristiku pouze pro jednu teplotu. Pro praktické použití je zapotřebí soubor všech charakteristik pro každou teplotu. To je v praxi nepohodlné, nepřesné a nepřehledné, nehledě na obtížnou interpolaci dat například pro hodnoty teplot, které nejsou přímo naměřené. Matematické modely Vzhledem ke značnému množství dat a obtížné orientaci v přehledových grafech s malou přesností odečtu je výhodné po statistickém vyhodnocení vytvořit matematický model růstu v počítači, který umožňuje zadávat do počítače konkrétní hodnoty prostředí a program vyhodnotí odpovídající statistické růstové křivky. Tento program bude demonstrován při přednášce Možnosti využití matematických modelů předpovědní mikrobiologie. Závěr Aw K popisu růstu mikroorganismů za různých vnějších podmínek jsou vhodné modely růstu. Primární a sekundární modely popisují růst mikroorganizmů s malou přehledností a nízkou praktickou použitelností. Proto je nutné vytvářet terciální počítačové modely, které jsou uživatelsky přívětivé. Dedikace ph 43:12:00 38:24:00 33:36:00 28:48:00 24:00:00 19:12:00 14:24:00 9:36:00 4:48:00 0:00:00 38:24:00-43:12:00 33:36:00-38:24:00 28:48:00-33:36:00 24:00:00-28:48:00 19:12:00-24:00:00 14:24:00-19:12:00 9:36:00-14:24:00 4:48:00-9:36:00 0:00:00-4:48:00 Práce byla podpořena grantovou agenturou MŠMT č. 2B

156 Použitá literatura 1. McMeekin T.A., Olley J.N., Ross T., Ratkowsky D.A., Predictive mikrobiology theory and application, Reseach Studies Press LTD, ANON1991: Recommendations by The National Advisory Committee on microbiological criteria for foods: The pathogenesis and virulence of Listeria monocytogenes, N7/2/efb5c39e5bc64991b40c25af075906b1 3. Aarnisalo,K., Vihavainen,E., Rantala,L., Maijala,R., Suihko,M. L., Hielm,S., Tuominen,P., Ranta,J., Raaska,L., Use of results of microbiological analyses for riskbased control of Listeria monocytogenes in marinated broiler legs, International Journal of Food Microbiology, 3, , Angelidis,A., Boutsiouki,P., Papageorgiou,D.,: Loss of viability of Listeria monocytogenes in contaminated processed cheese during storage at 4, 12 and 22 C. Food Microbiology, 27, , Augustin,J. Ch., Rosso,L., Carlier,V.: A model describing the effect of temperature history on lag time for Listeria monocytogenes International Journal of Food Microbiology 57, ,

157 VÝVOJ A TESTOVÁNÍ SYNTETICKÉ DNA PRO MONITORING INHIBICÍ/ENHANCERŮ OVLIVŇUJÍCÍCH KVANTITATIVNÍ REAL-TIME PCR Development and testing of synthetic DNA for monitoring of inhibition/enhancers affecting quantitative real-time PCR 1 Hodek J.,, 2 Demnerová K., 1 Ovesná J. 1 Výzkumný ústav rostlinné výroby, V.v.i. Praha 2 Vysoká škola chemicko-technologická v Praze Kontaktní adresa 1. autora: Mgr. Jan Hodek, Výzkumný ústav rostlinné výroby, v.v.i., Drnovská 507, Praha 6, Abstrakt Metoda Real-time PCR je nejpoužívanější metodou pro kvantifikaci DNA. Výsledek analýzy může být výrazně ovlivněn inhibitory nebo enhancery PCR. Pro odhalení přítomnosti látek takové povahy v reakční směsi byla vyvinuta syntetická DNA. Byla optimalizována Real-time PCR reakce pro kvantifikaci syntetické DNA, byla ověřena specificita reakce, dynamický rozsah reakce a efektivita reakce. Syntetická DNA je připravena pro použití při monitoringu inhibitorů/enhancerů v Real-time PCR. Klíčová slova syntetická DNA, DNA kvantifikace, PCR inhhibitor, PCR enhancer Abstract Real-time PCR is the most widely used method for the DNA quantification. Result of analysis can be significantly affected by PCR inhibitors or enhancers. To detect the presence of that kind substances in the reaction mixture was developed synthetic DNA. Real-time PCR for synthetic DNA quantification was optimized, the reaction specificity was verified, dynamic range of reaction was determined as well as the reaction efficiency. Synthetic DNA is ready for use in the monitoring of inhibitors/enhancers in Real-time PCR. Key words synthetic DNA, DNA quantification, PCR inhibitor, PCR enhancer Úvod Metoda polymerázové řetězové reakce v reálném čase (Real-time PCR) je v současnosti nejpoužívanější molekulárně-biologickou metodou pro kvantifikaci nukleových kyselin. Mezi základní parametry charakterizující Real-time PCR patří specificita reakce, dynamický rozsah reakce, mez detekce, mez kvantifikace a efektivita reakce. Tyto parametry vymezují rozsah aplikace metody Real-time PCR pro spolehlivou kvantifikaci nukleových kyselin a vztahují se ke specifickému typu nukleových kyselin, které jsou danou metodou 157

