Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:




2 Tato skripta jsou spolufinancována z Operačního programu Vzdělávání pro konkurenceschopnost: Inovace bakalářského a navazujícího magisterského studijního programu v oboru Bezpečnost a kvalita potravin (reg. č. CZ.1.07/2.2.00/ )

3 Na úvod aneb co vás čeká. Do rukou se Vám dostává aktuální verze skript, která jsou určena pro Vás, především studenty bakalářského, ale i magisterského studia obou veterinárních fakult VFU Brno, pro praktická cvičení z předmětu Biologie a genetika nebo Biologie. Tato skripta vznikla za finanční podpory Operačního programu CZ.1.07/2.2.00/ : Inovace bakalářského a navazujícího magisterského studijního programu v oboru Bezpečnost a kvalita potravin. Výuka biologie bude probíhat formou přednášek a praktických cvičení se zaměřením na obecnou biologii a základy genetiky. V souvislosti se změnou kurikula v magisterské formě studia došlo k redukci výuky ze dvou semestrů na jeden, v bakalářské formě studia bude probíhat výuka stále ve dvou semestrech. Na tyto změny jsme reagovali úpravou sylabů a to jak v přednáškách tak i ve cvičeních. V zimním semestru bude výuka pro obě formy studia probíhat stejně. Během 13 týdnů se budete věnovat především mikroskopické technice. Budeme tedy po Vás chtít, abyste byli schopni popsat mikroskop (jeho části a co k čemu slouţí) a uměli ho správně pouţívat při pozorování trvalých preparátů, které budete mít na cvičeních k dispozici. Sami si zhotovíte různé nativní preparáty, krevní nátěry, bakteriologické roztěry a otestujete si svoji krevní skupinu. Naučíte se, jaký je rozdíl mezi rostlinnou a ţivočišnou buňku, jakým způsobem se pohybují, jak reagují na různá osmotická prostředí a jak se rozmnoţují. Biologie se v dnešní době neobejde bez moderních metod, proto Vás seznámíme s metodami molekulární biologie (izolace DNA, PCR, gelová elektroforéza a restrikční analýza) a to formou řešení konkrétního úkolu zjištění pohlaví ptačího jedince. Po absolvování těchto cvičení budete znát principy jednotlivých metod, jejich význam a praktické vyuţití. V zimním semestru vyuţijete genetický model octomilku (Drosophila melanogaster) k jednoduchému experimentu, tak abyste si mohli ověřit, jak se dědí barva očí u tohoto hmyzu v dalších generacích. Studenti bakalářského studia budou absolvovat praktickou výuku biologie i v letním semestru. Během 14 týdnů se seznámíte s viry a elektronovými mikroskopy, vyzkoušíte si, jak reagují buňky na různé fyzikální a chemické vlivy prostředí a seznámíte se i s pokusy na zvířatech a vše co s tím souvisí. Převáţná většina cvičení bude ale věnována genetice a počítání genetických příkladů z oblasti mendelistické a nemendelistické dědičnosti, populační a kvantitativní genetiky. Po absolvování cvičení zvládnete jednoduchá genetická kříţení (kombinační čtverec, ale i rozvětvovací metodu) k odhalení genotypů a fenotypů různých generací potomstva výchozího kříţení a naučíte se, jakým způsobem se dědí krevní skupiny u lidí a zvířat. Pochopíte, jak se mohou geny vzájemně ovlivňovat, jak probíhá mitochondriální a chloroplastová dědičnost, jak ovlivňuje dědičnost pohlaví a vazba genů a jaký je rozdíl mezi kvalitativním a kvantitativním znakem. Tyto poznatky budete aplikovat i do genetiky populací. V rámci cvičení v letním semestru navštívíte muzeum J. G. Mendela v Brně, kde se blíţe seznámíte s jeho prací, uvidíte včelíny a letní zahrádku, kde se věnoval genetickým kříţením a v muzeu můţete obdivovat i model DNA. Studenti magisterského studia budou o letní část semestru ochuzeni, nicméně v rámci ZS budou rovněţ řešit řadu genetických příkladů v rámci samostatné práce. V těchto skriptech se můţete orientovat podle obsahu, který je rozčleněn do celků, zhruba tak jak budou probíhat na cvičeních. Kaţdá kapitola začíná teoretickým úvodem do problematiky. Tuto část berte jako minimum znalostí, které od Vás budeme poţadovat na cvičeních (je nutné, abyste na cvičení chodili připraveni!). Rovněţ doporučujeme chodit na přednášky, kde se dozvíte o dané problematice více informací. Pro hlubší studium vyuţijte seznam studijní literatury a studijních pomŧcek na konci těchto skript. Za teoretickým úvodem najdete jednotlivé mikroskopické úkoly či genetické příklady. Skripta jsou doplněna o názorné obrázky, tabulky a grafy, vzorové genetické příklady, doporučenou literaturu a internetové odkazy. Další potřebné informace (sylaby, rozvrhy, přednášky, odkazy na multimediální pomůcky atd.) naleznete na webových stránkách Ústavu biologie a chorob volně ţijících zvířat. Přejeme Vám hodně studijních úspěchů a doufáme, ţe tato skripta Vám budou uţitečnou pomůckou. Kolektiv autorů

4 OBSAH 1. Vedení protokolů na cvičeních Metody získávání informací v biologických vědách Zvětšovací zařízení (lupa, světelný mikroskop) Světelný mikroskop Vývoj světelných mikroskopů Sloţení světelného mikroskopu Druhy světelných mikroskopů Mikroskopická technika Chemické sloţení bioplazmy Prvky Látky Prokaryota, zastavení objektu pod imerzí Prokaryota Doména bakterií (Bacteria) Doména archeí (Archaea) Eukarya (eukaryota) ţivočišná buňka, protozoa Eukarya (eukaryota) rostlinná buňka Pohyb a taxe, nativní preparáty Pohyb a taxe Nativní preparáty Vyšetření krve Metody vyšetření krve a jejich vyuţítí Měření velikosti mikroskopických objektů Transport látek, osmotické jevy (ţivočišná buňka) Určování krevních skupin Buněčný cyklus, mitóza Rozmnoţování a vývoj Modelový organizmus Drosophila melanogaster Cytogenetika Metody molekulární biologie Buněčné a tkáňové kultury Nebuněčné formy ţivota, elektronové mikroskopy Nebuněčné formy ţivota Elektronové mikroskopy Fyzikální a chemické vlivy vnějšího prostředí Genetika Mendelismus, monohybridismus Dihybridismus, polyhybridismus a rozvětvovací metoda Polymorfní geny Dědičnost a pohlaví Genové interakce Vazba genů Nemendelistická dědičnost Kvantitativní genetika Populační genetika Pokusy na ţivých zvířatech Studijní literatura a studijní pomůcky

5 1 Vedení protokolů na cvičeních 1. Vedení protokolŧ na cvičeních Z kaţdého praktického cvičení budete vypracovávat protokol do podepsaného nelinkovaného sešitu formátu A4 (jsou akceptovatelné i nelinkované volné listy stejného formátu, které musí být sepnuty dohromady). U kaţdého protokolu uveďte název cvičení (ideálně na nové straně) a datum. Dále budou následovat jednotlivé praktické úkoly, které budete na cvičeních řešit (číslujte úkoly podle toho, jak budou pouţity na cvičeních). Vţdy uveďte název úkolu, druh pouţitého preparátu (nativní/trvalý) a o jaký konkrétní preparát se jedná. V případě zhotovování nativních preparátů nebo experimentů je nutné doplnit protokol i o postup přípravy. Cílem mikroskopických cvičení bude zastavení objektů v mikroskopu a následné zhotovení kresby tuţkou (je potřeba mít tuţku o správné tvrdosti, vhodnou pro kreslení!), případně pastelkami (zelený chloroplast apod.). Je nutné, aby byly kresby dostatečně velké (2 úkoly na jednu stranu listu) a kvalitní. Zhotovenou kresbu doplňte o popis jeho částí (buněčná stěna, jádro, chloroplast apod.) a zvětšení, které jste pouţili k pozorování (zápis zvětšení viz vzor protokolů). V případě experimentů, nebo pozorování nějakých jevů, je třeba uvést i závěr, kde shrnete výsledky svého pozorování a vysvětlení daných jevů. Protokoly budou Vaší vizitkou, proto se snaţte při jejich psaní dodrţovat určitou úroveň, tak abyste se za svoji vizitku nemuseli stydět. Pokud má někdo problém s úpravou, je vhodné pořídit si linkovanou podloţku, nebo psát protokoly během cvičení nanečisto a později je přepsat. Na cvičeních budete mít dostatečný prostor pro přípravu preparátů i pro zapsání protokolů. Ušetřený čas můţete vyuţít ke studiu a k přípravě na jednotlivá cvičení. Protokoly, jejich kompletnost (v případě absence je potřebné si protokoly doplnit) a úprava budou součástí hodnocení práce studentů ve cvičeních (společně s docházkou a úspěšným absolvováním zápočtových testů) a podmínkou udělení zápočtu. 1

6 1 Vedení protokolů na cvičeních Vzor protokolu Datum: Číslo a název cvičení: Úkol 1: (název úkolu) Postup přípravy: (tam, kde bude třeba zhotovení nativních preparátů, barvení, pozorování různých jevů, biologické experimenty apod.) Kresba: (dostatečně velká, tuţkou, nebo pastelkami) Popis obrázku: (co nejdůkladněji popsat části obrázku jádro, buněčná stěna, mitochondrie apod.) Zvětšení: (dvě moţnosti zápisu: 1) celkové zvětšení 40, 100, 400, 1000, 2) zvětšení okuláru ku zvětšení pouţitého objektivu 10/4, 10/10, 10/40, 10/100) Závěr: (výsledek pozorování nebo experimentu, princip daného jevu, vyvození závěru apod.) Úkol 2: (aby byly kresby dostatečně velké, pouţijte pouze 2 úkoly na jednu stranu listu) 2

7 2 Metody získávání informací v biologických vědách 2. Metody získávání informací v biologických vědách Kaţdý vědní obor včetně biologie usiluje o získávání nových informací, které mohou doplnit nebo rozšířit stávající poznatky, nebo slouţí k ověřování hypotéz. Hlavní metodou pro získávání nových údajů je pozorování, ke kterému je moţné vyuţít všechny naše smysly (především zrak), jejichţ účinnost se můţe v kombinaci s přístroji (lupa, mikroskop) znásobit. V biologii a medicíně lze k získávání informací vyuţít i sloţitější postupy, které vyţadují speciální znalosti a techniku. Jedná se například o klinické, biochemické, serologické, hematologické, imunologické, mikrobiologické (bakteriologické, virologické, parazitologické), cytogenetické, histologické, či patoanatomické vyšetření. Lze vyuţít různé postupy s vyuţitím pokusných laboratorních zvířat, buněčných či tkáňových kultur nebo ţivných půd a v neposlední řadě i moderní metody molekulární biologie. Další důleţité informace mohou být získávány např. ze zdravotní dokumentace, statistických přehledů, z rozhovoru, z dotazníků, z odborných časopisů a z různých databází přístupných na internetu. Některým metodám z oblasti biochemie, hematologie, bakteriologie, cytologie a molekulární biologie jsou věnované samostatné či dílčí kapitoly. Další metodou získávání nových údajů je pokus (experiment), coţ je výzkumný postup, při kterém se zjišťují následky vyvolané u zkoumaného objektu změnou jednoho z faktorů, které na objekt působí. Při pokusu musí být dodrţeno pravidlo jedné proměnné, musí být dobře definované a stabilní podmínky, které umoţňují reprodukovatelnost pokusu. K vyloučení chyb a k porovnání výsledků pokusu slouţí kontrolní nebo slepé pokusy. K vyhodnocení výsledků pokusů se vyuţívají různé statistické metody. Pokusům na ţivých zvířatech je věnována jedna samostatná kapitola. Jelikoţ hlavním cílem praktických cvičení z biologie je naučit se pozorovat a klasifikovat některé jevy v ţivé přírodě na mikroskopické úrovni, jsou první kapitoly věnovány mikroskopické technice. 3

8 3 Zvětšovací zařízení (lupa, světelný mikroskop) 3. Zvětšovací zařízení (lupa, světelný mikroskop) Studium mikroskopických struktur a funkcí biologických objektů se neobejde bez pouţití zvětšovacích technických zařízení, která umoţňují pozorování detailů pod hranicí rozlišovací schopnosti lidského oka (0,2 mm). Zvětšení rozlišovací schopnosti lidského oka je moţné pomocí lupy nebo světelného mikroskopu, coţ jsou optická zařízení, která zvětšují obraz předmětu v závislosti na pouţité optické soustavě a druzích čoček. Na cvičeních budeme pouţívat světelné mikroskopy se zvětšením v rozsahu s rozlišovací schopností 0,2 µm. Mikroskopem prochází světelný paprsek (od toho název světelný mikroskop), který je usměrňován skleněnými čočkami. ČOČKY jsou jednoduchá optická zařízení zhotovená ze skla nebo jiného čirého materiálu (kazivec, umělá pryskyřice). Podle lomu paprsků, které přicházejí do čočky rovnoběţně s optickou osou, se dělí čočky na spojky (spojné čočky), které lámou rovnoběţně přicházející paprsky do ohniska a obraz zvětšují a rozptylky (rozptylné čočky), které rozptylují rovnoběţně přicházející paprsky a obraz zmenšují. LUPA je nejjednodušší optické zařízení, které umoţňuje jen malá zvětšení a lze je vyuţít např. ke studiu částí květů, drobnějšího hmyzu a planktonu. Lupy jsou sloţeny z jedné nebo více čoček spojných, které zvětšují Obraz pozorovaného objektu, vloţeného mezi čočku a přední ohnisko, je přímý (nepřevrácený) a zvětšený. Na praktických cvičeních budeme pouţívat lupu pouze pro pozorování octomilek (Drosophila melanogaster) Světelný mikroskop Vývoj světelných mikroskopŧ "Spatřil jsem neuvěřitelné mnoţství zvířátek plavajících čiperněji neţ cokoli, co jsem do té doby viděl. Největší z nich kroutila svými tělíčky a tak se pohybovala vpřed. A co víc - menších zvířátek bylo tolik, ţe voda vypadala jako ţivá." Citát pochází z dopisu, který roku 1674 zaslal Královské společnosti v Londýně holandský výrobce mikroskopů a amatérský pozorovatel mikrosvěta Anthonie van Leeuwenhoek. Optickou část mikroskopu tvořila jediná čočka, vzorek se umisťoval na hrot před čočku a mikroskop se drţel v ruce těsně u oka. Leeuwenhoekovy mikroskopy zvětšovaly aţ 270 a jejich rozlišovací schopnost byla aţ 1,35 μm. Anthonie van Leeuwenhoek nebyl první výrobce mikroskopů. Uţ kolem roku 1595 vznikl v dílně Holanďana Zachariase Janssena mikroskop tvořený dvěma čočkami umístěnými na opačných koncích posuvného tubusu, zvětšoval pouze 9 a trpěl váţnými optickými vadami. Mikroskopy Angličana Roberta Hooka z roku 1665 poskytovaly sice větší zvětšení, ale i ony měly potíţe s kvalitou zobrazení. Optické vady sloţených mikroskopů byly odstraněny aţ v 19. století, kdy firma Weiss začala vyrábět mikroskopy s vylepšenými optickými vlastnostmi skla. Základní princip optického mikroskopu se od 19. století nezměnil. Uţ v dobách Carla Zeisse narazil mikroskop na nepřekonatelné hranice dané fyzikálními zákony zvětšení maximálně 1000 a rozlišení 0,2 μm. Byly však vyvinuty mnohé metody, které rozšířily moţnosti badatelů. Aby se např. světelným paprskům usnadnila cesta skrz vzorek do objektivu, pouţívá se u větších zvětšení (imerzní objektiv se zvětšením 100 ) tzv. imerze. Vědci se postupně naučili vzorky barvit různými barvivy, která se váţou pouze na určité 4

9 3 Zvětšovací zařízení (lupa, světelný mikroskop) buněčné struktury, např. na některé buněčné organely, a tím zvyšují jejich viditelnost. Pozorování v temném poli nebo v polarizovaném světle, Nomarského diferenciální kontrast, metoda fázového kontrastu (která umí vyuţít rozdíly v rychlosti, jakou světlo proniká vzorkem, ke zvýraznění kontrastu) to jsou jen některé z řady optických triků, jimiţ vědci dokáţí zviditelnit zdánlivě neviditelné. V minulosti měl výzkumník velmi omezené moţnosti. Preparát mohl zabezpečit proti vyschnutí a uchovat, důleţité objevy mohl překreslit, vyfotografovat, případně pomocí měřicí vloţky v okuláru určit rozměry pozorovaných objektů. Dnešní mikroskopy propojené s počítači umoţňují nejen pohodlnou archivaci digitalizovaných obrázků, ale i jejich podrobnou analýzu. Měření, výpočty buněčných objemů a koncentrací barevně odlišených látek, tvorba trojrozměrných modelů a skládání více obrázků do sebe se dnes stalo samozřejmostí Sloţení světelného mikroskopu Část optická objektivy, okuláry. Část osvětlovací (světelná) zdroj světla, kondenzor s lamelovou clonou, zrcátko (v současných mikroskopech zabudované v podstavci), případně filtry. Část mechanická podstavec, stativ (nosič), tubus, revolverový měnič objektivů, stolek se svorkami a kříţovým vodičem preparátů, makroposuv a mikroposuv (točítka hrubého a jemného posuvu). ČÁST OPTICKÁ Je tvořena dvěma čočkami nebo dvěma soustavami čoček. Soustava čoček, která je blíţe k pozorovanému předmětu (objektu), je označována jako objektiv, druhá, která je blíţe k oku, se označuje jako okulár. Předmět se umísťuje mezi jednoduchou a dvojnásobnou ohniskovou vzdálenost objektivu, kterým vzniká převrácený a zvětšený obraz. Tento obraz se dále zvětšuje (10 ) a pozoruje se okulárem. OBJEKTIVY jsou optické soustavy sloţené z několika čoček, buď volných, nebo tmelených dohromady. Soustavy čoček jsou uloţeny ve válcovitých kovových pouzdrech (tubusech), která jsou opatřena na jednom konci standardním závitem. Charakteristické vlastnosti objektivů: Ohnisková vzdálenost (f) je vzdálenost čočky od ohniska, kolísá od 1,5 mm (objektivy nejvíce zvětšující) do 20 mm (objektivy málo zvětšující). Zvětšení (Z) je nepřímo závislé na ohniskové vzdálenosti objektivu. Čím kratší je ohnisková vzdálenost, tím je větší zvětšení a naopak. Z = 250/f, kde 250 = konvenční pracovní vzdálenost lidského oka v mm. Celkové zvětšení světelných mikroskopů pouţívaných na cvičeních je v rozmezí 40 aţ Volná pracovní vzdálenost je vzdálenost mezi čelní čočkou objektivu a krycím sklem preparátu. Volná pracovní vzdálenost se u více zvětšujících objektivů zmenšuje. Velikost zorného pole (plocha, kterou vidíme v mikroskopu) je závislá na okuláru a jeho cloně a na ohniskové vzdálenosti objektivu. Čím je ohnisková vzdálenost větší, tím je i zorné pole větší. Velikost zorného pole se u více zvětšujících objektivů zmenšuje (plocha, kterou v mikroskopu vidím se zmenšuje, vidím toho méně, ale ve větších detailech). Numerická apertura (NA) (apertura = otvor) je dána vzorcem: NA = n.sinα, kde n = index lomu prostředí mezi objektivem a preparátem, α (alfa) = úhel svíraný optickou osou mikroskopu a pláštěm kuţele, v němţ se nacházejí paprsky, které z daného místa 5

10 3 Zvětšovací zařízení (lupa, světelný mikroskop) preparátu mohou vstoupit do objektivu a podílet se na zobrazení. Na numerické apertuře je závislá světelnost a rozlišovací schopnost objektivu. Čím více zvětšující objektiv, tím větší je i NA. Numerická apertura je jedna ze základních charakteristik objektivu a její hodnota je na objektivu uvedena. Rozlišení (d) je vlastnost objektivů rozlišit dva od sebe nepatrně vzdálené body ještě jako dva samostatné body. d = λ/na, kde NA = numerická apertura, (lambda) = vlnová délka pouţitého světla. Čím větší je numerická apertura, tím je lepší rozlišení (tj. menší minimální vzdálenost mezi dvěma body). Čím kratší je vlnová délka, tím lepší je rozlišení. Rozlišovací schopnost světelného mikroskopu je 0,2 μm (objekty do této velikosti jsme schopni pozorovat, na menší objekty je třeba pouţít elektronový mikroskop). Světelnost objektivu je schopnost objektivu zachytit co nejvíce paprsků, které se podílejí na vytvoření reálného obrazu. Závisí na numerické apertuře a velikosti otvorového úhlu (alfa). Mnoţství světla, které vniká do objektivu, je rovněţ závislé na indexu lomu prostředí (n), kterým paprsky procházejí. Prochází-li světlo podloţním a krycím sklem (n = 1,5) a pak vzduchem (n = 1), paprsky se lámou od kolmice, čímţ mnohé z nich do objektivu vůbec neproniknou (obr. 1). Světelnost je moţné zvýšit homogenizací prostředí (pouţitím tzv. imerze), která vede k tomu, ţe paprsky procházejí přímočaře a do objektivu vstoupí téměř všechny paprsky, které se podílejí na vzniku obrazu. Mezi látky uţívané k homogenizaci prostředí patří např. cedrový olej (n = 1,519) a tekutý kanadský balzám (n = 1,515 aţ 1,530). Voda má index lomu prostředí n = 1,33. objektiv s imerzní objektiv suchý objektiv α imerzní olej r krycí sklo podloţní sklo A r Obr. 1: A poloviční otvorový úhel (α), svíraný optickou osou mikroskopu a pláštěm světelného kuţele vnikajícího do objektivu. B vliv indexu lomu prostředí mezi čelní čočkou objektivu a krycím sklem preparátu (u objektivu suchého a imerzního) na numerickou aperturu objektivu. U objektivu suchého (bez imerzního oleje) se šikmý paprsek (r) na rozhraní skla a vzduchu láme (odlišný index lomu) od kolmice a uniká mimo objektiv (r ). U imerzního objektivu proniká analogický šikmý paprsek (s) přímočaře sklem preparátu a imerzním olejem (stejný index lomu prostředí, paprsek se neláme) a je zachycen objektivem (s ). Imerzním olejem se tak zvyšuje světelnost objektivu. Penetrační schopnost (hloubka ostrosti) je schopnost objektivu zobrazit ostře současně několik optických rovin pozorovaného objektu. Je nepřímo závislá na numerické apertuře. Více zvětšující objektivy mají menší penetrační schopnost (je nutné proostřovat). B s 6

11 3 Zvětšovací zařízení (lupa, světelný mikroskop) Typy objektivů: 1. Podle pouţitého média mezi objektem a čelní čočkou objektivu: a) suché - objektivy zvětšující 2 60 (existují i neimerzní 100 zvětšující objektivy, ale jejich cena je vysoká). Mezi objektem a čelní čočkou objektivu je vzduch (n = 1). Na cvičeních budeme pouţívat suché objektivy b) imerzní - objektivy zvětšující (výjimečně jsou vyráběny i 60 zvětšující imerzní objektivy). Mezi objektem a objektivem je umístěno médium (imerzní olej), které má přibliţně stejný index lomu jako sklo preparátu, čímţ se zvětšuje numerická apertura objektivu a s ní i světelnost a rozlišovací schopnost. Imerzní objektiv je odpruţený, tj. je vybaven pruţným uloţením vstupní čočky, která se při dotyku krycího skla částečně zasune do pouzdra, čímţ je objektiv chráněn před poškozením. Na cvičeních budeme pouţívat imerzní objektiv Podle optických vlastností (stupně úpravy rŧzných vad čoček): a) achromáty jsou korigovány pro 2 barvy spektra (červená a modrozelená). Otvorová vada je korigována pro světlo ţluté. Jsou pouţívány pro běţnou mikroskopickou praxi. b) apochromáty mají korigovánu barevnou vadu pro 3 barvy spektra (ţlutozelená, modrá a červená). Otvorová vada je korigována pro 2 barvy. Slouţí pro zhotovování barevných mikrofotografií. c) planachromáty, planapochromáty mají korigované sklenutí zorného pole, které se jinak projevuje nemoţností zaostřit rovinný objekt současně v celém zorném poli mikroskopu. Pouţívají se pro zhotovování mikrofotografií. d) monochromáty jsou objektivy určené pro monochromatické světlo. Pouţívají se např. při mikroskopování s vyuţitím ultrafialového záření. Barevná (chromatická) vada je způsobena optickou disperzí, tj. závislostí indexu lomu na vlnové délce světla. Bodový předmět je zobrazován na různá místa optické osy v závislosti na vlnové délce světla. Otvorová (kulová, sférická) vada je způsobena tím, ţe objektiv je tvořen čočkami, které zdaleka nejsou tenké a navíc dochází i ke značnému odchylování paprsků od optické osy. Paprsky více odchýlené od optické osy jsou více lámány. Bodový předmět je pak zobrazován ne jako bod, ale jako úsečka leţící v optické ose. Označení objektivu: Na objektivech je vyznačen typ objektivu (např. A achromát, PL objektiv pro fázovou mikroskopii, označený také širokým rastrovaným černým prstencem), zvětšení, numerická apertura, délka tubusu v mm, doporučená tloušťka pouţívaného krycího skla v mm, případně výrobce a výrobní číslo (obr. 2). Barevné značení objektivů: Pro snadnou orientaci jsou dnes objektivy barevně odlišeny. V tabulce jsou uvedeny pouze objektivy, které jsou vyuţívány na cvičeních. Zvětšení Barevné značení červená ţlutá modrá bílá 7

12 3 Zvětšovací zařízení (lupa, světelný mikroskop) druh objektivu (A - achromát) zvětšení délka tubusu v mm PL - objektiv pro fázovou mikroskopii numerická apertura doporučená tloušťka krycího skla Obr. 2: Značení objektivu. OKULÁRY představují druhý optický systém, který přispívá ke zvětšení obrazu. Okuláry jsou sloţeny ze 2 3 čoček. Směrem k objektu je tzv. čočka kolektivní, která obraz vytvořený objektivem zmenší, ale současně jej zjasní a zkoriguje některé vady objektivů. Blíţe k oku je tzv. čočka očnicová (frontální), která působí jako lupa a obraz zvětší. Nejčastěji se pouţívají tzv. okuláry Huyghensovy (negativní), sloţené ze dvou plankonvexních čoček, které jsou obráceny vypouklými plochami směrem k objektivu. Mezi čočkami je umístěna clona, která vylučuje postranní paprsky a je v rovině ostrosti obrazu. To umoţňuje vkládat na tuto clonu okulárový mikrometr pro měření objektŧ. Běţné okuláry mají zvětšení 10 (jsou ale i okuláry se zvětšením 5, 12,5, 15 ). Okuláry jsou výměnné, mají moţnost nastavit vzdálenost očních pupil a rovněţ provést dioptrickou korekci pro uţivatele, kteří nosí brýle. CELKOVÉ ZVĚTŠENÍ MIKROSKOPU (Z) se stanoví podle vzorce Z = d.250/f1.f2, kde d = optická délka tubusu, 250 = konvenční pracovní vzdálenost lidského oka v mm (250 mm), f1 = ohnisková vzdálenost objektivu v mm, f2 = ohnisková vzdálenost okuláru v mm. Celkové zvětšení mikroskopu se rovná součinu zvětšení objektivu a okuláru: Zvětšení Okulár Objektiv Celkové zvětšení Zvětšení u kreseb lze zapsat dvěma způsoby: jako celkové zvětšení (40, 100, 400, 1000 ), nebo ve zlomku jako zvětšení okuláru ku zvětšení pouţitého objektivu (10/4, 10/10, 10/40, 10/100). ČÁST OSVĚTLOVACÍ (SVĚTELNÁ) Slouţí k usměrňování, koncentrování a homogenizaci světelných paprsků vycházejících ze světelného zdroje a procházejících přes objekt do optické části mikroskopu a do oka. ZDROJ SVĚTLA - vyuţívá se buď přirozené světlo (denní sluneční světlo), nebo umělé zdroje světla (osvětlovací ţárovky, vysokotlaké rtuťové výbojky), které jsou součástí lamp (např. Šiklova lampa). U novějších mikroskopů je zdroj světla zabudován přímo v podstavci mikroskopu. 8

13 3 Zvětšovací zařízení (lupa, světelný mikroskop) KONDENZOR je sloţen z několika spojných čoček uloţených v pouzdru pod stolkem, které soustřeďují paprsky v podobě kuţele na preparát. Kondenzor je opatřen irisovou clonou. IRISOVÁ (LAMELOVÁ) CLONA je sloţena z vějířovitě uspořádaných lamel, které se překrývají a tak mění průměr centrálního otvoru, jímţ procházejí paprsky ze zdroje světla, čímţ je regulováno mnoţství světla vstupujícího do kondenzoru. ZRCÁTKO je důleţité pro usměrňování a koncentrování světelných paprsků do kondenzoru. Mikroskopy se zabudovanými zdroji světla mají plochá kovová zrcátka vestavěna v podstavci mikroskopu. FILTRY upravují světlo ze zdroje tak, aby bylo vhodné pro přímé pozorování nebo fotografické účely. Ochranné filtry (ţluté a oranţové) brání průniku škodlivého UV záření do oka, ţlutozelený filtr je pouţíván při pozorování ve fázovém kontrastu k monochromatizaci světla, polarizační filtry slouţí k polarizaci světla, modrý filtr (kobaltové sklo) zachytává ţlutou sloţku ze světla umělého zdroje. ČÁST MECHANICKÁ Tvoří kostru mikroskopu a je nosičem optické a osvětlovací části mikroskopu. PODSTAVEC vytváří základnu pro celý přístroj, ukrývá zdroj světla, zrcátko a nosič filtrů. STATIV (NOSIČ) má tvar obráceného písmene L. Na stativu je připevněn revolverový měnič objektivů, tubus s okuláry, pohyblivý stolek s kříţovým vodičem preparátu a pod stolkem je na nosič upevněn kondenzor. TUBUS je trubice dlouhá 160 aţ 170 mm, do jejíţ horní části se zasunují okuláry o standardním průměru 23 mm. Spodní část tubusu je pevně spojena s revolverovým měničem objektivů. Existuje monokulární, binokulární a trinokulární tubus (jeden výstup slouţí pro přesměrování světla do fotografického přístroje nebo televizní kamery). REVOLVEROVÝ MĚNIČ OBJEKTIVŦ je sloţen z vypouklého kovového kotouče s kruhovým otvorem a je upevněn na dolním konci tubusu, tak aby středem otvoru procházela optická osa mikroskopu. Pod ním je pohyblivě upevněný druhý kotouč se třemi nebo čtyřmi otvory na přišroubování objektivů. STOLEK slouţí pro uloţení pozorovaného objektu do optické osy mikroskopu. Proto je ve stolku otvor, kterým procházejí paprsky z osvětlovací části mikroskopu přes objekt optickou soustavou mikroskopu. Stolek bývá čtvercový, částečně otočný, nebo kulatý a plně otočný. Součástí stolku je kříţový vodič preparátů, který usnadňuje hledání pozorovaného objektu. Preparát se vkládá do upínací svorky kříţového vodiče. KŘÍŢOVÝ VODIČ PREPARÁTŦ umoţňuje posunovat preparát pomocí sáňkového zařízení dvěma směry (dopředu a dozadu, doleva a doprava), coţ se označuje jako koaxiální ovládání. Zařízení je zpravidla opatřeno měřítky k určení souřadnic horizontální polohy sledovaného detailu v preparátu. MAKROPOSUV A MIKROPOSUV (HRUBÝ A JEMNÝ POSUV) jsou uloţeny oboustranně po stranách stativu. Oba umoţňují zaostření obrazu pozorovaného objektu v zorném poli. Makroposuv je větší, je uloţen blíţe ke stativu a slouţí k hrubému zaostření objektu. Mikroposuv je menší a slouţí k jemnému a přesnému doostření, na svém obvodu nese mikrometrické měřítko, které je rozděleno na dílky po 2,5 μm, coţ umoţňuje proměřování tloušťky (výšky) pozorovaných objektů. 9

14 3 Zvětšovací zařízení (lupa, světelný mikroskop) okulár dioptrická korekce tubus revolverový měnič objektivů objektiv šroub k uvolnění tubusu stativ (nosič) upínací svorka kříţového vodiče stolek kondenzor točítko clony kondenzoru kondenzoruuclocloondenzoruč ítko posuvu kondenzoru koaxiální ovládání kříţového posunu makroposuv (točítko hrubého posuvu) mikroposuv (točítko jemného posuvu) clona zdroje světla včetně objímky pro filtry podstavec hlavní vypínač regulátor intenzity osvětlení Obr. 3: Popis světelného mikroskopu. 10

15 3 Zvětšovací zařízení (lupa, světelný mikroskop) Druhy světelných mikroskopŧ 1. Podle způsobu pozorování: a) monokulární (1 okulár) b) binokulární (2 okuláry) 2. Podle chodu paprsků světla: a) v procházejícím světle, mikroskop inverzní b) v dopadajícím světle 3. Podle druhu světla či osvětlení: a) pro pozorování ve fázovém kontrastu b) pro pozorování v temném poli (v zástinu) c) pro pozorování v polarizovaném světle, Nomarského diferenciální kontrast d) fluorescenční e) konfokální Monokulární mikroskop slouţí pro pozorování jedním okem s moţností vyuţití druhého oka ke kreslení. Binokulární mikroskop slouţí pro pozorování oběma očima současně. Obraz je systémem hranolů rozloţen do dvou okulárů. Binokulární hlavice má vlastní zvětšovací optickou soustavu, se kterou je nutno kalkulovat při výpočtu celkového zvětšení pozorovaného objektu. Rozestup optických os okulárů lze přizpůsobit vzdálenosti očí, dioptrické rozdílnosti očí jsou kompenzovány dioptrickým doostřováním. Mikroskopy pro pozorování v procházejícím světle světlo přicházející ze zdroje je pomocí zrcátka odraţeno do kondenzoru, kde je rovnoměrně rozloţeno a koncentrováno na poměrně malou plochu. Mikroskop inverzní má optickou soustavu vzhůru nohama, tj. jeho osvětlovací souprava a kondenzor jsou umístěny nad preparátem, zatímco objektivy jsou pod ním. Tento mikroskop je určen např. pro pozorování tkáňových kultur v kultivačních nádobách (viz buněčné kultury). Mikroskopy pro pozorování v dopadajícím světle jsou určeny pro pozorování objektů, které jsou opacitní (nepropouštějí světlo), vyuţívají se v mineralogii a metalurgii. Do této kategorie se řadí i preparační mikroskopy. Výše zmíněné typy mikroskopů mohou být vybaveny příslušenstvím pro pozorování objektů za speciálních podmínek (např. pozorování ve fázovém kontrastu, v temném poli, v ultrafialovém, polarizovaném nebo interferenčním světle). Mikroskopy pro pozorování ve fázovém kontrastu - k získání dostatečně kontrastního obrazu lze vyuţít jednak barvení a jednak skutečnost, ţe světelné paprsky procházející prostředím, ve kterém dochází k lomu světla, se opoţďují (fázový posun). Princip fázového kontrastu vychází z jevů, které nastávají při ohybu (difrakci) světelných paprsků na optické mříţce a při jejich interferenci. Za jeho objev obdrţel holandský fyzik F. Zernike v r Nobelovu cenu za fyziku. Fázový kontrast je vhodný pro pozorování nativních nebarvených preparátů, nejlépe ţivých objektů, které se ve fázovém mikroskopu jeví jako tmavě nebo světle konturované. Pro pozorování ve fázovém kontrastu lze pouţít běţný mikroskop s pouţitím speciálních pomůcek, jako je fázový kondenzor (10 nebo 40), jemu odpovídající fázový objektiv (10 nebo 40, s označením PL a černým gumovým prstencem) a pomocný mikroskop. Po vycentrování prstencových clon fázového kondenzoru a objektivu je mikroskop 11