158 stanovovány. Obecně se tyto charakteristiky stanovují experimentálně, několikanásobným nezávislým opakováním reakce (Burns et al., 2006). Optimalizovaná a charakterizovaná metoda Real-time PCR se často aplikuje pro kvantifikaci nukleových kyselin z různých zdrojů (různých matric analyzovaného vzorku), výkonnostní charakteristiky reakce se však pro jednotlivé matrice mohou lišit (Gryson, 2010). Proto je doporučeno u vzorků, s nimiž je pracováno poprvé nebo došlo-li k jakýmkoliv změnám vzhledem ke zpracování vzorku (během homogenizace vzorku, extrakce DNA, purifikace DNA apod.), nejprve monitorovat efekt Real-time PCR na vzorky tím, že se vzorky definovaným způsobem ředí a hodnotí se změna poklesu fluorescenčního signálu, případně linearita ředící řady (ISO 21570, 2005). Výskyt PCR inhibitorů/enhancerů je doporučeno sledovat také v analytickém běhu Real-time PCR (Wilson, 1997). Nedostatek v monitoringu efektu Real-time PCR metodou ředěním vzorku je v nemožnosti použítí v případě nízkého obsahu analytu (cílové nukleové kyseliny) ve vzorku. Ředěním vzorku se dostane fluorescenční signál reakce pod mez kvantifikace nebo pod mez detekce, oba případy pak znemožní další kvantifikaci nukleových kyselin. V rámci této studie byla vyvinuta syntetická dsdna, jejíž použití umožňuje ověřit přítomnost inhibitorů či enhancerů v reakční směsi Real-time PCR. Pro amplifikaci syntetické dsdna byly navrženy primery a fluorescenční sonda a byly optimalizovány reakční podmínky Realtime PCR. Materiál a Metody Návrh syntetické DNA: S využitím volně dostupného počítačového programu (http://www.llamastar.com/phptest/dna.php) byla navržena náhodná DNA sekvence o délce 1000 bp. Návrh amplifikace specifického úseku syntetické DNA: S použitím programu Primer3Plus (Untergasser et al., 2007) byly navrženy primery a sonda pro amplifikaci a detekci 78 bp dlouhého úseku vytvořené DNA sekvence. Specifický 78 bp dlouhý úsek náhodné DNA sekvence byl in-silico testován metodou BLAST (Basic Local Alignment Search Tool) v databázi NCBI z hlediska své podobnosti s DNA a RNA sekvencemi živočišného, rostlinného a bakteriálního původu či se sekvencemi uměle vytvořenými, které jsou do databáze vloženy Kvalita primerů byla in-silico ověřena programem FastPCR (Kalendar et al., 2011). Obě vlákna syntetické DNA ( + i vlákno) o délce 78 bp, oba primery a fluorescenční sondy byly syntetizovány firmou GeneriBiotech (Česká republika). Klonování: Specifický úsek syntetické DNA o délce 78 bp byl klonován do plasmidového vektoru s použitím TOPO TA Cloning Kit (Invitrogen, USA). Plasmid s vloženým úsekem DNA byl označen jako I-CTRL. Plasmid byl vložen do bakteriální konzervy, ve které byl uchováván při -80 C. Před použitím v PCR byla cirkulární forma plasmidu linearizována s použitím enzymu HINDIII, aby byly zajištěny srovnatelné reakční podmínky s lineární genomickou DNA testovaného vzorku v PCR (Hou et al., 2010). Sekvenace: Sekvenací úseku I-CTRL s použitím primerů M13 byla ověřena nukleotidová sekvence vloženého úseku DNA do plasmidu. Sekvenace byla provedena s použitím komerční soupravy BigDye Terminator v3.1 (Applied Biosystems, USA) v kapilárním genetickém analyzátoru ABI 3130 (Applied Biosystems, USA). Sekvenace byla provedena nezávisle 4x. Real-time PCR: Real-time PCR pro kvantitativní analýzu syntetické DNA s fluorescenční detekcí (fluorescenční značka FAM) byla optimalizována v přístroji 7900HT Fast Real-Time 158

159 PCR system (Applied Biosystems, USA). Reakce probíhala v objemu 25 µl, finální koncentrace jednotlivých složek reakční směsi bylo následující: 1 x 2x TaqMan Universal PCR Master Mix (Applied Biosystems, USA), 250 nm primeru F, 250 nm primeru R, 80 nm sondy, doplnit vodou do 20 µl, k reakční směsi se přidalo 5 µl templátové DNA. Teplotní profil reakce se sestával z 50 C po dobu 2 minut, 95 C po dobu 10 minut, poté následoval 45 x cyklus 95 C po dobu 15 sekund a 60 C po dobu 1 minuty, během které byl odečítán fluorescenční signál. Výsledky a diskuze Byla navržena náhodná sekvence DNA o délce 1000 bp. Procentuálním zastoupením jednotlivých nukleotidů A:G:C:T bylo 24,3 : 24,6 : 25,7 : 25,4 % (Obrázek 1). Obrázek 1. Náhodná sekvence DNA (5 3 ) o délce 1000 bp V databázi NCBI bylo ověřeno, že navržená syntetická DNA není významně podobná žádné z DNA či cdna sekvencí, které jsou v databázi zveřejněné. Hodnota E-value pro nejpodobnější sekvence byla 4,4 (sekvence v NCBI pod kódem XM_ , XM_ , CR ), což dopovídá 2, 3 a 4 % pokrytí srovnávaných sekvencí při maximální identitě sekvencí 96, 83 a 88 %. Byly navrženy primery a fluorescenční sonda pro amplifikaci a detekci specifického úseku syntetické DNA sekvence o délce 78 bp (Tabulka 1). Bylo ověřeno, oligonukleotidy pro PCR netvoří dimery. Specificita primerů a sondy byla in-silico ověřena v databázi NCBI. Pro forward primer byla vygenerována hodnota E-value = 13, pro revers primer E-value = 3,3 a pro sondu byla E-value = 14. To odpovídá pokrytí 80% (forward primer), 85% (revers primer) a 85% (sonda). Nebyla nalezena žádná DNA sekvence, která by byla amplifikovaná systémem obou navržených primerů ani systémem sondy a revers primeru. 159

160 Tabulka 1. Amplifikovaný úsek syntetické DNA a použité oligonukleotidy pro real-time PCR oligonukleotid nukleotidová sekvence (5 3 ) délka oligonukleotidu zdroj I-CTRL AGGCGGCTAGATGTGTAACG 78 bp tato práce CTTCAATTTCGAACAATGTA CCAGGTCGGCGCGATTATTT CTAGCCCGACAGGTCTGT F AGGCGGCTAGATGTGTAACG 20 bp tato práce R ACAGACCTGTCGGGCTAGAA 20 bp tato práce Sonda 6-FAM-GAACAATGTACCAGGTCGGC-MGBNFQ 20 bp tato práce Experimentálně byly optimalizovány reakční podmínky Real-time PCR pro kvantifikaci specifického úseku syntetické DNA sekvence. Byla ověřena specifita navržených primerů při daných reakčních podmínkách byl výsledek PCR negativní při použití přirozených DNA templátů (DNA kulturních rostlinných druhů, bakteriální a plasmidová DNA). Byla připravena plasmidová kontrola I-CLTR s inzertem syntetické DNA o délce 78 bp. Očekávaná sekvence vložené DNA byla potvrzena sekvenací plasmidu I-CTRL. Sekvenace byla provedena nezávisle 4x. Pro určení vhodného množství DNA plasmidu I-CTRL do reakce byly provedeny 4 nezávislé real-time PCR s počáteční koncentrací plasmidu v reakci 10 ng/µl. Koncentrace DNA plasmidu byla určena spektrofotometricky na UV spektrofotometru NanoPhotometer (Implen, Německo). Výpočtem z molární hmotnosti plasmidu I-CTRL (molární hmotnost zjištěná na základě znalosti počtu bází vzhledem k průměrné molární hmotnosti jedné báze) byl přes výpočet látkového množství spočítán s použitím Avogadrovy konstanty počet kopií DNA v reakci (Tabulka 2). Tabulka 2. Výpočet počtu kopií DNA plasmidu I-CTRL HMOTNOST DNA [g] MOLÁRNÍ HMOTNOST [g/mol] LÁTKOVÉ MNOŽSTVÍ [mol] AVOGADROVA KONSTANTA POČET ČÁSTIC [kopie DNA] ,5 2, , , Dalších koncentračních bodů bylo dosaženo ředěním původního roztoku DNA vodou pro PCR v poměru 1:9. Jednotlivé body ředění a dosažené Ct hodnoty v Real-time PCR jsou uvedeny v Tabulce 3. Obrazový výstup softwaru SDS pro real-time PCR (Applied Biosystems, USA), je uveden na Obrázku 2. Tabulka 3. Ředící řada plasmidu I-CTRL a Ct hodnoty, odpovídající jednotlivým koncentracím DNA KONCENTRACE HODNOTA Ct DNA [ng/µl] Průměrná hodnota ze 4 opakování Směrodatná odchylka 10 9,3635 9,2044 9,907 9,9601 9,6088 0, , , , , ,7254 0,3618 0,1 15, , , , ,2021 0,2508 0,01 17, ,386 18, ,695 18,3643 0,3196 0,001 22, ,11 21, , ,7781 0,4821 0, , , , ,873 25,3726 0,2897 0, , , , , ,4649 0,5581 0, , , ,242 32,453 31,538 0,

161 Obrázek 2. Obrazový výstup ředící řady DNA v real-time PCR Jako nejvhodnější koncentrace pro real-time PCR byla experimentálně určena koncentrace 0,01 ng/µl plasmidu I-CTRL, což odpovídá 12, kopiím DNA. Průměrná hodnota Ct pro tuto vstupní koncentraci plasmidu I-CTRL ze 4 nezávislých měření odpovídá hodnotě 18,3643. Při plánovaném využití plasmidu, kdy by DNA plasmidu byla ředěna DNA analyzovaného vzorku v poměru 1:9, je očekávaný posun signálu o cca 3,3 Ct, tzn. z 18,3643 Ct na cca 21,7 Ct. Obě tyto hodnoty jsou v mezích běžně používaného dynamického rozsahu real-time PCR. Ve 4 nezávislých opakováních byla testována efektivita real-time PCR s použitím plasmidu I-CTRL a detekcí 6-FAM fluoroforu. Efektivita reakce vypočítána z poklesu fluorescenčního signálu pětibodové kalibrační křivky, která byla připravena ředěním plasmidu I-CTRL o počáteční koncentraci 0,01 ng/µl. Ředění bylo provedeno vodou pro PCR v poměru 1:9. V Tabulce 4 jsou uvedeny jednotlivé body kalibrační křivky a výsledné Ct hodnoty z realtime PCR. Na Obrázku 3 jsou znázorněny kalibrační přímky s výpočtem směrnice přímky y a s výpočtem efektivity reakce E podle vzorce E= (10-1/y -1) 100. Tabulka 4. Ředící řada plasmidu I-CTRL a Ct hodnoty, odpovídající jednotlivým koncentracím DNA KONCENTRACE DNA [ng/µl] MNOŽSTVÍ DNA V REAKCI [ng] POČET KOPIÍ DNA V REAKCI HODNOTA Ct ,01 0,05 12, , , , ,0585 0,001 0,005 12, , , , ,356 0,0001 0, , , ,506 25, ,6613 0, , ,523 28,68 28,532 29,3783 0, , , , , ,







Ústav chemie a analýzy potravin. Mykotoxiny. Prof. Ing. Jana Hajšlová, CSc. Ing. Marta Kostelanská

Ústav chemie a analýzy potravin. Mykotoxiny. Prof. Ing. Jana Hajšlová, CSc. Ing. Marta Kostelanská Mykotoxiny Zpracovatelé: Prof. Ing. Jana Hajšlová, CSc. Ing. Marta Kostelanská Zpracováno v rámci projektu MŠMT 2B06118 Vliv technologického zpracování na osud nutričně významných látek a kontaminantů



VLIV DÁVKY A FORMY DUSÍKATÉ VÝŽIVY NA VÝNOS A OBSAH DUSÍKATÝCH LÁTEK V ZRNU Karel KLEM Agrotest fyto, s.r.o. VLIV DÁVKY A FORMY DUSÍKATÉ VÝŽIVY NA VÝNOS A OBSAH DUSÍKATÝCH LÁTEK V ZRNU Materiál a metodika V lokalitě s nižší půdní úrodností (hlinitopísčitá půda s nízkým obsahem


Agronomická fakulta. Ústav pěstování, šlechtění rostlin a rostlinolékařství. Zemědělská 1, Brno, Česká republika. Report č.

Agronomická fakulta. Ústav pěstování, šlechtění rostlin a rostlinolékařství. Zemědělská 1, Brno, Česká republika. Report č. Mendelova univerzita v Brně Agronomická fakulta Ústav pěstování, šlechtění rostlin a rostlinolékařství Zemědělská 1, 613 00 Brno, Česká republika Report č.2 Typ Produkt Indikace Plodina Lokalita Maloparcelní


Kořenový systém plodin jako adaptační opatření na sucho

Kořenový systém plodin jako adaptační opatření na sucho Sucho a degradace půd v České republice - 2014 Brno 7. 10. 2014 Kořenový systém plodin jako adaptační opatření na sucho Vodní provoz polních plodin Ing. Jana Klimešová Ing. Tomáš Středa, Ph.D. Mendelova


Indikátory pro polní plodiny v rámci výzkumného záměru

Indikátory pro polní plodiny v rámci výzkumného záměru Indikátory pro polní plodiny v rámci výzkumného záměru Výzkumný záměr: Biologické a technologické aspekty udržitelnosti řízených ekosystémů a jejich adaptace na změnu klimatu Studium polních plodin v souvislosti






EFFECT OF MALTING BARLEY STEEPING TECHNOLOGY ON WATER CONTENT EFFECT OF MALTING BARLEY STEEPING TECHNOLOGY ON WATER CONTENT Homola L., Hřivna L. Department of Food Technology, Faculty of Agronomy, Mendel University of Agriculture and Forestry in Brno, Zemedelska


Zjišťování a stanovení kontaminujících látek při intervenčním nákupu obilovin

Zjišťování a stanovení kontaminujících látek při intervenčním nákupu obilovin Zjišťování a stanovení kontaminujících látek při intervenčním nákupu obilovin Komise Evropských společenství jasně deklaruje, že v zájmu ochrany veřejného zdraví je nezbytné udržet množství kontaminujících


Fungicidní pokusy u ozimé pšenice v roce 2011 na pracovištích firmy SELGEN

Fungicidní pokusy u ozimé pšenice v roce 2011 na pracovištích firmy SELGEN Fungicidní pokusy u ozimé pšenice v roce 2011 na pracovištích firmy SELGEN V roce 2011 byl netypický výskyt houbových chorob na obilninách. Vlivem suchého a poměrně teplého jara se choroby objevovaly jen


nový postřikový fungicid se zcela unikátním mechanismem účinku a bezkonkurenčně dlouhodobým účinkem na ochranu pšenice a ječmene proti padlí travnímu

nový postřikový fungicid se zcela unikátním mechanismem účinku a bezkonkurenčně dlouhodobým účinkem na ochranu pšenice a ječmene proti padlí travnímu Talius nový postřikový fungicid se zcela unikátním mechanismem účinku a bezkonkurenčně dlouhodobým účinkem na ochranu pšenice a ječmene proti padlí travnímu 1 Přednosti použití dlouhodobá účinnost na padlí