16 3 Zvětšovací zařízení (lupa, světelný mikroskop) připraven k pozorování ve fázovém kontrastu. K pozorování je moţné pouţít ţlutozelený filtr, který propouští zelené světlo o vlnové délce 540 nm, které zvyšuje kontrast obrazu. Příprava mikroskopu pro pozorování ve fázovém kontrastu: Vysunout drţák filtru ze spodní části kondenzoru a místo něj dát fázový kondenzor s označením 10 nebo 40. Kondenzor posunout co nejblíţe pod stolek a úplně otevřít clonu. Nastavit na mikroskopu odpovídající objektiv pro pozorování ve fázovém kontrastu (10 nebo 40, s označením PL a černým gumovým prstencem). Do tubusu okuláru vsunout místo jednoho okuláru pomocný mikroskop, zaostřit ho vysunutím jeho vnitřní části a poté utáhnout šroubek na boku pomocného mikroskopu. Pomocí šroubků na bocích fázového kondenzoru vycentrovat prstencové clony fázového kondenzoru a objektivu. Vysunout pomocný mikroskop z mikroskopu a místo něj dát normální okulár, mikroskop je připraven k pozorování ve fázovém kontrastu. Objekty je moţno pozorovat s pouţitím kulatého skleněného zeleného nebo ţlutozeleného filtru, který se vkládá na zdroj světla. fázová clona objektivu fázový kondenzor fázová clona kondenzoru A B Obr. 4: Fázový kondenzor a fázové clony: A nevycentrované, B vycentrované. Mikroskopy pro pozorování v temném poli (v zástinu) vyţadují zvláštní osvětlovací část (paraboloidní kondenzor), která propouští pouze šikmo procházející paprsky. Tím je objekt osvětlen pouze ze stran a zorné pole je tmavé. To umoţňuje pozorovat objekty mnohem menší neţ ty, které je moţno pozorovat v procházejícím světle. Této metody se vyuţívá např. k diagnostice bakterií (leptospiry, Treponema pallidum), které nelze v procházejícím světle vidět. Mikroskopy pro pozorování v polarizovaném světle slouţí ke zjišťování dvojlomu různých látek. V okuláru nebo těsně pod ním je uloţen polarizační filtr označovaný jako analyzátor a pod kondenzorem je umístěn druhý filtr - polarizátor. Vloţí-li se mezi oba polarizační systémy objekt, který obsahuje látku opticky aktivní (tj. stáčí polarizační rovinu o určitý počet stupňů), dochází k průchodu světla. Optická aktivita se dá přesně odečíst ve stupních otáčením jednoho z obou filtrů. Nomarského diferenciální kontrast vyuţívá vlastnosti světla ke zvýšení rozdílů v jasu mezi různými částmi vzorku. Pracuje s polarizovaným světlem, které se na dvojlomných hranolech dělí na dva nepatrně posunuté obrazy. Výsledek působí dojmem šikmo osvětleného trojrozměrného objektu. Mikroskopy fluorescenční patří mezi světelné mikroskopy, které vyuţívají zajímavé vlastnosti některých látek. Při osvícení světlem o určité vlnové délce dojde k vymrštění elektronů v jejich atomech na energeticky bohatší dráhy kolem atomových jader. Při návratu elektronů na původní dráhu dojde k uvolnění energie ve formě záření o jiné, delší vlnové délce, neţ mělo záření, které celý efekt způsobilo. Jinými slovy látka se rozzáří. Fluorescenční mikroskopy, sériově vyráběné od 70. let 20. století, vyuţívají tento princip k získání unikátních obrázků. Vzorek se vystaví záření o vlnové délce, která dokáţe vyvolat fluorescenci některé z látek ve vzorku. Fluorescence vytváří obraz pozorovaného objektu. Oblasti vzorku, v nichţ k fluorescenci nedošlo, zůstanou tmavé, protoţe zbytkové 12

17 3 Zvětšovací zařízení (lupa, světelný mikroskop) záření je odfiltrováno. Mnohé přírodní látky, např. chlorofyl nebo některé vitaminy září pod vlivem UV paprsků. Fluorochromy jsou sloučeniny schopné fluorescence, které se vyuţívají ke zviditelnění různých součástí buněk, např. DNA, proteinů (bílkovin). V mikroskopu je viditelná fluorescence v místě, kde se navázal fluorochrom na danou látku. Tato metoda se např. v kombinaci s přímými nebo nepřímými imunologickými metodami pouţívá např. při diagnostice vztekliny. Mikroskopy konfokální se začaly objevovat ve druhé polovině 80. let. Tyto mikroskopy vyuţívají fluorescence ještě dokonaleji. U běţných fluorescenčních mikroskopů dopadá na detektor i světlo vyzářené z vrstev vzorku leţících nad a pod rovinou ostrosti. Konfokální mikroskop tento "světelný šum" odstraňuje. V cestě paprsku stojí zábrana s miniaturním otvorem, jenţ propustí pouze světlo z právě zkoumaného místa, výsledkem je ostrý obraz. Zdrojem světla vyvolávajícím fluorescenci vzorku je u konfokálního mikroskopu laser, jehoţ paprsek míří pouze do jediného místa. Paprsek se obrovskou rychlostí bod po bodu posouvá, takţe postupně osvítí celý vzorek. Údaje získané z jednotlivých bodů se v počítači sloţí do úplného obrazu. Laserový paprsek je moţné zaměřit do jiné hloubky a postupně tak pořídit obraz z dalších vrstev vzorku. Mikroskop tak vytváří "optické řezy", jako by vzorek rozřezal na tenké plátky. Kdyby se jich na sebe poskládalo tisíc, byly by vysoké pouze 0,5 milimetru. Počítačovým zpracováním řezů lze vytvořit trojrozměrné modely zkoumaných struktur nebo animaci procházející vzorkem od povrchu aţ do hloubky několika desetin milimetru. První laserový konfokální rastrovací mikroskop byl vyroben r Konfokální mikroskop je velmi citlivý, pro získání obrazu stačí malé mnoţství barviv, coţ má význam pro pozorování ţivých buněk, kterým barvení příliš nesvědčí. Konfokální mikroskopy se pouţívají k tzv. life cell imaging, který umoţňuje sledovat funkce vnitrobuněčných struktur in vivo a to aţ na molekulární úrovni: růst buněčných kultur v reálném čase, sledování účinků fyzikálních a chemických faktorů na buněčné kultury, studium mechanizmu buněčného dělení a zejména jeho poruch v somatických buňkách, buňkách zárodečné linie i raných embryích. Kontrolní otázky světelný mikroskop Z jakých částí se skládá světelný mikroskop? Co patří do optické, světelné a mechanické části mikroskopu? Jaké existují typy objektivů? Jaké jsou charakteristické vlastnosti objektivu? Jak se mění vlastnosti objektivů v závislosti na jejich zvětšení? Jaký je rozsah celkového zvětšení světelných mikroskopů? Jaká je rozlišovací schopnost světelných mikroskopů? 13

18 4 Mikroskopická technika 4. Mikroskopická technika POTŘEBY K MIKROSKOPOVÁNÍ Laboratorní sklo: podloţní skla ( ,2 mm se zabroušenými okraji nebo bez zábrusu), krycí skla (čtvercového nebo obdélníkového tvaru 18 18, 22 22, mm), kádinky, zkumavky, Petriho misky, střičky, odměrné válce, nálevky Nástroje: kahan, nůţky, skalpel, pinzeta, bakteriologická klička, preparační jehla, kapátko Přístroje: mikroskop, lupa, vodní lázeň Chemikálie: kyseliny, hydroxidy a jejich soli, barviva, imerzní olej PŘÍPRAVA MIKROSKOPU K MIKROSKOPOVÁNÍ znamená umístění mikroskopu tak, aby nosič tubusu byl od pozorovatele odvrácen a volná strana mikroskopického stolku směřovala k němu. Mikroskop musí být snadno v dosahu, aby pozorovatel mohl pohodlně sedět. Nejlépe je psát záznamy vpravo od mikroskopu a vlevo si umístit potřeby pro přípravu preparátů (leváci naopak). Mikroskop se spouští spínačem umístěným v podstavci mikroskopu. Pokud přerušujete mikroskopování pouze na čas, mikroskop nevypínejte (opakovaným zapínáním se zkracuje ţivotnost ţárovky). Preparát se vkládá do rohu upínacího zařízení stolku a poté se uchytí svorkou. Při mikroskopování se postupuje od nejméně zvětšujících objektivů po nejvíce zvětšující, tj. 4, 10, 40 a 100. Při zvětšení 40 a vyšším je vhodné korigovat optické vady očí, protoţe většina lidí nemá obě oční čočky stejně dioptricky silné. Nejdříve je třeba upravit rozestup okulárů (oční rozestup) a poté se snaţit pozorovat obraz oběma očima. Pozorování jen jedním okem vyvolává jeho neúměrnou zátěţ a při opakovaném zatěţování zhoršuje vady oka. Rozdíl vede opět k neúměrnému zatěţování jednoho oka. Vadu je moţné kompenzovat úpravou dioptrické síly levého okuláru takto: zavřete levé oko a obraz dokonale zaostřete mikrošroubem při pozorování pravým okem v pravém okuláru, zakryjte si pravé oko a pozorujte obraz levým okem v levém okuláru. Pokud není obraz dokonale ostrý, zaostřete objekt pomocí točítka dioptrické korekce na levém okuláru. Poté byste měli oběma očima vidět stejně ostře. Vyhledáním optimální vzdáleností očí od okulárů docílíte při troše cviku splynutí obrazu z obou okulárů a obě oči tak budete zatěţovat rovnoměrně. ZASTAVENÍ OBJEKTU V ZORNÉM POLI MIKROSKOPU znamená umístění objektu do středu zorného pole a zaostření a osvětlení obrazu objektu v zorném poli. Preparát se pokládá na stolek mikroskopu pod pérovou svorku tak, aby objekt nebo krycí sklo byly umístěny nad otvorem stolku směrem k objektivu (podloţním sklem dolů a krycím nahoru). Při zastavování objektu v mikroskopu je třeba se dívat do mikroskopu a současně pomocí kříţového vodiče pohybovat preparátem na stolku mikroskopu a pomocí makroposuvu najít správnou volnou pracovní vzdálenost. Jakmile se v mikroskopu objeví objekt, provede se doostření pomocí mikroposuvu. Je třeba si také seřídit osvětlení mikroskopu pomocí regulátoru osvětlení (v podstavci mikroskopu) a zvýšit hloubku ostrosti pomocí irisové clony kondenzoru. Při pozorování málo kontrastních objektů (epitelie, objektivový mikrometr, pylová zrna) je potřeba více zaclonit a zaostřit na správnou optickou rovinu. Při pozorování preparátů je potřeba dát si pozor na tzv. artefakty (termín poprvé pouţil Sir Julian Huxley), jako jsou např. škrábance, kazy ve skle, bubliny, prach, útvary z ţelatiny apod., které bývají zaměňovány za pozorované objekty. 14

19 4 Mikroskopická technika Nejčastější chyby (závady) a jejich odstraňování: Do velkých zásahů a oprav mikroskopu se nepouštějte, výjimkou jsou některé technické závady, které můţete sami odstranit: Chyba (závada) Příčina Odstranění mikroskop nesvítí šňůra není v zásuvce nebo není zastrčit šňůru do zásuvky a do mikroskopu zastrčena "nadoraz" do "nadoraz" mikroskopu makroposuv jde ztuha špatné nastavení tuhosti chodu natočte točítko makroposuvu proti směru hodinových ručiček mikroskop samovolně sjíţdí špatné nastavení tuhosti chodu natočte točítko makroposuvu ve směru hodinových ručiček neostrý obraz, nejde zaostřit preparát je krycím sklem dolů poloţte preparát správně při pouţití objektivu 40x zalepený objektiv vyčistěte objektiv obraz je zamlţen znečištěný objektiv (prach, olej) objektiv očistěte od prachu a otřete hadříkem (vatovým tamponem) navlhčeným v alkoholu znečištěný okulár (při otáčení okulárem se otáčí i nečistota) očistěte okulár od prachu, otisků prstů apod. nedostatečné osvětlení obrazu kondenzor je příliš nízko osvětlená jen část obrazu, abnormální zorné pole obraz je málo kontrastní nedaří se nalézt objekty při malém zvětšení objekt zmizí při přechodu na větší zvětšení 40x a 100x vibrace preparátu, vzduchové bubliny záměna za artefakty nejde rozlišit objekty neúplně otočena revolverová hlavice objektivů při střídání objektivů posuňte kondenzor a nastavte nejlepší osvětlení otočte revolverovou hlavici aţ po zaklapnutí západky (pořádně docvaknout objektiv) velký otvor u clony kondenzoru přivřete irisovou clonu kondenzoru málo kontrastní objekty (epitelie, objektivový mikrometr, ale i pylová zrna) objekt je umístěn na okraji zorného pole moc nebo málo vody hledání mimo správnou optickou rovinu tlustý preparát, příliš mnoho materiálu více zaclonit a zaostřit na správnou optickou rovinu vrátit se k menšímu zvětšení, a umístit objekt do středu zorného pole (středit) optimalizovat mnoţství vody přidávané k preparátu zaostřit na správnou optickou rovinu připravit tenkou homogenní vrstvu Fáze a zásady mikroskopování: 1. Umístění mikroskopu před sebe, tak aby byl snadno v dosahu, a aby pozorovatel pohodlně seděl (mikroskopem během mikroskopování nepohybovat - při velkých zvětšeních se objekt můţe ztratit). Kontrola kompletnosti mikroskopu a zapnutí mikroskopu. 2. Prohlédnutí preparátu nejdříve pouhým okem ke zjištění polohy, velikosti nebo obarvení objektu (na některých preparátech je fixem v krouţku vyznačeno, kde je třeba objekt hledat). Hledat v obarvené části preparátu. 3. Umístění preparátu na stolek pod pérovou svorku (krycím sklem nahoru) a umístění objektu (pokud je viditelný pouhým okem) do dráhy světelného paprsku (ověřit z dálky při otevřené irisové cloně). 4. Seřízení rozestupu okulárů a kontrola nastavení dioptrického doostřování. 15

20 4 Mikroskopická technika 5. Levá ruka ovládá makrošroub a mikrošroub k vyhledání správné optické roviny a zaostření, pravá ruka ovládá kříţový posun k vyhledávání objektů. K systematickému prohlíţení preparátu slouţí meandrovitý způsob. 6. Pozorování objektu nejdříve pod málo zvětšujícími objektivy (4 a 10 ), středně zvětšujícími objektivy (40 ) a nakonec pod imerzním objektivem (100 ). Objektivy 40 a 100 nejsou na vyhledávání objektu, ale na detailní prohlédnutí objektu nalezeného při menších zvětšeních. Při pouţití objektivů 4 a 10 ostřit makrošroubem, při pouţití objektivů 40 a 100 ostřit mikrošroubem. 7. Při kaţdém zvětšení je potřeba upravit mnoţství procházejícího světla pomocí regulátoru napětí v podstavci mikroskopu a zvýšením hloubky ostrosti pomocí irisové clony. Při malém zvětšení co nejvíce zaclonit (uzavřít irisovou clonu) a přitom přidat světlo na zdroji (ne přidušené oranţové). Při větších zvětšeních je třeba postupně přidávat osvětlení otvíráním irisové clony. 8. Před kaţdým pouţitím více zvětšujícího objektivu je třeba objekt umístit do středu zorného pole (tzv. středění objektu). 9. Záznam o pozorování (protokol kresba, popis, závěr). 10. Před vytáhnutím preparátu z mikroskopu je dobré vrátit se k nejméně zvětšujícímu objektivu - preparát se díky většímu prostoru bezpečněji vyndá. Očištění preparátu a objektivu od imerze alkoholem, vypnutí mikroskopu a jeho přikrytí igelitovým krytem. MĚŘENÍ VÝŠKY (TLOUŠŤKY) OBJEKTU se provádí pomocí mikrometrického měřítka vyrytého na objímce mikroposuvu. Obvod tohoto šroubu je rozdělen na 50 dílků po 2,5 μm. Při měření se postupuje tak, ţe se zaznamená hodnota dílku na měřítku při zaostření detailu objektu v horní optické rovině a poté se odečte hodnota dílku na měřítku při zaostření detailu objektu v dolní optické rovině. Počet dílků (rozdíl mezi odečtenými hodnotami) násobený 2,5 μm představuje skutečnou výšku (tloušťku) objektu v μm. Výška (tloušťka) objektu v μm = 2,5 x počet dílků otočených mezi horní a spodní optickou rovinou. ÚKOLY Úkol 1: Zastavení objektu při rŧzném zvětšení objektivy (4, 10, 40 ) Trvalý preparát (TP): písmeno Umístěte preparát na stolek mikroskopu tak, aby natištěné slovo bylo z vaší strany dobře čitelné "pouhým okem". Zastavte preparát při různých zvětšeních objektivu (4, 10 a 40 ) a zakreslete, co vidíte v zorném poli při jednotlivých zvětšeních. Jaký obraz v mikroskopu vzniká? Jak se mění volná pracovní vzdálenost, velikost zobrazené plochy a detaily v zorném poli v závislosti na pouţitém zvětšení? Úkol 2: Středění objektu TP: barvená vlna Zastavte barvenou vlnu (překříţení vláken nebo jiný "pevný bod") přesně ve středu zorného pole při nejmenším zvětšení objektivu (4 ). Pouţijte větší zvětšení objektivu (10 a 40 ), aniţ byste pohybovali preparátem a pozorujte posun vlny mimo střed zorného pole. Jaká zásada z toho vyplývá? 16

21 4 Mikroskopická technika A B C Obr. 5: Středění objektu (barvená vlna) při různých zvětšeních objektivů (A 4, B 10, C 40 ). Úkol 3: Funkce clony TP: prachové peří (nebo pylová zrna) Zastavte a prohlédněte si preparát při různých zvětšeních objektivů (4, 10 a 40 ). U kaţdého zvětšení pozorujte a porovnejte obraz při otevřené a uzavřené cloně. Jak je potřeba upravit clonu při různých zvětšeních? Úkol 4: Optické roviny a měření výšky objektu TP: křídlo hmyzu Po zastavení preparátu při nejmenším zvětšení a výběru vhodného místa (s mnoha chloupky), zastavte preparát při zvětšení objektivu 40. Pomocí mikroposuvu zaostřete objekt nejprve v horní optické rovině a nakreslete jen část, kterou vidíte ostře. Poté zakreslete totéţ ve střední optické rovině a nakonec ve spodní. Ze všech tří obrazů nakreslete výsledný obraz, který vznikne sloţením všech ostrých obrazů jednotlivých optických rovin. Změřte výšku objektu a výsledek zaznamenejte do závěru. A B C Obr. 6: Optické roviny (A horní, B střední, C dolní) u křídla hmyzu. Kontrolní otázky mikroskopická technika Z jakých částí se skládá světelný mikroskop? Co se děje s objektem při zobrazování ve světelném mikroskopu, jaký obraz vzniká? Jak se mění volná pracovní vzdálenost, velikost zobrazené plochy a detaily v zorném poli v závislosti na pouţitém zvětšení? Co znamená středění objektu a proč se dělá? Jak je třeba upravit clonu v závislosti na pouţitém zvětšení? Jak se provádí měření tloušťky (výšky) mikroskopického objektu? 17

22 5 Chemické sloţení bioplazmy 5. Chemické sloţení bioplazmy 5.1. Prvky Stejné chemické sloţení je sice jednou z obecných vlastností všech typů buněk, ale chemické prvky jsou součástí i neţivé přírody. Některé prvky se nacházejí v ţivých organizmech častěji neţ v jejich neţivém okolí. Prvky, které se vyskytují v ţivých organizmech, se nazývají biogenní a dělí se na makrobiogenní (makroprvky, makroelementy) a mikrobiogenní. MAKROBIOGENNÍ PRVKY zahrnují C, H, O, N, S, P, K, Na, Cl, Ca, Mg a Fe. Mezi nejdůleţitější makrobiogenní prvky se řadí C, H, O, N, S a P. Tyto prvky jsou obsaţeny v informačních makromolekulách (nukleových kyselinách a proteinech) a představují aţ 95 % celkové hmotnosti ţivých organizmů. Uhlík patří mezi nejtypičtější prvky ţivých organizmů. Primárním zdrojem veškerého uhlíku je pro ţivou přírodu oxid uhličitý. Vodík a kyslík jsou vázány v molekulách vody, která je podstatnou sloţkou kaţdé buňky. Dusík je součástí všech nukleových kyselin a proteinů. Síra je součástí některých aminokyselin a fosfor je přítomen jak v nukleových kyselinách, tak ve sloučeninách, které se účastní energetických přeměn v buňce (adenosintrifosfát, ATP). Vápník a hořčík umoţňují činnost mnoha enzymů. Vápník také funguje jako druhý posel v buněčné signalizaci a uplatňuje se při svalovém stahu. MIKROBIOGENNÍ PRVKY (OLIGOBIOGENNÍ, MIKROELEMENTY, STOPOVÉ PRVKY) zahrnují především těţké kovy a dále některé další prvky (Cu, Mn, Co, Br, Se, I, F, B, Si, Li, Ba, Zn atd.), tvoří asi 0,1 % celkové hmotnosti ţivých organizmů. Větší mnoţství těţkých kovů se můţe v ţivých organizmech hromadit (kumulovat) nebo můţe mít přímo toxický účinek Látky Látkové sloţení buňky tvoří voda (70 %), proteiny (15 %), nukleové kyseliny (7 %), polysacharidy (2 %), fosfolipidy (2 %), ionty a malé molekuly (4 %). NUKLEOVÉ KYSELINY (NK) jsou tvořeny nukleotidy, jejichţ pořadí (sekvence) určuje primární strukturu NK. Nukleové kyseliny tvoří genomy ţivých organismů. Sloţení nukleotidu: kyselina fosforečná + pentóza (ribóza či deoxyribóza) + dusíkaté báze (purinové: adenin (A), guanin (G), pyrimidinové: cytozin (C), tymin (T) a uracil (U). Dusíkaté báze se spolu spojují na základě komplementarity: A-T (A-U), C-G. Typy NK: Deoxyribonukleová kyselina (DNA) je tvořena zpravidla 2 polynukleotidovými řetězci (dvouvláknová, dvouřetězcová). V ose řetězce se střídá kyselina fosforečná s cukrem (deoxyribóza), spojené esterickou vazbou. Na cukr se glykozidovou vazbou váţe dusíkatá báze, která je spojena s dusíkatou bází druhého řetězce vodíkovými můstky (mezi A a T jsou 2 vodíkové můstky, mezi C a G jsou 3 vodíkové 18 vazebné místo pro aminokyselinu antikodon Obr. 7: trna jetelový list.

23 5 Chemické sloţení bioplazmy můstky). V roce 1953 popsali J. Watson a F. Crick sekundární strukturu DNA jako pravotočivou dvouřetězcovou šroubovici, jejíţ řetězce probíhají antiparalelně, tzn. na jednom konci řetězce DNA je fosfátová skupina (5 konec), zatímco na druhém je pentóza (3 konec). Na druhém vláknu je to obráceně. Ribonukleová kyselina (RNA) je tvořena zpravidla 1 polynukleotidovým řetězcem (jednovláknová). Skládá se z kys. fosforečné, cukru ribózy a dusíkatých bází A, U, G, C. Existuje několik typů RNA: transferová (trna), ribozómová (případně ribozomální, rrna), mediátorová (mrna), malá interferující (sirna), ribozymová, virová (vrna). Nukleové kyseliny se mnoţí replikací (u eukaryot probíhá v jádře, mitochondriích a chloroplastech, u prokaryot v cytoplazmě) viz přednáška. Genetická informace obsaţena v DNA se přepisuje do mrna během transkripce (u eukaryot probíhá v jádře, mitochondriích a chloroplastech, u prokaryot v cytoplazmě), na ní navazuje translace (syntéza proteinů). Funkce: Uchování genetické informace Ovlivnění činnosti buňky a celého organismu (prostřednictvím syntézy proteinů) VODA tvoří u většiny ţivých organizmů % jejich hmotnosti. Málo vody obsahují jen některé spory a semena jako adaptaci pro přetrvání v nepříznivých podmínkách. Voda byla nezbytným prostředím při vzniku ţivota na Zemi a dodnes je podmínkou ţivota. Ţivotně důleţité chemické reakce probíhají pouze ve vodných roztocích. Molekuly a ionty rozpuštěné ve vodě mohou prostupovat buněčnými povrchy. Voda má funkci rozpouštědla, pomáhá udrţovat konstantní teplotu a udrţuje stálost vnitřního prostředí má význam pro osmotické děje v buňkách a udrţování acidobazické rovnováhy. PROTEINY jsou sloţeny z aminokyselin (AK). H NH2 C R COOH Obr. 8: Obecný vzorec aminokyseliny: (NH2 aminová skupina, COOH karboxylová skupina, R postranní řetězec). Dnes existuje 22 aminokyselin (ke 20 běţnějším patří ještě selenocystein a pyrolysin), které se značí třípísmenným nebo jednopísmenným kódem: např. alanin (Ala, A), glycin (Gly, G), valin (Val, V), leucin (Leu, L). Aminokyseliny (AK, případně AA amino acids) se spojují kovalentní peptidovou vazbou (spojuje se aminová skupina jedné AK s karboxylovou skupinou druhé AK), čímţ vzniká peptidový řetězec, který má N konec (aminový, zakončen NH2 skupinou) a C konec (karboxylový, zakončen COOH skupinou). Běţný proteiny (bílkovina) je tvořena aţ 300 AK. Proteiny vznikají během genové exprese při translaci (překlad genetické informace z mrna do pořadí aminokyselin) na ribozomech, které jsou vázané na drsné endoplasmatické retikulum (eukaryota) nebo volně v cytoplazmě (prokaryota) viz přednáška. U proteinů rozlišujeme tyto struktury (konformace): primární je dána pořadím aminokyselin v polypeptidovém řetězci, zapisuje se od N-konce k C-konci proteinu (první určení primární struktury provedl v roce 1953 Frederick Sanger), sekundární - prostorové uspořádání polypeptidového řetězce, např. alfa šroubovice (alfa-helix), struktura skládaného listu (beta-sheet), terciární 19

24 5 Chemické sloţení bioplazmy trojrozměrné uspořádání celého peptidového řetězce, kvarterní uspořádání podjednotek v proteinových aglomerátech, tvořících jednu funkční bílkovinu např. fibrily kolagenu. Funkce: Stavební (strukturní): jsou součástí buněčných struktur, cytoskeletu, chromozomů a ribozomů (proteiny + NK), biomembrán (proteiny + fosfolipidy), buněčné stěny a extracelulární matrix (proteiny + polysacharidy). Enzymatická: urychlují chemické reakce (sniţují aktivační energii chemických reakcí). Informační: podílí se na buněčné signalizaci (signály, receptory). SACHARIDY jsou sloţeny z monosacharidŧ s obecným vzorcem (CH2O)n. Monosacharidy se spojují kovalentními glykozidovými vazbami za vzniku disacharidů, oligosacharidů (trisacharidy, tetrasacharidy atd.) aţ polysacharidů (tisíce jednotek). Funkce: Energetický zdroj: glukóza, glykogen (ţivočichové), škrob (rostliny). Mechanická podpora: celulóza (rostliny), chitin (kostra hmyzu, buněčná stěna hub), glykolipidy, glykoproteiny (sloţka slizů, hlenu, chrupavek, buněčné membrány). LIPIDY jsou tvořeny mastnými kyselinami a glycerolem. Funkce: Stavební: fosfolipidy - součást buněčných membrán. Energetický zdroj: tukové kapénky. Signalizace: steroidní hormony. Metabolismus vitamínŧ: vitamíny (A, D, E, K) jsou rozpustné v tucích. ÚKOLY Úkol 1: Prŧkaz škrobu brambor, Lugolův roztok Rozkrojte bramborovou hlízu a skalpelem setřete tekutinu z řezné plochy a naneste na podloţní sklo. Pozorujte tvar excentrických škrobových zrn a zakreslete. Poté přidejte k preparátu Lugolův roztok (2KI + I 2 + H 2 O), přikryjte krycím sklíčkem a znovu pozorujte. Jak se změnila barva škrobových zrn? Úkol 2: Prŧkaz tukŧ v bioplazmě TP: jaterní tkáň s tukovou infiltrací barvená na tuky (Sudan III, olejová červeň) Zakreslete si jaterní buňku s oranţově zbarveným tukem, který se v buňce nachází v podobě tukových kapének nebo vyplňuje celý obsah buňky. tukové kapénky Obr. 9: Škrobová zrna zásobní rostlinné inkluze. Obr. 10: Tukové kapénky v jaterních buňkách. 20

25 5 Chemické sloţení bioplazmy Úkol 3: Prŧkaz proteinŧ (Hellerova zkouška sráţecí reakce s koncentrovanou kyselinou dusičnou) bílek, kys. dusičná Do zkumavky nalijte asi 2 ml koncentrované kyseliny dusičné a po stěně zkumavky opatrně navrstvěte suspenzi vaječného bílku, tak aby nedošlo k promíchání tekutin. Na styčné ploše obou vrstev se vytvoří bílý prstenec vysráţených (denaturovaných) proteinů. vaječný bílek bílý prstenec denaturovaných proteinů HNO 3 Obr. 11: Průkaz proteinů (Hellerova zkouška) Kontrolní otázky chemické složení bioplazmy Umíš zapsat obecný vzorec aminokyselin? Kolik existuje proteinogenních aminokyselin? Uveď příklady aminokyselin. Jak a kde vznikají proteiny? Umíš namalovat ribozom a trna? Jaké jsou konformace proteinů? Umíš je nakreslit? Jaká je funkce proteinů v buňce? Z čeho se skládají po chemické stránce nukleové kyseliny? Jak se párují dusíkaté báze v DNA a RNA? Kolik je vodíkových můstků ve vazbě? Jaký je rozdíl mezi DNA a RNA? Kdo popsal sekundární strukturu DNA? Umíš namalovat DNA? Jaký je monomer a funkce sacharidů v buňce? Jaké jsou stavební sloţky lipidů a jejich funkce v buňce? Co se pouţívá k průkazu škrobu? K čemu slouţí Lugolův roztok? Umíš namalovat škrobové zrno? Co se pouţívá k průkazu tuků v buňkách? Mezi jaké inkluze patří tukové kapénky a škrobová zrna? Co se pouţívá k průkazu proteinů? K čemu slouţí Hellerova zkouška? 21

26 6 Prokaryota, zastavení objektu pod imerzí 6. Prokaryota, zastavení objektu pod imerzí 6.1. Prokaryota Prokaryota jsou tvořena buňkou prokaryotického typu, která je evolučně starší a jednodušší neţ buňka eukaryotického typu, průměrná velikost se pohybuje mezi 1-10 μm. Nukleoid (prokaryotické jádro neohraničené membránou) obsahuje jeden chromozom sloţený z kruţnicové dvouřetězcové DNA. Buňka není rozdělena na kompartmenty, neobsahuje mitochondrie ani plastidy. Ribozomy se sedimentační konstantou 70S jsou uloţeny v cytoplazmě. Mnoţí se binárním dělením. Prokaryota se dělí na doménu bakterií a archeí Doména bakterií (Bacteria) Bakterie jsou buňky prokaryotického typu. Většina (s výjimkou mykoplazmat) se vyznačuje přítomností buněčné stěny tvořené peptidoglykanem mureinem. Mezi glycerolem a karboxylovými kyselinami v plazmatické membráně je esterová vazba. Geny bakterií neobsahují introny, značná část genů je organizována do transkripčních jednotek typu operonŧ. Kromě nukleoidu obsahují plazmidy, malé kruhové dvouřetězcové molekuly DNA, které mohou obsahovat geny rezistence k antibiotikům. Tuto informaci si mohou bakterie mezi sebou předávat prostřednictvím konjugace. Při syntéze polypeptidového řetězce se v ribozomech jako první zařazuje aminokyselina N-formylmetionin. Rozmnoţují se nepohlavně (binárním dělením nebo pučením), jsou autotrofní (fotoautotrofní nebo chemoautotrofní) nebo heterotrofní (fotoheterotrofní nebo chemoheterotrofní). Pohyb se uskutečňuje pomocí bičíků nebo klouzavým způsobem po povrchu substrátu. Některé bakterie jsou nepohyblivé. Dělení bakterií: 1. Podle tvaru: a) kulovité (koky): dvojice (diplokoky), řetízky (streptokoky), čtveřice (tetrakoky), hroznovité seskupení (stafylokoky) b) tyčkovité (tyčky, tyčinky): dvojice tyček, řetízky tyček (streptobakterie), tyčky s endosporami mohou mít bacilární tvar (místo se sporou se nerozšíří) nebo klostridiální tvar (spora je uloţena v rozšíření uprostřed buňky) c) zakřivené: vibrioidní (vibria), spirálovité (spirily) či helikální (spirochéty) d) větvící se: např. mykobakterie 2. Podle umístění bičíkŧ: a) monotrichální nebo lofotrichální (bičíky na jednom konci buňky) b) amfitrichální (bičíky na obou koncích buňky) c) peritrichální (bičíky po celém povrchu buňky) 3. Podle buněčné stěny: a) Gram-negativní (G - ) s buněčnou stěnou mají tenkou buněčnou stěnu z peptidoglykanu, nad ní je vnější vrstva (membrána) z fosfolipidů a lipopolysacharidů. Při barvení dle Grama se krystalová violeť v komplexu s jodidem draselným neváţe na buněčnou stěnu, vymývá se etanolem a po pouţití jiného barviva (safranin, karbolfuchsin) se buňka zbarví červeně. Patří sem např. Escherichia coli, Salmonella Typhi, Haemophilus influenzae, Klebsiella pneumoniae, Proteus mirabilis, Helicobacter pylori. 22

27 6 Prokaryota, zastavení objektu pod imerzí b) Gram-pozitivní (G + ) s buněčnou stěnou mají silnou buněčnou stěnu sloţenou z několika vrstev peptidoglykanu. Při barvení dle Grama váţe buněčná stěna komplex krystalové violeti s jodidem draselným, buňka se barví modře aţ fialově. Patří sem např. Staphylococcus, Streptococcus, Enterococcus, Bacillus, Listeria nebo Clostridium. c) bakterie bez buněčné stěny (např. mykoplazmata). Někteří zástupci bakterií: 1. Nitrifikační bakterie: ţijí v půdě, oxidují amonné soli na dusitany a ty na dusičnany, tím obohacují půdu o dusík (př. Nitrosomonas, Nitrococcus, Nitrobacter); hlízkové bakterie: ţijí v symbióze s bobovitými rostlinami, asimilují vzdušný dusík (např. Rhizobium) 2. Oxygenní fototrofní bakterie: gramnegativní bakterie obsahující bakteriochlorofyl, během fotosyntézy uvolňují O 2 podobně jako zelené rostliny. Dělí se na: a) Prochlorofyta bakterie obsahující bakteriochlorofyl a a bakteriochlorofyl b, nemají fykobiliny, jsou buď jednobuněčné, nebo tvoří vícebuněčná vlákna. b) Cyanobakterie (sinice) bakterie obsahující bakteriochlorofyl a, fykobiliny (modrý fykocyanin a alofykocyanin, u některých je fykoerytrocyanin nebo červený fykoerytrin) a karotenoidy. Většina druhů ţije v rozmezí teplot od 2 o C (antarktická jezera) do 74 o C (horké prameny). Ţijí ve sladké i slané vodě, kde jsou součástí planktonu (Trichodesmium erythraeum podmiňuje zbarvení Rudého moře) nebo bentosu. V letních měsících se mohou ve sladkých vodách obsahujících fosfáty a nitráty rozmnoţit a vytvořit na povrchu hladiny tzv. vodní květ. Mohou ţít endosymbioticky s rozsivkami nebo houbami a exosymbioticky s lišejníky nebo játrovkami. 3. Patogenní bakterie vyvolávající onemocnění: např. Salmonella (tyfus, paratyfus), Shigella dysenteriae (úplavice), Streptococcus (angína, spála), Mycobacterium (tuberkulóza), Yersinia pestis (mor člověka) Doména archeí (Archaea) Archea jsou také buňky prokaryotického typu. Mají tvar koků, spiril nebo tyček. S výjimkou rodu Thermoplasma mají buněčnou stěnu, která neobsahuje murein, ale můţe obsahovat pseudopeptidoglykan neboli pseudomurein. Vazba mezi glycerolem a vyššími karboxylovými kyselinami v plazmatické membráně je éterová. Geny přepisované do transferové RNA (trna) a ribozómové RNA (rrna) (nikoli strukturní geny) obsahují introny, které jsou vystřihávány podobně jako u eukaryot, značná část genů je organizována do transkripčních jednotek typu operonŧ, při syntéze polypeptidového řetězce se v ribozomech jako první zařazuje aminokyselina metionin. Rozmnoţují se nepohlavně binárním dělením nebo pučením. Jsou chemoautotrofní nebo chemoheterotrofní (obligátně nebo fakultativně), mezofilní nebo termofilní (rostou i při 100 o C). Skupiny: 1. Extrémně halofilní archea - ţijí v prostředí s vysokou koncentrací solí (9 23 % NaCl), jako jsou solná jezera. 2. Archea produkující metan - vyskytují se v horkých pramenech, v odpadních a stojatých vodách, na dně moří, v trávicím traktu přeţvýkavců a termitů, kde přeměňují CO 2 a CO na metan. 23