ÚSTŘEDNÍ KONTROLNÍ A ZKUŠEBNÍ ÚSTAV ZEMĚDĚLSKÝ PŘEHLED ODRŮD 2013 PŠENICE JARNÍ ÚSTŘEDNÍ KONTROLNÍ A ZKUŠEBNÍ ÚSTAV ZEMĚDĚLSKÝ PŘEHLED ODRŮD 2013 PŠENICE JARNÍ Pšenice jarní patří z pohledu ozimé pšenice a jarního ječmene pouze k doplňkovým plodinám. Její osevní plochy kolísají na


Aktifol Mag. Zroj: Ditana-odrůda Mulan, ZS Kluky-odrůda Tobak, VURV Piešťany odrůda Golem

Aktifol Mag. Zroj: Ditana-odrůda Mulan, ZS Kluky-odrůda Tobak, VURV Piešťany odrůda Golem Aktifol Mag podpora fungicidního ošetření zvětšení asimilační plochy rostlin zvýšení výnosu Pšenice ozimá Zdravé porosty pšenice mají vyšší šanci dosáhnout lepších výnosů, než porosty napadené listovými



ÚSTŘEDNÍ KONTROLNÍ A ZKUŠEBNÍ ÚSTAV ZEMĚDĚLSKÝ PŘEHLED ODRŮD 2012 PŠENICE JARNÍ ÚSTŘEDNÍ KONTROLNÍ A ZKUŠEBNÍ ÚSTAV ZEMĚDĚLSKÝ PŘEHLED ODRŮD 2012 PŠENICE JARNÍ Pšenice jarní patří z pohledu ozimé pšenice a jarního ječmene pouze k doplňkovým plodinám. Její osevní plochy kolísají na


Ozimá pšenice. SELGEN, a. s. Stupice 24, 250 84 Sibřina tel.: 281 091 443, 46; fax: 281 971 732 e-mail: selgen@selgen.cz, www.selgen.

Ozimá pšenice. SELGEN, a. s. Stupice 24, 250 84 Sibřina tel.: 281 091 443, 46; fax: 281 971 732 e-mail: selgen@selgen.cz, www.selgen. Ozimá pšenice Sultan PEKAŘSKÁ JAKOST Odrůdová agrotechnika SELGEN, a. s. Stupice 24, 250 84 Sibřina tel.: 281 091 443, 46; fax: 281 971 732 e-mail: selgen@selgen.cz, www.selgen.cz Obsah Úvod............................................................


Lze zopakovat výnosy jarního ječmene, kterých bylo dosaženo v loňském roce?

Lze zopakovat výnosy jarního ječmene, kterých bylo dosaženo v loňském roce? Lze zopakovat výnosy jarního ječmene, kterých bylo dosaženo v loňském roce? Váňová M., Růžková S., Tvarůžek L. Agrotest fyto s.r.o., Havlíčkova 2787, Kroměříž Název předkládaného textu je velmi provokativní,



VÝNOS A KVALITA SLADOVNICKÉHO JEČMENE PŘI HNOJENÍ DUSÍKEM A SÍROU. Ing. Petr Babiánek Mendelova univerzita v Brně Ústav agrochemie, půdoznalství, mikrobiologie a výživy rostlin VÝNOS A KVALITA SLADOVNICKÉHO JEČMENE PŘI HNOJENÍ DUSÍKEM A SÍROU Ing. Petr Babiánek Školitel: doc. Ing. Pavel


Rizika výskytu fuzarióz pro produkci bioetanolu z pšenice

Rizika výskytu fuzarióz pro produkci bioetanolu z pšenice Rizika výskytu fuzarióz pro produkci bioetanolu z pšenice RISKS OF THE FUSARIUM INFESTATION FOR BIOETHANOL PRODUCTION FROM WHEAT Ivana Capouchová 1, Marta Kostelanská 2, Daniela Erhartová 1, Evženie Prokinová


Zakládání porostů jarního ječmene z pohledu dlouhodobých pokusů

Zakládání porostů jarního ječmene z pohledu dlouhodobých pokusů Zakládání porostů jarního ječmene z pohledu dlouhodobých pokusů Zakládání kvalitních porostů jarního ječmene je jedním z rozhodujících faktorů podílejících se na tvorbě výnosů. Rozdílné systémy hospodaření


Ječmen setý. Ječmen setý

Ječmen setý. Ječmen setý Ječmen setý Význam pro krmné účely potravinářství farmaceutický průmysl (maltózové sirupy) pro výrobu sladu - pěstování sladovnického ječmene je náročnější Biologické vlastnosti: forma: ozimá i jarní výška


Úzkořádková technologie pěstování kukuřice. Smutný V., Šedek A.

Úzkořádková technologie pěstování kukuřice. Smutný V., Šedek A. Úzkořádková technologie pěstování kukuřice Smutný V., Šedek A. MENDEL- INFO 2017, Žabčice, 16. 2. 2017 Proč měnit technologii? Výměra kukuřice se v osevních postupech stále zvyšuje. - bioplynové stanice





Organizace a kontrola pěstování GM plodin v ČR. Ing. Jana Trnková MZe, odbor rostlinných komodit

Organizace a kontrola pěstování GM plodin v ČR. Ing. Jana Trnková MZe, odbor rostlinných komodit Organizace a kontrola pěstování GM plodin v ČR Ing. Jana Trnková MZe, odbor rostlinných komodit Geneticky modifikované plodiny GM plodiny, transgenní rostliny změněn dědičný materiál (DNA) pomocí genových


Půdní a zemědělské sucho

Půdní a zemědělské sucho Zlepšování základních půdních vlastností a eliminace dopadů sucha na výši produkce plodin pomocí aplikace půdních aktivátorů Půdní a zemědělské sucho Konference s mezinárodní účastí Kutná hora, 28. 29.


Kvalita pšenice sklizně 2012 v ČR s bližším pohledem na vybrané odrůdy. Ondřej Jirsa, Ivana Polišenská, Slavoj Palík; Agrotest fyto, s.r.o.

Kvalita pšenice sklizně 2012 v ČR s bližším pohledem na vybrané odrůdy. Ondřej Jirsa, Ivana Polišenská, Slavoj Palík; Agrotest fyto, s.r.o. Kvalita pšenice sklizně 2012 v ČR s bližším pohledem na vybrané odrůdy Ondřej Jirsa, Ivana Polišenská, Slavoj Palík; Agrotest fyto, s.r.o., Kroměříž Souhrn Obsahem příspěvku je vyhodnocení dosažené pekárenské


Jiří Skládanka a Libor Kalhotka Agronomická fakulta Mendelovy univerzity v Brně

Jiří Skládanka a Libor Kalhotka Agronomická fakulta Mendelovy univerzity v Brně Jiří Skládanka a Libor Kalhotka Agronomická fakulta Mendelovy univerzity v Brně Tato prezentace je spolufinancována z Evropského sociálního fondu a státního rozpočtu České republiky Bakterie Enterobacteriaceae






ČESKÁ REPUBLIKA ÚSTŘEDNÍ KONTROLNÍ A ZKUŠEBNÍ ÚSTAV ZEMĚDĚLSKÝ Držitel certifikátu ISO 9001:2008 Národní odrůdový úřad ČESKÁ REPUBLIKA ÚSTŘEDNÍ KONTROLNÍ A ZKUŠEBNÍ ÚSTAV ZEMĚDĚLSKÝ Držitel certifikátu ISO 9001:2008 Národní odrůdový úřad Nově registrované odrůdy (jaro 2014) Ječmen jarní BRITNEY Britney je sladovnická polopozdní



MYKOTOXINY V KUKUŘICI MYKOTOXINY V KUKUŘICI MYKOTOXINY V MYKOTOXINY V KUKUŘICI KUKUŘICI RNDr. Jan Nedělník, Ph.D., Ing. Klára Konečná Výzkumný ústav pícninářský, spol. s r.o., Zemědělský výzkum, spol. s r.o. Troubsko Co jsou mykotoxiny? Produkty





Aktuální situace v oblasti ekologických osiv v ČR. Ing. Petr KONVALINA, Ph.D. Jihočeská univerzita v Českých Budějovicích

Aktuální situace v oblasti ekologických osiv v ČR. Ing. Petr KONVALINA, Ph.D. Jihočeská univerzita v Českých Budějovicích Aktuální situace v oblasti Ing. Petr KONVALINA, Ph.D. Jihočeská univerzita v Českých Budějovicích Úvod: Ekologické zemědělství v ČR (31.12.2010) 3 517 registrovaných podniků 448 202 ha zemědělské půdy


Vliv výživy hospodářských zvířat na kvalitu živočišných produktů s důrazem na zdraví člověka

Vliv výživy hospodářských zvířat na kvalitu živočišných produktů s důrazem na zdraví člověka Vliv výživy hospodářských zvířat na kvalitu živočišných produktů s důrazem na zdraví člověka ODBORNÝ SEMINÁŘ v rámci projektu Aplikace nových poznatků z oblasti výživy hospodářských zvířat do běžné zemědělské


Kvalita pšenice sklizně 2014 v ČR s bližším pohledem na vybrané odrůdy

Kvalita pšenice sklizně 2014 v ČR s bližším pohledem na vybrané odrůdy Kvalita pšenice sklizně 2014 v ČR s bližším pohledem na vybrané odrůdy Ivana Polišenská, Ondřej Jirsa, Dr. Ing. Ludvík Tvarůžek; Agrotest fyto, s.r.o., Kroměříž Souhrn Obsahem příspěvku je vyhodnocení






ZMĚNA KLIMATU A JEJÍ DOPADY NA RŮST A VÝVOJ POLNÍCH PLODIN ZMĚNA KLIMATU A JEJÍ DOPADY NA RŮST A VÝVOJ POLNÍCH PLODIN Zdeněk Žalud 1, Miroslav Trnka 1, Daniela Semerádová 1, Martin Dubrovský 1,2 1 Ústav agrosystémů a bioklimatologie, Mendelova zemědělská a lesnická


K aktuálním problémům pěstebních technologií ozimé pšenice a jarního ječmene

K aktuálním problémům pěstebních technologií ozimé pšenice a jarního ječmene K aktuálním problémům pěstebních technologií ozimé pšenice a jarního ječmene Jan Křen a kol. Ústav agrosystémů a bioklimatologie Aktuální problémy I Na svých pozemcích mám výnosný čtyřhonný osevní postup:


Odrůdy cukrovky registrované v roce 2015

Odrůdy cukrovky registrované v roce 2015 Odrůdy cukrovky registrované v roce 2015 Sugar Beet Varieties Registered in 2015 Lenka Hakaufová ÚKZÚZ, referát semenných okopanin Pro registrační řízení byly v roce 2014 založeny pokusy s cukrovou řepou



UPLATNĚNÁ CERTIFIKOVANÁ METODIKA Fakulta potravinářské a biochemické technologie Ústav analýzy potravin a výživy UPLATNĚNÁ CERTIFIKOVANÁ METODIKA Jana Hajšlová, Zdenka Vepříková, Marta Václavíková, Milena Zachariášová Stanovení mykotoxinů


Ověření účinnosti přípravku Agrosol na výnos a kvalitu produkce brambor

Ověření účinnosti přípravku Agrosol na výnos a kvalitu produkce brambor VÝZKUMNÝ ÚSTAV BRAMBORÁŘSKÝ H a v l í č k ů v B r o d, s. r.o. Dobrovského 2366, 580 01 Havlíčkův Brod O d d ě l e n í p ě s t e b n í c h t e c h n o l o g i í Ověření účinnosti přípravku Agrosol na výnos





půdy na vodostálost Ing. Jaroslava Bartlová, Ph.D. Degradace půdy Půdní struktura

půdy na vodostálost Ing. Jaroslava Bartlová, Ph.D. Degradace půdy Půdní struktura Vliv různr zného zpracování půdy na vodostálost půdních agregátů Ing. Jaroslava Bartlová, Ph.D. Zemědělský výzkum, spol. s r.o. Troubsko, Výzkumný ústav pícninářský, spol. s r.o. Troubsko e-mail: bartlova@vupt.cz


Výzkumný program MZe

Výzkumný program MZe 4.3 Redakčně upravená závěrečná zpráva projektu č. QG60047 Analýza rizika kontaminace obilovin fuzáriovými mykotoxiny studiem kritických faktorů s využitím spektrálních, imunologických a molekulárních





Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie

Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie Leona Leišová Přírodovědecká fakulta UK, Praha 2009 Metody kvantifikace: Nepřímé metody odhad míry


MYKOTOXINY. Jarmila Vytřasová. Univerzita Pardubice Fakulta chemicko-technologická Katedra biologických a biochemických věd

MYKOTOXINY. Jarmila Vytřasová. Univerzita Pardubice Fakulta chemicko-technologická Katedra biologických a biochemických věd MYKOTOXINY Jarmila Vytřasová Univerzita Pardubice Fakulta chemicko-technologická Katedra biologických a biochemických věd Centralizovaný rozvojový projekt MŠMT č. C29: Integrovaný systém vzdělávání v oblasti


Výsledky monitoringu mykotoxinů v krmivech (ÚKZÚZ)

Výsledky monitoringu mykotoxinů v krmivech (ÚKZÚZ) Výsledky monitoringu mykotoxinů v krmivech (ÚKZÚZ) Markéta Pospíchalová marketa.pospichalova@ukzuz.cz Mykotoxiny a zemědělská produkce, 13.3.213, Brno Průchod vzorku laboratoří Akreditace ČSN EN ISO1725:25


Jarní regenerace různých odrůd ozimé pšenice

Jarní regenerace různých odrůd ozimé pšenice Jarní regenerace různých odrůd ozimé pšenice Ing. Radek Vavera, Ph.D., Ing. Pavel Růžek, CSc., Ing. Helena Kusá, Ph.D. Výzkumný ústav rostlinné výroby, v.v.i., Drnovská 507, 161 06, Praha 6 Ruzyně Přestože


Již několik let se stále více zabýváme mykotoxiny zejména proto, že je pomocí vyvíjející se techniky daří stále lépe odhalovat

Již několik let se stále více zabýváme mykotoxiny zejména proto, že je pomocí vyvíjející se techniky daří stále lépe odhalovat Mykotoxiny u zvířat Mykotoxiny u zvířat Úvod Již několik let se stále více zabýváme mykotoxiny zejména proto, že je pomocí vyvíjející se techniky daří stále lépe odhalovat 1. Podstata a původ mykotoxinů


Xtra výnos, Xtra kvalita, Xtra profit.