28 6 Prokaryota, zastavení objektu pod imerzí 3. Hypertermofilní archea - vyskytují se v horkých sirných pramenech nebo v podmořských vulkanických oblastech při teplotách o C. Za anaerobních podmínek redukují síru na H 2 S, za aerobních podmínek oxidují H 2 S a síru na H 2 SO 4. ÚKOLY Úkol 1: Příprava trvalého preparátu suchou cestou roztěr bakterií bakterie G + a G -, krystalová violeť, Lugolův roztok, etanol, karbolfuchsin Nejdříve si vyţíhejte bakteriologickou kličku v plameni a poté proveďte kličkou stěr z povrchu agarové půdy porostlé koloniemi bakterií (zástupci Gram-pozitivních a Gramnegativních bakterií). Obsah kličky homogenizujte v co nejmenší kapce vody na podloţním sklíčku, po usušení na vzduchu fixujte nad plamenem (stačí 3x protáhnout nad plamenem roztěrem nahoru) a proveďte barvení preparátu. Postup barvení dle Grama: na sklíčko s roztěrem bakterií kápněte barvivo krystalová violeť (nechat barvit 3 min) slijte, opláchněte destilovanou vodou a převrstvěte preparát Lugolovým roztokem (KI + I + H 2 O) (2 min) slijte, opláchněte destilovanou vodou a přidávejte alkohol (etanol) tak dlouho dokud se bude barvivo vyplavovat opláchněte destilovanou vodou a převrstvěte karbolfuchsinem (1,5 min) opláchněte destilovanou vodou a osušte Pomůcka pro zapamatování postupu barvení: VLAK (violeť, Lugol, alkohol, karbolfuchsin) Preparát s obarvenými bakteriemi pozorujte pod imerzním objektivem. Do protokolu si zakreslete a zapište, jak se oba typy bakterií navzájem liší, a to tvarem a zbarvením. A B C Obr. 12: Postup zhotovení roztěru bakterií: A přenos bakterií do kapky vody bakteriologickou kličkou, B homogenizace, C hotový roztěr bakterií. Úkol 2: Pozorování bakterií pod imerzí TP, NP: zástupci G + a G - bakterií Imerzní objektiv slouţí k pozorování větších detailů, které jiţ nejsou patrné pod suchými objektivy. Nejdříve je potřeba najít vhodné místo v preparátu při menším zvětšení a umístit objekt do středu zorného pole mikroskopu. Následně je třeba pootočit revolverový měnič do poloviny (mezi objektivy), na krycí sklo nanést kapku imerzního oleje (dostatečně velkou) a dotočit objektiv do optické osy mikroskopu. Tím se spojí čelní čočka objektivu s kapkou imerzního oleje. Další postup: pomocí makroposuvu posunout stolek mikroskopu aţ do nejvyšší polohy (pozor, ať nepraskne preparát), kontrolovat pohledem ze strany, následně 24

29 6 Prokaryota, zastavení objektu pod imerzí točit makrošroubem opačným směrem, tj. oddalovat stolek s preparátem aţ se v zorném poli mikroskopu objeví objekt, doostřit mikroposuvem a upravit osvětlení imerzní olej Zásady: Obr. 13: Dva způsoby zastavení objektu pod imerzí. 1. Mezi objektivem a preparátem musí být imerzní olej, proto je potřeba nanést dostatečně velkou kapku oleje. 2. Po skončení práce s imerzním objektivem je nutné očistit čočku objektivu a sklíčko trvalého preparátu alkoholem. 3. Nepodaří-li se zastavit pozorovaný objekt pod imerzním objektivem, je třeba olej odstranit a celý postup zopakovat. Kontrolní otázky prokaryota, zastavení objektu pod imerzí Jaký je rozdíl mezi eukaryotickou a prokaryotickou buňkou (velikost, stáří, organely, rozmnoţování, pohyb atd.)? Jaká je velikost bakterií a jaký mikroskop se pouţívá pro jejich pozorování? Jaký je rozdíl mezi bakteriemi a archei? Uveď příklady zástupců. Jaký je postup barvení dle Grama? Jaký je rozdíl mezi G+ a G- bakteriemi? Uveď příklady zástupců. Co znamená imerzní objektiv a k čemu slouţí? 25

30 7 Eukarya (eukaryota) ţivočišná buňka, protozoa 7. Eukarya (eukaryota) ţivočišná buňka, protozoa Jejich základní stavební jednotkou je buňka eukaryotního typu, která je vývojově mladší a sloţitější neţ buňka prokaryotního typu. Průměrná velikost eukaryotní buňky se pohybuje mezi μm. Eukaryotní buňky se mnoţí mitózou, pohlavní buňky meiózou. Eukaryotní buňka můţe mít různý tvar a velikost, např. epiteliální buňky jsou kubické, buňky fibroblastů vřetenovité, nervové buňky mají dlouhé výběţky, bílé a červené krvinky u savců jsou obvykle kruhovité, u ptáků oválné. Od vnějšího prostředí je buňka ohraničena polopropustnou cytoplazmatickou membránou. Ribozomy mají sedimentační konstantu 80S. U eukaryotních buněk jsou hojně zastoupeny buněčné organely, které jsou specializovány na různé funkce. JÁDRO na jeho povrchu je dvojitá membrána, která odděluje jádro od cytoplazmy. V jaderné membráně se nachází jaderné póry, kterými se uskutečňuje transport molekul z jádra do cytoplazmy a naopak. V jádře jsou chromozomy, které jsou tvořeny lineární DNA a proteiny histony. Jádra různých buněk se liší velikostí, tvarem i počtem. JADÉRKO je součástí jádra a nachází se jen u eukaryotních buněk v interfázi. Obsahuje geny pro rrna a trna a jejich produkty. Na počátku mitózy jadérko mizí a v telofázi opět vzniká. Počet jadérek v jednom jádře není pevný a také jejich velikost je různá a závisí na metabolické aktivitě buňky. ENDOPLAZMATICKÉ RETIKULUM (ER) vytváří systém plochých váčků a kanálků a naléhá těsně na jádro. Jsou-li na jejich vnější straně přilehlé ribozomy, jedná se o drsné ER, na kterém probíhá syntéza proteinů. Hladké ER je bez ribozomů a probíhá v něm syntéza lipidů. Endoplazmatické retikulum je rovněţ zásobárnou vápníku. GOLGIHO APARÁT (GA) je systém samostatných plochých cisteren, u rostlin se tradičně označuje jako diktyozom. Do GA jsou transportními váčky (vezikuly) přepravovány z ER proteiny, lipidy a sacharidy, které jsou dále chemicky modifikovány. Primárně se v GA syntetizují látky, které jsou transportovány a vyměšovány z buňky (sekrety, enzymy, hormony) prostřednictvím sekreční dráhy (viz obr. 14). ríbozomy vezikuly jadérko cisterny jaderný pór jádro drsné ER Obr. 14: Sekreční dráha v buňce. Golgiho aparát MITOCHONDRIE jsou oválné organely se dvěma membránami, z nichţ ta vnitřní je zprohýbaná v kristy, vnitřní prostor se nazývá matrix (obr. 15). Mají chromozomy, které jsou prokaryotního typu s cirkulární dvojřetězcovou DNA bez histonů. V buňce můţe být jedna aţ tisíce mitochondrií. Mitochondrie lze povaţovat za centra buněčného dýchání a energetická centra v buňce. Uvolňují chemickou energii vázanou v organických látkách 26

31 7 Eukarya (eukaryota) ţivočišná buňka, protozoa (buněčné dýchání) a na vnitřní membráně se syntetizují molekuly ATP (oxidativní fosforylace), které jsou pro buňku okamţitým zdrojem energie. matrix (vnitřní prostor) mezimembránový prostor vnitřní membrána tvořící kristy vnější membrána Obr. 15: Mitochondrie. PEROXISOMY jsou kulovité útvary, obsahují oxidační enzymy. Podílejí se na katabolismu, detoxikaci látek a odbourání peroxidu vodíku. LYZOSOMY (lysozomy, lysosomy) jsou malé měchýřkovité útvary obsahující hlavně trávicí enzymy. Dochází zde ke kyselé hydrolýze různých organických makromolekul na sloţky, které buňka následně vyuţívá na stavbu vlastních makromolekul, nebo které vylučuje. VAKUOLY se nachází u jednobuněčných eukaryot. Jedná se o potravní (trávicí) vakuoly, které jsou naplněné substrátem se ţivinami a pulzující vakuoly, které slouţí k osmoregulaci (u sladkovodních eukaryot odstraňují přebytečnou vodu). potravní vakuoly pulzující vakuoly Obr. 16: Nálevník s vakuolami (pulzující a potravní) PIGMENTOVÉ INKLUZE vznikají ukládáním pigmentů. Buňky, které tento pigment obsahují, se označují jako chromatofory (např. melanofory obsahují tmavý pigment melanin). Mezi eukaryota se řadí jednobuněčné eukaryotické organizmy (protozoa, dříve prvoci), chromista, houby, rostliny a ţivočichové. Eukaryota se aktuálně člení do šesti říší: OPISTHOKONTA (některá jednobuněčná eukaryota, houby, ţivočichové), AMOEBOZOA, RHIZARIA, EXCAVATA (v těchto třech říších jsou pouze jednobuněčná eukaryota), ARCHAEPLASTIDA (rostliny, řasy) a CHROMALVEOLATA (chromista a některá jednobuněčná eukaryota). NÁLEVNÍCI jsou pojmenovaní podle toho, ţe se objevují v nálevech, např. v senném nálevu připraveném z vody, sena, rozkládajících se rostlin, listů a malého mnoţství hlíny. Všude v přírodě a tedy i v seně jsou přítomné cysty nálevníků, ze kterých ve vodě vzniknou aktivní nálevníci. 27

32 7 Eukarya (eukaryota) ţivočišná buňka, protozoa ÚKOLY Úkol 1: Tvar buněk nervová buňka TP: mícha Ve ventrálních rozích šedé hmoty míšní vyhledejte neurony, pozorujte a zakreslete tvar nervové buňky (neuronu). šedá hmota míšní bílá hmota míšní ventrální roh míšní s neurony dendrit jádro cytoplazmatická membrána A Obr. 17: A průřez míchou, B sloţení neuronu. B Úkol 2: Tvar a počet jader TP: jaterní tkáň, leukocyty, nálevníci - trepka (Paramecium sp.), plazivenka (Spirostomum sp.), opalinka ţabí (Opalina ranarum) Pozorujte a zakreslete počet a tvar jader v jednotlivých buňkách. Jádra leukocytů (bílé krvinky) mohou mít tvar kulovitý, bobovitý (ledvinovitý), podkovovitý (tyčinkovitý), segmentovaný (esovitý nebo laločnatý); erytrocyt (červená krvinka) u savčích buněk je bez jádra, u ptáků má jádro oválný tvar. U trepky jsou v cytoplazmě dva typy morfologicky i funkčně odlišných jader: makronukleus (velké jádro vegetativní) a mikronukleus (malé jádro generativní); během procesu konjugace dvou trepek dochází k vzájemné výměně a vývoji těchto jader. Plazivenka má jádro růţencovité/korálkovité (připomíná růţenec, korálky na šňůrce), v cytoplazmě opalinky můţeme pozorovat velký počet drobných stejných jader (mnohojaderná buňka). kulovité jádro bezjaderná buňka (erytrocyt) makronukleus mikronukleus bobovité (ledvinovité) jádro laločnaté, esovité a podkovovité jádro mnohojaderná buňka růţencovité jádro Obr. 18: Typy buněčných jader. 28

33 7 Eukarya (eukaryota) ţivočišná buňka, protozoa Úkol 3: Buněčné organely Golgiho aparát, mitochondrie TP: tenké střevo (stříbřené a dobarvené hematoxylin-eosinem), játra obarvená na mitochondrie (podle Heidenheina) Do středu zorného pole zastavte klky střevní sliznice a při větším zvětšení prohlédněte jejich povrchové buňky (enterocyty). V apikální (horní) části buňky nad fialově zbarveným jádrem můţete nalézt Golgiho aparát v podobě hnědočerného klubkovitého útvaru nebo nepravidelné sítě. V jaterních buňkách jsou vidět mitochondrie (drobné tmavě zbarvené čárkovité aţ oválné útvary) a světlé šedé jádro (případně růţové) s tmavými jadérky. Nakreslete Golgiho aparát a mitochondrie. Golgiho aparát klk jádro A B Obr. 19: Golgiho aparát: A průřez tenkým střevem, B střevní klk s enterocyty s Golgiho aparátem a jádrem. jádro s jadérkem mitochondrie Obr. 20: Mitochondrie v jaterních buňkách. Úkol 4: Pigmentové inkluze TP: kůţe ţáby Pod mikroskopem pozorujte buňky epidermis ţáby (tzv. chromatofory resp. melanofory) obsahující inkluze pigmentu melaninu. Buněčné inkluze v podobě drobných hnědých zrnek se v cytoplazmě shlukují do hvězdicovitých útvarů s různě dlouhými výběţky, realizuje se tím barvoměna. jádro melanin Obr. 21: Melanofory ţáby obsahující melanin. 29

34 7 Eukarya (eukaryota) ţivočišná buňka, protozoa Kontrolní otázky živočišná buňka, protozoa Jaký je rozdíl mezi eukaryotickou a prokaryotickou buňkou (velikost, stáří, organely, rozmnoţování, pohyb atd.)? Co patří mezi eukaryota? Jaká je velikost eukaryotní buňky? Co je to endosymbióza? Jaké organely se nachází v eukaryotické buňce a jakou mají funkci? Umíš nakreslit a popsat jádro, Golgiho aparát, endoplazmatické retikulum, mitochondrii? Umíš nakreslit nervovou buňku? Jaké tvary mohou mít jádra leukocytů? Jaké typy a počty jader se mohou vyskytovat u nálevníků? Jaké specifické barvení se pouţívá k průkazu Golgiho aparátu a mitochondrií? Kde v buňce se nachází mitochondrie? Jaké inkluze se mohou nacházet v ţivočišné buňce? 30

35 8 Eukarya (eukaryota) rostlinná buňka 8. Eukarya (eukaryota) rostlinná buňka Rostlinná buňka je eukaryotického typu (sloţení eukaryotické buňky bylo popsáno v Kapitole 7), ale na rozdíl od buňky ţivočišné má navíc buněčnou stěnu sloţenou z celulózy, dále obsahuje chloroplasty, zásobní a krystalické buněčné inkluze a velkou centrální vakuolu (ekvivalent lysozomů) s rostlinnými šťávami a barvivy (např. antokyany). PLASTIDY se podle obsahu barviv rozlišují na bezbarvé leukoplasty, barevné chromoplasty, amyloplasty obsahující škrob, proteoplasty obsahující proteiny, oleoplasty obsahující tuky a chloroplasty obsahující zelené barvivo chlorofyl. CHLOROPLASTY se nachází u rostlin a jejich funkční ekvivalenty se nacházejí i u některých bakterií. Mají chromozomy prokaryotního typu s cirkulární dvouřetězcovou DNA s histon-like proteiny (např. HC). Uvnitř chloroplastů na tylakoidních membránách probíhá nejdůleţitější biochemický proces na Zemi fotosyntéza spojená s tvorbou ATP (fotosyntetická fosforylace). tylakoidy tvořící grana stroma (vnitřní prostor) vnější mebrána vnitřní mebrána Obr. 22: Chloroplast popis. CENTRÁLNÍ VAKUOLA vyplňuje většinu objemu buňky. Centrální vakuola je ohraničena membránou (tonoplast), která se aktivně podílí na regulaci osmotického tlaku v buňce. Ve vakuolách se ukládají zásobní sacharidy, alkoholy, barviva, ale i odpadní látky a jsou zde i enzymy, které tyto nepotřebné látky rozkládají. Zhoustne-li obsah vakuol, dochází k vykrystalizování některých látek a ke vzniku buněčných inkluzí. INKLUZE můţeme rozdělit na několik typů: zásobní (např. škrobová zrna, viz Kapitola 5) a krystalické (krystaly šťavelanu vápenatého, které vznikly neutralizací přebytečné kyseliny šťavelové kationty vápníku jako např. rafidy, styloidy a drúzy). ANTOKYANY jsou barviva, která se nachází např. ve vakuolách buněk oplodí bobulí ptačího zobu (Ligustrum vulgare). Antokyany chrání rostlinu proti nadměrnému ozáření, zvyšují odolnost proti mrazu a suchu a odpovídají za zbarvení, které můţe být v závislosti na ph červené (kyselé ph), fialové (neutrální ph 6,8-7,3) nebo modré (alkalické ph). Antokyany se vyskytují i v kořenech (červená řepa), stonku (begonie), listech (červené zelí), nebo květech (plicník lékařský). OSMOTICKÉ JEVY obecný princip viz Kapitola 10. Rostlinná buňka: Hypotonické prostředí - voda proudí do buňky tak dlouho, dokud se nevyrovná vnitřní tlak plazmatické membrány protitlaku buněčné stěny, pak proudit přestane. Buněčná stěna je silná, napne se a dochází ke zvýšení turgoru (vnitřní tlak). Při poškození buněčné stěny můţe výjimečně dojít i k prasknutí buňky. Hypertonické prostředí - z rostlinné buňky uniká voda, ale tvar buňky se díky buněčné stěně, která drţí tvar, nemění. Cytoplazma a vakuoly zmenšují svůj objem a plazmatická membrána se odděluje od buněčné stěny. Jev se označuje jako plazmolýza. 31

36 8 Eukarya (eukaryota) rostlinná buňka ÚKOLY Úkol 1: Vakuoly, chloroplasty NP: bobule ptačího zobu (Ligustrum vulgare), voda, NaOH, kys. octová Rozřízněte bobuli ptačího zobu a obtiskněte na podloţní sklíčko. Přidejte vodu, přikryjte krycím sklíčkem a pozorujte. Jaké je zbarvení vakuol (neutrální prostředí)? Pozorujte, jak se změní zbarvení vakuol po přidání kys. octové (kyselé prostředí) a NaOH (zásadité prostředí) a vaše pozorování zapište. Kromě vakuol lze uvnitř buněk pozorovat i drobné zelené chloroplasty. chloroplasty vakuola Obr. 23: Buňky bobule ptačího zobu s centrální vakuolou a chloroplasty Úkol 2: Zvýšení turgoru pyl, voda Na podloţní sklíčko naneste špejlí pylová zrna, pozorujte a zakreslete jejich tvar. Pylová zrna se někdy v preparátu hůře hledají. Nejdříve se snaţte zaostřit na vnitřní hranu krycího skla a poté prohledávejte okraje preparátu meandrovitým způsobem při zvětšení 10 (nezapomeňte clonit a proostřovat). Poté přikápněte k pylu kapku destilované vody, přikryjte krycím sklíčkem a znovu pozorujte a zakreslete. Pronikáním vody do pylových zrn, dojde ke změně jejich tvaru (zvětší se a zakulatí), u některých pylových zrn můţe docházet k praskání - výronům ţlutě zbarvené cytoplazmy. Nezaměňujte ale se vzduchovými bublinami, které mají černé kontury. A výron cytoplazmy Obr. 24: Osmotické jevy: A pylové zrno (dva různé tvary) v izotonickém prostředí, B pylové zrno v hypotonickém prostředí (změna tvaru a výron cytoplazmy). B 32

37 8 Eukarya (eukaryota) rostlinná buňka Úkol 3: Plazmolýza (prostá a křečová) cibule, KNO 3 Z cibule sloupněte vnitřní epidermis (protáhlé buňky) a dejte na podloţní sklíčko (vyrovnejte epidermis preparační jehlou), přikápněte 1 % neutrální červeň a přikryjte krycím sklíčkem. Po obarvení vakuol do červena přikápněte k hraně krycího skla kapku 1M KNO 3 (hypertonické prostředí) a z protilehlé hrany krycího skla odsajte filtračním papírem tekutinu pod krycím sklem. V mikroskopu pozorujte plazmolýzu - oddělování cytoplazmy od buněčné stěny z důvodu úniku vody z buňky do hypertonického prostředí. V jednom preparátu můţete pozorovat zároveň prostou plazmolýzu (oddělování cytoplazmatické membrány od buněčné stěny na protilehlých stranách buňky) a křečovou plazmolýzu (nestejnoměrné oddělování cytoplazmatické membrány od buněčné stěny, centrální vakuola je křečovitě staţená). Plazmolýza můţe být vratný proces. Nakreslete a napište závěr. buněčná stěna tonoplast cytoplazma vakuola A B Obr. 25: Osmotické jevy v buňkách epidermis cibule: A prostá plazmolýza, B křečová plazmolýza. Kontrolní otázky eukarya, rostlinná buňka Jaký je rozdíl mezi rostlinnou a ţivočišnou buňkou? Umíš nakreslit a popsat chloroplast? Co je to tonoplast? Co patří mezi krystalické inkluze? Co jsou to antokyany a k čemu slouţí? Jak se mění zbarvení vakuol v bobulích ptačího zobu v závislosti na ph? Co je to turgor? Co je to plazmolýza (prostá a křečová)? 33

38 9 Pohyb a taxe, nativní preparáty 9. Pohyb a taxe, nativní preparáty 9.1. Pohyb a taxe POHYB MOLEKUL - BROWNŦV MOLEKULÁRNÍ POHYB je náhodný pohyb mikroskopických částic v kapalném nebo plynném médiu. Tento pohyb poprvé zaznamenal v roce 1827 biolog Robert Brown, kdyţ pozoroval chování pylových zrn ve vodě. Podstatu tohoto jevu objasnil v roce 1905 Albert Einstein na základě kinetické teorie látek. Molekuly vody se v roztoku vlivem tepelného pohybu neustále sráţejí, přičemţ směr a síla těchto sráţek jsou náhodné. Čím je částice menší, tím je pohyb výraznější. POHYB BUNĚK/ORGANIZMŦ zahrnuje aktivní změnu tvaru jakékoliv součásti buňky, v uţším pojetí se týká lokomoce (pohyb z místa na místo) buňky/organizmu. Na pohybu se podílí vlákna cytoskeletálního systému: mikrofilamenta (aktinová vlákna) a mikrotubuly. Jejich pohyb závisí na transformaci energie chemické v mechanickou, kterou realizují tzv. motorové proteiny (molekulové motory dyneiny a kineziny asociované s mikrotubuly a myoziny I a II asociované s mikrofilamenty). CYTOSKELET je součástí všech eukaryotních buněk. Jedná se o systém proteinových různě dlouhých vláken. Podle velikosti a funkce se vlákna cytoskeletu dělí na: a) intermediární (střední) filamenta z fibrilárních proteinů různých typů (keratiny, vimentiny, neurofilamenta, laminy), dodávají buňkám mechanickou pevnost, vytváří jejich vnitřní kostru a určují umístění některých organel v buňce. Na pohybu buněk se nepodílí. b) mikrotubuly z globulárních proteinů tubulinů, vytváří vlákna mitotického vřeténka, řasinky a bičíky. Bičíky a řasinky eukaryotních buněk mají v centru 2 samostatné mikrotubuly, na periferii 9 párů mikrotubulů (tj. struktura 9+2). c) mikrofilamenta (aktinová vlákna) z globulárních proteinů aktinů, vytváří kontraktilní prstenec při dělení ţivočišných buněk (cytokineze), účastní se améboidního a svalového pohybu. AMÉBOIDNÍ POHYB (měňavkovitý) je zaloţen na vysílání výběţků (panoţek) ve směru pohybu buňky. Růst panoţek je zprostředkován klouzáním mikrofilament za pomocí molekulového motoru myozinu I. Po přichycení panoţky k podkladu dojde ke kontrakci zadní části buňky a přelití cytoplazmy ve směru vytvořené panoţky. Pohyb je charakteristický pro jednobuněčné měňavky (améby); u ţivočichů se takto pohybují např. makrofágy při fagocytóze. POHYB BIČÍKŦ A ŘASINEK EUKARYOT (tzv. kinocilií) je podmíněn klouzáním mikrotubulŧ poháněných molekulovými motory dyneiny. Hlavní strukturou kinocilií je svazek 10 párů mikrotubulů (struktura 9+2, tj. 9 párů po obvodu a 2 mikrotubuly ve středu, obr. 26). Kinocilie jsou na povrchu kryty cytoplazmatickou membránou a v buňce jsou pevně zakotveny v tzv. bazálních tělískách. Bičíky jsou dlouhé a jejich počet bývá malý (1-8). Pozorovat je lze u jednobuněčných eukaryotních organizmů s bičíky, ale i u buněk ţivočichů (spermie, plaménkové buňky protonefridií), modifikací bičíku je tzv. undulující membrána trypanosom. Řasinky (brvy) jsou krátké a většinou pokrývají celý povrch buňky. Pozorovat je lze především u jednobuněčných nálevníků, u ţivočichů nalezneme řasinky na tzv. řasinkovém epitelu (např. na povrchu ploštěnek a v dýchacích cestách savců). Modifikacemi brv jsou např. cirri (vzniklé splynutím skupiny brv v silnější útvar 34

39 9 Pohyb a taxe, nativní preparáty a mající pohybovou a opornou funkci), nebo membranelly (vzniklé splynutím řad brv a slouţící k přihánění potravy). radiální spojka spoke centrální mikrotubuly dynein mikrotubulový pár (A a B jednotka) A B Obr. 26: Příčný řez kinocilií struktura 9+2. SVALOVÝ POHYB je zaloţen na zkracování sarkomer (základní kontraktilní jednotka svalu) svalového vlákna v důsledku posunu aktinových vláken podél myozinových. Impulzem pro svalový stah je nervový vzruch, který vyvolá uvolnění Ca 2+ iontů ze sarkoplazmatického retikula (speciální název pro endoplazmatické retikulum ve svalových buňkách). Vápenaté ionty se váţí na protein troponin C a způsobí změnu jeho konformace a následně i změnu konformace tropomyozinu, který je navázán na aktinové vlákno. Aktinové vlákno se uvolní z vazby a můţe reagovat s myozinovým vláknem (tvořeno molekulovým motorem myozinem II) a dojde ke svalovému stahu. Stah se uvolní načerpáním Ca 2+ iontů do sarkoplazmatického retikula vápenatými pumpami, aktinové vlákno je opět zablokováno tropomyozinem a svalový stah odezní. Z disk aktin myozin Z disk Obr. 27: Sarkomera základní kontraktilní jednotka svalu. TAXE jsou usměrněné pohyby jednobuněčných eukaryot (prvoků) a ţivočichů na působení podnětu (podráţdění). fototaxe - pohyb ke světlu oxygenotaxe - pohyb do prostředí se zvýšenou koncentrací kyslíku chemotaxe - pohyb vyvolaný přítomností chemické látky Taxe mohou být pozitivní nebo negativní podle toho, jestli je vyvolaný pohyb orientován směrem k podnětu nebo opačně. 35

40 9 Pohyb a taxe, nativní preparáty 9.2. Nativní preparáty NATIVNÍ PREPARÁTY jsou preparáty připravené ze ţivých objektů neovlivněných ţádným fixačním roztokem. Nelze je dlouhodobě uchovávat a není moţné pozorovat některé detaily, které nejsou obarveny. Jako médium pro pozorování slouţí tekutina, ve které se studované objekty vyskytují za přirozených podmínek (voda, krevní sérum, plazma, kultivační média), nebo tzv. izotonické roztoky, např. fyziologický roztok, nebo PBS (phosphate buffered saline, fosfátem pufrovaný fyziologický roztok). Některé objekty je moţné pozorovat pouze poloţené na podloţním skle a přikryté krycím sklem bez pouţití tekutého média (např. různé koţní deriváty - chlupy a peří, chitinové části členovců - blanitá křídla, šupiny). Pozorování rychle se pohybujících organizmŧ se usnadní přidáním některých viskózních látek (glycerol, ţelatina, arabská guma), které zvyšují odpor tekutiny a brzdí tak pohyb organizmů, nebo přidáním některých narkotik (voda s několika kapkami éteru, chloroformu nebo CO 2 ), které v malých dávkách vedou ke zpomalení pohybu. K omezení pohybu někdy stačí zvýšení tlaku na krycí sklo, odsátí přebytečné tekutiny apod. Preparát by neměl být příliš hustý, proto je dobré tekuté objekty ředit, části tkání je vhodné separovat na podloţním skle preparační jehlou nebo rozdrtit druhým podloţním sklem (kompresní preparát). Jinou metodou je příprava nativního otiskového preparátu, tj. přiloţení řezné plochy objektu na podloţní sklo, přikápnutí kapky tekutiny, přikrytí krycím sklem a pozorování částic, které ulpěly na skle. Pro dlouhodobé pozorování nativních preparátů slouţí různé typy vlhkých komůrek. Ke zvýraznění některých struktur, které jsou pozorovatelné jen v ţivých organizmech, se pouţívá vitální barvení. ÚKOLY Úkol 1: Brownŧv molekulární pohyb NP: suspenze oxidu ţelezitého Kápněte na podloţní sklo suspenzi oxidu ţelezitého a přikryjte krycím sklem a pozorujte jednu malou částici a zakreslete trajektorii jejího pohybu. Jaký je princip pohybu částice? Úkol 2: Buňky s řasinkami TP: buňky s řasinkovým epitelem obarvené hematoxylin-eosinem Pozorujte a zakreslete buňky cylindrického nebo kónického tvaru s viditelným jádrem a řasinkami na širší základně. jádro řasinky A cytoplazma B Obr. 28: A Brownův molekulární pohyb, B buňka s řasinkami 36

41 9 Pohyb a taxe, nativní preparáty Úkol 3: Řasinkový pohyb NP: senný nálev, detrit z akvária/ video Z povrchové blanky senného nálevu (nebo detritu z akvária) naberte opatrně kapátkem kapku nálevu, přeneste na podloţní sklíčko a pod úhlem 45 o přikryjte krycím sklíčkem (rovnoběţně s podloţním) tak, aby pod sklíčkem nevznikly vzduchové bubliny. Pozor na chyby: nadbytek vody (vibrace, unášení objektů proudem vody mimo zorné pole, únik ze zaostřené optické roviny, voda na stolku, kondenzoru), nedostatek vody (bubliny, rychlé vyschnutí preparátu). V preparátu pozorujte rychle se pohybující buňky jednobuněčných eukaryot, především nálevníky různých velikostí, drobné bičíkovce, a také velké mnoţství prokaryot (bakterií) (obr 17). Pohyb řasinek lze pozorovat na obrvených buňkách nálevníků, ale i na povrchu mikroskopických ţivočichů z akvária (ploštěnky, vířníci). U nálevníků pozorujte i potravní a pulzující vakuoly. Pro lepší pozorování lze pouţít fázový kontrast. kulovité bakterie spirálovité bakterie tyčinkovité bakterie háďátko nálevník slávinka nálevník bobovka bičíkovec vířník ploštěnka Obr. 29: Zástupci mikrofauny. Úkol 4: Améboidní pohyb NP: senný nálev/video Připravte NP z povrchové blanky senného nálevu a pozorujte améby. Zpočátku jsou améby podráţděné a zakulacené, po několika desítkách sekund se přemění v plošší formy a začnou vysílat panoţky (pseudopodie) ve směru pohybu. Panoţky jsou homogenní, cytoplazma je granulovaná. Pozorujte, nakreslete a popište princip améboidního pohybu. Úkol 5: Bičíkový pohyb NP: spermie, senný nálev/video Kápněte spermie z inseminační dávky (v médiu androhep) na nahřáté podloţní sklíčko a pozorujte pohyb spermií a to směrem dopředu a rotaci kolem osy (mění se šířka hlavičky, bičík je na zadním konci buňky, buňku tlačí před sebou). Obdobně lze pozorovat bičíkový pohyb u bičíkovců v NP zhotoveném ze senného nálevu (většina volně ţijících bičíkovců má bičík na přední části buňky, bičík táhne buňku za sebou). Pro zpomalení nálevníků odsajte část vody pod sklíčkem pomocí filtračního papíru. 37

42 9 Pohyb a taxe, nativní preparáty Úkol 6: Struktura příčně pruhovaného svalu TP: příčně pruhovaný sval z končetiny hmyzu obarvený Heidenheinovým hematoxylinem a příčně pruhovaný sval potkana obarvený haematoxylin-eosinem Pozorujte oba typy preparátů a zakreslete příčné pruhování svaloviny, které je způsobené rozdílnou barvitelností svalových vláken. Vysvětlete princip svalového pohybu. myozin aktin A B C Obr. 30: A améboidní pohyb, B bičíkový pohyb, C příčně pruhovaný sval hmyzu. Úkol 7: Oxygenotaxe u nálevníkŧ NP: senný nálev Připravte nativní preparát ze senného nálevu a přikryjte krycím sklíčkem tak, aby pod sklíčkem vznikly vzduchové bubliny. Nálevníci vyhledávají prostředí s optimální tenzí kyslíku a začnou se shromaţďovat v okolí bublin. Stejný jev je moţné pozorovat při okrajích krycího sklíčka. O jakou oxygenotaxi se jedná? (pozitivní nebo negativní) vzduchová bublina nálevníci Kontrolní otázky pohyb a taxe, nativní preparáty Jaký je princip Brownova molekulárního pohybu? Jaké znáš typy pohybů u buněk/organizmů? Jaké cytoskeletální vlákno a molekulový motor se podílí na jednotlivých typech pohybů? Uveď příklad buněk s řasinkami a bičíky Umíš nakreslit příčný řez bičíkem (struktura 9+2)? Jak probíhá svalový pohyb? Umíš nakreslit sarkomeru? Co je to chemotaxe a oxygenotaxe u nálevníků? Jaké vakuoly se nachází u nálevníků? 38

43 10 Vyšetření krve 10. Vyšetření krve Metody vyšetření krve a jejich vyuţítí HEMATOLOGICKÉ VYŠETŘENÍ Krevní obraz (KO) poskytuje údaje o počtu krevních elementů (erytrocyty, leukocyty, trombocyty), mnoţství krevního barviva (hemoglobin) a hematokritu (procentuální podíl erytrocytů na objemu krve). Diferenciální rozpočet slouţí ke stanovení počtu jednotlivých druhů bílých krvinek (neutrofilní, eozinofilní, bazofilní, monofilní, lymfocyty, monocyty atd.). Pouţívá se při screeningu, krevních chorobách a zánětlivých onemocněních. Sedimentace erytrocytŧ (FW - podle Fahrea a Westergreena) pouţití při screeningu, zánětlivých, infekčních a nádorových onemocněních. Quick test určuje protrombinový čas, pouţití při léčbě koagulancii. APTT (aktivovaný parciální tromboplastinový čas) slouţí ke zjištění koagulačních faktorů IX, XI, XII pro vnitřní sráţení, pouţití při heparinizaci, léčbě streptokinázou a u hemofilie. Krvácivost (sráţlivost) pouţití při krvácivých chorobách a předoperačních vyšetřeních. Určení krevní skupiny a Rh faktoru Coombsŧv test slouţí k rozpoznání imunohemolytické reakce při inkompatibilitě Rh faktoru dítěte a matky. BIOCHEMICKÉ VYŠETŘENÍ Ionty (ionogram nebo mineralogram) stanovení koncentrace elektrolytů v krvi (Na, K, Ca, P, Mg, Fe atd.). Pouţití: součást screeningu, rozvrat vnitřního prostředí, poruchy činnosti ledvin, šok, zvracení, průjmy, poruchy srdeční činnosti. Metabolity produkty metabolismu (např. urea, kreatinin, bilirubin). Bílkoviny stanovujeme celkovou bílkovinu, albuminy, imunoglobuliny. Pouţití: posouzení stavu výţivy, imunity nebo sledování vývoje zánětu. Enzymy např. transaminázy (ALT, AST, ALP), GMT, LDH, CK a amylázy. Pouţití: onemocnění jater, ţlučových cest, pankreatu, kosterních svalů apod. Lipidy např. cholesterol, triglyceridy. Hormony např. TSH, T 3, T 4, aldosteron, progesteron, apod. Tumorové markery např. alfafetoprotein, CA, CEA, PSA. Léky např. Digoxin, Phenobarbital, atd. Speciální metabolity např. vit. A, B 6, B 12, C, D apod. Toxiny např. alkohol. stanovení glykémie stanovení acidobazické rovnováhy MIKROBIOLOGICKÉ VYŠETŘENÍ bakteriologické hemokultura mykologické plísně virologické viry parazitologické paraziti SÉROLOGICKÉ VYŠETŘENÍ Těmito vyšetřeními se stanoví hladiny některých protilátek, které vznikají jako odpověď na infekční agens (viry, bakterie a parazity). Příkladem je stanovení C-reaktivního proteinu (CRP), jehoţ koncentrace zejména při bakteriálních infekcích prudce stoupá. 39

44 10 Vyšetření krve Měření velikosti mikroskopických objektŧ Měření velikosti objektu se provádí běţným mikroskopem, do jehoţ okuláru se vloţí okulárový mikrometr. Je to kruhová, skleněná destička, na níţ je vyryta 1 cm dlouhá úsečka rozdělená na 100 dílků po 0,1 mm. Okulárovým mikrometrem se provádí vlastní proměřování objektu. Jak velké dílky okulárového mikrometru se skutečně jeví v mikroskopu, lze zjistit porovnáním s jiným přesným měřidlem pozorovatelným celou optickou soustavou mikroskopu. K tomuto účelu slouţí objektivový mikrometr, coţ je krycí sklo (přitmelené kanadským balzámem na podloţní sklo), na kterém je vyryta 1 mm dlouhá úsečka rozdělená na 100 dílků, takţe 1 dílek odpovídá 10 μm. Na začátku měření je nejdříve potřebné zjistit tzv. mikrometrický koeficient, tj. jaké hodnotě odpovídá jeden dílek okulárového mikrometru. K tomuto stanovení slouţí okulárový mikrometr v jednom z okulárů a objektivový mikrometr, který se umístí na stolek mikroskopu a zastaví se jako běţný preparát. Otáčením okuláru s okulárovým mikrometrem se dají obě měřítka do takové polohy, aby byla vzájemně rovnoběţná. Potom se posouvá objektivovým mikrometrem tak, aby se jeho počáteční ryska kryla s počáteční ryskou okulárového mikrometru. Poté se hledá libovolný dílek objektivového měřítka, který se překrývá s dílkem okulárového měřítka (nejjednodušší je vzít pravý okraj kratšího měřítka a odečíst odpovídající hodnotu na okulárovém měřítku), hodnoty dílků se zaznamenají. Měření je potřebné provést pro všechna zvětšení objektivů. Při pouţití menších zvětšení je třeba hodně clonit a před přechodem na větší zvětšení (hlavně ze 40 na 100 ) umístit objektivové měřítko do středu zorného pole, aby se neztratilo. Je třeba také počítat s tím, ţe objektivové měřítko se při větších zvětšeních také úměrně zvětšuje (pokud si nejste jisti, které měřítko je které, tak při otočení okulárem se otočí okulárový mikrometr). Hodnota jednoho dílku okulárového mikrometru (mikrometrický koeficient) se vypočítá vydělením počtu dílků odečtených na objektivovém mikrometru počtem dílků odečtených na okulárovém mikrometru. Je nutné stanovit mikrometrický koeficient zvlášť pro jednotlivá zvětšení objektivů. Mikrometrický koeficient = Počet dílkŧ obj. mikrometru 10 Počet dílkŧ okul. mikrometru okulárový mikrometr objektivový mikrometr Obr. 31: Příklad stanovení mikrometrického koeficientu pro zvětšení objektivu 4 (100. dílek objektivového mikrometru odpovídá 40. dílku okulárového mikrometru do vzorce pro mikrometrický koeficient dosadíme /40 = 25 µm). Mikrometrické koeficienty pro různé objektivy: 25 (4 ), 10 (10 ), 2,5 (40 ), 1 (100 ) Při vlastním měření mikroskopického objektu se umístí preparát na stolek mikroskopu a zjistí se, kolika dílkům okulárového mikrometru odpovídá měřený objekt. Tento počet dílků se vynásobí mikrometrickým koeficientem pro daný objektiv a výsledek se vyjádří v μm. 40

45 10 Vyšetření krve Transport látek, osmotické jevy (ţivočišná buňka) Buňka, jako otevřená soustava, můţe ţít jen za stálé výměny látek, energie a informací se svým okolím. Hlavní strukturou regulující buněčný příjem a výdej látek je cytoplazmatická membrána, která je polopropustná (semipermeabilní). Svou selektivní propustností zajišťuje, ţe koncentrace látek uvnitř buňky jsou udrţovány na úrovni optimální pro ţivot buňky. Mezi mechanizmy transportu látek přes membránu patří: PŘÍMÁ (PROSTÁ) DIFUZE závisí na fyzikálních vlastnostech membrány, která je propustná pro nízkomolekulární látky např. plyny, uhlovodíky, organické kyseliny, močovinu, etanol a vodu. Difuze závisí na rozdílu koncentrace daných látek uvnitř a vně buňky tj. na koncentračním spádu, teplotě a velikosti molekul. Difuze probíhá tak dlouho, aţ se koncentrace na obou stranách membrány vyrovnají. Zvláštním případem difuze je osmóza. OSMÓZA souvisí s polopropustností membrány, tzn. vodu propouští snadno, ale nepropouští látky ve vodě rozpuštěné. Je-li buňka obklopena izotonickým roztokem (roztokem o stejné koncentraci, jakou má cytoplazma), k průchodu vody membránou nedochází. Osmotické jevy nastanou tehdy, je-li buňka obklopena roztokem hypotonickým (o niţší koncentraci neţ má cytoplazma) nebo hypertonickým (o vyšší koncentraci neţ má cytoplazma). Ţivočišná buňka: Hypotonické prostředí - do buňky začne proudit voda (endosmóza vody), buňka zvětšuje svůj objem, aţ praskne. Jev se obecně označuje jako plazmoptýza, u červených krvinek jako osmotická hemolýza. Hypertonické prostředí - z buňky začne proudit voda ven (exosmóza) a buňka se začne svrašťovat. Někdy se tento jev označuje jako plazmorhiza. TRANSPORT POMOCÍ MEMBRÁNOVÝCH TRANSPORTNÍCH PROTEINŦ - specifický transport větších nenabitých polárních molekul (aminokyseliny, nukleotidy, cukry) a iontů (H+, Na+, K+, Ca2+, Mg2+, Cl-, HCO3 - ) pomocí kanálových proteinů, které vytváří póry (iontové kanály) pro difuzi rozpuštěných látek, nebo pomocí přenašečových proteinů na základě změny konformace (funkce turniketu). ENDOCYTÓZA - příjem kapalin a různě velkých částic vchlípením plazmatické membrány a následnou tvorbou endocytotických váčků, které jsou přesouvány do lyzosomů, kde jsou stráveny. Příjem rozpuštěných látek se označuje jako PINOCYTÓZA, příjem pevných částeček je FAGOCYTÓZA. EXOCYTÓZA výdej kapalin a různě velkých částic buňkou Určování krevních skupin KREVNÍ SKUPINY U LIDÍ Krevními skupinami (KS) obecně rozumíme všechny antigeny na membránách erytrocytů, které jsou schopné vyvolat tvorbu protilátek. Jedná se o proteiny (receptory, enzymy či transportní proteiny), glykoproteiny či oligosacharidy. Tyto antigeny se obvykle označují jako aglutinogeny. Protilátky (aglutininy) se v krevním oběhu vyskytují buď přirozeně, nebo je jejich tvorba vyvolána průnikem krvinek jiné KS do krevního oběhu. Shlukování krvinek v přítomnosti příslušných protilátek proti daným antigenům se označuje jako aglutinace a vyuţívá se pro rychlé orientační stanovení KS. U člověka je 41 Krevní skupina Aglutinogen Protilátky A A anti-b B B anti-a AB A, B - O - anti-a, anti-b

46 10 Vyšetření krve známo více neţ 30 systémů krevních skupin. Mezi nejvýznamnější patří systémy AB0, Rh či MNS. V systému AB0 rozeznáváme čtyři základní krevní skupiny: A, B, AB a 0. Tento systém je nejstarší a nejvýznamnější. Jako první jej popsal rakouský vědec a lékař Karl Landsteiner v roce 1901 (a za tento objev dostal v roce 1930 Nobelovu cenu za medicínu). Landsteiner však popsal pouze tři krevní skupiny, A, B a C (dnes 0). Nezávisle na něm dospěl v roce 1907 ke stejnému objevu rovněţ český lékař Prof. MUDr. Jan Janský. Ten ovšem správně identifikoval a klasifikoval všechny čtyři krevní skupiny, které sám označoval I, II, III a IV. Jedinci krevní skupiny A nesou na svých krvinkách aglutinogen A a tvoří protilátky anti-b, skupina B nese aglutinogen B a protilátky anti A. Skupina AB má oba aglutinogeny a ţádné protilátky, skupina 0 nemá aglutinogeny (je přítomen jen jejich prekurzor) a tvoří protilátky proti oběma aglutinogenům. Při transfúzi krve odlišné krevní skupiny hrozí akutní hemolýza: rychlá destrukce darovaných krvinek protilátkami příjemce a jejich následné odbourání prostřednictvím makrofágů a retikuloendoteliálním systémem. URČOVÁNÍ KREVNÍCH SKUPIN U LIDÍ K určení krevních skupin u lidí se pouţívá diagnostická souprava pro určování krevních skupin systému ABO (monoklonální). Tato souprava obsahuje monoklonální Anti-A, monoklonální Anti- B, diagnostické karty a tyčinky k promíchání diagnostik s krevními vzorky. Princip testu: aglutinační reakce, která je zaloţena na reakci mezi antigenem (na povrchu erytrocytů) a protilátkou (reagencie v testu). Postup: Do kaţdého modrého krouţku karty se kápne po 1 kapce monoklonálního diagnostika Anti-A. Do kaţdého ţlutého krouţku se kápne po 1 kapce monoklonálního diagnostika Anti-B. Do červeného krouţku se kápne po 1 kapce krve (po píchnutí do prstu tenkou jehlou stisknout prst a vymáčknout kapku krve). Přiloţenými tyčinkami se promíchají kapky monoklonálních diagnostik s kapkami krve a to kaţdý vzorek samostatným koncem tyčinky. Hodnocení: Výsledky se odečítají do 1 minuty po promíchání za mírného kývavého pohybu diagnostickou kartou. Pozitivní reakce (aglutinace) indikuje přítomnost odpovídajícího antigenu na erytrocytech. Negativní reakce (bez viditelné aglutinace) indikuje chybění odpovídajícího antigenu na erytrocytech Příslušná krevní skupina se určí podle následující tabulky Krevní skupiny v populaci lidí v ČR: A (45%) 0 (30 35%) B (15 20%) AB (5 7%) Reakce s diagnostikem Anti-A Anti-B Krevní skupina + - A - + B + + AB - - O 42

47 10 Vyšetření krve ÚKOLY Úkol 1: Příprava trvalého preparátu suchou cestou krevní nátěr krev K jedné straně odmaštěného podloţního skla kápněte malou kapku nesráţlivé krve. Před kapku krve přiloţte pod úhlem 45 o podloţní sklo se zabroušenými rohy a nechejte krev roztéct podél hrany sklíčka a poté plynulým tahem rozetřete kapku po podloţním skle (kapka krve se táhne za sklíčkem). Krevní nátěr musí být tenký, rovnoměrný, asi do 2/3 podloţního sklíčka. Několikrát postup opakujte, aţ se vám podaří zhotovit kvalitní krevní nátěr, který nechte zaschnout a prohlédněte pod mikroskopem. A D B E C Obr. 32: Postup zhotovení krevního nátěru: A kápnutí kapky krve na podloţní sklo, B přiloţení krycího skla před kapku krve pod úhlem 45 o, C zhotovení krevního nátěru, D ptačí erytrocyt (oválný, s jádrem, větší), E savčí erytrocyt (kulatý, bikonkávní, bez jádra, menší) Úkol 2: Barvení krevního nátěru (panoptické barvení dle Pappenheima) krev, May-Grünwald, Giemsa-Romanowski Zhotovte krevní nátěr (viz předchozí úkol). Po zaschnutí převrstvěte preparát barvivem May-Grünwald a nechejte působit 5 min., poté přidejte destilovanou vodu a opět nechejte 5 min. působit. Slijte a převrstvěte barvivem Giemsa-Romanowski. Po 10 min. slijte, opláchněte destilovanou vodou a k preparátu opatrně přiloţte filtrační papír k odsátí zbytků vody. Po odstranění filtračního papíru nechte nátěr zaschnout. Prohlédněte si obarvený krevní nátěr, v kterém můţete kromě erytrocytů pozorovat i leukocyty s modře obarvenými jádry. Úkol 3: Měření velikosti mikroskopických objektŧ TP: ptačí erytrocyty, NP: savčí erytrocyty Měření velikosti objektů se provádí pomocí okulárového mikrometru (měřítka), který je umístěn v jednom z okulárů. Při měření velikosti objektu je třeba zjistit, kolika dílkům okulárového mikrometru odpovídá měřený objekt. Tento počet dílků se vynásobí mikrometrickým koeficientem pro daný objektiv (kaţdý objektiv má svůj koeficient) a výsledek se vyjádří v μm. Změřte velikost ptačích a savčích erytrocytů. Jaký je rozdíl mezi ptačím a savčím erytrocytem (velikost, tvar a přítomnost jádra)? 43

48 10 Vyšetření krve ptačí erytrocyt bakterie - koky savčí erytrocyt bakterie - tyčinky pylové zrno 10 μm Obr. 33: Porovnání velikostí různých buněk. Úkol 4: Hemolýza osmotická (makroskopicky) krev, fyziol. roztok, voda Do dvou zkumavek nalijte po 1 ml savčí krve. Do jedné ze zkumavek přidejte 3 ml fyziologického roztoku a do druhé stejné mnoţství destilované vody. Mírně protřepejte a porovnejte obě zkumavky. Vysvětlete, k čemu v jednotlivých zkumavkách došlo a proč. Proveďte tzv. čtecí zkoušku a výsledky zaznamenejte. 3 ml destilované vody 1 ml krve 3 ml fyziologického roztoku Úkol 5: Hemolýza osmotická (mikroskopicky) krev, voda Na podloţní sklíčko naneste malou kapku krve a přikryjte krycím sklíčkem. K okraji sklíčka přikápněte kapku destilované vody. Pozorujte postupné ubývání erytrocytů způsobené jejich praskáním (prasklé erytrocyty jsou málo viditelné). Úkol 6: Plazmorhiza krev, 1M KNO 3 Na podloţní sklo naneste kapku krve a přikápněte k ní kapku 1M KNO 3. Po přiloţení krycího skla pozorujte a zakreslete krvinky svraštělé do hvězdicovitých útvarů, tzv. echinocyty (k této deformaci krvinek můţe dojít také např. v silných nátěrech, které pomalu vysychaly). Nakreslete a zapište závěr. 44

49 10 Vyšetření krve erytrocyt prasklý erytrocyt erytrocyt svraštělý erytrocyt A B Obr. 34: Osmotické jevy u savčích erytrocytů: A hemolýza, B plazmorhiza. Úkol 7: Fagocytóza TP: fagocytující bílé krvinky, barvené Pappenheimovou metodou Prohlédněte si preparát, najděte a zakreslete bílé krvinky s fagocytovanými partikulemi. Spočítejte fagocytární aktivitu (FA): FA = počet fagocytujících buněk/počet počítaných buněk. jádro fagocytované partikule leukocyt Obr. 35: Leukocyt s fagocytovanými partikulemi. Úkol 8: Určování krevních skupin Pomocí diagnostické soupravy pro určování krevních skupin systému ABO (monoklonální) si určete svoji krevní skupinu a zaznamenejte do protokolu. Kontrolní otázky vyšetření krve Co se pouţívá k panoptickému barvení (dle Pappenheima) krevního nátěru? Jaký je rozdíl mezi ptačím a savčím erytrocytem (velikost, tvar a přítomnost jádra)? Jak se provádí měření velikosti mikroskopického objektu? K čemu slouţí mikrometrický koeficient? Umíš nakreslit a popsat membránu (model tekuté mozaiky)? Jaké jsou způsoby transportu látek přes membránu? Jaký je rozdíl mezi endocytózou, exocytózou, pinocytózou a fagocytózou? Co je to osmóza? Jaké typy prostředí v souvislosti s osmotickými jevy rozlišujeme? Co se stane s ţivočišnou buňkou v hypotonickém, hypertonickém a izotonickém prostředí? Co znamená plazmoptýza a plazmorhiza? Co je to hemolýza? Jak vypadá hemolýza makroskopicky a mikroskopicky? Jaký je princip určování krevních skupin u lidí? Jaké jsou krevní skupiny u lidí (která skupina je nejčastější a která je vzácná)? 45

50 11 Buněčný cyklus, mitóza 11. Buněčný cyklus, mitóza BUNĚČNÝ CYKLUS je sled pochodů probíhajících v buňce od skončení jedné mitózy do konce mitózy následující a má 4 fáze: G 1 (z angl. gap - mezera), S (syntetická fáze), G 2 a M (mitóza). První tři fáze se označují jako interfáze, která zaujímá 90 % času celého buněčného cyklu. G 1 - buňka roste, probíhá v ní mnoţení organel, syntéza proteinů, RNA a DNA polymerázy. Na začátku G 1 fáze leţí hlavní kontrolní bod. Diferencované nedělicí se buňky (nervové, svalové) přecházejí do klidové fáze označované jako G 0. S - jaderná DNA se replikuje (replikace mimojaderné DNA probíhá během celého cyklu s výjimkou mitózy), zdvojuje se počet chromozomů a centrozomů. G 2 - buňka opět roste a přibývá buněčných struktur. M (MITÓZA) - slouţí jak k budování mnohobuněčného organizmu, tak i k nepohlavnímu rozmnoţování (u jednobuněčných a primitivnějších mnohobuněčných organizmů). Při mitóze dochází k rovnoměrnému rozdělení genetického materiálu, zdvojeného mechanizmem replikace DNA v predcházející S-fázi, do dvou dceřiných buněk, které jsou tak geneticky identické (klony). Mitóza zahrnuje období vlastního dělení jádra (karyokineze) a dělení cytoplazmy buňky (cytokineze) a má 4-5 fází: profáze, (prometafáze - v mikroskopu těţko odlišitelná od jiných fází), metafáze, anafáze a telofáze. Profáze - mizí jadérko, kondenzace (zviditelnění) chromozomů, centrozomy se rozchází k opačným pólům buňky a začíná se formovat dělicí (mitotické) vřeténko sloţené z pólů dělicího vřeténka (centrozomy) a mikrotubulů, vznik kinetochorŧ (komplex proteinů) v místě centromery na kaţdé sesterské chromatidě chromozomu. kinetochorové mikrotubuly astrální mikrotubuly chromatida centrozom centrioly polární mikrotubuly ekvatoriální rovina Obr. 36: Dělící vřeténko v ţivočišné buňce během metafáze. Prometafáze - rozpad jaderného obalu, vazba mikrotubulů dělicího vřeténka na kinetochory. Metafáze - seskupení chromozomů v ekvatoriální rovině buňky za pomoci mikrotubulů a molekulových motorů kinezinů. Anafáze - přerušení spojení sesterských chromatid proteolytickými enzymy a jejich rozchod (segregace) k opačným pólům vřeténka pomocí molekulových motorů dyneinů a zkracováním mikrotubulů. Telofáze - dekondenzace dceřiných chromozomů, vznik dvou jader s jaderným obalem a jadérky, zánik dělicího vřeténka. 46

51 11 Buněčný cyklus, mitóza Cytokineze - obvykle začíná jiţ v anafázi, kdy se u ţivočišných buněk začíná v ekvatoriální rovině pod plazmatickou membránou formovat kontraktilní prstenec tvořený mikrofilamenty a molekulovým motorem myozinem II. Stahováním prstence dojde k rozdělení buňky a poté se kontraktilní prstenec rozpadne. U rostlin a hub se v cytokinezi uplatňuje přepáţka fragmoplast, která je formována ze zbytků polárních mikrotubulů v ekvatoriální rovině buňky. K fragmoplastu jsou podél mikrotubulů transportovány váčky z Golgiho aparátu. Váčky se slévají a rostou směrem k buněčné stěně, aţ dojde k rozdělení buňky. jádro fragmoplast ekvatoriální rovina vezikuly mikrotubuly jádro kontraktilní prstenec mikrotubuly Rostlinná buňka Ţivočišná buňka Obr. 37: Cytokineze u rostlinné a ţivočišné buňky. PORUCHY MITÓZY vznikají vlivem mutagenů (např. hydrochinonu). Následkem těchto poruch můţe být: fragmentace chromozomŧ v profázi anafázový most - vzniká tak, ţe se sesterské chromatidy spojí v místě telomer (opakující se nukleotidová sekvence na konci chromatid) a při mitóze tak nedojde k jejich oddělení. anafáze u porušených chromozomŧ A B C Obr. 38: Poruchy mitózy (A fragmentace chromozomů v profázi, B anafázový most, C anafáze u porušených chromozomů). ÚKOLY Úkol 1: Mitóza v buňkách kořínku cibule TP: kořínek cibule obarvený v acetorceinu Mitóza u rostlinných buněk je mnohem výraznější neţ u buněk ţivočišných, 47

52 11 Buněčný cyklus, mitóza jednotlivé chromozomy jsou po obarvení acetorceinem patrné a jsou vidět i mikrotubuly dělicího vřeténka. V preparátu najděte a zakreslete jednotlivé fáze mitózy a rovněţ buňku v interfázi. telofáze raná anafáze profáze metafáze pozdní anafáze interfáze Obr. 39: Mitóza v buňkách kořínku cibule. Úkol 2: Mitóza v tkáňové kultuře a mitotický index TP: preparát z tkáňové kultury z ledvin králíka V preparátu najděte a zakreslete jednotlivé fáze mitózy, buňku v interfázi a tzv. monaster (buňka v metafázi při pohledu shora). V preparátu jsou patrné i poruchy mitózy jako je anafázový most. V 5 zorných polích mikroskopu spočítejte buňky v mitóze a buňky v klidu a dosaďte do vzorce pro MI. MITOTICKÝ INDEX udává frekvenci mitóz v ţivočišné tkáni nebo v rostlinném pletivu. Vyjadřuje podíl počtu buněk ve stádiu mitózy k celkovému počtu buněk. MI (%) = M/N x 100 kde, M = počet buněk v mitóze, N = celkový počet buněk profáze metafáze anafáze telofáze Obr. 40: Mitóza v ţivočišné buňce. 48

53 11 Buněčný cyklus, mitóza Úkol 3: Mitotické buňky v histologickém řezu tenkého střeva TP: střevo laboratorního potkana barvené hematoxylin-eosinem Preparát střeva prohlédněte nejdříve při malém zvětšení a zakreslete průřez střeva s vyznačením místa, kde budete hledat mitotické buňky. Při větším zvětšení se pokuste najít jednotlivé fáze mitózy. Buňky v mitóze jsou větší se zaoblenými okraji, světlejší a místo jádra je moţné pozorovat některou z mitotických figur. Průřez střevem Střevní klk telofáze metafáze B anafáze Obr. 41: Mitóza v epitelu tenkého střeva. Úkol 4: Mitotické buňky v histologickém řezu dělohy TP: děloha laboratorního potkana barvená hematoxylin-eosinem Preparát prohlédněte nejdříve při malém zvětšení a zakreslete průřez dělohou s kubickým epitelem děloţní sliznice, kde je moţné najít buňky v mitóze. Při větším zvětšení se pokuste najít jednotlivé fáze mitózy. Průřez dělohou Sliznice dělohy anafáze telofáze Obr. 42: Mitóza ve sliznici dělohy. 49

54 11 Buněčný cyklus, mitóza Úkol 5: Mitotické buňky v histologickém řezu varlat TP: varle laboratorního potkana barvené hematoxylin-eosinem Preparát prohlédněte a nakreslete nejdříve při malém zvětšení s vyznačením místa, kde budete hledat mitotické buňky, tj. na obvodu semenotvorných kanálků. Při větším zvětšení se pokuste najít jednotlivé fáze mitózy. Průřez varletem Semenotvorný kanálek anafáze Obr. 43: Mitóza v semenotvorném kanálku varlete. Kontrolní otázky buněčný cyklus, mitóza Jaké jsou fáze buněčného cyklu a co se děje v jednotlivých fázích? Jaké jsou fáze mitózy a co se děje v jednotlivých fázích? Co je to interfáze? Umíš nakreslit a popsat dělící vřeténko? Jak probíhá cytokineze u rostlinné a ţivočišné buňky? Jaké mohou být poruchy mitózy? Co je to anafázový most a jak vzniká? Co je to monaster? 50

55 12 Rozmnoţování a vývoj 12. Rozmnoţování a vývoj NEPOHLAVNÍ (ASEXUÁLNÍ, VEGETATIVNÍ) ROZMNOŢOVÁNÍ je vznik nového jedince z jedné nebo většího počtu somatických buněk mateřského jedince. Genetická informace se přenáší nezměněná, všichni potomci jsou tedy stejní jako generace předchozí. Hlavními způsoby nepohlavního rozmnoţování jsou dělení a pučení: a) Dělení (fisiparie) - dceřiní jedinci vznikají rozdělením mateřského jedince, který zaniká. Prvoci se dělí podélně (trypanosomy) nebo příčně (nálevníci). Známo je i mnohonásobné dělení, tzv. polytomie (např. při schizogonii, sporogonii, gamogonii u prvoků kmene Apicomplexa; nebo při schizogenezi (seriálním dělení) u ţivočichů, kdy se dceřiní jedinci začínají dělit dříve, neţ se sami oddělí od mateřského jedince a vzniká tak řetězec spojených jedinců (ploštěnky, mnohoštětinatci). b) Pučení (gemiparie) - na mateřském jedinci se vyvíjí pupen, který postupně dorůstá v dceřiného jedince (časté u přisedlých organizmů - houbovců, ţahavců, mechovců). POHLAVNÍ (SEXUÁLNÍ, GENERATIVNÍ) ROZMNOŢOVÁNÍ - nový jedinec se vyvíjí z jediné buňky (zygoty), která vzniká splynutím samčí a samičí pohlavní buňky (gamety). Gamety vznikají redukčním meiotickým dělením. U gonochoristŧ se tvoří samčí gamety v jiném jedinci neţ gamety samičí; u hermafroditŧ jsou gamety obojího typu tvořeny jedním jedincem. MEIÓZA je proces (gametogeneze), který slouţí ke vzniku pohlavních buněk. Meióza je jaderné dělení, při němţ se jádro dvakrát dělí, ale dělení předchází pouze jedna syntetická fáze (syntéza jaderné DNA). V prvním dělení (téţ heterotypické, první zrací, redukční, meióza I) se rozcházejí homologní chromozomy (dvojchromatidové). Ve druhém dělení (téţ homeotypické, druhé zrací, ekvační, meióza II) se rozcházejí sesterské chromatidy (identické chromatidy se stejnou nukleotidovou sekvencí). Mezi dvěma děleními můţe být interkineze (obdoba interfáze u mitózy), ale bez S fáze. Heterotypické dělení - počet chromozomů je redukován na polovinu (diploidní počet 2n se mění na haploidní počet chromozomů n). Má 4 fáze (profáze, metafáze, anafáze, telofáze): PROFÁZE I - z celého meiotického dělení zaujímá aţ 90 %. Můţe trvat několik hodin, dní aţ roků. Při zahájení profáze I jsou jiţ chromozomy zdvojeny (dvojchromatidové, obsahují 2 sesterské chromatidy, ke zdvojení došlo během S fáze). Během profáze I je moţné rozlišit 5 fází: Leptotene (časná profáze I, leptonema podle leptos = tenký) - chromozomy se začínají spiralizovat (začínají být viditelné), mají vzhled dlouhých jemných vláken. Začíná párování homologních chromozomů (nepohlavní chromozomy, obsahující stejné geny). Zygotene (období mezi časnou a střední profází I, zygonema podle zygon = dvojitá nit) - homologní chromozomy (kaţdý má 2 sesterské chromatidy) se přikládají těsně k sobě a vzniká tzv. bivalent sloţený ze 4 chromatid (= tetráda). Za vyhledání a navázání jiţ maximálně kondenzovaných homologních chromozomů odpovídá tzv. synaptonemální komplex, tj. seskupení proteinů, které specificky rozezná příslušný chromozomový pár. Pachytene (střední profáze I, pachytene podle pachynema = tlustý) - dochází k reciproké (vzájemné) výměně částí homologních chromozomů od otce a od matky (dochází k rekombinaci genetické informace). Tato výměna se označuje jako crossingover a místa překříţení chromatid jako chiazmata (jednotné číslo chiazma). Synaptonemální komplex se rozpadá a chromozomy se více kondenzují (zkracují a ztlušťují). 51

56 12 Rozmnoţování a vývoj Diplotene (střední aţ pozdní profáze I, diplonema podle diplos = dvojitý) - homologní chromozomy se od sebe oddělují (bez rekombinace nebo po rekombinaci vlivem crossing-overu). Diakineze (pozdní profáze I, podle diakino = rozpojuji) - zaniká jaderná membrána a jadérko, vzniká dělicí vřeténko. METAFÁZE I - homologní páry chromozomů se pomocí mikrotubulů dělícího vřeténka řadí v ekvatoriální rovině. ANAFÁZE I - dochází k segregaci chromozomŧ. Segregace je nezávislá, tj. náhodně se k pólům buňky rozchází homologní chromozomy (dvojchromatidové) původově od otce a od matky nebo rekombinované při crossing-overu. Tím dochází k druhé rekombinaci genetické informace, jejímţ výsledkem je jádro vytvořené kombinací otcovských, mateřských a v crossing-overu rekombinovaných chromozomů. TELOFÁZE I - kolem dvou nových jader s haploidním počtem dvouchromatidových chromozomů se vytvoří nová jaderná membrána. Vzniknou 2 haploidní buňky (2 haploidní jádra) oddělené buněčnou přepáţkou a telofáze heterotypického dělení přechází do profáze homeotypického dělení. Homeotypické dělení - haploidní buňky se dělí jako při mitóze. PROFÁZE II - chromozomy se kondenzují, na konci profáze se diferencují 2 dělící vřeténka. METAFÁZE II - chromozomy zaujmou polohu v ekvatoriální rovině. ANAFÁZE II - dochází k podélnému rozštěpení centromer a k rozchodu sesterských chromatid dceřiných chromozomů k pólům dělicího vřeténka. TELOFÁZE II - tvoří se jaderná membrána kolem kaţdé sady chromozomů. Následuje cytokineze, chromozomy se despiralizují a přestávají být viditelné. Produktem meiózy výchozí mateřské buňky s diploidním počtem dvouchromatidových chromozomů je čtveřice gamet s haploidním počtem jednochromatidových chromozomů. Studium a pochopení průběhu meiózy se uplatňuje v cytogenetice. SPERMIOGENEZE (spermatogeneze) je vznik a vývoj spermií ve varleti. Spermatogonie se mitoticky dělí na spermatocyty I. řádu (primární spermatocyt), které vstupují do prvého meiotického dělení za vzniku spermatocytŧ II. řádu (sekundární spermatocyt). Po druhém meiotickém dělení vznikají čtyři spermatidy, které se následně diferencují ve spermie. Diferenciace spermií (ztráta většiny cytoplazmy a vytvoření bičíku) se děje aţ po ukončení meiózy, kdy jsou buněčná jádra haploidní a buňky ukončily cytokinezi. Spermiogeneze je zahájena v době pohlavní dospělosti a trvá asi 74 dnů. OOGENEZE je vznik a vývoj vajíček ve vaječníku. Vajíčka vznikají z diploidních zárodečných prapohlavních buněk (primordiální gonocyty), které osídlily vaječník a staly se z nich oogonie. Ty se mitoticky dělí a vznikají primární oocyty (oocyty I. řádu), které vstupují do meiózy (u člověka v 7. měsíci nitroděloţního vývoje) a zastaví se v profázi prvého meiotického dělení (u ţeny to je do let). Během této doby primární oocyt roste aţ na konečný průměr 100 μm, pomocí endocytózy a folikulárních buněk (pomocné buňky obalující vajíčko) se v nich hromadí ţloutek jako materiálová a energetická rezerva. Gonadotropní hormon vylučovaný z hypofýzy (folikulostimulační hormon, FSH) navodí v buňkách folikulů tvorbu pohlavních hormonů (estrogenů), které indukují pokračování zrání primárního oocytu. V pohlavní dospělosti pokračuje oogeneze. Ve 28 denních cyklech vzniká z primárního oocytu sekundární oocyt (oocyt II. řádu) a první pólové tělísko. Sekundární oocyt se zastaví v metafázi druhého meiotického dělení, kde setrvá aţ do oplození. Po oplození dokončí sekundární oocyt druhé meiotické dělení a vznikne vajíčko a druhé pólové tělísko. Vajíčko se začne rýhovat, pólová tělíska zanikají. 52

57 12 Rozmnoţování a vývoj oogonie 2n mitóza 2n spermatogonie primární oocyt (oocyt I. řádu) 2n 2n I. meiotické dělení spermatocyt I. řádu pólové tělísko oocyt II. řádu n n n n II. meiotické dělení spermatocyt II. řádu n n n n spermatida pólová tělíska vajíčko n n n n spermie A B Obr. 44: A schéma průběhu oogeneze, B schéma průběhu spermiogeneze. ESTRUS (říje) - dozrávání a uvolňování samičích gamet u savců probíhá opakovaně v tzv. estrálním cyklu. Rozlišujeme 4 fáze, pro něţ je charakteristický mikroskopický nález ve stěru z poševní sliznice. Pro proestrus jsou typické epiteliální buňky s malým dobře barvitelným jádrem (v této době dozrává vajíčko ve vaječníku uvnitř folikulu, který je tvořen folikulárními buňkami, které produkují hormon estrogen); v estru převládají bezjaderné zrohovatělé epiteliální buňky (dochází k uvolnění zralého vajíčka z Graafova folikulu = ovulace); v metestru je moţné najít buňky s velkými jádry a hlen (děloţní sliznice se připravuje na případné zahnízdění oplozeného vajíčka, vzniká ţluté tělísko corpus luteum, které produkuje hormon progesteron); v diestru převládá hlen a leukocyty (dochází k vyloučení neoplozeného vajíčka). Monoestrická zvířata - říje (estrus, ovulace) probíhá jednou ročně (např. vlk, jelen). Deiestrická zvířata - říje probíhá dvakrát do roka (např. pes). Polyestrická zvířata - říje probíhá několikrát do roka (např. hlodavci, zajíc, mnozí domestikovaní savci). UTAJENÁ BŘEZOST je prodlouţení doby mezi pářením a porodem pozastavením vývoje zárodku zpravidla na konci rýhování ve stadiu blastocysty (některé kunovité a medvědovité šelmy, pásovci, srna aj. savci). UTAJENÉ OPLOZENÍ - páření proběhne určitou dobu před ovulací a spermie jsou po kopulaci uchovávány v pohlavních cestách samice aţ do ovulace (např. u netopýrů a některých ptáků). INDUKOVANÁ OVULACE (provokovaná říje) - stimulem pro ovulaci je vlastní akt páření (např. králík, zajíc, myš, drobné šelmy), případně ztráta mláďat (lvi, hulmani - noví vůdčí samci záměrně zabíjejí cizí, tedy ne svá mláďata = infanticida). FYLOGENETICKÝ VÝVOJ je vývoj v historickém sledu, představující příbuzenské vztahy ţijících i vymřelých organizmů. ONTOGENETICKÝ VÝVOJ je individuální vývoj organizmu v průběhu jeho ţivota od oplození vajíčka do dospělého stavu, případně aţ do jeho smrti. Probíhá ve dvou 53