Xtra výnos, Xtra kvalita, Xtra profit. Xtra výnos, Xtra kvalita, Xtra profit. Široké spektrum účinnosti Preventivní i kurativní fungicidní účinek Zvýšení výnosu a kvality produkce www.syngenta.cz Xtra ochrana proti hlízence Co byste měli vědět


Vliv kapkové závlahy na výnos a kvalitu hroznů Effect of drip irrigation on yield and quality grapes

Vliv kapkové závlahy na výnos a kvalitu hroznů Effect of drip irrigation on yield and quality grapes Rožnovský, J., Litschmann, T., (eds): Závlahy a jejich perspektiva. Mikulov, 18. 19. 3. 2015, ISBN 978-80-87577-47-9 Vliv kapkové závlahy na výnos a kvalitu hroznů Effect of drip irrigation on yield and


TVORBA VÝNOSŮ PŠENICE OZIMÉ A SILÁŽNÍ KUKUŘICE PŘI RŮZNÉM ZPRACOVÁNÍ PŮDY Forming of winter wheat and silage maize yields by different soil tillage

TVORBA VÝNOSŮ PŠENICE OZIMÉ A SILÁŽNÍ KUKUŘICE PŘI RŮZNÉM ZPRACOVÁNÍ PŮDY Forming of winter wheat and silage maize yields by different soil tillage TVORBA VÝNOSŮ PŠENICE OZIMÉ A SILÁŽNÍ KUKUŘICE PŘI RŮZNÉM ZPRACOVÁNÍ PŮDY Forming of winter wheat and silage maize yields by different soil tillage Badalíková B., Bartlová J. Zemědělský výzkum, spol. s


Systém kontroly a monitoringu mykotoxinů v krmivářské praxi. Miroslav Florián ředitel Sekce úředníkontroly ÚKZÚZ Brno

Systém kontroly a monitoringu mykotoxinů v krmivářské praxi. Miroslav Florián ředitel Sekce úředníkontroly ÚKZÚZ Brno Systém kontroly a monitoringu mykotoxinů v krmivářské praxi Miroslav Florián ředitel Sekce úředníkontroly ÚKZÚZ Brno Mykotoxiny v krmivech Mykotoxiny jsou nejvíce produkovány rody mikroskopických hub Aspergillus,





Ochrana pšenice ozimé a ječmene jarního

Ochrana pšenice ozimé a ječmene jarního Ochrana pšenice ozimé a ječmene jarního proti chorobám a poléhání ÚSPORNÁ TECHNOLOGIE INTENZIVNÍ TECHNOLOGIE www.syngenta.cz Ochrana pšenice ozimé a ječmene jarního proti chorobám a poléhání Společnost



ZPRÁVA ZA DÍLČÍ VÝSLEDKY ŘEŠENÍ VÝZKUMNÉHO PROGRAMU 3.d ZA ROK 2014 ZPRÁVA ZA DÍLČÍ VÝSLEDKY ŘEŠENÍ VÝZKUMNÉHO PROGRAMU 3.d ZA ROK 2014 1. TITULNÍ LIST Podpora tvorby rostlinných genotypů s vysokou rezistencí k biotickým i abiotickým faktorům a diferencovanou kvalitou


VENDELA DVOUŘADÝ. Špičkový výkon pro České pivo. Sladovnický ječmen, Krmný ječmen. Ječmen jarní

VENDELA DVOUŘADÝ. Špičkový výkon pro České pivo. Sladovnický ječmen, Krmný ječmen. Ječmen jarní Přednosti odrůdy Špičkový výnos předního zrna Doporučeno pro České pivo Zdravý porost až do sklizně Vysoká tolerance k různým půdně-klimatickým podmínkám Pěstování odrůdy VENDELA je mimořádně výnosná sladovnická


Kroměříž, soutěže technologií 2016

Kroměříž, soutěže technologií 2016 Kroměříž, soutěže technologií 2016 Vyhodnocení kvality pšenice U 58 vzorků Soutěže pěstebních technologií byly analyzovány tyto kvalitativní parametry: hmotnost tisíce zrn, obsah N-látek, číslo poklesu,





Minimalizační technologie zpracování půdy a možnosti jejich využití při ochraně půdy

Minimalizační technologie zpracování půdy a možnosti jejich využití při ochraně půdy Minimalizační technologie zpracování a možnosti jejich využití při ochraně Autorský kolektiv: Dryšlová, T., Procházková, B., Neudert, L., Lukas, V., Smutný, V., Křen, J. Prezentované výsledky vznikly jako








Geneticky modifikované potraviny a krmiva

Geneticky modifikované potraviny a krmiva Geneticky modifikované potraviny a krmiva Co je to geneticky modifikovaný organismus (GMO)? Za GMO je považován organismus, s výjimkou člověka, jehož dědičná informace uložená v DNA byla změněna pomocí


Účinná, dlouhotrvající výkonnost

Účinná, dlouhotrvající výkonnost Účinná, dlouhotrvající výkonnost Technologie Duosafe - silné přilnutí k voskové vrstvě a patogenu Vitality efekt - zvyšuje fotosyntetickou aktivitu, toleranci k suchu a stresu Dlouhodobá ochrana - až 7


Aplikace nových poznatků z oblasti výživy hospodářských zvířat do běžné zemědělské praxe

Aplikace nových poznatků z oblasti výživy hospodářských zvířat do běžné zemědělské praxe Výživa zvířat a její vliv na užitkovost a zdraví zvířete ODBORNÝ SEMINÁŘ v rámci projektu Aplikace nových poznatků z oblasti výživy hospodářských zvířat do běžné zemědělské praxe Za podpory Ministerstva


J. Chrpová a kol. Pěstební technologie odrůdy ozimé pšenice. Tosca

J. Chrpová a kol. Pěstební technologie odrůdy ozimé pšenice. Tosca J. Chrpová a kol. Pěstební technologie odrůdy ozimé pšenice Tosca Dedikace Ověřená technologie vznikla za finanční podpory projektu MZe ČR NAZV QJ 1210. Metodika je určena pro zemědělskou praxi. O uplatnění



PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER Trojan V., Hanáček P., Havel L. Department of Plant Biology, Faculty of Agronomy, Mendel University of Agriculture and Forestry in Brno, Zemedelska


Systém zajištění bezpečnosti potravin

Systém zajištění bezpečnosti potravin Systém zajištění bezpečnosti potravin Ing. Jitka Götzová Světový den výživy Praha 20.10.2015 bezpečnost potravin je základním principem evropské potravinové politiky, který zaručuje ochranu zdraví spotřebitelů





o Retengo Plus, číslo povolení :

o Retengo Plus, číslo povolení : Errata: o Retengo Plus, číslo povolení 4895-0: u fungicidu Retengo Plus je na str. 234 u indikace cukrovka (cerkosporióza řepy, ) uvedena ochranná lhůta 25 dnů. V platném rozhodnutí o povolení je uvedeno



STUDIE GENOMON VÝSKYT GENETICKY MODIFIKOVANÝCH POTRAVIN V TRŽNÍ SÍTI V ČR V ROCE 2010. M. Mendlová, V. Ostrý, J. Ruprich STUDIE GENOMON VÝSKYT GENETICKY MODIFIKOVANÝCH POTRAVIN V TRŽNÍ SÍTI V ČR V ROCE 2010 M. Mendlová, V. Ostrý, J. Ruprich Státní zdravotní ústav v Praze Centrum zdraví, výživy a potravin Oddělení analýzy


Kontaminace snětmi a fuzárii snižuje kvalitu ozimé pšenice. Ing. M. Váňová, CSc. Zemědělský výzkumný ústav Kroměříž

Kontaminace snětmi a fuzárii snižuje kvalitu ozimé pšenice. Ing. M. Váňová, CSc. Zemědělský výzkumný ústav Kroměříž Kontaminace snětmi a fuzárii snižuje kvalitu ozimé pšenice Ing. M. Váňová, CSc. Zemědělský výzkumný ústav Kroměříž Na zrnu obilovin Na zrnu obilovin se může vyskytovat celá řada původců houbových chorob,


Errata: Respektujte varovné věty a symboly uvedené v označení Přípravek je ke dni 25.9.2014 povolen pouze pro profesionální uživatele

Errata: Respektujte varovné věty a symboly uvedené v označení Přípravek je ke dni 25.9.2014 povolen pouze pro profesionální uživatele Errata: Respektujte varovné věty a symboly uvedené v označení Přípravek je ke dni 25.9.2014 povolen pouze pro profesionální uživatele Dokonalá ochrana proti botrytidě a sekundárním chorobám Popis přípravku


Odrůdové zkušebnictví ÚKZÚZ Lípa,

Odrůdové zkušebnictví ÚKZÚZ Lípa, Odrůdové zkušebnictví ÚKZÚZ Lípa, 12.7.2012 Daniel Jurečka Radmila Šafaříková a kol. > 600.000 41.565 85.000 Odrůd v registru genových zdrojů (PGRFA) Odrůd v katalozích EU Počet zkušebních parcel ÚKZÚZ





Slovensko-prosinec 2013. Marie Váňová Zemědělský výzkumný ústav Kroměříž

Slovensko-prosinec 2013. Marie Váňová Zemědělský výzkumný ústav Kroměříž Slovensko-prosinec 2013 Marie Váňová Zemědělský výzkumný ústav Kroměříž Jarní ječmen Osnova přednášky : obr. 1 až 15 je hodnocení postavení jarního ječmene obr. 15-50 je technologie pěstování obr.51-73



VÝ SLEDKÝ PROVOZNÍ CH A MALOPARCELKOVÝ CH POKUSU AMAGRO 2013/2014 druhá č á st VÝ SLEDKÝ PROVOZNÍ CH A MALOPARCELKOVÝ CH POKUSU AMAGRO 2013/2014 druhá č á st MALOPARELNÍ POKUSY: 3. VÚRV pšenice ozimá Magister, pokusná stanice Humpolec maloparcelky 2014 Výsevek 4,5 MKS Metodika: Termín


Tab. 1: Půdní charakteristika pro danou lokalitu. Zrnitostní frakce (částice) v procentech % jíl prach písek. Půdní druh (podle Nováka)

Tab. 1: Půdní charakteristika pro danou lokalitu. Zrnitostní frakce (částice) v procentech % jíl prach písek. Půdní druh (podle Nováka) Vliv počtu aplikací fungicidů na výnos vybraných odrůd ozimé pšenice v rozdílných pěstebních technologiích srovnávaných v Mezinárodní soutěži pěstebních technologií Kroměříž 2014/2015 (The influence of





Metodika indikátor. torů. Bilance energie. prof. Ing. Jan Křen, K

Metodika indikátor. torů. Bilance energie. prof. Ing. Jan Křen, K Metodika indikátor torů Bilance energie prof. Ing. Jan Křen, K CSc. Popis indikátor torů a jejich požadovan adované hodnoty Pro samotné hodnocení bilance energie je pak možné využít několik indikátorů:


Provázanost zkušebnictví, výzkumu a vzdělávání v praxi

Provázanost zkušebnictví, výzkumu a vzdělávání v praxi Ústřední kontrolní a zkušební ústav zemědělský Provázanost zkušebnictví, výzkumu a vzdělávání v praxi doc. Ing. Pavel Ryant, Ph.D. Den zemědělského zkušebnictví strana 1 Osnova Mendelova univerzita v roce


Agrotest fyto, s.r.o. Metodika pro zakládání a hodnocení pokusů s umělou inokulací obilnin fuzáriózami klasů

Agrotest fyto, s.r.o. Metodika pro zakládání a hodnocení pokusů s umělou inokulací obilnin fuzáriózami klasů Agrotest fyto, s.r.o. Metodika pro zakládání a hodnocení pokusů s umělou inokulací obilnin fuzáriózami klasů Kroměříž 2012 2 Metodika vznikla využitím poskytnuté institucionální podpory na dlouhodobý koncepční


Vliv redukovaného zpracování půdy na výskyt drátovců a zavíječe kukuřičného

Vliv redukovaného zpracování půdy na výskyt drátovců a zavíječe kukuřičného Vliv redukovaného zpracování půdy na výskyt drátovců a zavíječe kukuřičného Effect of reduced soil tillage on occurrence wireworms and corn borer Jiří Rotrekl ABSTRAKT Z výsledků, které jsme získali za



SEMENÁŘSKÁ KVALITA OSIVA ODRŮD PŠENICE JARNÍ SEMENÁŘSKÁ KVALITA OSIVA ODRŮD PŠENICE JARNÍ Seed Quality of Spring Wheat Varieties Jan Šťastný 1), Václav Hosnedl 2) 1) Selgen a.s. 2) Katedra rostlinné výroby, ČZU v Praze Abstract Seed quality is influenced


Změna klimatu, bezpečnost potravin a zdraví člověka

Změna klimatu, bezpečnost potravin a zdraví člověka 20. Konference Monitoringu, Milovy, 6. 10. 2015 Změna klimatu, bezpečnost potravin a zdraví člověka Vladimír Ostrý, Marie Jefremová, Jiří Ruprich Státní zdravotní ústav v Praze Centrum zdraví, výživy a


The target was to verify hypothesis that different types of seeding machines, tires and tire pressure affect density and reduced bulk density.