58 12 Rozmnoţování a vývoj obdobích: embryonálním (prenatálním) a postembryonálním (postnatálním) (u savců bývá včleněno ještě tzv. období fetální). NEPŘÍMÝ VÝVOJ ŢIVOČICHŦ je vývoj jedince přes stádium larvy. Larvy mají zpravidla jinou potravní základnu a ţijí v jiném prostředí neţ dospělci. Primární larvy jsou upravená vývojová stádia (např. obrvená blastula), sekundární larvy jsou stavebně zcela odlišné (larvy hmyzu a pulci ţab). U hmyzu má nepřímý vývoj 2 varianty: Proměna nedokonalá (hemimetabolie) - larvy se podobají dospělci, tj. imagu hmyzu (kobylky, ploštice, všenky aj.). Proměna dokonalá (holometabolie) - larvy se morfologicky i ekologicky liší od imaga, které vzniká metamorfózou (u hmyzu přes stádium kukly, např. motýli). Vyskytuje se také u obratlovců s vnějším oplozením, jako jsou ryby a obojţivelníci. PŘÍMÝ VÝVOJ ŢIVOČICHŦ - z oplozeného vajíčka se vyvíjí jedinec podobný dospělci aţ do vzniku pohlavně dospělého jedince. Podle odlišného vývoje rozlišujeme: Vejcorodost (oviparie) - mláďata se líhnou z vajíček uloţených v prostředí mimo tělo matky (ptáci, hmyz, plazi, ryby, někteří savci). Vejcoţivorodost (ovoviviparie) - vajíčka zůstávají v pohlavních vývodech matky a její tělo opouštějí larvy nebo juvenilní jedinci (některý hmyz, ryby, plazi, př. zmije obecná). Ţivorodost (viviparie) - vývoj zárodku uvnitř mateřského organizmu, kde je vyţivován alespoň částečně z těla matky prostřednictvím placenty (savci). APOMIXE je vývoj jedince z haploidní buňky - gamety. Příklady apomixe: Partenogeneze (řecky parthenos = panna) - vývoj jedince z neoplozeného vajíčka zcela bez účasti spermie (pavoukovci, hmyz, některé druhy ryb a ještěrů). Gynogeneze - vývoj vajíčka je aktivován spermií, jeţ poskytuje dělicí aparát, jádro spermie však zaniká a dalšího vývoje se neúčastní (hlístice, ploštěnky, vzácně ryby a ještěrky). Androgeneze (řecky andros = muţ) - vývoj jedince ze samčí pohlavní buňky (pouze u rostlin). ÚKOLY Úkol 1: Spermiogeneze TP: varle potkana barvené hematoxylin-eosinem Spermiogeneze probíhá v semenotvorných kanálcích varlat. Na příčném řezu semenotvorného kanálku jsou patrná jednotlivá vývojová stádia spermiogeneze. Prohlíţejte kanálek směrem od periferie do středu kanálku a zakreslete jednotlivé typy buněk. Na periferii semenotvorného kanálku se nachází spermatogonie, menší buňky s jádrem bohatým na chromatin, směrem do středu kanálku se vyskytují spermatocyty I. řádu a spermatocyty II. řádu, které se liší velikostí buněk i typem jader. Blíţe ke středu jsou spermatidy s malým mnoţstvím chromatinu v jádrech, v centru kanálku jsou dozrávající spermie. V některých kanálcích převládá pouze určitý typ buněk, proto je důleţité prohlédnout větší počet kanálků a zakreslit jednotlivá vývojová stádia buněk. Úkol 2: Pozorování tvaru a velikosti spermií rŧzných druhŧ zvířat TP: spermie potkana, králíka, prasete a býka. Fotografie spermií dalších druhů ţivočichů Pozorujte a zakreslete v poměrných velikostech jednotlivé typy spermií lišících se počtem a délkou bičíků, tvarem hlavičky a velikostí akrozomu (struktura ve tvaru čepičky, která 54

59 12 Rozmnoţování a vývoj obklopuje přední polovinu hlavičky, obsahuje důleţité enzymy, které umoţňují pronikání hlavičky spermie do vajíčka). semenotvorné kanálky spermie spermatida spermatocyt II. řádu spermatocyt I. řádu spermatogonie A B spermatogonie spermatocyt I. řádu spermatocyt II. řádu spermatida spermie Obr. 45: Spermiogeneze ve varleti potkana: A příčný řez varletem potkana, B semenotvorný kanálek s jednotlivými buňkami spermiogeneze, C vývojová řada spermiogeneze. potkan býk vyšší korýši perloočka králík hřebec ryby škrkavka ploštěnka kanec Obr. 46: Ukázky spermií různých ţivočichů v poměrných velikostech. Úkol 3: Meióza TP: obarvené podélné řezy varlat brouka smrtníka obecného (Blaps mortisaga) Prohlédněte si v TP několik řezů varlat a hledejte jednotlivé fáze meiózy. Do protokolu zakreslete charakteristickou strukturu jader meiotické profáze I v chronologicky správném pořadí. 55

60 12 Rozmnoţování a vývoj leptotene zygotene diakineze pachytene telofáze diplotene anafáze metafáze leptotene zygotene pachytene diplotene diakineze Obr. 47: Meióza v podélném řezu varlete brouka smrtníka obecného. Úkol 4: Oogeneze TP: ovarium potkana Prohlédněte si preparát ovaria potkana. Najděte a zakreslete oocyt s několika folikulárními buňkami (tzv. primární folikul, tj. nezralý) a Graafův folikul, tj. zralý folikul obsahující zralý oocyt se zmnoţenými folikulárními buňkami a dutinkami vyplněnými tekutinou. sekundární folikul folikulární buňky primární folikul oocyt (vaječná buňka) jádro jádérko Graafův folikul Obr. 48: Oogeneze ve vaječníku potkana. 56

61 12 Rozmnoţování a vývoj Úkol 5: Cytologické změny vaginální sliznice v prŧběhu estrálního cyklu TP: obarvené vaginální výtěry potkana v různých fázích estrálního cyklu V kaţdé fázi estrálního cyklu převládá charakteristický typ buněk. Pozorujte a zakreslete nálezy typické pro jednotlivé fáze estrálního cyklu. leukocyty hlen proestrus estrus metestrus diestrus Obr. 49: Jednotlivé fáze estrálního cyklu s typickým nálezem ze stěru z poševní sliznice. Úkol 6: Rýhování vajíčka králíka TP: vajíčko obklopené folikulárními buňkami a vajíčko se 2 blastomerami. Fotografie vajíčka se 2 pólovými tělísky a vajíčka s 8 blastomerami. Prohlédněte si trvalé preparáty a fotografie a zakreslete zralé vajíčko a jednotlivá stádia rýhování. A B C D Obr. 50: Vajíčko králíka: A neoplozené vajíčko, B vajíčko po oplození, C 2 blastomery, D 8 blastomer. Úkol 7: Pučení kvasinek NP: suspenze kvasinek v kultuře Zhotovte nativní preparát ze suspenze kvasinek. Pozorujte a zakreslete pučení, tj. vznik pupenu na pólu některých buněk, který se postupně zvětšuje a nakonec se odloučí od mateřské buňky. pupen Obr. 51: Pučení kvasinky. 57

62 12 Rozmnoţování a vývoj Úkol 8: Vývoj jednotlivých druhŧ ţivočichŧ TP: Hmyz s proměnou nedokonalou (luptouš Menacanthus currucae nebo péřovka Degeeriela rufa). Kyvety s vývojovými stadii hmyzu s proměnou dokonalou (motýl bekyně velkohlavá Lymantria dispar), ryby (pstruh obecný Salmo trutta), obojţivelníka (skokan hnědý Rana temporaria), ptáka (kur domácí Gallus gallus) a savců (potkan Rattus norvegicus, plod člověka Homo sapiens). Prohlédněte si vývojová stádia hmyzu s proměnou nedokonalou (vajíčko, larva, nymfa II. a III. instaru, imago), hmyzu s proměnou dokonalou (vajíčko, larva, kukla, imago), ryby (jikra, zárodek, vykulený plůdek se ţloutkovým vakem), obojţivelníků (vajíčko, pulec, ţába s pulčím ocáskem, ţába), ptáků (vejce, embryo vyjmuté z vejce, kuře po vylíhnutí) a savců (děloha v raném a pozdním období gravidity, plod potkana). A B C D Obr. 52: Vývoj hmyzu B s proměnou nedokonalou (všenka): A vajíčko, B larva, C nymfa II. a III. instaru, D imago (dospělec) Kontrolní otázky rozmnožování a vývoj Jaký je rozdíl mezi nepohlavním a pohlavním rozmnoţováním? Jak se liší mitóza od meiózy? K čemu slouţí meióza a jaké jsou fáze meiózy? Jaké jsou fáze profáze prvního meiotického dělení? Co je to crossing-over a kdy k němu dochází? Co je to spermiogeneze? Umíš zakreslit schéma spermiogeneze? Co je to oogeneze? Umíš zakreslit schéma oogeneze? Jak dlouho trvá spermiogeneze a jak dlouho oogeneze? Co jsou to folikulární buňky a jaký hormon produkují? Co je to Graafův folikul? Co je to corpus luteum a jaký hormon produkuje? Jaké jsou fáze estrálního cyklu a co je pro ně typické? Jaký je rozdíl mezi ontogenezí a fylogenezí? Umíš nakreslit příklad fylogenetického stromu? Jaký je rozdíl mezi proměnou dokonalou a nedokonalou (uveď příklady)? Co je to apomixe? 58

63 13 Modelový organizmus Drosophila melanogaster 13. Modelový organizmus Drosophila melanogaster Drosophila melanogaster (octomilka obecná, drozofila, lidově banánová nebo vinná muška) patří do řádu Diptera (dvoukřídlí) a jejím původním domovem je Indo-malajská oblast. Kromě tohoto druhu se ve střední Evropě nachází přes 10 jiných druhů rodu Drosophila. Genetické studium u drozofil začalo r v laboratoři T. H. Morgana v USA. Jedná se o genetický model, který byl pouţit z několika důvodů: snadný chov a kříţení, krátká generační doba, početné potomstvo, existence mutantních kmenů a malý genom (bylo popsáno a analyzováno genů, celý genom čítá asi 116 Mb, miliónů párů bází). Karyotyp 2n = 8, z toho 1. pár chromozomů jsou gonozomy (metacentrické, X je větší neţ Y), pár chromozomů jsou autozomy (2. a 3. pár velké metacentrické, 4. pár velmi malé metacentrické). Ţivotní cyklus: vajíčko (1 den), bílé, velikost 0,5 mm první larvální stádium L1, 1. instar (1 den) druhé larvální stádium L2, 2. instar (1 den) třetí larvální stádium L3, 3. instar (2 dny) kukla (4 dny), zpočátku bílá, později hnědne. imago, dospělec (40-50 dnů), velikost 2-3 mm, samička se od samečka liší velikostí, tvarem a zbarvením hřbetní strany zadečku (na zašpičatělém zadečku má tmavé pruhování, zatímco sameček má na kulatém zadečku celistvou tmavou skvrnu). Pro kříţení se vybírají neoplozené (virginelní) samičky, tj. asi 4-6 hod. po vylíhnutí. Tyto samičky jsou světlejší, mají protáhlý zadeček a někdy ne zcela rozvinutá křídla. Samičky jsou schopny se pářit za 12 hodin od vylíhnutí z kukly, samečci se mohou pářit jiţ za několik málo hodin. Za 6-10 dnů od páření klade samička aţ 300 vajíček. Obr. 53: Drosophila melanogaster rozdíl mezi samečkem a samičkou Laboratorní chov: Mouchy se chovají v Erlenmeyerových baňkách při pokojové teplotě nebo v termostatu při 25 o C. Na dno baněk se nalije ţivné médium, které se připraví z kukuřičného šrotu, sušených kvasnic, cukru a agaru. Na ţivné médium se pokládá filtrační papír a po vpuštění drozofil do baněk se baňka uzavře vatovou zátkou. 59

64 13 Modelový organizmus Drosophila melanogaster Mutantní linie: U drozofil je vyšlechtěna celá řada mutantních linií s rozdílnými geneticky zaloţenými znaky (barva očí a těla, morfologie křídel). Mutantní alela se u drozofily značí symbolem s malým počátečním písmenem, je-li recesivní, coţ je většina (w white = bílé oči; y yellow = ţluté tělo) a velkým písmenem, je-li dominantní (B bar = zúţené oči). Standardní alela se značí symbolem (+). Mutace Symbol Fenotyp white w bílé oči vestigial vg zakrnělá křídla curly cy křídla zahnutá nahoru yellow y ţluté zbarvení těla ebony e černé zbarvení těla eyeless ey redukované oči divoká forma white vestigial curly yellow ebony Obr. 54: Některé typy mutací u octomilky (Drosophila melanogaster) v porovnání s divokou formou. ÚKOLY Úkol 1: Kříţení drozofil s rŧzně zbarvenýma očima Drosophila melanogaster samec a samice s různou barvou očí Kříţení původní (divoké) formy drozofily s červenýma očima a mutantní linie drozofily s bílýma očima. Jedná se o pokus, který bude probíhat během 3 cvičení: 1. cvičení - zahájení pokusu Na cvičeních budete pracovat ve skupinách. Kaţdá skupina dostane Erlenmeyerovu baňku s čerstvým ţivným médiem a 2 zkumavky s drozofilami vytříděnými podle pohlaví. Prohlédněte si obě zkumavky (někdo bude mít červenooké samečky a bělooké samičky, jiní zase červenooké samičky a bělooké samečky), všimněte si a zaznamenejte rozdíly 60

65 13 Modelový organizmus Drosophila melanogaster mezi oběma pohlavími a různě zbarvených očí. Poté opatrně přesypte drozofily (samečky i samičky) do Erlenmeyerovy baňky, kterou si důkladně popište. 2. cvičení - odstranění dospělých drozofil z pokusu Na vatu připevněnou zespodu uzávěru uspávací nádobky kápněte trochu éteru a nádobku uzavřete. Za chvíli nádobku otevřete a vytřepejte do ní mouchy z kultivační nádoby. Mouchy jsou během několika sekund znehybněny a můţete je přesypat do zkumavky. 3. cvičení - hodnocení výsledku pokusu Pomocí éteru uspěte mouchy (potomky kříţení) a roztřiďte je podle pohlaví a barvy očí a odvoďte, jak se tento znak dědí. Dědičnost viz Kapitola Úkol 2: Mutantní linie Mutantní linie drozofil (white, yellow, ebony, curly, vestigial) - ţivé, v lihu a na obrázku. Prohlédněte si jednotlivé mutantní linie drozofil a zakreslete. Kontrolní otázky modelový organismus Drosophila melanogaster Kdo pouţíval octomilku ke svým experimentům? Proč se octomilky pouţívají jako vhodný genetický model? Jaký je vývojový cyklus octomilky? Jaký je rozdíl mezi samcem a samicí octomilky? Kolik chromozomů má octomilka? Znáš příklady mutací u octomilek? Jak se dědí barva očí u octomilek? 61

66 14 Cytogenetika 14. Cytogenetika CHROMOZOMY jsou pentlicovité útvary o velikosti 1-10 μm, které je moţné pozorovat mikroskopem v dělicí se buňce. U eukaryot existuje více modelů struktury chromozomů (např. jednořetětězcové, víceřetězcové). Metafázický chromozom se skládá ze dvou chromatid, které jsou spojeny proteiny koheziny v místě primární konstrikce, tj. v místě centromery. Na základě polohy centromery se chromozomy dělí na metacentrické, submetacentrické, akrocentrické a telocentrické. Lidské chromozomy se rozdělují podle Denverské nomenklatury do sedmi skupin A aţ G podle jejich velikosti a uloţení centromery. Chromozom je tvořen tzv. chromatinem tvořeným DNA, která je v trvalé vazbě s bazickými proteiny histony a dalšími kyselými proteiny. Podle intenzity barvení acetobarvivy, stupně kondenzace a intenzity transkripce se rozlišují dva druhy chromatinu: euchromatin (slabé barvení, malá kondenzace, transkripčně aktivní, přítomný v jádře inaktivní, pozorovatelný především při mitóze). jádro telomera centromera chromozom nukleozom s histony Obr. 55: Uloţení DNA v buňce v podobě chromozomů DNA šroubovice A B Obr. 56: Typy chromozomů podle polohy centromery (A metacentrický, B submetacentrický, C akrocentrický, D telocentrický). C D Pohlaví jedinců většiny druhů s odděleným pohlavím (gonochoristů) je určeno pohlavními chromozomy (heterochromozomy, gonozomy). Ostatní chromozomy se označují jako somatické chromozomy (autochromozomy, autozomy). Diploidní buňky jedince homogametického pohlaví obsahují 2 stejné gonozomy, jedinec heterogametického pohlaví obsahuje dvojici rozdílných gonozomů, nebo jen jeden gonozom. V následující tabulce je uveden přehled počtu chromozomů, gonozomů a autozomů v tělních a pohlavních buňkách člověka. Buňka Počet sad Celkem chromozomŧ chromozomŧ Gonozomy Autozomy Tělní (somatická) 2 (2n) Pohlavní (gameta) 1 (n) DETERMINACE POHLAVÍ U ŢIVOČICHŦ Různý genetický základ u samce a samice (pohlavní chromozomy) viz následující tabulka 62

67 14 Cytogenetika Typ chromozomového určení pohlaví Typ savčí (Drosophila) XY XX Typ ptakopysk Typ ptačí (Abraxas, systém ZW) Samec Samice Zástupci X 1 Y 1, X 2 Y 2, X 3 Y 3, X 4 Y 4, X 5 Y 5 ZZ X 1 X 1, X 2 X 2, X 3 X 3, X 4 X 4, X 5 X 5 savci, většina řádů hmyzu, rostliny, některé ryby, někteří plazi, obojţivelníci ptakopysk Stejný genetický základ u samce a samice (vliv prostředí, inkubační teplota) u některých ţelv a krokodýlů má inkubační teplota vliv na pohlaví mláďat (při inkubační teplotě niţší neţ 28 o C se líhnou z vajec pouze samci, při teplotě o C se líhnou samci i samice a při teplotě větší neţ 32 o C se líhnou pouze samice). POLYTENNÍ CHROMOZOMY (mnohovláknové, mnohořetězcové, obrovské, gigantické) jsou chromozomy, které je moţné najít v různých tkáních (slinné ţlázy, buňky střevního epitelu a malpighických trubic) larev některého dvoukřídlého hmyzu, rovněţ i u rostlin např. v endospermu kukuřice, v máku, oměji, pšenici a řeřiše. Polytenní chromozomy jsou zpravidla delší neţ normální chromozomy, měří μm a dosahují šířky aţ 25 μm. Kaţdý polytenní chromozom se skládá z mnoţství chromatinových vláken, která vznikla mnohonásobnou replikací a zůstávají spolu v paralelním uspořádání. Při barvení acetobarvivy vykazují lineární řadu střídajících se prouţků (disků a meziprouţků tmavší a světlejší barvy), coţ je způsobeno rozdílným barvením heterochromatinu a euchromatinu. Při aktivním fungování ztrácejí některé části polytenních chromozomů diskovité uspořádání, vznikají méně barvitelné vychlípeniny tzv. pufy ( puffs, Balbianiho prstence), kde probíhá tvorba mrna. LYONIZACE, BARROVO TĚLÍSKO u člověka a řady savců (např. kočka) u homogametického pohlaví (tedy samic), byla v nedělících se jádrech somatických buněk opakovaně prokázána přítomnost tzv. pohlavního chromatinu, který je podle svého objevitele označován jako Barrovo tělísko. Jedná se o 1 μm velký oválný útvar, který je ostře ohraničen a zpravidla bývá uloţen při vnitřní straně jaderné membrány. Barrovo tělísko nelze obvykle prokázat ve všech buňkách (např. u ţen se nachází ve 20 70% buněk ústní sliznice, u muţů se nachází v 0 3% buněk). Pohlavní chromatin je vlastně inaktivovaný chromozom X, který v interfázi zůstává spiralizován a je proto barvitelný. Většina genů inaktivovaného X chromozomu není geneticky aktivní, coţ počátkem 60. let zjistila M. F. Lyonová a tento jev (proces) byl nazván lyonizace. K irreverzibilní inaktivaci jednoho z chromozomů X dochází u savců jiţ v rané fázi embryonálního vývoje. Trvání inaktivace nemusí být absolutní, kondenzovaný X chromozom můţe být reaktivován během tvorby vajíček. Vyšetření buněk na přítomnost pohlavního chromatinu se vyuţívá k orientačnímu určování pohlaví u člověka. CYTOGENETIKA je obor, který se zabývá studiem buněčných struktur nesoucích genetickou informaci. Pomocí cytogenetických metod se zjišťuje počet, tvar a struktura chromozomů a hledají se příčiny a následky jejich změn. Základní cytogenetickou metodou je chromozomová analýza, jejímţ výsledkem je stanovení karyotypu. Materiálem pro vyšetřování chromozomů v somatických buňkách během mitózy jsou buňky kostní dřeně, choria, plodové vody, ale jako nejvhodnější se jeví lymfocyty z periferní krve. Mitotická aktivita lymfocytů se stimuluje fytohemaglutininem (extrakt z fazole), který se přidá do kultivačního média a buňky se kultivují v termostatu 72 hod. při 37 o C. Ke konci kultivace se do média přidává asi na 2 hod kolchicin, který poruší funkci dělicího ZW ptáci, motýli, některé ryby, někteří plazi, obojţivelníci, ojediněle u rostlin Typ Protenor (systém XO) XO XX ploštice, rovnokřídlý hmyz Typ včela (podle sad chromozomů) n 2n společenský hmyz 63

68 14 Cytogenetika vřeténka, zastaví dělení buněk v metafázi a tak vyvolá nahromadění metafázických buněk. Buňky jsou dále umístěny do hypotonického prostředí, fixovány, naneseny na podloţní sklo a obarveny Giemsovým barvivem. Vhodné karyotypy se mohou vyfotografovat, jednotlivé chromozomy vystříhat a roztřídit podle velikosti, umístění centromery a uspořádání prouţků a sestavit tak karyogram. KARYOGRAM, IDIOGRAM je schématické grafické znázornění chromozomového souboru jednotlivých druhů organizmů. KARYOTYP je sestava chromozomů zjištěná u konkrétního jedince. Kaţdý chromozom v preparátech je tvořen sesterskými chromatidami. EUPLOIDIE jsou změny počtu sad chromozomů př. triploidie (3n), oktoploidie (8n). ANEUPLOIDIE jsou změny počtu jednotlivých chromozomů, např. monosomie (2n-1), trisomie (2n+1). Aneuploidie mohou u člověka způsobovat poruchy (syndromy) se specifickými příznaky. K nejčastějším syndromům patří: Downŧv syndrom trisomie chromozomu 21, u obou pohlaví (47,XX+21; 47,XY+21) Edwardsŧv syndrom trisomie chromozomu 18, u obou pohlaví (47,XX+18; 47,XY+18) Pataŧv syndrom trisomie chromozomu 13, u obou pohlaví (47,XX+13; 47,XY+13) Turnerŧv syndrom chybí chromozom X, jen u ţen (45,XO; nebo 45,X) Syndrom tří X (metafemale) navíc chromozom X, u ţen (47,XXX) Klinefelterŧv syndrom navíc chromozom X, u muţů (47,XXY) Syndrom dvou Y (Jacobův syndrom, metamale) - navíc chromozom Y, u muţů (47,XYY) BARVICÍ METODY (prouţkovací, banding metody) slouţí k přesné identifikaci jednotlivých chromozomů a jejich aberací: G pruhy nejpouţívanější metoda, kdy se chromozomy vystaví účinku trypsinu, který denaturuje proteiny chromozomů, které se obarví Giemsovým barvivem. Na chromozomech vzniknou tmavé a světlé prouţky (úsek chromozomu s převahou párů bází adenin-tymin se barví tmavě, úseky, kde převaţují páry bází cytosin-guanin se barví světle). FISH (fluorescence in situ hybridization) vyuţívá fluorescenční sondy ke specifickému barvení jednotlivých chromozomových párů. Je moţné pouţít současně více sond (barev) k označení více párů chromozomů. ÚKOLY Úkol 1: Struktura polytenních chromozomŧ TP: slinné ţlázy larev pakomárů (Chironomus sp.) s obrovskými chromozomy Pozorujte buňky s polytenním chromozomem v buněčném jádru označovaném jako pentlicovité jádro. Pod větším zvětšením jsou na chromozomu patrné různě široké, odlišně se barvící okrsky, tzv. chromomery, které připomínají čárový kód. Dále jsou na chromozomu patrné zduřeniny, tzv. pufy. Zakreslete buňku slinných ţláz s polytenním chromozomem. Úkol 2: Karyotypy savcŧ TP: karyotypy králíka (44), prasete (38), ovce (54), koně (64), skotu (60) a člověka (48) obarvené metodou podle Giemsy po předchozí kultivaci s kolchicinem V TP z krve jednotlivých zástupců savců hledejte chromozomy. Porovnejte počty a tvary chromozomů jednotlivých druhů savců na základě mikroskopického pozorování. Zakreslete alespoň jeden karyotyp. V čem je zvláštní karyotyp skotu? Úkol 3: Zápis karyotypŧ Pokuste se správně zapsat následující karyotypy: 64

69 14 Cytogenetika hlavová část 1) karyotyp zdravého muţe a ţeny 2) karyotyp býka, klisny, berana 3) karyotyp muţe s Downovým syndromem a muţe s Klinefelterovým syndromem 4) karyotyp ţeny s Edwardsovým syndromem a ţeny s Turnerovým syndromem larva pakomára koncová část slinné ţlázy chromozom chromomery Obr. 57: Polytenní chromozom v buňkách slinných ţláz z larev pakomára. chromozomy A B Obr. 58: Ukázka karyogramu: A tur domácí (Bos taurus), 60 chromozomů, B cibule kuchyňská (Allium cepa), 16 chromozomů. Kontrolní otázky cytogenetika Čím se zabývá cytogenetika? Z čeho se skládá chromozom po chemické stránce? Jaké jsou typy chromozomů podle polohy centromery? Jaké jsou počty chromozomů (autozomů a gonozomů) v somatické a pohlavní buňce? Jak je determinováno pohlaví u různých skupin zvířat? Co je to polytenní chromozom? Co je to pohlavní chromatin (Barrovo tělísko) a jak vzniká? Jaký je rozdíl mezi trisomii a triploidii, jak se to dá zapsat? Z jakých buněk a jakým způsobem se dá zjistit karyotypy jedince? Umíš zapsat karyotyp člověka a domácích zvířat? Znáš příklady syndromů spojené s numerickou aberací? Umíš je zapsat? Jaká barvení se pouţívají pro chromozomy? 65

70 15 Metody molekulární biologie 15. Metody molekulární biologie MOLEKULÁRNÍ BIOLOGIE je vědní disciplína zabývající se studiem buněčných biologických procesů na molekulární úrovni. Princip fungování některých biologických jevů je odhalitelný pouze studiem jejich molekulární podstaty. Molekulární biologie studuje strukturu biomakromolekul (DNA, RNA a proteinů), jejich vzájemné interakce a regulace jejich funkcí ve vztahu k funkcím a vlastnostem buňky. Molekulární biologie tak na jedné straně souvisí s biologií buňky, na straně druhé s biochemií a genetikou. Tento dynamicky se rozvíjející obor integruje ve svém přístupu hlediska biologická, chemická i fyzikální. Metody molekulární biologie zahrnují např. fyzikální a chemické separační a charakterizační metody, jako jsou chromatografie, elektroforéza, elektronová mikroskopie a spektroskopie. Molekulárně biologické metody jsou široce vyuţívané nejen v základním a aplikovaném genetickém výzkumu nebo v genovém inţenýrství, ale i v archeologii, zoologii, botanice, klinické medicínské diagnostice, kriminalistice nebo v soudním lékařství. K hlavním metodickým přístupům molekulární biologie patří purifikace a separace nukleových kyselin, amplifikace nukleových kyselin, různé způsoby manipulace s nukleovými kyselinami, sekvenování DNA a dále pak různé metody analýzy genové exprese (studium transkripce a translace). V následující části kapitoly jsou vysvětleny principy nejpouţívanějších molekulárně biologických metod spolu s příklady jejich moţného vyuţití. IZOLACE DNA je prvním krokem většiny molekulárně biologických technik. Materiálem pro izolaci DNA mohou být jednotlivé buňky (např. prokaryotických organizmů nebo kvasinek), tkáně a orgány eukaryot, které jsou nejdříve homogenizovány, nebo například virové částice. Izolace DNA zahrnuje 3 základní kroky: 1. Rozrušení buněk nebo virových kapsidů působením enzymů (lysozym, celulázy) a/nebo detergentů (dodecylsulfát sodný). 2. Odstranění kontaminant pomocí enzymů (proteináza, RNAáza). 3. Vlastní extrakce DNA nejčastěji je pouţívaná fenol chloroformová extrakce, kdy buněčný lyzát je promíchán se směsí fenolu a chloroformu. Fenol je organické rozpouštědlo pouţívané k oddělení proteinů od NK. Proteiny jsou hydrofobní a zůstávají v organické fázi, zatímco NK jsou vysoce nabité a přecházejí do vodné fáze. Chloroform denaturuje proteiny, rozpouští tuky a napomáhá oddělení jednotlivých fází získaných v následujícím kroku. Centrifugací je oddělena spodní organická fáze, tvořená fenolem, mezifáze, tvořená denaturovanými proteiny a zbytky buněk, a horní vodná fáze, v níţ je rozpuštěna DNA. DNA je následně vysráţena etanolem, precipitát je shromáţděn centrifugací a získaný sediment je rozpuštěn ve vhodném roztoku (např. ve vodě). K izolaci DNA ze vzorku krve či tkáně je moţné pouţít komerčně dodávané izolační soupravy (kity), které výrazně zjednodušují a urychlují postup získání DNA. PCR (polymerase chain reaction, polymerázová řetězová reakce) je metoda slouţící k mnohonásobnému zmnoţení (amplifikaci) specifického úseku DNA in vitro. PCR zavedl v roce 1983 Kary Mullis (za objev této metody dostal Nobelovu cenu). Princip syntézy DNA touto metodou je podobný replikaci: kopie úseku DNA jsou syntetizovány pomocí enzymu DNA-polymerázy podle templátu ve formě jednořetězcové DNA na principu komplementarity bází. K zahájení reakce je zapotřebí dvou primerŧ (čti prajmrů) chemicky syntetizovaných krátkých oligonukleotidů, které se připojují ke komplementárním úsekům protilehlých řetězců DNA tak, ţe jejich 3'-OH-konce směřují 66

71 15 Metody molekulární biologie proti sobě. Pomocí primerů je zároveň vymezen úsek DNA, který bude amplifikován. Jako templáty pro syntézu slouţí oba řetězce dsdna, po předchozí denaturaci. Reakční směs pro PCR: templátová DNA můţe být izolována z různých mikroorganizmů, bioptických vzorků, stěrů, z buněk z tkáňových kultur, z tělních tekutin 2 primery (kaţdý komplementární k jednomu řetězci DNA) dntp (deoxyribonukleosidtrifosfáty) termostabilní DNA polymeráza (např. Taq polymeráza získaná z termofilní bakterie Thermus aquaticus ţijící v horkých pramenech) (dntp a DNA polymeráza bývají součástí tzv. master mixu) Reakční směs pro PCR se napipetuje do malé PCR zkumavky, která se vloţí do speciálního přístroje termocykleru (čti termosajkleru), kde probíhají cyklicky se opakující kroky za různých teplot. Průběh PCR: 1. počáteční denaturace DNA (separace řetězců) (94 C, 2-5 min) Vlastní řetězová reakce: 2. denaturace (separace řetězců) (94 95 C, s) 3. připojení (nasedání) primerŧ (55 65 C, s) 4. polymerační reakce (72 C, s) (prodluţování řetězců pomocí DNA-polymerázy, která syntetizuje komplementární řetězce DNA z volných nukleotidů, nově syntetizované řetězce slouţí jako templáty pro další cyklus) tyto kroky se cyklicky opakují (25-30 cyklů) 5. závěrečná extenze (72 C, 5 min) (dosyntetizování případně nedosyntetizovaných řetězců) Výhodou PCR je, ţe vyţaduje minimální mnoţství DNA (teoreticky stačí 1 molekula DNA). Touto metodou lze získat 2 n -1 kopií, kdy n je počet cyklů. Z jedné molekuly DNA lze tedy například získat po proběhnutí 30 amplifikačních cyklů víc neţ 10 9 kopií. *PCR (polymerázová používá se enzym DNA polymeráza, řetězová reakce počet kopií DNA roste během jednotlivých cyklů řetězovou řadou 2, 4, 8, 16, 32...). Výsledný produkt PCR (amplifikovaný úsek DNA) můţeme analyzovat např. stanovením velikosti produktu gelovou elektroforézou, štěpením restrikčními enzymy a posouzením vznikajících restrikčních fragmentů (RFLP), hybridizací se značenou sondou komplementární k části sekvence amplifikovaného úseku nebo stanovením sekvence DNA (sekvenování). Variantou PCR umoţňující syntézu cdna podle RNA templátu je reverzní PCR (RT-PCR) vyuţívající enzymu reverzní transkriptázy. Vyuţití PCR: PCR má mnohostranné vyuţití nejen v základním výzkumu (k izolaci genů nebo jejich částí, k přípravě značených sond, při sekvenování DNA) a aplikovaném genetickém výzkumu (k detekci mutací v genech, ke studiu polymorfizmu genů nebo v populační genetice), ale uplatňuje se i v klinických disciplínách (v prenatální diagnostice např. dědičných chorob, při detekci patogenních mikroorganizmů, k identifikaci onkogenů, ke stanovení pohlaví), v archeologii, kriminalistice (k identifikaci jedinců), v soudním lékařství (např. k určení paternity), v potravinářském prŧmyslu (k identifikaci falšování 67

72 15 Metody molekulární biologie potravinářských výrobků) a v dalších vědních oborech (zoologie, botanika, mikrobiologie, parazitologie). GELOVÁ ELEKTROFORÉZA patří k nejpouţívanějším separačním technikám slouţícím k izolaci a analýze nukleových kyselin a proteinů. Na tomto místě je vysvětleno pouţití gelové elektroforézy pro separaci různě dlouhých fragmentů DNA. Principem metody je pohyb záporně nabitých molekul DNA (hlavním nositelem náboje nukleových kyselin jsou záporně nabité fosfátové skupiny) v elektrickém poli směrem k anodě. Pomocí gelové elektroforézy můţeme separovat molekuly DNA na základě rozdílných rychlostí pohybu molekul DNA v gelu, které jsou nepřímo úměrné velikosti molekuly DNA. Elektroforéza se provádí na vhodném nosiči, nejčastěji v gelu tvořeném agarózou či polyakrylamidem (ve cvičení bude pouţita agaróza). Gel je tvořen sloţitou sítí polymerních molekul s póry, jimiţ se různě velké molekuly DNA pohybují různou rychlostí (velké fragmenty pomaleji, malé fragmenty rychleji). Agarózový gel se připravuje v různé hustotě (udávané v % práškové agarózy). Agaróza se rozpouští v pufru, který je také obsaţen v elektroforetické vaně jako elektrolyt (ve cvičení bude pouţit TBE pufr obsahující Tris, kyselinu boritou a EDTA). Vzorky se nanáší do jamek v gelu, které byly vytvořeny pomocí tzv. hřebínku. Zatíţení DNA (klesne do jamky v gelu) a migrace DNA v gelu jsou zajištěny přidáním tzv. nanášecího neboli vkládacího pufru, který je tmavě zbarvený a je tak umoţněna kontrola vloţení PCR produktu do příslušné jamky a také migrace v gelu. Pro odhad velikosti pozorovaných DNA fragmentů se do jedné jamky gelu nanáší tzv. velikostní marker (hmotnostní standard, DNA ladder = ţebřík) o definované velikosti jednotlivých fragmentů. Po proběhnutí elektroforézy je třeba separované fragmenty DNA zviditelnit. Pro vizualizaci DNA se pouţívá značení barvivem, které se váţe na DNA, např. ethidiumbromid nebo Midori Green (na cvičení bude pouţit Midori Green) a v UV záření v přístroji zvaném UV transiluminátor zviditelní fragmenty DNA. Pro detekci fragmentů DNA lze pouţít radioaktivní značení, nebo hybridizaci se značenou sondou (krátkým oligonukleotidem, který se komplementárně váţe k hledané sekvenci). Rozdělené molekuly DNA lze také ve funkční formě izolovat z gelu. RFLP (restriction fragment length polymorphism, polymorfismus délky restrikčních fragmentŧ) je metoda, jejíţ podstatou je enzymatické štěpení molekul DNA ve specifickém restrikčním místě enzymem restrikční endonukleázou. Různé restrikční endonukleázy štěpí cílovou DNA v různých místech, v závislosti na sekvenci DNA. Po rozdělení vzniklých fragmentů pomocí gelové elektroforézy můţeme na základě velikosti a počtu fragmentů sledovat rozdíly ve studovaných sekvencích, tzv. polymorfizmy. Polymorfizmy v délkách restrikčních fragmentů jsou způsobeny přestavbami (např. inzercemi, delecemi a substitucemi bází) ve studované sekvenci, které způsobí změnu počtu restrikčních míst. Vyuţití např. k určení pohlaví u ptáků nebo určení otcovství (test paternity). 68

73 velikostní standard vzorek 15 Metody molekulární biologie - směs fragmentů DNA různé velikosti zdroj dlouhé fragmenty krátké fragmenty elektroforetický gel Obr. 59: Gelová elektroforéza. dítě matka otec? otec? dítě matka otec otec? elektroforéza Obr. 60: Určení otcovství na základě metody RFLP DNA je izolovaná např. z buněk bukální sliznice a vyuţita k amplifikaci specifické sekvence. Amplikon je následně rozštěpen enzymem a výsledné fragmenty jsou separovány gelovou elektroforézou. Výsledné fragmenty lze vyuţít k vyloučení nebo potvrzení otcovství. HYBRIDIZACE NUKLEOVÝCH KYSELIN je zaloţena na specifickém spojení (hybridizaci, renaturaci) komplementárních nukleotidových sekvencí pocházejících z různých molekul NK. Základem hybridizace je obvykle značená sonda krátký úsek DNA o známé nukleotidové sekvenci, s jejíţ pomocí můţeme detekovat sekvenci k ní komplementární. Sonda můţe být značena fluorescenčně nebo radioaktivně. Nejčastěji bývá hybridizace prováděna na nosičích (viz Southernův přenos), ale je například moţno hybridizovat NK i v intaktních buňkách (hybridizace in situ ). 69

74 15 Metody molekulární biologie značená ss sonda B hybridizace ss DNA dsdna značená ss sonda se váţe na ss DNA na základě komplementarity Obr. 61: Princip hybridizace DNA (ss jednořetězcová, ds dvouřetězcová). Postup Southern blottingu (Southernův přenos) + hybridizace: 1. Příprava a značení sondy. 2. Rozdělení restrikčních fragmentů DNA daného vzorku gelovou elektroforézou. 3. Denaturace DNA a přenos jednořetězcových fragmentů DNA na nylonovou membránu = Southern blotting. 4. Inkubace membrány se značenou jednořetězcovou sondou hybridizace (navázání) sondy s komplementární sekvencí DNA na membráně. 5. Odmytí nenavázané sondy. 6. Detekce navázané sondy = vizualizace (autoradiografie nebo stanovení fluorescence). SEKVENOVÁNÍ DNA slouţí ke stanovení pořadí (sekvence) nukleotidů v molekule DNA (primární struktury). Sekvenování DNA je zaloţeno na přípravě, separaci a detekci fragmentů DNA, jejichţ velikost se liší o 1 nukleotid. Enzymová (Sangerova, po Fredericku Sangerovi) metoda vyuţívá modifikovanou PCR k syntéze kopií DNA, do nichţ jsou začleňovány kromě deoxyribonukleosidtrifosfátů (dntp) i dideoxynukleosidtrifosfáty (ddntp), které postrádají hydroxylovou skupinu na 3 - konci, na kterou by se mohl navázat další nukleotid v nově vznikajícím řetězci. Tyto ddntp tedy slouţí jako terminátory syntézy (viz obr. 62). Samotná syntéza DNA pomocí PCR se provádí odděleně ve čtyřech vzorcích, přičemţ kaţdý z nich obsahuje jiný dideoxynukleosidtrifosfát (A, T, G, nebo C). Polymerázová řetězová reakce využívaná při sekvenování DNA má další specifika. Amplifikace produktu probíhá pomocí tzv. asymetrické PCR, která na rozdíl od klasické PCR využívá pouze jednoho primeru. Amplifikace PCR produktu tedy probíhá pouze na jednom řetězci DNA, na který se tento primer specificky váže, a kopie molekul DNA nepřibývají exponenciální řadou. Reakční směs: templátová DNA 1 primer připojující se k místu na molekule DNA, od něhoţ chceme stanovovat sekvenci 4 typy normálních nukleotidŧ v nadbytku (datp, dctp, dgtp, dttp) jeden typ ddntp v malém mnoţství (v kaţdém ze 4 vzorků je jiný) DNA polymeráza 70

75 15 Metody molekulární biologie Ribóza Deoxyribóza Dideoxyribóza (ddr) HO OH HO H H H Obr. 62: Chemická struktura dideoxynukleosidtrifosfátu (ddntp) a princip terminace syntézy nově vznikajícího řetězce DNA po začlenění dideoxynukleosidtrifosfátu do nově vznikajícího řetězce DNA. Postup enzymového (Sangerova) sekvenování: 1. Příprava ssdna jejíţ sekvence má být stanovena. 2. Rozdělení do 4 vzorků, z nichţ kaţdý obsahuje jiný ddntp 3. Reakce s DNA polymerázou, při níţ se začlení do různých míst syntetizované DNA příslušný ddntp obsaţený ve směsi. V kaţdém ze 4 vzorků vzniknou fragmenty, které jsou zakončeny jedním typem ddntp (ddctp, ddgtp, ddatp, nebo ddttp). 4. Denaturace produktů 5. Elektroforetická separace umoţňující oddělení fragmentů lišících se délkou o jednu bázi 6. Detekce fragmentů Automatické sekvenování DNA je variantou enzymatického sekvenování DNA. Syntéza DNA probíhá v jedné PCR reakci (kaţdý ddntp je značen jinou fluorescenční značkou) a vzniklé produkty (různě dlouhé úseky jednořetězcové DNA) jsou tak označeny jinou fluorescenční značkou. K následnému stanovení sekvence DNA vzniklých PCR produktů se vyuţívá genetický analyzátor sekvenátor. Detekce těchto produktů probíhá během kapilární elektroforézy (=elektroforéza probíhá v tenké kapiláře naplněné gelem) pomocí laserového detektoru napojeného na počítač, který vyhodnocuje sekvenci. Vyuţití sekvenování DNA - sekvenování DNA má řadu aplikací ve vědě, medicíně a dalších oblastech. Sekvenují se celé genomy, případně jenom některé části, které mají pro daný obor význam. Ve fylogenetice představuje DNA sekvenování moţnost studovat fylogenezi organizmů, kde se zpravidla sekvenuje DNA, která kóduje ribozomální RNA. Antropologie vyuţívá srovnávání DNA ke zjišťování migrací lidských ras (zejména podle mitochondriální DNA a Y-chromozomální DNA). Má vyuţití rovněţ ve forenzních vědách a v kriminalistice k testování paternity nebo například umoţňuje stanovení viny či neviny v případě podezření z trestné činnosti. V zemědělství má moţnost vyuţití například při tvorbě geneticky modifikovaných plodin V lékařství slibuje sekvenování DNA například revoluci v diagnostice chorob a časnému zjištění náchylnosti jedince k určitým nemocem (rakovina, kardiovaskulární onemocnění) a v neposlední řadě také moţnost vyuţití v genové terapii. Sekvenování příští generace (NGS, next-generation sequencing) je dalším stupněm vývoje sekvenačních metod. Tyto nejnovější metody jsou zaloţeny na paralelizaci procesu sekvenování a produkci tisíců aţ milionů sekvencí současně a umoţňují tak velmi rychlé a relativně levné sekvenování ve velkých objemech. Díky rychle klesajícím cenám a zvyšující se dostupnosti se tyto metody rychle prosazují nejen při studiu celých genomů 71

76 15 Metody molekulární biologie (tzv. celogenomové sekvenování) či jejich částí, ale také v rutinní DNA diagnostice v humánní medicíně, v cytogenetice aj. GENOMIKA, BIOINFORMATIKA, BIOLOGICKÉ DATABÁZE A POČÍTAČOVÉ ZPRACOVÁNÍ BIOLOGICKÝCH DAT Výše zmíněnými metodami automatického sekvenování DNA a sekvenování příští generace je dnes moţno stanovit nukleotidové sekvence celých genomů. Komplexní analýzou genomů zaloţenou na znalosti pořadí nukleotidů v DNA se zabývá obor genomika. V současné době je známa kompletní sekvence desítek genomů, a to nejen bakteriálních, ale i genomů vyšších organismů, např. kvasinky Saccharomyces cerevisiae (12 Mbp), drozofily (137 Mbp) a od roku 2000 je známá i nukleotidová sekvence lidského genomu (3 Gbp). Genomové sekvence představují obrovský objem biologických dat, který nelze zpracovávat bez odpovídajícího počítačového vybavení. Pro účely přehledného uchovávání biologických dat, vyhledávání potřebných informací a jejich následné analýzy jsou vyuţívány přístupy bioinformatiky. Termín bioinformatika se objevil poprvé v roce 1991, představuje spojení dvou technologií (oblast molekulární biologie a biotechnologií a oblast informačních technologií), u nichţ došlo v posledních letech k explozivnímu růstu nových poznatků. Hlavní oblastí zájmu bioinformatiky je vyhledávání informací v databázích, srovnávání sekvencí nukleových kyselin a proteinů, vyhledávání genů, funkční genomika, klasifikace proteinů a proteomika, fylogenetické studie a srovnávací genomika. Shromaţďováním a správou dat, vývojem nástrojů pro jejich analýzu a poskytováním informací se ve světě zabývá několik institucí. Na internetových stránkách těchto institucí jsou veřejně přístupné biologické databáze, které obsahují rozsáhlé soubory dat (nukleotidových nebo aminokyselinových sekvencí), které jsou obvykle spojeny s počítačovým softwarem pro aktualizaci a vyhledávání dat. Nejdůleţitější databáze sekvencí nukleových kyselin a proteinů: Databáze EMBL byla zřízená v roce 1980 jako první databanka nukleotidových sekvencí Evropskou molekulárně biologickou laboratoří (EMBL - European Molecular Biology Laboratory) ve Velké Británii. Je veřejně přístupná na stránkách Evropského institutu pro bioinformatiku (EBI - European Bioinformatic Institute) Databáze DDBJ zahájila svojí činnost v roce 1984, shromaţďuje data především z japonských výzkumů. Databáze je spravována Centrem informační biologie (CIB - Center for Information Biology, zaloţen v roce 1995 jako oddělení Národního genetického institutu) v Japonsku a je veřejně přístupná na adrese GenBank byla zaloţena v roce Databázi nukleotidových sekvencí spravuje Národní centrum biotechnologických informací (NCBI - National Center for Biotechnology Information). Je přístupná na adrese Swiss-Prot a TrEMBL je databáze zřízená v roce 1986 Švýcarským institutem pro bioinformatiku (SIB - Swiss Institute of Bioinformatics). Databáze obsahuje aminokyselinové sekvence proteinů a je přístupná na adrese Mnoţství molekulárně-biologických dat se zvyšuje tak rychle, ţe je nezbytné mít k dispozici prostředky, pomocí kterých můţeme k těmto datům snadno přistupovat. Existují tři prostředky na získávání informací, které jsou vstupním bodem do několika (aţ 80) integrovaných databází: Entrez (vyvinut v NCBI, gov/entrez/), SRS (Sequence Retrieval System, vyvinut v EBI, 72

77 15 Metody molekulární biologie a DBGET/Link DB (Integrated Database Retrieval System, vyvinut v Institutu pro chemický výzkum v Japonsku, Nukleotidové sekvence můţeme pomocí počítačových analýz dále zpracovávat. Pomocí vhodného softwaru je moţné identifikovat geny, jejich strukturu (exony a introny), nebo regulační oblasti (např. promotory, terminátory transkripce atd.). Na základě nalezených genů můţeme, opět s pouţitím vhodného softwaru, stanovit aminokyselinovou sekvenci proteinů kódovaných těmito geny a stanovit jejich základní charakteristiky (např. sekundární strukturu). Software vhodný k podobným analýzám je volně přístupný na Internetu např. na adresách nebo Kromě výše zmíněné základní charakterizace lze také srovnávat nukleotidové sekvence různých buněk (organizmů, druhů atd.) mezi sebou, coţ je náplní komparativní (srovnávací) genomiky. Můţeme např. identifikovat rozdíly mezi genomy příbuzných druhů a určit tak jejich evoluční příbuznost (viz následující kapitola). ÚKOLY Cvičení z molekulární biologie jsou sestavena tak, aby se studenti prakticky seznámili se základními metodami, které se vyuţívají k analýze DNA. Studenti si sami vyzkouší izolaci DNA, amplifikaci DNA pomocí PCR, restrikční štěpení PCR produktu, elektroforézu, vizualizaci DNA a hodnocení výsledku. Tyto metody budou vyuţity při řešení jednoho komplexního úkolu. Bude se jednat o určení pohlaví ptačího jedince z biologického materiálu pomocí restrikční analýzy PCR produktu specifického genu. Kaţdý student bude pracovat samostatně. Materiál k vyšetření bude zajištěn, ale lze si zajistit svůj vlastní materiál. Instrukce k zajištění vlastního materiálu: K vyšetření lze pouţít jakékoliv ptačí buňky obsahující DNA. Lze odebrat krev od ptačího jedince zaţiva, krev nebo orgány během poráţky (kur, husa, kachna...), případně odebrat tkáň z drůbeţího masa koupeného v trţní síti. Ptačí krev: odběr do zkumavky s anti-koagulans EDTA (zkumavky budou k vyzvednutí u laborantky) poţadovaný objem je minimálně 200 μl po odběru je třeba vzorek uloţit do mrazáku při teplotě pod -15 C Ptačí tkáň (svalovina či vnitřní orgán): odběr do igelitového sáčku nebo mikrozkumavky o velikosti minimálně dvou špendlíkových hlaviček po odběru je třeba vzorek uloţit do mrazáku při teplotě pod -15 C Vzorek je třeba označit (jméno studenta, číslo skupiny) a předat laborantce k evidenci a uloţení do mrazáku ve cvičebně. Vzorky je potřeba přinést nejpozději do cvičení, kdy bude probíhat příprava tkáně k izolaci DNA. Úkol 1 a 2: Příprava tkáně k izolaci DNA a vlastní izolace DNA Izolace DNA se provádí pomocí izolační soupravy zaloţené na principu adsorpce DNA na silikát. Vyšetřovaný materiál (ptačí krev či tkáň) je nejdříve lyzován pomocí lyzačního pufru (obsahuje detergenty, které rozpouští membrány a denaturuje proteiny) a enzymu proteinázy K (štěpí proteiny včetně histonů vázajících se na DNA). Buněčný lyzát se přenese na izolační kolonku, jejíţ součásti je silikátový povrch (SiO 2 sklo). V přítomnosti chaotropních solí (součást lyzačního pufru) adheruje DNA na silikát. Kolonka s DNA vázanou na silikát je promyta promývacími roztoky a následně uvolněna pomocí elučního pufru. Vzhledem k tomu, ţe různé izolační soupravy od jednotlivých výrobců se poněkud liší, 73

78 15 Metody molekulární biologie pokud jde o jednotlivé komponenty (zejména pouţité roztoky a jejich pipetované objemy), není moţné uvést vţdy platný konkrétní sled kroků a je třeba se vţdy řídit předepsaným postupem od příslušného výrobce, který vám bude k dispozici na cvičení. Zásady práce: Kaţdý student zpracovává vlastní vzorek a pracuje v pracovní skupině, která má k dispozici sadu automatických pipet. U pipet lze nastavit poţadovaný objem - pozor na přetočení pipety mimo dané rozmezí. K zabránění kontaminace vzorku a chemikálií se pro jednotlivé kroky pouţívá vţdy nová špička. K zabránění kontaminace pipet se pro práci s DNA pouţívá špička s filtrem. K zajištění přesného objemu je třeba důkladně nasadit špičku na pipetu. Poţadovaný objem se získá stlačením pipety do první polohy a ponořením špičky pipety do nasávané tekutiny, povolením stlačení, přenesením poţadovaného objemu a stlačením pipety do druhé polohy. Homogenizace vzorku se provádí ve zkumavce tzv. propipetováním tj. po přidání určité chemikálie do zkumavky třikrát opakovaně nasát směs do špičky a vytlačit. Mikrozkumavky je třeba označit číslem skupiny a pořadovým číslem studenta ve skupině. Úkol 3: PCR Příprava PCR: 1. Kaţdá pracovní skupina si do mikrozkumavky (1,5 ml) připraví společnou PCR směs dle počtu vzorků (n) s rezervou (n+1): Směs pro jeden vzorek: 10 μl - PCR master mix (směs nukleotidů dntp, DNA polymerázy a Mg 2+ iontů) 0,2 μl - primer PP (pořadí nukleotidů: TCTGGATCGCTAAATCCTTT) 0,2 μl - primer P8 (CTCCCAAGGATGAGRAAYTG) (R a Y - degenerované nukleotidy) 7,6 μl - voda pro PCR 2. Napipetujte (novou špičkou) 18 μl PCR směsi do PCR mikrozkumavky (0,2 ml) označené fixem. 3. Napipetujte (špičkou s filtrem) 2 μl izolované DNA. 4. Uzavřete důkladně PCR mikrozkumavku, vloţte ji do termocykleru a spusťte program. 5. Po dokončení programu bude PCR produkt uchován v lednici. Program PCR amplifikace (trvá asi 1 hod 55 min): Počáteční denaturace DNA 94 C 1 min 30 s Nasedání primerů (annealing) 49 C 45 s Syntéza komplementárního řetězce DNA (extenze) 72 C 1 min 30 cyklů Denaturace DNA 94 C 1 min Dosyntetizování řetězců DNA (finální extenze) 72 C 10 min Úkol 4: Restrikční reakce s PCR produktem, elektroforéza, vizualizace a hodnocení K určení pohlaví u ptáků se vyuţívá gen CHD (Chromo-Helicase-DNA binding gene), který kóduje protein, jeţ reguluje aktivaci transkripce na úrovni chromatinu. Tento gen je u ptáků lokalizován na pohlavních chromozomech. 74

79 15 Metody molekulární biologie Samčí pohlaví je u ptáků homogametické s pohlavními chromozomy ZZ. Samičí pohlaví je heterogametické s pohlavními chromozomy ZW. Pomocí PCR je namnoţena DNA odpovídající části genu na chromozomu W (CHD-W) a na chromozomu Z (CHD-Z). PCR produkt je štěpen pomocí restrikční endonukleázy (restriktázy) Hae III (izolované z bakterie Haemophilus aegyptius) v restrikčním místě: 5 -GG CC-3 3 -CC GG-5 PCR produkt genu CHD-Z toto místo obsahuje, proto dojde působením enzymu k odštěpení fragmentu DNA, zatímco PCR produkt genu CHD-W se enzymem neštěpí. Fragmenty jsou separovány pomocí gelové elektroforézy, vizualizovány pod UV zářením a vyhodnoceny. Restrikční reakce: 1. Napipetujte 1,2 μl směsi restriktázy Hae III a aktivačního pufru do nové označené PCR zkumavky (0,5 ml). 2. Napipetujte (novou špičkou s filtrem) 10 μl PCR produktu. 3. Vloţte do termocykleru při teplotě 37 C na 45 min. Příprava 1,2 % agarózového gelu: Připraví se jeden gel pro všechny studenty ve cvičebně. 1. Do baňky typu Erlen dejte 1,2 g agarózy. 2. Skleněným válcem odměřte 100 ml TBE pufru, přidejte do baňky a krouţením promíchejte. 3. Dejte baňku do mikrovlnné trouby a vařte při teplotě nastavené na maximální ohřev po dobu 2 minut (jakmile začne obsah kádinky bublat, přerušte ohřev a promíchejte obsah kádinky v ruce s nasazenou rukavicí). 4. Po 2 minutách ohřevu vyjměte baňku z mikrovlnné trouby a opatrně ji ochlaďte pod tekoucí vodou na teplotu přibliţně 60 C (teplota, kdy několik sekund udrţíme kádinku přiloţenou ke hřbetu ruky). 5. Do rozehřátého roztoku agarózy napipetujte (novou špičkou) 3 μl Midori Green (10 tis. krát koncentrovaný roztok) a v ruce promíchejte. 6. Připravte si nalévací vanu a přelijte do ní rozehřátý roztok agarózy z baňky do výšky minimálně 8 mm. 7. Do vany vloţte hřebínek a pipetovací špičkou odstraňte případné bubliny v gelu. 8. Gel ztuhne asi po 30 minutách. Horizontální agarová gelová elektroforéza a vizualizace DNA 1. Po ztuhnutí gelu vyjměte hřebínek, otočte gel v elektroforetické vaně a zalijte TBE pufrem, tak aby byl celý gel ponořený. 2. Do jedné z jamek v gelu (nejlépe do prostřední) naneste 3 μl velikostního markeru. 3. Do sousední jamky naneste 10 μl směsného vzorku PCR produktu (směsný vzorek PCR produktu připravíte smícháním všech vzorků ve cvičebně). 4. Do dalších jamek nanáší (novou špičkou) kaţdý student svůj vzorek, tj. 10 μl PCR produktu po restrikční analýze. S pipetou je třeba manipulovat opatrně, ať neprotrhnete gel. 5. Zapojte elektroforetickou vanu do zdroje a pusťte elektrický proud při konstantním napětí 160 V po dobu minut. 6. Po ukončení elektroforézy přemístěte gel na UV-transiluminátor a pod UV zářením odečtěte výsledek. V rámci bezpečnosti je třeba pozorovat gel přes plastový kryt. 75

80 15 Metody molekulární biologie U samičího pohlaví: (ZW) se na gelu objeví 2 pruhy (bandy). Jeden větší, který odpovídá neštěpenému CHD-W (o stejné velikosti jako neštěpený PCR produkt) a druhý menší asi o 50 bp (párů bází). U samčího pohlaví: dojde ke štěpení CHD-Z a na gelu se objeví jeden pruh o menší velikosti. 100 bp 200 bp 300 bp 400 bp 500 bp Obr. 63: Výsledek gelové elektroforézy: 1 velikostní standard, 2 neštěpený PCR produkt, 3 samec, 4 samice. Úkol 5: Sekvenátor a sekvenování DNA Neţ proběhne restrikční reakce nebo gelová elektroforéza navštivte Laboratoř sekvenční analýzy na Ústavu biologie a chorob volně ţijících zvířat, kde se seznámíte s osmikapilárovým automatickým sekvenátorem (Beckman Coulter CEQ 8000), který slouţí ke stanovení sekvence DNA na principu separace fragmentů DNA syntetizovaných terminační enzymovou Sangerovou metodou. Kontrolní otázky metody molekulární biologie Jaké znáš metody molekulární biologie? Jaký je princip izolace DNA? O co se zaslouţili Kary Mullis a Frederick Sanger? Co je to PCR a jaký je její princip? Jaké jsou fáze PCR? Co vše je třeba pro PCR a v jakém přístroji probíhá? K čemu se PCR vyuţívá? Co je to gelová elektroforéza a jaký je její princip? Co je to RFLP a jaký je její princip? K čemu se RFLP vyuţívá? Jak funguje hybridizace a k čemu ji lze vyuţít? Co je to sekvenování a jaký je jeho princip? Co vše je třeba pro sekvenování a v jakém přístroji probíhá? K čemu se sekvenování vyuţívá? Jak se dá určit pohlaví ptáků pomocí metod molekulární biologie? Jak se dá určit otcovství pomocí metod molekulární biologie? 76

81 16 Buněčné a tkáňové kultury 16. Buněčné a tkáňové kultury Buňky, tkáně a dokonce i celé orgány (nebo části orgánů) mohou být udrţovány (pěstovány) naţivu mimo tělo v pufrovaném roztoku s ţivinami, tzn. za podmínek, jeţ věrně napodobují jejich fyziologickou situaci. V medicíně, biologii a příbuzných oborech se v souvislosti s pěstováním organizmů v umělých podmínkách ve zkumavkách či jiném laboratorním skle pouţívá termín in vitro (z latiny ve skle ). Naproti tomu termín in vivo (z latiny v ţivém ) znamená výskyt organizmů (popř. jejich orgánů nebo jejich jednodušších sloţek a látek) v přirozených podmínkách (u sloţek či orgánů to znamená na/v ţivém organizmu). Prvotní tkáně pouţívané pro zaloţení kultur v laboratořích jsou často získávány ze zvířat, ale mohou být pouţity i lidské tkáně (např. krevní buňky, buňky z pupeční šňůry, placenty a chrupavek). Vyuţití: Metody buněčných a tkáňových kultur mají v dnešní době význam např. při vývoji a ověřování nových léků, při výrobě vakcín, v testech toxicity, v diagnostice, jsou pouţívány ke kultivaci a dlouhodobým pasáţím nitrobuněčných parazitů nebo virů nebo při genových manipulacích. Vyuţití buněčných a tkáňových kultur tak velkou měrou přispívá i k omezování pokusů na zvířatech. HISTORIE Roux E. (1885) jako první kultivoval embryonální kuřecí buňky v solném roztoku mimo tělo. Problémem byla dlouhodobá kultivace, aniţ by došlo k bakteriální kontaminaci. Tento problém později vyřešila antibiotika. Rous P. a Jones F.S. (1916) pouţívali proteolytický enzym trypsin k natrávení kousku tkáně. Takto dispergované buňky bylo moţno opakovaně pasáţovat - počátek studií moderních tkáňových kultur. Eagle H. (1955) definoval sloţení média potřebné ke kultivaci buněk (tzv. Eaglovo médium). Do té doby se pouţívala nepřesně definovaná média sloţená např. z krevní plazmy a extraktů hovězích embryí. Hayflick L. a Moorhead P. (1961) prokázali, ţe lidské fibroblasty ve tkáňové kultuře po určitém počtu generací podléhají krizi a umírají (viz fázová křivka růstu buněk v tkáňových kulturách). Wigler M. a Axel R. (1977) vyvinuli metodu pro vnášení savčích genů do buněk v kultuře. TKÁŇOVÉ KULTURY jsou tvořeny buňkami, které nejsou od sebe odděleny, a proto mohou na sebe navzájem působit, tak jako v organizmu. Tkáňové kultury tak nacházejí vyuţití např. při kontrole účinků teratogenů a při testování koţní dráţdivosti. BUNĚČNÉ KULTURY jsou tvořeny izolovanými buňkami, které jsou pěstovány v kultivačních nádobách, kde rostou v jedné vrstvě (tzv. monolayer). Modifikace metod tkáňových kultur umoţňují pěstovat v kultuře celou řadu specializovaných buněk, nejpouţívanější jsou fibroblasty a epiteliální buňky. Buňky získané přímo z organizmu, jeţ jsou pěstovány v kultuře, jsou známy pod názvem primární buněčné kultury. Příleţitostně se mohou tyto buňky spontánně přetransformovat do souvislých buněčných linií, jeţ jsou schopny přeţít v podmínkách in vitro po mnoho let. Např. název buněčné linie HeLa je odvozen ze jména 31 leté Američanky Henrietty Lacksové, které byly odebrány buňky z nádoru děloţního čípku v roce Ačkoliv buňky buněčné linie jsou si velmi podobné, často nejsou identické. Genetickou uniformitu buněčné linie lze zajistit klonováním buněk, kdy se z jedné izolované buňky vytvoří kolonie identických buněk, tzv. klony. 77

82 16 Buněčné a tkáňové kultury Příklady buněčných kultur: Buněčná linie Typ buněk Pŧvod Zpŧsob kultivace Kc167 embryonální buňky octomilka adherentní MDBK epiteliální buňky tur domácí adherentní MDCK epiteliální buňky pes adherentní Vero epiteliální buňky kočkodan adherentní HeLa epiteliální buňky člověk suspenzní BHK21 fibroblasty křeček zlatý suspenzní SP2 plazmatické buňky myš suspenzní KULTIVAČNÍ NÁDOBY - buňky se kultivují ve skleněných či plastových lahvích označovaných jako Roux (čti "ru") láhve v termostatu při optimální teplotě (37 C). KULTIVAČNÍ MÉDIUM poskytuje buňkám optimální prostředí a slouţí jako zdroj ţivin pro jejich růst. Přidává se do kultivačních nádob a pravidelně se musí vyměňovat za nové. Média (MEM = minimální esenciální médium) obsahují definované mnoţství solí, glukózy, aminokyselin, vitaminŧ, inzulínu, transferinu, specifických rŧstových faktorŧ a bovinního fetálního séra. K prevenci bakteriální kontaminace se do média přidávají antibiotika (penicilin, streptomycin). Většina buněčných linií roste dobře při ph 7,4, při poklesu ph na 6,5 přestanou růst a při ph pod 6,5 ztrácí ţivotaschopnost. Jako indikátor ph v médiu se pouţívá fenolová červeň. Při ph 7,4 je zbarvení média červené, při poklesu ph (spotřebování ţivin, nahromadění metabolitů) se barva mění do ţluta a to je signál pro výměnu média za čerstvé. KULTIVACE BUNĚK A PASÁŢOVÁNÍ - při práci s buněčnými kulturami (výměna média, pasáţování buněk atd.) je potřebné dodrţovat pravidla sterilní manipulace (pouţívání boxů a germicidních lamp). Růst buněk v kultivační nádobě je moţné průběţně pozorovat prostřednictvím speciálního inverzního mikroskopu. Buňky rostou v určitých fázích, které znázorňuje tzv. fázová křivka rŧstu. Většina buněk roste v kultivačních nádobách aţ do doby, kdy dosáhne vysokého procenta konfluence, tj. stavu, kdy buňky zaplní povrch dna nádoby a dostanou se do vzájemného Obr. 64: Inverzní mikroskop. kontaktu, čímţ dochází k tzv. kontaktní inhibici. V té době je potřebné přenést (pasáţovat) buňky do nové kultivační nádoby. Necháme-li buněčnou kulturu růst do vysoké hustoty, selektují se buňky, které ztrácejí normální kontrolu růstu a nepodléhají kontaktní inhibici. Takovéto buněčné linie nazýváme liniemi transformovanými. Podle způsobu růstu v kultuře a odlišnému způsobu pasáţování lze buňky dělit na adherentní a suspenzní: Adherentní buňky adherují (přichycují se) na dno kultivační lahve v důsledku sekrece proteinů extracelulární matrix, jako např. lamininu, fibronektinu, kolagenu. Při výměně média se slije staré médium a nahradí se čerstvým, při pasáţování se k uvolnění buněk ze dna lahve pouţívá proteolytický enzym trypsin nebo jiná proteáza. Suspenzní buňky jsou volně dispergované v médiu. Při výměně média nebo pasáţování je potřebné oddělit médium od buněk odstředěním. 78

83 počet buněk 16 Buněčné a tkáňové kultury III IV II A Obr. 65: A plastové láhve pro kultivaci buněk, B fázová křivka růstu buněk. ÚKOLY Úkol 1: Pozorování buněk v buněčné kultuře TP: ledvinné buňky králíka z buněčné kultury Pozorujte a zakreslete si ledvinné buňky králíka z buněčné kultury. B I I I lag fáze II fáze logaritmického růstu III stacionární fáze IV fáze úbytku čas kubická buňka v anafázi klidová vřetenovitá buňka kubická buňka v profázi vřetenovitá buňka v metafázi Obr. 66: Buňky rozdílné morfologie z buněčné kultury v klidové fázi a v mitóze. Úkol 2: Práce s inverzním mikroskopem a buněčnou kulturou NP: adherentní buňky z buněčné kultury V inverzním mikroskopu si prohlédněte kultivační láhev s buněčnou kulturou (všímejte si tvaru buněk pokrývajících celé dno láhve). Slijte médium z láhve, propláchněte roztokem PBS (phosphate buffered saline, fosfátem pufrovaný fyziologický roztok) a do láhve přidejte 2 ml trypsinu. Účinkem trypsinu dojde k uvolnění buněk ze dna láhve, coţ se projeví zakalením obsahu láhve (uvolňování buněk lze urychlit umístěním láhví do termostatu na 37 o C nebo mechanicky klepáním láhve o dlaň ruky). Pod inverzním mikroskopem pozorujte uvolněné buňky, které jsou zakulacené a volně plavou. Do kultivační láhve přidejte médium obsahující sérum, které inhibuje účinek trypsinu, tak aby se zabránilo natrávení buněk. Poté slijte obsah láhve do kádinky, připravte si nativní preparát a pozorujte pod svým mikroskopem. Zakreslete si tvar buněk a porovnejte s tvarem, který měly buňky přisedlé. Kontrolní otázky buněčné a tkáňové kultury V čem a za jakých podmínek se kultivují buňky in vitro? Jaký je rozdíl mezi pěstováním adherentních a suspenzních buněk? Jak se provádí pasáţování buněk? Jaký průběh má růstová křivka buněk kultivovaných in vitro? Jaký mikroskop se pouţívá k prohlíţení buněčných kultur? 79