The target was to verify hypothesis that different types of seeding machines, tires and tire pressure affect density and reduced bulk density. INFLUENCE OF TRACTOR AND SEEDING MACHINE WEIGHT AND TIRE PRESSURE ON SOIL CHARACTERISTICS VLIV HMOTNOSTI TRAKTORU A SECÍHO STROJE A TLAKU V PNEUMATIKÁCH NA PŮDNÍ VLASTNOSTI Svoboda M., Červinka J. Department


Vliv pěstebních postupů na výživovou hodnotu potravin doc. Ing. Lenka Kouřimská, Ph.D.

Vliv pěstebních postupů na výživovou hodnotu potravin doc. Ing. Lenka Kouřimská, Ph.D. Vliv pěstebních postupů na výživovou hodnotu potravin doc. Ing. Lenka Kouřimská, Ph.D. Katedra kvality zemědělských produktů, Česká zemědělská univerzita v Praze Produkční systémy Konvenční Integrované


Identifikace nebezpečí výskytu vláknitých mikroskopických hub (plísní) v potravinách

Identifikace nebezpečí výskytu vláknitých mikroskopických hub (plísní) v potravinách Seminář Mykotoxiny a zemědělská produkce, Brno na Výstavišti, 13. 3. 2013 Identifikace nebezpečí výskytu vláknitých mikroskopických hub (plísní) v potravinách Doc. MVDr. Vladimír Ostrý, CSc. Státní zdravotní


Testování Nano-Gro na pšenici ozimé Polsko 2007/2008 (registrační testy IUNG, Pulawy) 1. Metodika

Testování Nano-Gro na pšenici ozimé Polsko 2007/2008 (registrační testy IUNG, Pulawy) 1. Metodika Testování Nano-Gro na pšenici ozimé Polsko 2007/2008 (registrační testy IUNG, Pulawy) Růstový stimulátor Nano-Gro, nanotechnologie vyrobená a dovezená z USA, prošla v letech 2007/2008 mnoho chemickými,


Systiva. První nepostřikový fungicid v ječmeni. Profil přípravku Systiva. Proč použít přípravek Systiva?

Systiva. První nepostřikový fungicid v ječmeni. Profil přípravku Systiva. Proč použít přípravek Systiva? Mořidla pro obilniny Systiva - první nepostřikový fungicid v ječmeni Kinto Duo - mořidlo pro všechny obilniny Premis 25 FS RED - specialista proti snětím Systiva První nepostřikový fungicid v ječmeni Jedná



ČESKÁ REPUBLIKA ÚSTŘEDNÍ KONTROLNÍ A ZKUŠEBNÍ ÚSTAV ZEMĚDĚLSKÝ Držitel certifikátu ISO 9001:2008 Národní odrůdový úřad ČESKÁ REPUBLIKA ÚSTŘEDNÍ KONTROLNÍ A ZKUŠEBNÍ ÚSTAV ZEMĚDĚLSKÝ Držitel certifikátu ISO 9001:2008 Národní odrůdový úřad GESINE CPG Nově registrované odrůdy (jaro 2015) Ječmen jarní Gesine je sladovnická


Zpráva Dopady kombinovaného použití Lignohumátu a sulfuron-metylu na plevelné rostliny a jarní ječmen

Zpráva Dopady kombinovaného použití Lignohumátu a sulfuron-metylu na plevelné rostliny a jarní ječmen Zpráva Dopady kombinovaného použití Lignohumátu a sulfuron-metylu na plevelné rostliny a jarní ječmen Autor a zpravodaj: postgraduální student Státní zemědělské univerzity v Petrohradu, S.S. Skrenževsky


Kořenový systém plodin a využití zásoby vody v půdním profilu - význam pro zemědělskou praxi

Kořenový systém plodin a využití zásoby vody v půdním profilu - význam pro zemědělskou praxi Sucho a degradace půd v České republice - 214 Brno 7. 1. 214 Kořenový systém plodin a využití zásoby vody v půdním profilu - význam pro zemědělskou praxi J. Haberle 1, P. Svoboda 1, V. Vlček 2, G. Kurešová



CENÍK SLUŽEB A PRACÍ Výzkumný ústav pícninářský, spol. s r.o. Troubsko CENÍK SLUŽEB A PRACÍ 2016 Ceny jsou uvedeny bez DPH Adresa: Výzkumný ústav pícninářský, spol. s r.o. Zahradní 1 664 41 Troubsko Tel.: 547 138 811 E-mail:





Kritické body při produkci osiv / obilovin. Sy tém HACCP. Kateřina Pazderů

Kritické body při produkci osiv / obilovin. Sy tém HACCP. Kateřina Pazderů Kritické body při produkci osiv / obilovin Sy tém HACCP Kateřina Pazderů HACCP Hazard Analysis and Critical Control Points Principy: 1. Analýza rizik 2. Identifikace kritických bodů 3. Definování kritických


Předmět: Ročník: druhý Téma: Vybrané zemědělské plodiny ječmen setý I

Předmět: Ročník: druhý Téma: Vybrané zemědělské plodiny ječmen setý I Střední odborná škola a Střední odborné učiliště Horky nad Jizerou 35 Obor: Zemědělec farmář 41-51-H/01 Registrační číslo projektu: CZ.1.07/1.5.00/34.0985 Předmět: Ročník: druhý Téma: Vybrané zemědělské


Pozvánka na pole. Pokusy na výživářské bázi Lípa POLNÍ DEN ÚKZÚZ 2015 PŮDA A JEJÍ ÚRODNOST. Michaela Smatanová

Pozvánka na pole. Pokusy na výživářské bázi Lípa POLNÍ DEN ÚKZÚZ 2015 PŮDA A JEJÍ ÚRODNOST. Michaela Smatanová www.ukzuz.cz Pozvánka na pole Pokusy na výživářské bázi Lípa Michaela Smatanová POLNÍ DEN ÚKZÚZ 2015 PŮDA A JEJÍ ÚRODNOST Přínosy výživářských pokusů: informace o dlouhodobém vlivu organických a minerálních


Vysoký příjem dusíku ale i draslíku koresponduje s tvorbou biomasy sušiny a stává se

Vysoký příjem dusíku ale i draslíku koresponduje s tvorbou biomasy sušiny a stává se živiny (kg.ha -1 ) živiny (kg.ha -1 ) Jak působí hnojivo NP 26-14 a listová aplikace hořčíku hnojivem Magnitra-L na výnos a kvalitu jarního ječmene? Dr.Hřivna,Luděk.-prof.Richter, Rostislav, MZLU Brno.