84 17 Nebuněčné formy ţivota, elektronové mikroskopy 17. Nebuněčné formy ţivota, elektronové mikroskopy Nebuněčné formy ţivota Mezi nebuněčné formy ţivota patří viry (nukleové kyselina a proteiny), viroidy, virusoidy (nukleové kyseliny) a priony (proteiny). VIRY jsou submikroskopické částice, jejichţ velikost se pohybuje v desítkách aţ stovkách nanometrů. Genom u nejmenších virů je tvořen nukleotidy (RNA-bakteriofág R17) a 3 strukturními geny kódující protein kapsidy, protein pro absorpci viru na hostitelskou buňku a specifickou RNA-polymerázu. Největším nově objeveným virem je Mimivirus z čeledi Mimiviridae (virus napodobuje bakterie), který byl zjištěn uvnitř buněk měňavky, měří 400 nm, jeho genetický kód se skládá z nukleotidů a obsahuje aţ 900 genů. Virion je jednotlivá částice (partikule), schopná infikovat hostitelskou buňku a mnoţit se v ní. Je sloţen z nukleokapsidu, tj. nukleové kyseliny (NK), a to buď deoxyribonukleové (DNA), nebo ribonukleové (RNA) a z kapsidy, coţ je proteinový obal sloţený z proteinových molekul (kapsomer). Obalené viry při zrání (maturaci) získávají membránový obal, který je odvozen z plazmatické nebo jaderné membrány (nebo z obou) hostitelské buňky, která je virem modifikována. Na povrchu obalu mohou být z glykoproteinů vytvořeny ostré výčnělky, tzv. hroty (peplomery), které udílí viru antigenní vlastnosti a jsou pro určité viry specifické. Bakteriofág (zkráceně fág, poţírač bakterií ) je virus infikující bakterie. Proteinová kapsida je sloţená z hlavičky obsahující nukleovou kyselinu (DNA, RNA) a z bičíku, ze kterého vyrůstají bičíková vlákna, která slouţí k přichycení. Tyto viry mohou lyzovat napadené bakterie a lze je tak vyuţít k antibakteriální léčbě. Po infekci bakterie můţe bakteriofág přejít do latentního (lyzogenního) stavu, kdy se začlení do genetické informace buňky ve formě tzv. profága. Teprve při stresu bakteriální buňky se virus aktivuje, začne se replikovat a buňku zlyzuje. Byly popsány i případy, kdy se kmeny bakterií se začleněnou virovou DNA stanou vysoce patogenními původci onemocnění. Pro taxonomii a systematiku virů jsou důleţité tyto znaky: 1) rozměry a morfologie virionu 2) přítomnost (nepřítomnost) povrchového obalu: obalené a neobalené viry 3) typ a molekulární stavba genomové NK: typ NK: RNA-viry, DNA-viry počet a tvar řetězců NK: ssrna - jednořetězcová (z angl. single stranded), dsrna - dvouřetězcová (z angl. double stranded), ssdna, dsdna, lineární (většinou) nebo kruţnicová NK polarita řetězce NK: (+)RNA (plus RNA, pozitivní RNA, stejná polarita jako mrna), (-)RNA (minus RNA, negativní RNA), (+)DNA, (-)DNA. 4) znaky proteinŧ kapsidu: symetrie helikální (šroubovicová), ikozahedrální (dvacetistěnová), komplexní, binární (u bakteriofágů; hlavička obsahující NK má 80

85 17 Nebuněčné formy ţivota, elektronové mikroskopy ikozahedrální symetrií, dutý bičík slouţící ke vstřikování NK do hostitelské buňky má symetrii helikální) 5) okruh hostitelŧ a afinita k jejich tkáním: okruh hostitelů: ţivočišné viry - viry obratlovců (včetně člověka) a viry bezobratlých (nejčastěji hmyzu), rostlinné viry, viry hub, řas a prvoků, viry bakterií (bakteriofágy, fágy) a viry fototrofních bakterií (cyanofágy) afinita k tkáním: viry respirační, enterální, sexuálně přenosné, hepatické Viry jsou zařazeny do řádů s koncovkou virales, čeledí s koncovkou viridae, podčeledí s koncovkou virinae a dále rozlišujeme rody, druhy a varianty. Některá virová onemocnění: Rostliny: mozaiková choroba tabáku, brambor, rajčat. Zvířata: slintavka a kulhavka sudokopytníků, vzteklina, myxomatóza králíků, mor drůbeţe. Člověk: dětská obrna, lidská hepatitida A (Picornaviridae), neštovice (Poxviridae), opary, infekční mononukleóza (Herpesviridae), spalničky, příušnice (Paramyxoviridae), chřipka (Orthomyxoviridae), klíšťová encefalitida, lidská hepatitida C, ţlutá zimnice (Flaviviridae, lat. flavus = ţlutý), zarděnky (Togaviridae), AIDS (Retroviridae). Reprodukce virů v hostitelských buňkách: LYTICKÝ CYKLUS probíhá v 7 krocích: 1. vazba virionu na povrch buňky: pomocí specifického receptoru 2. proniknutí (penetrace) do buňky: celý virion proniká do buňky pinocytózou (ţivočišné a rostlinné viry), nebo je do buňky vstříknuta pouze NK (u bakteriofágů), u obalených virů splývá jejich vnější obal s plazmatickou membránou buňky a do cytoplazmy se dostává nukleokapsid 3. uvolnění NK z kapsidy: enzymatickým rozloţením 4. replikace virové NK a genová exprese: liší se v závislosti na typu NK: ds(+/-)dna (u bakteriofágů a ţivočišných virů) - DNA se replikuje a přepisuje do virové mrna, podle které jsou syntetizovány proteiny ss(+)dna - nejdříve se nasyntetizuje komplementární řetězec DNA, další průběh jako u dsdna ds(+/-)rna - k syntéze proteinů slouţí jen jedno ze dvou vláken ss(+)rna (u bakteriofágů, ţivočišných a rostlinných virů) - můţe přímo slouţit jako mrna pro syntézu proteinů, jinak dochází k nasyntetizování komplementární (-)RNA, která je matricí pro replikaci (+)RNA, která slouţí jako mrna pro syntézu proteinů nových virionů ss(+)rna se zpětnou transkripci (u ţivočišných virů - retrovirů), (+)RNA se přepisuje v komplementární ss(-)dna, podle níţ je dosyntetizována komplementární (+)DNA za vzniku ds(+/-)dna. Oba procesy katalyzuje virová polymeráza reverzní transkriptáza. Dvouřetězcová DNA se začlení do genomu buňky jako provirus, odkud je přepisována do (+)RNA, která slouţí k syntéze proteinů nových virionů. ss(-)rna (u bakteriofágů) - nejdříve probíhá syntéza komplementární (+)RNA s následnou tvorbou proteinů, podle (+)RNA se nasyntetizuje (-)RNA, která je součástí nových virionů. 5. syntéza virových proteinŧ: probíhá v cytoplazmě (na ribozomech) hostitelské buňky 6. zrání (maturace) virionŧ: spojování NK s kapsidem 7. uvolnění virionŧ z buňky: exocytózou nebo rozpadem (lýzou) buňky 81

86 17 Nebuněčné formy ţivota, elektronové mikroskopy dsdna replikace transkripce dsdna mrna translace protein virion ssdna ss(+)rna translace ss(-)rna protein ss(+)rna virion ss(-)rna ss(+)rna zpětná (reverzní) transkripce ss(-)dna dsdna transkripce mrna translace ss(+)rna protein ssdna dsdna transkripce virion mrna translace protein ss(-)rna ss(+)rna translace virion protein virion Obr. 67: Schéma rozdílů genové exprese u různých virů v závislosti na typu jejich nukleové kyseliny. VIROGENNÍ CYKLUS u ţivočišných virů (zejména virů čeledi Retroviridae např. virus HIV) spočívá v začlenění virové NK (DNA) do genomu hostitelské buňky jako tzv. provirus. Provirus můţe být přenášen z rodičů na potomky, aniţ by se infekce projevila. Spontánně nebo účinkem indukčních činitelů (UV paprsky, peroxidy atd.) se provirus vyčlení z chromozomu, a tím je spuštěn lytický cyklus. Virogenní cyklus onkogenních virŧ můţe vést i k nádorové transformaci hostitelské buňky. LYZOGENNÍ CYKLUS (např. u bakteriofágů) je obdobou virogenního cyklu. Do genomu bakterií je začleňována virová NK jako tzv. profág. bakteriofág bakterie Lytický cyklus Lyzogenní cyklus profág Obr. 68: Lytický a lyzogenní cyklus u bakteriofágů. 82

87 17 Nebuněčné formy ţivota, elektronové mikroskopy VIROIDY jsou malé infekční cirkulární molekuly RNA bez proteinového obalu. Předpokládá se, ţe vznikají cirkularizací intronů genů svých eukaryotických hostitelů uvolněných posttranskripčním sestřihem. Nekódují ţádný protein, replikují se v jádře buňky pomocí jaderných RNA polymeráz. Vyvolávají onemocnění kulturních rostlin (např. vřetenovitost brambor, onemocnění kokosových palem), která jsou obvykle vázána na určitou lokalitu (první viroidová onemocnění byla objevena aţ ve 20. století). SATELITY (VIRUSOIDY) jsou samostatné krátké molekuly nukleových kyselin (DNA či RNA), které vyvolávají onemocnění u rostlin. Byly objeveny teprve roku Nemohou se replikovat nezávisle, ale vyţadují pomocný virus, v jehoţ kapsomeře jsou uzavřeny (jsou tedy jakýmisi parazity jiných virů ). Nekódují ţádný protein, replikují se v cytoplazmě. PRIONY jsou infekční proteiny (bez NK) kódované strukturními geny hostitelského organizmu. Vznikají konformační změnou prionového proteinu PrP C s prostorovou strukturou α-helix (šroubovice) na PrP Sc s β-strukturou (sloţeného listu). Priony jsou původci přenosných spongiformních (houbovitý vzhled degenerované tkáně centrální nervové soustavy) encefalopatií. U lidí je to např. Creutzfeldtova-Jakobova choroba a kuru, u zvířat klusavka ovcí a koz (scrapie), bovinní spongiformní encefalopatie (BSE, "nemoc šílených krav") a felinní spongiformní encefalopatie (FSE) Elektronové mikroskopy Některé objekty jako např. viry jsou tak malé, ţe je nelze pozorovat ani nejvýkonnějším optickým mikroskopem s nejlepšími skleněnými čočkami, coţ zjistil jiţ v 19. století německý fyzik Ernst Abbe. Rozlišovací schopnost optického mikroskopu je totiţ omezena vlnovou délkou viditelného světla ( nm). A protoţe vlnovou délku pro nás viditelného světla neumíme zkrátit, bylo třeba pro posunutí hranice rozlišovací schopnosti mikroskopu najít jiné "světlo" s výrazně kratší vlnovou délkou. A tady začíná příběh elektronového mikroskopu, který byl zkonstruován ve 20. století a umoţnil odhalit do té doby skrytá tajemství hmoty. Cesta k jeho sestrojení byla podmíněna technologickým pokrokem a sestávala z postupného propojování objevů mnoha badatelů. Důleţitý byl objev elektronu anglickým fyzikem J. J. Thompsonem v roce Dalším krokem vedoucím k pouţití elektronů k zobrazení mikrosvěta byl poznatek, který v roce 1925 publikoval Louis de Broglie, ţe rychle letící elektrony se chovají nejen jako částice, ale mají i vlnový charakter podobně jako viditelné světlo. Protoţe elektron jako záporně nabitá částice ochotně přispěchá k čemukoliv kladně nabitému, je moţné mu tímto způsobem udělit určitou rychlost, které odpovídá konkrétní vlnová délka. Navíc je moţné dráhu letícího elektronu ovlivnit silným magnetickým polem podobným způsobem, jako je tomu při průchodu světla optickými čočkami. Tím byla nalezena cesta k novému "světlu" vhodnému pro zkoumání mikrosvěta. Postupně byly sestrojeny dva typy elektronových mikroskopů (transmisní a rastrovací), které vyuţívají urychlené elektrony, a které posunuly hranici rozlišovací schopnosti do rozměru desetin nanometru, tj. na úroveň velikosti atomů. První transmisní elektronový mikroskop sestrojili v roce 1931 němečtí vědci Max Knoll a Ernst Ruska. Teprve v roce 1986 dostal Ernst Ruska za konstrukci transmisního elektronového mikroskopu Nobelovu cenu. Rastrovací elektronový mikroskop se na trhu objevil aţ v roce O rozvoj elektronové mikroskopie se zaslouţil i český vědec Armin Delong (brněnský profesor, rodák z Bartovic u Ostravy), který uvedl první elektronový mikroskop do výroby uţ v roce V roce 2005 mu byla udělena Národní cena vlády České republiky Česká hlava. 83

88 17 Nebuněčné formy ţivota, elektronové mikroskopy Elektronové mikroskopy mohou dosahovat aţ násobného zvětšení a jejich rozlišovací schopnost se pohybuje na hranici 2 20 nm, čímţ umoţňují pozorovat např. viry, které mají průměrnou velikost kolem 50 nm (do tečky za touto větou by se vešly stovky tisíc virů). V elektronovém mikroskopu se místo světelných paprsků pohybují elektrony (od toho název elektronový mikroskop), jejichţ průchod mikroskopem je ovlivňován ne skleněnými, ale ektromagnetickými čočkami. TRANSMISNÍ (PROZAŘOVACÍ) ELEKTRONOVÝ MIKROSKOP (TEM) je zařízení, které se vejde do menší místnosti. Jeho nejnápadnější částí je tubus (asi metr dlouhá svislá dutá trubice), kterým procházejí elektrony. Ty jsou v horní části tubusu uvolňovány elektronovým dělem (nejčastěji rozţhavené wolframové vlákno - katoda), jehoţ pracovní teplota je okolo 2500 C. Aby vlákno neshořelo, musí být prostor elektronového děla zbaven vzduchu. Stejně tak musí být vzduch vyčerpán i z ostatních prostorů, kterými elektrony na své pouti tubusem procházejí. Uvolněné elektrony jsou urychleny působením kladně nabité anody a získají rychlost (aţ polovinu rychlosti světla), která je nezbytná k prolétnutí celým tubusem. Zhruba v jeho polovině jim stojí v cestě vzorek, jímţ musí proniknout. Elektrony, které jsou vzorkem zachyceny, nedopadnou a nerozzáří stínítko na dně tubusu, čímţ vzniknou stíny vytvářející mnohonásobně zvětšený obraz vzorku. Průchod elektronového paprsku tubusem je ovlivňován elektromagnetickými čočkami. V horní části tubusu se nachází kondenzorové čočky, řídící sílu a průměr elektronového svazku. Pod vzorkem je umístěn objektiv (nejvýkonnější čočka), který zaostřuje svazek elektronů na vzorek a zvětšuje obraz asi 50. O zvětšování obrazu na poţadovanou hodnotu se postarají další čočky (projektor resp. projektiv) umístěné pod objektivem. Ke zviditelnění obrazu neseného elektrony slouţí stínítko na dně tubusu. Je tvořeno fluorescenční látkou, která se po dopadu elektronů rozzáří v závislosti na mnoţství a energii dopadajících elektronů. Obraz, který na něm elektrony vytvoří, je moţné pozorovat mikroskopem, zaznamenat na fotografický materiál uloţený pod stínítkem nebo pomocí speciální CCD kamery (Charge Coupled Device nábojově vázaný prvek) jej přenést do počítače v digitalizované podobě. oko elektronové dělo okulár kondenzor vzorek objektiv objektiv vzorek projektor (projektiv) kondenzor zdroj světla Obr. 69: Směr pohybu světelných paprsků ve světelném mikroskopu. stínítko Obr. 70: Směr pohybu elektronů v elektronovém mikroskopu (TEM). 84

89 17 Nebuněčné formy ţivota, elektronové mikroskopy Velké poţadavky jsou kladeny na vzorek, který nesmí obsahovat vodu, protoţe by se v prostoru zbaveném vzduchu vypařovala. Tloušťka vzorku by se měla pohybovat do 100 nanometrů, tak aby jím mohly elektrony procházet. Vzorek o velikosti 1 1 mm se zaleje do speciální pryskyřice a po vytvrzení se ze vzniklého bločku na ultramikrotonu odkrajují ultratenké řezy, které se pak pokrývají tenkou vrstvou těţkého kovu nebo jeho oxidu. Obraz pořízený v elektronovém mikroskopu je černobílý, ale pomocí počítačového programu je moţné získat i barevný obraz dle vlastního výběru. RASTROVACÍ (SKENOVACÍ) ELEKTRONOVÝ MIKROSKOP (SEM) získal své jméno na základě skutečnosti, ţe elektronový svazek jako velmi jemný hrot přejíţdí po povrchu vzorku a skenuje ho. Svazek se pohybuje v řádcích podobně jako při zapisování signálu na televizní obrazovce. Při dopadu elektronů jsou z povrchu vzorku vyraţeny sekundární elektrony, které jsou zachyceny detektorem. Povrch vzorku je nutné upravit podobně jako u transmisního mikroskopu. Tento typ mikroskopu je oblíbeným nástrojem pro pozorování mikrosvěta díky schopnosti poskytnout velmi plastický obraz s vysokou hloubkou ostrosti (trojrozměrný obraz) i z tak členitých objektů, jakými je např. hmyz. elektronové dělo rastrovací generátor kondenzor deflektor svazku objektiv obrazovka detektor elektrony ze vzorku vzorek Obr. 71: Směr pohybu elektronů v elektronovém mikroskopu (SEM). Mezi světelnými a elektronovými mikroskopy jsou určité analogie a určité rozdíly: Světelné mikroskopy vyuţívají jako zdroj zobrazení světlo, světelný paprsek se pohybuje optickou soustavou mikroskopu, kterou tvoří skleněné čočky, rozlišovací schopnost je 0,2 μm, zvětšení max. 1000, výhodou je, ţe lze pozorovat i nativní preparáty bez sloţité úpravy nebo fixace, pozorovaný obraz můţe být barevný. Elektronové mikroskopy vyuţívají jako zdroj zobrazení elektrony, jejichţ proud je usměrňován elektromagnety, rozlišovací schopnost je 2 20 nm, zvětšení max , nevýhodou je vysoká cena elektronových mikroskopů, sloţitá úprava vzorků, nutnost fixace a nemoţnost pozorovat ţivé objekty, obraz pořízený z mikroskopu je černobílý, výhodou je moţnost pořízení trojrozměrného obrazu (pomoci SEM). 85

90 17 Nebuněčné formy ţivota, elektronové mikroskopy ÚKOLY Úkol 1: Viry Nakreslete si do sešitu alespoň 3 zástupce různých druhů virů. Můţete si vybrat virus známého onemocnění nebo virus, kde je patrný vztah mezi vzhledem a názvem - např. filovirus (filum = vlákno), kalicivirus (calyx = kalich), coronavirus (corona = koruna, věnec), parvovirus (parvus = malý), toga (toga = plášť, obal). Filoviridae (v. Ebola) Caliciviridae (v. hepatitidy E) Coronaviridae Parvoviridae Togaviridae (v. zarděnek) Rhabdoviridae (v. vztekliny) Retroviridae (HIV) Orthomyxoviridae (v. chřipky) Paramyxoviridae (v. spalniček) Obr. 72: Někteří zástupci virů. Kontrolní otázky metody molekulární biologie Co patří mezi nebuněčné formy ţivota? Jaké je chemické sloţení virů, prionů, viroidů a virusoidů? Znáš příklady virového a prionového onemocnění? Jaká je velikost virů? Jak probíhá reprodukce virů v buňce? Jaký je rozdíl mezi lytickým a lyzogenním cyklem? Jak probíhá genová exprese u virů v závislosti na typu nukleové kyseliny? Jaké jsou dva typy elektronových mikroskopů? Jaký je rozdíl mezi světelným a elektronovým mikroskopem? Jaký je rozdíl mezi transmisním a rastrovacím elektronovým mikroskopem? Jaké je zvětšení a rozlišovací schopnost elektronových mikroskopů? Jak je třeba upravit vzorek před pozorováním v el. mikroskopu? 86

91 18 Fyzikální a chemické vlivy vnějšího prostředí 18. Fyzikální a chemické vlivy vnějšího prostředí FYZIKÁLNÍ VLIVY Teplota - vysoké teploty způsobují denaturaci proteinů, naopak teploty pod bodem mrazu způsobují krystalizaci vody v buňce spojenou s jejím mechanickým poškozením. Fotodynamie je jev, který vyvolávají některé látky, tzv. fotodynamická barviva (fagopyrin, hypericin obsaţen v třezalce, eosin, akridin, fluorescein, porfyriny, chlorofyl), která způsobí zcitlivění organizmu na světlo. Vzniklá nemoc ze světla (např. fagopyrizmus skotu po zkrmení pohanky), můţe mít i letální následky. Princip fotodynamie spočívá v tom, ţe látky s fotodynamickým účinkem jsou barevné, nebo jsou v organizmu metabolizovány za vzniku barevných derivátů nebo metabolitů. Světlo je v povrchových tkáních organizmu absorbováno v relativně silné vrstvě a při běţných intenzitách záření je teplo produkované při absorpci fotonů v oblasti viditelného nebo ultrafialového spektra odváděno bez významnějšího patologického vlivu na tkáně. Je-li ovšem podkoţní tkáň prostoupena barvivem, dochází k pohlcení tohoto záření v relativně slabé vrstvě, která se silně přehřívá. Tkáň reaguje uvolněním látek charakteristických pro zánět (histamin, bradykinin aj.), coţ se projeví lokálním zánětem. Při ozáření celého těla dochází k ataku na centrální nervový systém, coţ se projeví vznikem křečí, narušením celkového zdravotního stavu a následnou smrtí. UV záření usmrcuje buňky velmi rychle (vyuţití při sterilizaci). Největší účinek má záření o vlnové délce 260 nm, které je specificky absorbováno nukleovými kyselinami a způsobuje vznik tyminových dimerů a následné znemoţnění replikace a transkripce. Ionizující záření - účinek záření závisí na mnoţství ionizací, vyvolaných podél stopy paprsku. Čím větší je rychlost částice, tím menší je mnoţství vzniklých iontů. Částice, které mají malou rychlost, vyvolávají velké mnoţství ionizace podél krátké dráhy a mají tedy na buňku velký efekt. Paprsky, které pronikají organizmem větší rychlostí, poškozují menší počet buněk, ale zasahují i hluboko uloţené tkáně. Hlavním mechanizmem účinku ionizujícího záření je tvorba velmi reaktivních volných radikálů (především H + a OH - ). CHEMICKÉ VLIVY Jedy (toxiny) jsou chemické látky, které způsobují porušení funkcí buňky nebo její smrt. Toxiny mohou působit na několika úrovních: syntéza biopolymerŧ (narušení syntézy buněčné stěny bakterií účinkem antibiotik - penicilinu, toxický účinek pro bakterie ne pro eukaryota), transportní funkce buněčných membrán (porušení soudrţnosti membrán účinkem fosfolipáz včelího a hadího jedu nebo účinkem povrchově aktivních látek jako jsou saponiny, detergenty), energetický metabolizmus (poruchy syntézy ATP účinkem kyanidů a barbiturátů), buněčný cyklus (zastavení mitózy účinkem mitotického jedu kolchicinu). Oligodynamie je schopnost některých poměrně stálých kovů (Au, Ag, Zn, Hg, Cu) emitovat ve vodním prostředí ionty, přestoţe tyto látky mohou být ve vodě nerozpustné. Tyto ionty nepříznivě ovlivňují jednobuněčné organizmy (např. nálevníky). Fytoncidy jsou těkavé látky, které se vyskytují u vyšších aromatických rostlin (cibule, česnek, křen atd.) a mají antibakteriální, antimykotické a antivirové účinky. Např. v cibuli jsou obsaţeny fytoncidy alliin a allicin. Velmi citlivými k fytoncidům jsou prvoci v senném nálevu a některý hmyz. 87

92 18 Fyzikální a chemické vlivy vnějšího prostředí BUNĚČNÝ STRES je negativní působení vnějších faktorů na buňku. STRESOVÉ FAKTORY (STRESORY) mohou být fyzikální, chemické nebo biologické, porušující ţivotní procesy v buňkách. Působení stresorů: specifické - ovlivnění pouze některé struktury či funkce buňky např. enzymové jedy blokují aktivitu některého enzymu, mikrotubulární toxiny zabrání vazbou na tubulin jeho polymerizaci v mikrotubuly atd. nespecifické - např. denaturace všech proteinů při teplotě nad 100 o C, účinkem těţkých kovů, kyselin, aldehydů a dalších chemických látek Účinek stresorů: cytocidní zánik buňky, tzv. nekróza cytostatický zastavení buněčného cyklu mitoklastický narušení průběhu mitózy genotoxický (mutagenní) změna genetické informace STRESOVÉ PROTEINY jsou proteiny syntetizované buňkou jako obranná reakce proti stresu. Některé proteiny tepelného šoku např. HSP60 (heat shock protein o velikost 60 kd) u Escherichia coli chrání buněčné proteiny před poškozením (denaturací) při zvýšené teplotě. ÚKOLY Úkol 1: Fotodynamie NP: senný nálev, eosin Připravte si 2 podloţní sklíčka. Na jedno dejte kapku senného nálevu a k tomu přidejte kapku eosinu a preparát umístěte do tmy (první kontrola). Na druhé sklíčko dejte dvě kapky senného nálevu: jedna z nich bude bez eosinu (druhá kontrola), k druhé kapce přidejte eosin (vlastní pokus) a sklíčko umístěte na denní světlo. Preparáty prohlíţejte zhruba kaţdé 3 min. a porovnejte, co se děje s nálevníky ve vlastním pokusu a ve dvou kontrolách. V preparátu na světle je moţno pozorovat nejdříve podráţdění (excitaci), které se projevuje zrychlením pohybu nálevníků. Po excitaci dochází ke zpomalení pohybu, aţ k jeho zastavení a úhynům prvoků. Ve tmě: Na světle: (senný nálev + eosin) (senný nálev) (senný nálev + eosin) Úkol 2: Vliv ionizujícího záření na varle potkana TP: varle potkana (normální tkáň a tkáň po ozáření dávkou 6,5 Gy = grayů), barvený hematoxylin-eosinem Nejprve si prohlédněte a nakreslete normální tkáň a poté tkáň po ozáření při malém a pak i při větším zvětšení. Porovnejte hustotu semenotvorných kanálků, jejich strukturu, tvar buněk a barvitelnost jader. 88

93 18 Fyzikální a chemické vlivy vnějšího prostředí A semenotvorný kanálek B Obr. 73: Porovnání struktury varlete a semenotvorného kanálku potkana: A před ozářením (při malém a větším zvětšení), B po ozáření (při malém a větším zvětšení). Úkol 3: Oligodynamie NP: senný nálev, voda nad rtutí Na podloţní sklo naneste kapku vody, pod níţ byla uchovávaná rtuť, a do ní přidejte kapku senného nálevu. Pozorujte preparát s nálevníky kaţdé 3 min. a porovnejte s kontrolní skupinou prvoků v čisté vodě. Nejprve dojde k excitaci prvoků, pak k útlumu pohybu a nakonec k úhynu. Zaznamenejte výsledky pozorování. pokus (senný nálev + voda nad rtutí) kontrola (senný nálev) Úkol 4: Vliv CdCl 2 na varle potkana TP: varle potkana (normální tkáň a tkáň potkana, kterému byl aplikován CdCl 2 ), barvený hematoxylin-eosinem Prohlédněte si a porovnejte preparát varlete potkana po účinku CdCl 2 s kontrolním preparátem. Všimněte si sníţení počtu spermiotvorných buněk a zvýšení počtu doprovodných buněk (Sertoliho buňky) a zakreslete rozdíly. 89

94 18 Fyzikální a chemické vlivy vnějšího prostředí Úkol 5: Vliv fytoncidŧ na nálevníky NP: senný nálev, cibule Nakrájejte cibuli na malé kousky a rozetřete v třecí misce s mořským pískem na jemnou kašovitou hmotu. Na podloţní sklíčko kápněte senný nálev a zkontrolujte přítomnost nálevníků. Preparát umístěte na podloţku do Petriho misky, na jejímţ dně je přidaná rozdrcená cibule. Po 3-5 min kontrolujte pohyblivost nálevníků v Petriho misce i v paralelně připravené kontrole mimo Petriho misku. Zaznamenejte výsledky pozorování. senný nálev cibulová drť Kontrolní otázky vlivy vnějšího prostředí Co patří mezi stresory? Jaký můţe být účinek stresorů? Co je to fotodynamie? Co patří mezi fotodynamická barviva a jaký je jejich účinek? Jaký je účinek ionizující záření na varle potkana? Co je to oligodynamie? Co jsou to fytoncidy a jaký je jejich účinek? 90

95 19 Genetika 19. Genetika Mendelismus, monohybridismus GEN je úsek DNA nesoucí dědičnou informaci pro tvorbu proteinů (gen strukturní) nebo tvorbu trna a rrna. ALELA je konkrétní forma genu. LOKUS je místo na chromozomu, kde je lokalizován určitý gen. Místa uloţení genů v buňce jsou genofory (jaderné chromozomy, mitochondriální a chloroplastové chromozomy, plazmidy). GENOM je soubor veškeré DNA v jádře (příp. v mitochondriích mitochondriální genom a v chloroplastech chloroplastový genom). GENOTYP je soubor všech alel (forem genů) organizmu. FENOTYP je soubor všech pozorovatelných vlastností (znaků) organizmu. HOMOZYGOT je organizmus, jehoţ obě alely zkoumaného genu jsou stejné. Můţe být dominantní (dvě dominantní alely) nebo recesivní (dvě recesivní alely). HETEROZYGOT je organizmus, jehoţ obě alely zkoumaného genu jsou navzájem různé. P GENERACE (parentální) je rodičovská generace s odlišnými homozygotními genotypy (dominantní a recesivní). F 1 GENERACE (první filiální) je první generace potomků, vzniká kříţením (hybridizací) dvou jedinců z P generace za vzniku heterozygotů. F 2 GENERACE (druhá filiální) je druhá generace potomků, vzniká kříţením dvou jedinců z F1 generace. B 1 GENERACE je první generace zpětného kříţení (back crossing), kříţení homozygotního rodiče a heterozygota. ÚPLNÁ DOMINANCE platí, jestliţe dominantní alela přítomná v homozygotní nebo heterozygotní sestavě má stejný fenotypový projev. NEÚPLNÁ DOMINANCE (semidominance) má rozdílný projev dominantní alely v homozygotní a heterozygotní sestavě. MONOHYBRIDISMUS je sledování dědičnosti jednoho kvalitativního znaku. MENDELOVA PRAVIDLA (ZÁKONY) 1. uniformita hybridů F 1 generace (heterozygoti) 2. identita reciprokých kříţení 3. čistota vloh a jejich štěpení (princip segregace vloh) 4. vzájemná volná kombinovatelnost vloh Platí za podmínek, ţe se jedná o monogenní dědičnost (1 znak je kódován 1 genem), autozomální dědičnost (geny leţí na autozomech) a kaţdý gen je na jiném chromozomu. CHÍ KVADRÁT TEST ( 2 test) je statistická metoda, která se pouţívá pro stanovení významnosti nalezené odchylky mezi skutečně získanými (empirickými) a očekávanými (teoretickými) údaji pro podíly z celku. V genetice se pouţívá pro ověřování štěpných poměrů. 2 ( N ) ( x i e i e i ) 2 x i.získaná (empirická) hodnota e i očekávaná (teoretická) hodnota N.počet stupňů volnosti (počet tříd štěpných poměrů zmenšený o jednu třídu) 91

96 19 Genetika Vypočtenou hodnotu porovnáme s tabulkovou hodnotou pro N stupňů volnosti na hladině významnosti = 0,05 (příloha 1). Jestliţe je vypočtená hodnota 2 menší neţ tabulková, pak rozdíl mezi získanými a očekávanými údaji není statisticky významný a můţeme říci, ţe se sledovaný znak vyštěpil v očekávaném poměru. ÚKOLY na cvičeních Úkol 1: Napište úplný rozpis kříţení homozygotních forem hledíku (Antirrhinum maius) červenokvětého (AA) s bělokvětým (aa). Heterozygot (Aa) má květy růţové. a) Doplňte genotypy a napište fenotypový a genotypový štěpný poměr v F 1 a F 2 generaci. b) Jak je dědičně zaloţena barva květů hledíku (úplná nebo neúplná dominance)? Úkol 2: Pomocí 2 testu zjistěte, zda experimentální štěpný poměr F 2 generace; 79 kuních tmavých, 170 kuních světlých a 95 ruských králíků odpovídá zjištěnému teoretickému fenotypovému štěpnému poměru (tabulková hodnota - příloha 1). Úkol 3: U tykví je bílá barva plodu dominantní nad ţlutou. Alela W podmiňuje bílé zbarvení, alela w ţluté zbarvení. a) Po kříţení tykví s bíle zbarvenými plody byly získány asi 3/4 potomků s bílými a 1/4 potomků se ţlutými plody. Jaké byly genotypy rodičů a potomků? b) Máte tykev s bílými plody. Jaký způsob kříţení zvolíte ke zjištění, zda jde o homozygota či heterozygota? Napište rozpis moţných kříţení (genotypy i fenotypy zúčastněných rostlin). Úkol 4: Modrou a hnědou barvu očí člověka podmiňují různé alely téhoţ genu. Při studiu jedné populace byly u 337 rodin zjištěny tyto údaje: Rodiče (barva očí) Počet rodin Děti (barva očí) modrá hnědá modré x modré modré x hnědé hnědé x hnědé Která barva očí je dominantní? Uţijte symbolů B, b a napište kaţdý z typů kříţení. Úkol 5: Dvě černé myší samičky byly kříţeny s hnědými samečky. V několika vrzích měla jedna samička 9 černých a 7 hnědých myší, druhá samička měla v několika vrzích 57 černých myší. a) Odvoďte, jak se dědí černé a hnědé zbarvení srsti u myší. b) Jaké byly genotypy rodičů v uvedených kříţeních? 92

97 19 Genetika ÚKOLY doplňková sada Úkol 6: Kříţením tykve s bílými plody s tykví mající ţluté plody vzniklo potomstvo: 327 rostlin s bílými plody a 361 se ţlutými (viz úkol 2). a) Zapište genotypy rostlin. Jaký je genotyp výchozí tykve s bílými plody? b) Jak se nazývá uvedený typ kříţení? c) Proveďte χ 2 test pro ověření štěpných poměrů (tabulková hodnota - příloha 1). Úkol 7: U okurky jsou listy typicky dlanité, je však znám gen, který podmiňuje vějířovité listy nazývané ginkgo, poněvadţ se podobají listům stromu jinanu dvoulaločného (Gingko biloba). Po kříţení homozygotní rostliny s listy dlanitými s homozygotní rostlinou s listy ginkgo byly listy všech rostlin F 1 generace dlanité. a) Jaký tvar listů je dominantní? b) Uveďte genotypový a fenotypový štěpný poměr v F 2 generaci a při zpětném kříţení. Úkol 8: U andaluského plemene slepic podmiňuje alela B tmavou barvu peří a alela b bílou. Slepice heterozygotní konstituce mají peří modravé. Jaké bude potomstvo po kříţení modravé slepice s kohoutem: a) s tmavým peřím, b) s modravým peřím, c) s bílým peřím? Kontrolní otázky monohybridismus Co znamenají pojmy gen, genom, genotyp, lokus? Jaký je rozdíl mezi pojmy znak a fenotyp? Uveď příklad. Co znamenají pojmy homozygot a heterozygot (uveď příklady)? Co je to P generace? Co je to F1 generace a jak vzniká? Co je to F2 generace a jak vzniká? Jaký je fenotypový štěpný poměr v F2 generaci při úplné dominanci? Jaký je fenotypový štěpný poměr v F2 generaci při neúplné dominanci? Co je to B1 generace a jak vzniká? Jaký je fenotypový štěpný poměr v B1 generaci? Co vše patří do mendelistické dědičnosti? Jak zní Mendelovy zákony a za jakých podmínek platí? K čemu se v genetice pouţívá Chí kvadrát test? 93

98 19 Genetika Dihybridismus, polyhybridismus a rozvětvovací metoda DIHYBRIDISMUS sleduje dědičnost dvou kvalitativních znaků. Vzorový příklad 1: U slepic jsou opeřené nohy F dominantní nad holými f a hráškovitý tvar hřebínku P dominantní nad jednoduchým p. Dva kohouti A a B byli pářeni se dvěma slepicemi C a D. Všichni čtyři jedinci měli opeřené nohy a hráškovité hřebínky. Kohout A dal s oběma slepicemi všechno potomstvo opeřené s hráškovitým hřebínkem. Kohout B se slepicí C dal potomstvo opeřené i neopeřené, avšak pouze s hráškovitým hřebínkem; se slepicí D však dal všechny potomky opeřené, avšak část s hráškovitým a část s jednoduchým hřebínkem. Jaké byly genotypy obou kohoutů a slepic? Postup: Máme odvodit genotypy rodičů z jejich fenotypů a fenotypů jejich potomků. Základem postupu je zapsat si genotypy/alely, které víme jistě, a postupně odvozovat a doplňovat doposud nejisté alely. Přitom s jistotou víme, ţe jedinec s recesivním fenotypem musí být recesivní homozygot, jedinec s dominantním fenotypem můţe být buď dominantní homozygot, nebo heterozygot. Moţný postup je potom např. následující: 1) Všichni čtyři jedinci A, B, C i D vykazovali v obou sledovaných znacích dominantní fenotyp, v obou příslušných genech tedy museli nést přinejmenším jednu dominantní alelu, coţ můţeme zapsat jako F-P-. Musíme tedy vţdy zjistit, jaká je ta druhá alela. 2) Z kříţení B x D bylo získáno pouze potomstvo s jednoduchým hřebínkem, coţ je recesivní fenotyp a příslušní potomci tedy musí být recesivní homozygoti. Aby se to mohlo stát, oba rodiče museli být schopni recesivní alelu p poskytnout a tedy museli být heterozygoti. O jedincích B a D tedy víme, ţe jsou genotypu F-Pp. 3) Z kříţení B x C bylo získáno pouze potomstvo s hráškovitým hřebínkem (dominantní fenotyp). Víme, ţe kohout B je v příslušném genu heterozygot. Aby se v potomstvu heterozygota vyskytoval pouze dominantní fenotyp, musí tento heterozygot být kříţen s dominantním homozygotem. Slepice C tedy je genotypu F-PP. 4) Kohout A dal s oběma slepicemi potomstvo s dominantním projevem v obou sledovaných znacích; slepice D je ale přitom v genu P heterozygot. Je-li v jejich potomstvu pouze dominantní fenotyp, musí být kohout A v genu P dominantní homozygot, tj. F-PP. Nyní uţ známe genotypy všech čtyř jedinců, co se týče genu P. 5) Z kříţení B x C tedy dvou opeřených jedinců vzniká obojí potomstvo, tj. i neopeření (recesivní fenotyp, recesivní homozygoti). Aby dva jedinci s dominantním fenotypem měli potomstvo recesivního fenotypu, musí být (analogicky k bodu 2) oba heterozygoti. Genotyp kohouta B je tedy FfPp, genotyp slepice C je tedy FfPP. 6) Z kříţení B x D tedy opeřeného heterozygota s opeřenou slepicí, vzešlo pouze opeřené potomstvo. Analogicky k bodům 3 a 4 tedy musí slepice D být dominantní homozygot a její genotyp je tedy FFPp. 7) Z kříţení A x C tedy opeřeného kohouta s opeřenou heterozygotkou také vzešlo pouze opeřené potomstvo. Analogicky k bodu 6 tedy musí být kohout A dominantní homozygot a jeho genotyp je tedy FFPP. POLYHYBRIDISMUS sleduje dědičnost více neţ dvou kvalitativních znaků. 94

99 19 Genetika DIHYBRIDNÍ KOMBINAČNÍ ČTVEREC zachycuje 16 zygotických kombinací vzniklých při vzájemném kříţení dvou dihybridů v F 1 generaci. F 1 generace: AaBb AaBb gamety: AB:Ab:aB:ab AB:Ab:aB:ab F2 generace: Gamety AB Ab ab ab AB AABB AABb AaBB AaBb Ab AABb AAbb AaBb Aabb ab AaBB AaBb aabb aabb ab AaBb Aabb aabb aabb Při psaní kombinačního čtverce je třeba dodrţovat pravidla zápisu pořadí gametických genotypů. Při zápisu genotypového či fenotypového štěpného poměru začínáme z levého horního rohu čtverce a pokračujeme úhlopříčně směrem k pravému dolnímu rohu. Proto zápis dihybridního genotypového štěpného poměru v F 2 generaci je následující: 1AABB : 2AABb : 1AAbb : 2AaBB : 4AaBb : 2Aabb : 1aaBB : 2aaBb : 1aabb. Zápis dihybridního fenotypového štěpného poměru F 2 generace při úplné dominanci obou znaků je následující: 9 A-B- : 3 A-bb : 3 aab- : 1 aabb (místo pomlčky v zápise genotypů je moţné doplnit jak dominantní alelu, tak alelu recesivní; fenotypový projev se v obou případech shoduje). Čtyři zygotické genotypy dihybridů (AaBb) leţí v úhlopříčce, která se nazývá úhlopříčka heterozygotŧ. Z levého horního rohu čtverce pak vychází úhlopříčka homozygotŧ (AABB, AAbb, aabb, aabb). Z prostředních 2 zygotických genotypových kombinací (AAbb, aabb) se vytváří fenotypy, které se dosud při kříţení P a F 1 generace nevyskytly a označují se jako pěstitelské a chovatelské novinky. ZÁVORKOVÁ METODA Principem je nejdříve zjistit štěpné poměry pro jednotlivé geny a následně tyto štěpné poměry vynásobit mezi sebou jako závorky. Lze pouţít pro stanovení genotypových i fenotypových štěpných poměrů. Vzorový příklad 1: Aabbcc AaBbCC (u všech genů je mezi alelami vztah úplné dominance). Aa x Aa AA, 2Aa, aa = štěpný poměr (1:2:1) bb x Bb..Bb, bb = štěpný poměr (1:1) cc x CC..Cc = 1 (1:2:1)x(1:1)x1= 1:1:2:2:1:1 ROZVĚTVOVACÍ METODA umoţňuje odvodit štěpné poměry, aniţ bychom pouţili kombinační čtverec. Tato metoda je vhodná zvláště pro zjišťování štěpných poměrů v potomstvech vícenásobných hybridů (polyhybridů). Principem je postupné větvení jednotlivých alternativ párů vloh (větví se heterozygoti). Vzorový příklad 1: Za pouţití rozvětvovací metody stanovte genotypy gamet jedince s genotypem AaBBCc. genotyp: AB C ABC c ABc ab C abc c abc Jedinec s výše uvedeným genotypem můţe vytvářet gamety se 4 různými genotypy. 95

100 19 Genetika Vzorový příklad 2: Pomocí rozvětvovací metody určete genotypový štěpný poměr a zastoupení genotypů u potomstva po kříţení rodičů s genotypy: Aabbcc AaBbCC (u všech genů je mezi alelami vztah úplné dominance). Aa x Aa AA, 2Aa, aa bb x Bb..Bb, bb cc x CC..Cc genotypy: AA BbCc AABbCc bbcc AAbbCc 2Aa BbCc 2AaBbCc bbcc 2AabbCc aa BbCc aabbcc bbcc aabbcc Kříţením rodičů s výše uvedenými genotypy mohou vznikat potomci s 6 různými genotypy v štěpném poměru 1 : 1 : 2 : 2 : 1 : 1. ÚKOLY na cvičeních Úkol 1: Vyplňte dihybridní kombinační čtverec a odvoďte fenotypový a genotypový štěpný poměr potomstva morčat dihybridů genotypů RrBb (R - hrubá srst, r - hladká srst, B - černá srst, b - bílá srst). U obou genů je mezi alelami vztah úplné dominance. Jaký bude štěpný poměr při zpětném kříţení? Úkol 2: Za pouţití rozvětvovací metody stanovte genotypy gamet jedince s genotypem: a) RrssTtUU b) AaBBCcddEe c) KkllmmNnOOppQq Úkol 3: Pomocí rozvětvovací i závorkové metody určete genotypový a fenotypový štěpný poměr u potomstva po kříţení hybridů: AaBBCcddEe aabbccddee (u všech genů je mezi alelami vztah neúplné dominance). Úkol 4: Kříţením černého hrubosrstého morčete s morčetem bílým hrubosrstým (viz úkol 1) vzniklo následující potomstvo: 32 černých hrubosrstých : 33 bílých hrubosrstých : 12 černých hladkosrstých : 9 bílých hladkosrstých. a) Jaké byly genotypy obou kříţených morčat? b) Pomocí rozvětvovací metody zjistěte teoretické frekvence genotypů potomků vzniklých tímto kříţením. c) Pomocí testu ověřte shodu mezi vzniklým (empirickým) a teoretickým fenotypovým štěpným poměrem (tabulková hodnota - příloha 1). 96


M I K R O S K O P I E Inovace předmětu KBB/MIK SVĚTELNÁ A ELEKTRONOVÁ M I K R O S K O P I E Rozvoj a internacionalizace chemických a biologických studijních programů na Univerzitě Palackého v Olomouci CZ.1.07/2.2.00/28.0066


Základy mikroskopie. Úkoly měření: Použité přístroje a pomůcky: Základní pojmy, teoretický úvod: Úloha č. 10

Základy mikroskopie. Úkoly měření: Použité přístroje a pomůcky: Základní pojmy, teoretický úvod: Úloha č. 10 Úloha č. 10 Základy mikroskopie Úkoly měření: 1. Seznamte se základní obsluhou třech typů laboratorních mikroskopů: - biologického - metalografického - stereoskopického 2. Na výše jmenovaných mikroskopech


Projekt realizovaný na SPŠ Nové Město nad Metují

Projekt realizovaný na SPŠ Nové Město nad Metují Projekt realizovaný na SPŠ Nové Město nad Metují s finanční podporou v Operačním programu Vzdělávání pro konkurenceschopnost Královéhradeckého kraje Modul 02 Přírodovědné předměty Hana Gajdušková 1 Viry


Základní pojmy Zobrazení zrcadlem, Zobrazení čočkou Lidské oko, Optické přístroje

Základní pojmy Zobrazení zrcadlem, Zobrazení čočkou Lidské oko, Optické přístroje Optické zobrazování Základní pojmy Zobrazení zrcadlem, Zobrazení čočkou Lidské oko, Optické přístroje Základní pojmy Optické zobrazování - pomocí paprskové (geometrické) optiky - využívá model světelného


Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi. Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi

Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi. Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi Co je to vlastně ta fluorescence? Některé látky (fluorofory)


Optická (světelná) Mikroskopie pro TM I

Optická (světelná) Mikroskopie pro TM I Optická (světelná) Mikroskopie pro TM I Ústav skla a keramiky VŠCHT Praha +42-0- 22044-4151 Osnova přednášky Typy klasických biologických a polarizačních mikroskopů Přehled součástí


Praktické cvičení č. 1.

Praktické cvičení č. 1. Praktické cvičení č. 1. Cvičení 1. 1. Všeobecné pokyny ke cvičení, zápočtu a zkoušce Bezpečnost práce 2. Mikroskopie - mikroskop a mikroskopická technika - převzetí pracovních pomůcek - pozorování trvalého


Tento materiál byl vytvořen v rámci projektu Operačního programu Vzdělávání pro konkurenceschopnost.

Tento materiál byl vytvořen v rámci projektu Operačního programu Vzdělávání pro konkurenceschopnost. Tento materiál byl vytvořen v rámci projektu Operačního programu Vzdělávání pro konkurenceschopnost. Projekt MŠMT ČR Číslo projektu Název projektu školy Šablona III/2 EU PENÍZE ŠKOLÁM CZ.1.07/1.4.00/21.2146



FLUORESCENČNÍ MIKROSKOP FLUORESCENČNÍ MIKROSKOP na gymnáziu Pierra de Coubertina v Táboře Pavla Trčková, kabinet Biologie, GPdC Tábor Co je fluorescence Fluorescence je jev spočívající v tom, že některé látky (fluorofory) po


Lupa a mikroskop příručka pro učitele

Lupa a mikroskop příručka pro učitele Obecné informace Lupa a mikroskop příručka pro učitele Pro vysvětlení chodu světelných paprsků lupou a mikroskopem je nutno navázat na znalosti o zrcadlech a čočkách. Hodinová dotace: 1 vyučovací hodina



I N V E S T I C E D O R O Z V O J E V Z D Ě L Á V Á N Í LABORATORNÍ PRÁCE Č. 34 MIKROSKOPIE LABORATORNÍ PRÁCE Č. 34 MIKROSKOPIE PRINCIP V chemické laboratoři se používá k některým stanovením tzv. mikrokrystaloskopie. Jedná se o použití optického mikroskopu při kvalitativních důkazech látek na


Fotografický aparát. Fotografický aparát. Fotografický aparát. Fotografický aparát. Fotografický aparát. Fotografický aparát

Fotografický aparát. Fotografický aparát. Fotografický aparát. Fotografický aparát. Fotografický aparát. Fotografický aparát Michal Veselý, 00 Základní části fotografického aparátu tedy jsou: tělo přístroje objektiv Pochopení funkce běžných objektivů usnadní zjednodušená představa, že objektiv jako celek se chová stejně jako


1. Z přiložených objektivů vyberte dva, použijte je jako lupy a změřte jejich zvětšení a zorná pole přímou metodou.

1. Z přiložených objektivů vyberte dva, použijte je jako lupy a změřte jejich zvětšení a zorná pole přímou metodou. 1 Pracovní úkoly 1. Z přiložených objektivů vyberte dva, použijte je jako lupy a změřte jejich zvětšení a zorná pole přímou metodou. 2. Změřte zvětšení a zorná pole mikroskopu pro všechny možné kombinace


Video mikroskopická jednotka VMU

Video mikroskopická jednotka VMU Video mikroskopická jednotka VMU Série 378 VMU je kompaktní, lehká a snadno instalovatelná mikroskopická jednotka pro monitorování CCD kamerou v polovodičových zařízení. Mezi základní rysy optického systému


Odraz světla na rozhraní dvou optických prostředí

Odraz světla na rozhraní dvou optických prostředí Odraz světla na rozhraní dvou optických prostředí Může kulová nádoba naplněná vodou sloužit jako optická čočka? Exponát demonstruje zaostření světla procházejícího skrz vodní kulovou čočku. Pohyblivý světelný


Školní a rutinní mikroskop CHK2

Školní a rutinní mikroskop CHK2 Školní a rutinní mikroskop CHK2 Tato příručka je určena pro školní a rutinní mikroskop CHK2. Doporučujeme Vám si ji prostudovat dříve, než mikroskop poprvé použijete. Informace uvedené v příručce Vám umožní


25. Zobrazování optickými soustavami

25. Zobrazování optickými soustavami 25. Zobrazování optickými soustavami Zobrazování zrcadli a čočkami. Lidské oko. Optické přístroje. Při optickém zobrazování nemusíme uvažovat vlnové vlastnosti světla a stačí považovat světlo za svazek


V organismu se bílkoviny nedají nahradit žádnými jinými sloučeninami, jen jako zdroj energie je mohou nahradit sacharidy a lipidy.

V organismu se bílkoviny nedají nahradit žádnými jinými sloučeninami, jen jako zdroj energie je mohou nahradit sacharidy a lipidy. BÍLKOVINY Bílkoviny jsou biomakromolekulární látky, které se skládají z velkého počtu aminokyselinových zbytků. Vytvářejí látkový základ života všech organismů. V tkáních vyšších organismů a člověka je


Laboratorní úloha č. 6 - Mikroskopie

Laboratorní úloha č. 6 - Mikroskopie Laboratorní úloha č. 6 - Mikroskopie Úkoly měření: 1. Seznamte se s ovládáním stereoskopického mikroskopu, digitálního mikroskopu a fotoaparátu. 2. Studujte pod mikroskopem různé preparáty. Vyberte vhodný



VY_32_INOVACE_FY.12 OPTIKA II VY_32_INOVACE_FY.12 OPTIKA II Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Jiří Kalous Základní a mateřská škola Bělá nad Radbuzou, 2011 Optická čočka je optická soustava dvou centrovaných


Fluorescenční vyšetření rostlinných surovin. 10. cvičení

Fluorescenční vyšetření rostlinných surovin. 10. cvičení Fluorescenční vyšetření rostlinných surovin 10. cvičení Cíl cvičení práce s fluorescenčním mikroskopem detekce vybraných rostlinných surovin Princip nepřímé dvojstupňové IHC s použitím fluorochromu Fluorescenční


Otázky z optiky. Fyzika 4. ročník. Základní vlastnosti, lom, odraz, index lomu

Otázky z optiky. Fyzika 4. ročník. Základní vlastnosti, lom, odraz, index lomu Otázky z optiky Základní vlastnosti, lom, odraz, index lomu ) o je světlo z fyzikálního hlediska? Jaké vlnové délky přísluší viditelnému záření? - elektromagnetické záření (viditelné záření) o vlnové délce



VÝUKOVÝ SOFTWARE PRO ANALÝZU A VIZUALIZACI INTERFERENČNÍCH JEVŮ VÝUKOVÝ SOFTWARE PRO ANALÝZU A VIZUALIZACI INTERFERENČNÍCH JEVŮ P. Novák, J. Novák Katedra fyziky, Fakulta stavební, České vysoké učení technické v Praze Abstrakt V práci je popsán výukový software pro


Jsme tak odlišní. Co nás spojuje..? Nukleové kyseliny

Jsme tak odlišní. Co nás spojuje..? Nukleové kyseliny Jsme tak odlišní Co nás spojuje..? ukleové kyseliny 1 UKLEVÉ KYSELIY = K anj = A ositelky genetických informací Základní význam pro všechny organismy V buňkách a virech Identifikace v buněčném jádře (nucleos)


Sylabus pro předmět Biochemie pro jakost

Sylabus pro předmět Biochemie pro jakost Sylabus pro předmět Biochemie pro jakost Kód předmětu: BCHJ Název v jazyce výuky: Biochemie pro Jakost Název česky: Biochemie pro Jakost Název anglicky: Biochemistry Počet přidělených ECTS kreditů: 6 Forma



EU PENÍZE ŠKOLÁM NÁZEV PROJEKTU : MÁME RÁDI TECHNIKU REGISTRAČNÍ ČÍSLO PROJEKTU :CZ.1.07/1.4.00/21.0663 EU PENÍZE ŠKOLÁM NÁZEV PROJEKTU : MÁME RÁDI TECHNIKU REGISTRAČNÍ ČÍSLO PROJEKTU :CZ.1.07/1.4.00/21.0663 Speciální základní škola a Praktická škola Trmice Fűgnerova 22 400 04 1 Identifikátor materiálu:


Biochemie. ochrana životního prostředí analytická chemie chemická technologie Forma vzdělávání: Platnost: od 1. 9. 2009 do 31. 8.

Biochemie. ochrana životního prostředí analytická chemie chemická technologie Forma vzdělávání: Platnost: od 1. 9. 2009 do 31. 8. Studijní obor: Aplikovaná chemie Učební osnova předmětu Biochemie Zaměření: ochrana životního prostředí analytická chemie chemická technologie Forma vzdělávání: denní Celkový počet vyučovacích hodin za


Pracovní listy pro žáky

Pracovní listy pro žáky Pracovní listy pro žáky : Ušlech lý pan Beketov Kovy a potraviny Úkol 1: S pomocí nápovědy odhadněte správný kov, který je v dané potravině obsažen. Nápověda: MANGAN (Mn), ŽELEZO (Fe), CHROM (Cr), VÁPNÍK


Laboratorní cvičení z obecné mikrobiologie

Laboratorní cvičení z obecné mikrobiologie MIKROSKOPY Mikroskopická technika je neodmyslitelnou součástí praktické mikrobiologie a mikroskop patří k základnímu vybavení každé laboratoře. 1. Popis zařízení Mikroskop je vlastně soustava čoček o jedné


Krafková, Kotlán, Hiessová, Nováková, Nevímová

Krafková, Kotlán, Hiessová, Nováková, Nevímová Krafková, Kotlán, Hiessová, Nováková, Nevímová Optická čočka je optická soustava dvou centrovaných ploch, nejčastěji kulových, popř. jedné kulové a jedné rovinné plochy. Čočka je tvořena z průhledného


Optické zobrazení - postup, kterým získáváme optické obrazy bodů a předmětů

Optické zobrazení - postup, kterým získáváme optické obrazy bodů a předmětů Optické soustav a optická zobrazení Přímé vidění - paprsek od zobrazovaného předmětu dopadne přímo do oka Optická soustava - soustava optických prostředí a jejich rozhraní, která mění chod paprsků Optické


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


PRÁCE S MIKROSKOPEM Praktická příprava mikroskopického preparátu

PRÁCE S MIKROSKOPEM Praktická příprava mikroskopického preparátu PRÁCE S MIKROSKOPEM 1. Praktická příprava mikroskopického preparátu 2. a) Z objektu, jehož část, chceme pozorovat pomocí mikroskopu, musíme nejprve vytvořit mikroskopický preparát. Obr. č. 1 b) Pozorovaný


TUKY. Autor: Mgr. Stanislava Bubíková. Datum (období) tvorby: 15. 3. 2013. Ročník: devátý

TUKY. Autor: Mgr. Stanislava Bubíková. Datum (období) tvorby: 15. 3. 2013. Ročník: devátý TUKY Autor: Mgr. Stanislava Bubíková Datum (období) tvorby: 15. 3. 2013 Ročník: devátý Vzdělávací oblast: Člověk a příroda / Chemie / Organické sloučeniny 1 Anotace: Žáci se seznámí s lipidy. V rámci tohoto


ZŠ ÚnO, Bratří Čapků 1332

ZŠ ÚnO, Bratří Čapků 1332 Úvodní obrazovka Menu (vlevo nahoře) Návrat na hlavní stránku Obsah Výsledky Poznámky Záložky edunet Konec Chemie 1 (pro 12-16 let) LangMaster Obsah (střední část) výběr tématu - dvojklikem v seznamu témat


R8.1 Zobrazovací rovnice čočky

R8.1 Zobrazovací rovnice čočky Fyzika pro střední školy II 69 R8 Z O B R A Z E N Í Z R C A D L E M A Č O Č K O U R8.1 Zobrazovací rovnice čočky V kap. 8.2 je ke konstrukci chodu světelných paprsků při zobrazování tenkou čočkou použit


Digitální učební materiál. III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Příjemce podpory Gymnázium, Jevíčko, A. K.

Digitální učební materiál. III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Příjemce podpory Gymnázium, Jevíčko, A. K. Digitální učební materiál Číslo projektu CZ.1.07/1.5.00/34.0802 Název projektu Zkvalitnění výuky prostřednictvím ICT Číslo a název šablony klíčové aktivity III/2 Inovace a zkvalitnění výuky prostřednictvím


Fluorescenční mikroskopie

Fluorescenční mikroskopie Fluorescenční mikroskopie Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 1 VYUŽITÍ FLUORESCENCE, PŘÍMÁ FLUORESCENCE, PŘÍMÁ A NEPŘÍMA IMUNOFLUORESCENCE, BIOTIN-AVIDINOVÁ METODA IMUNOFLUORESCENCE


Inovace profesní přípravy budoucích učitelů chemie

Inovace profesní přípravy budoucích učitelů chemie Inovace profesní přípravy budoucích učitelů chemie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í CZ.1.07/2.2.00/15.0324 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem


Výukový materiál zpracován v rámci projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0996

Výukový materiál zpracován v rámci projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0996 Výukový materiál zpracován v rámci projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0996 Šablona: III/2 č. materiálu: VY_32_INOVACE_CHE_413 Jméno autora: Mgr. Alena Krejčíková Třída/ročník:


TEST (Aminokyseliny) 9. Kolik je esenciálních aminokyselin a kdo je neumí syntetizovat?

TEST (Aminokyseliny) 9. Kolik je esenciálních aminokyselin a kdo je neumí syntetizovat? TEST (Aminokyseliny) A 1. Definuj deriváty uhlovodíků 2. Napiš obecný vzorec karboxylové kyseliny 3. Napiš vzorec ß - aminakyseliny 5. Doplň: větu: Oligopeptid je... 6. Doplňte větu: Silon vznikl... 7.


DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 3 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 02.06.2014 Ročník: 6AF, 6BF Anotace DUMu: chromatin - stavba, organizace a struktura


Aminokyseliny příručka pro učitele. Obecné informace: Téma otevírá kapitolu Bílkoviny, která svým rozsahem překračuje rámec jedné vyučovací hodiny.

Aminokyseliny příručka pro učitele. Obecné informace: Téma otevírá kapitolu Bílkoviny, která svým rozsahem překračuje rámec jedné vyučovací hodiny. Obecné informace: Aminokyseliny příručka pro učitele Téma otevírá kapitolu Bílkoviny, která svým rozsahem překračuje rámec jedné vyučovací hodiny. Navazující učivo Před probráním tématu Aminokyseliny probereme


Základy biologie a ekologie VZNIK A VÝVOJ ŽIVOTA

Základy biologie a ekologie VZNIK A VÝVOJ ŽIVOTA Základy biologie a ekologie VZNIK A VÝVOJ ŽIVOTA Výsledky vzdělávání Učivo Ţák Základy biologie charakterizuje názory na vznik a vývoj vznik a vývoj ţivota na Zemi ţivota na Zemi, porovná délku vývoje


Základní přehled. Dalekohled přístroj, který nám při pohledu do něj přiblíží daný předmět tolikrát, kolik činí jeho zvětšení.

Základní přehled. Dalekohled přístroj, který nám při pohledu do něj přiblíží daný předmět tolikrát, kolik činí jeho zvětšení. Základní přehled Dalekohled přístroj, který nám při pohledu do něj přiblíží daný předmět tolikrát, kolik činí jeho zvětšení. Reflektor zrcadlový dalekohled, používající ke zobrazení dvou (primárního a


Výukový materiál zpracován v rámci projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0996

Výukový materiál zpracován v rámci projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0996 Výukový materiál zpracován v rámci projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0996 Šablona: III/2 č. materiálu: VY_32_INOVACE_CHE_412 Jméno autora: Třída/ročník: Mgr. Alena


Tabulace učebního plánu. Obecná chemie. Vzdělávací obsah pro vyučovací předmět : Ročník: 1.ročník a kvinta

Tabulace učebního plánu. Obecná chemie. Vzdělávací obsah pro vyučovací předmět : Ročník: 1.ročník a kvinta Tabulace učebního plánu Vzdělávací obsah pro vyučovací předmět : CHEMIE Ročník: 1.ročník a kvinta Obecná Bezpečnost práce Názvosloví anorganických sloučenin Zná pravidla bezpečnosti práce a dodržuje je.


Obchodní akademie a Jazyková škola s právem státní jazykové zkoušky Písek

Obchodní akademie a Jazyková škola s právem státní jazykové zkoušky Písek Obchodní akademie a Jazyková škola s právem státní jazykové zkoušky Písek Pracovní list DUMu v rámci projektu Evropské peníze pro Obchodní akademii Písek", reg. č. CZ.1.07/1.5.00/34.0301, Číslo a název


Jednoduchý elektrický obvod

Jednoduchý elektrický obvod 21 25. 05. 22 01. 06. 23 22. 06. 24 04. 06. 25 28. 02. 26 02. 03. 27 13. 03. 28 16. 03. VI. A Jednoduchý elektrický obvod Jednoduchý elektrický obvod Prezentace zaměřená na jednoduchý elektrický obvod


Mikroskop Delta Optical Genetic Pro

Mikroskop Delta Optical Genetic Pro Mikroskop Delta Optical Genetic Pro Návod Před použitím mikroskopu seznamte se, prosím, s návodem k jeho obsluze. Děkujeme Vám, že jste zakoupili náš mikroskop. Věř íme, že náš produkt splní vaše očekávání.


ZOBRAZOVÁNÍ ČOČKAMI. Mgr. Jan Ptáčník - GJVJ - Fyzika - Septima - Optika

ZOBRAZOVÁNÍ ČOČKAMI. Mgr. Jan Ptáčník - GJVJ - Fyzika - Septima - Optika ZOBRAZOVÁNÍ ČOČKAMI Mgr. Jan Ptáčník - GJVJ - Fyzika - Septima - Optika Čočky Zobrazování čočkami je založeno na lomu světla Obvykle budeme předpokládat, že čočka je vyrobena ze skla o indexu lomu n 2





Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE


MIKROSKOP. Historie Jeden z prvních jednoduchých mikroskopů sestavil v roce 1676 holandský obchodník a vědec Anton van Leeuwenhoek.

MIKROSKOP. Historie Jeden z prvních jednoduchých mikroskopů sestavil v roce 1676 holandský obchodník a vědec Anton van Leeuwenhoek. MIKROSKOPIE E- mailový zpravodaj MIKROSKOP firmy Olympus Journal of Scanning Probe Microscopy ( Materials Today, 2008, New Microscopy Special Issue MIKROSKOP Historie Jeden


VY_52_Inovace_242 Vzdělávací oblast: Člověk a příroda Vzdělávací obor: Chemie Ročník: 8, 9 Projekt EU peníze školám Operačního programu Vzdělávání

VY_52_Inovace_242 Vzdělávací oblast: Člověk a příroda Vzdělávací obor: Chemie Ročník: 8, 9 Projekt EU peníze školám Operačního programu Vzdělávání Sacharidy VY_52_Inovace_242 Vzdělávací oblast: Člověk a příroda Vzdělávací obor: Chemie Ročník: 8, 9 Projekt EU peníze školám Operačního programu Vzdělávání pro konkurenceschopnost Sacharidy název z řeckého


C Mapy Kikuchiho linií 263. D Bodové difraktogramy 271. E Počítačové simulace pomocí programu JEMS 281. F Literatura pro další studium 289

C Mapy Kikuchiho linií 263. D Bodové difraktogramy 271. E Počítačové simulace pomocí programu JEMS 281. F Literatura pro další studium 289 OBSAH Předmluva 5 1 Popis mikroskopu 13 1.1 Transmisní elektronový mikroskop 13 1.2 Rastrovací transmisní elektronový mikroskop 14 1.3 Vakuový systém 15 1.3.1 Rotační vývěvy 16 1.3.2 Difúzni vývěva 17


ZŠ ÚnO, Bratří Čapků 1332

ZŠ ÚnO, Bratří Čapků 1332 Animovaná chemie Top-Hit Analytická chemie Analýza anorganických látek Důkaz aniontů Důkaz kationtů Důkaz kyslíku Důkaz vody Gravimetrická analýza Hmotnostní spektroskopie Chemická analýza Nukleární magnetická


TEST + ŘEŠENÍ. PÍSEMNÁ ČÁST PŘIJÍMACÍ ZKOUŠKY Z CHEMIE bakalářský studijní obor Bioorganická chemie 2010

TEST + ŘEŠENÍ. PÍSEMNÁ ČÁST PŘIJÍMACÍ ZKOUŠKY Z CHEMIE bakalářský studijní obor Bioorganická chemie 2010 30 otázek maximum: 60 bodů TEST + ŘEŠEÍ PÍSEMÁ ČÁST PŘIJÍMACÍ ZKUŠKY Z CEMIE bakalářský studijní obor Bioorganická chemie 2010 1. apište názvy anorganických sloučenin: (4 body) 4 BaCr 4 kyselina peroxodusičná



ZOBRAZOVÁNÍ ROVINNÝM ZRCADLEM ZOBRAZOVÁNÍ ROVINNÝM ZRCADLEM Pozorně se podívejte na obrázky. Kterou rukou si nevěsta maluje rty? Na které straně cesty je automobil ve zpětném zrcátku? Zrcadla jsou vyleštěné, zpravidla kovové plochy


Školní mikroskop CX31. Návod k obsluze

Školní mikroskop CX31. Návod k obsluze Školní mikroskop CX31 Návod k obsluze CZ Důležité informace Bezpečnostní upozornění 1. Před výměnou žárovky vždy přepněte hlavní vypínač mikroskopu (1) do polohy (vypnuto) a odpojte sí ovou šňůru ze zásuvky



MOLEKULÁRNÍ ZÁKLADY DĚDIČNOSTI Maturitní téma č. 33 MOLEKULÁRNÍ ZÁKLADY DĚDIČNOSTI NUKLEOVÉ KYSELINY - jsou to makromolekuly tvořené řetězci vzájemně spojených nukleotidů. Molekula nukleotidu sestává z : - pětiuhlíkatého monosacharidu


Fyzika_7_zápis_7.notebook April 28, 2015

Fyzika_7_zápis_7.notebook April 28, 2015 OPTICKÉ PŘÍSTROJE 1) Optické přístroje se využívají zejména k pozorování: velmi malých těles velmi vzdálených těles 2) Optické přístroje dělíme na: a) subjektivní: obraz je zaznamenáván okem např. lupa,



ANALYTICKÝ PRŮZKUM / 1 CHEMICKÉ ANALÝZY ZLATÝCH A STŘÍBRNÝCH KELTSKÝCH MINCÍ Z BRATISLAVSKÉHO HRADU METODOU SEM-EDX. ZPRACOVAL Martin Hložek / 1 ZPRACOVAL Martin Hložek TMB MCK, 2011 ZADAVATEL PhDr. Margaréta Musilová Mestský ústav ochrany pamiatok Uršulínska 9 811 01 Bratislava OBSAH Úvod Skanovací elektronová mikroskopie (SEM) Energiově-disperzní


Střední škola gastronomie, hotelnictví a lesnictví Bzenec náměstí Svobody 318. Profilová část maturitní zkoušky

Střední škola gastronomie, hotelnictví a lesnictví Bzenec náměstí Svobody 318. Profilová část maturitní zkoušky Střední škola gastronomie, hotelnictví a lesnictví Bzenec náměstí Svobody 318 Obor: 29 42 M / 01 Analýza potravin Období: jarní 2015 Profilová část maturitní zkoušky 1. Povinná volitelná zkouška Předmět:



VY_32_INOVACE_06_UŽITÍ ČOČEK_28 VY_32_INOVACE_06_UŽITÍ ČOČEK_28 Autor: Mgr. Pavel Šavara Škola: Základní škola Slušovice, okres Zlín, příspěvková organizace Název projektu: Zkvalitnění ICT ve slušovské škole Anotace Materiál (DUM digitální


Elektronová mikroskopie SEM, TEM, AFM

Elektronová mikroskopie SEM, TEM, AFM Elektronová mikroskopie SEM, TEM, AFM Historie 1931 E. Ruska a M. Knoll sestrojili první elektronový prozařovací mikroskop 1939 první vyrobený elektronový mikroskop firma Siemens rozlišení 10 nm 1965 první


h n i s k o v v z d á l e n o s t s p o j n ý c h č o č e k

h n i s k o v v z d á l e n o s t s p o j n ý c h č o č e k h n i s k o v v z d á l e n o s t s p o j n ý c h č o č e k Ú k o l : P o t ř e b : Změřit ohniskové vzdálenosti spojných čoček různými metodami. Viz seznam v deskách u úloh na pracovním stole. Obecná


Složky potravy a vitamíny

Složky potravy a vitamíny Složky potravy a vitamíny Potrava musí být pestrá a vyvážená. Měla by obsahovat: základní živiny cukry (60%), tuky (25%) a bílkoviny (15%) vodu, minerální látky, vitaminy. Metabolismus: souhrn chemických


Střední škola gastronomie, hotelnictví a lesnictví Bzenec, náměstí Svobody 318. Profilová část maturitní zkoušky

Střední škola gastronomie, hotelnictví a lesnictví Bzenec, náměstí Svobody 318. Profilová část maturitní zkoušky Střední škola gastronomie, hotelnictví a lesnictví Bzenec, náměstí Svobody 318 Obor: 29 42 M / 01 Analýza potravin Třída: AN4A Období: jaro 2013 Profilová část maturitní zkoušky 1. Povinná volitelná zkouška


Biochemie Ch52 volitelný předmět pro 4. ročník

Biochemie Ch52 volitelný předmět pro 4. ročník Biochemie Ch52 volitelný předmět pro 4. ročník Charakteristika vyučovacího předmětu Vyučovací předmět vychází ze vzdělávací oblasti Člověk a příroda, vzdělávacího oboru Chemie. Mezipředmětové přesahy a


Diagnostika amyloidózy z pohledu patologa Látalová P., Flodr P., Tichý M.

Diagnostika amyloidózy z pohledu patologa Látalová P., Flodr P., Tichý M. Diagnostika amyloidózy z pohledu patologa Látalová P., Flodr P., Tichý M. Ústav klinické a molekulární patologie LF UP a FN Olomouc Úvodem -vzácná jednotka i pro patologa Statistika Ústavu klinické a


Fyzika aplikovaná v geodézii

Fyzika aplikovaná v geodézii Průmyslová střední škola Letohrad Vladimír Stránský Fyzika aplikovaná v geodézii 1 2014 Tento projekt je realizovaný v rámci OP VK a je financovaný ze Strukturálních fondů EU (ESF) a ze státního rozpočtu


Didaktické testy z biochemie 2

Didaktické testy z biochemie 2 Didaktické testy z biochemie 2 Metabolismus Milada Roštejnská Helena Klímová br. 1. Schéma metabolismu Zažívací trubice Sacharidy Bílkoviny Lipidy Ukládány jako glykogen v játrech Ukládány Ukládány jako


Molekulová spektroskopie 1. Chemická vazba, UV/VIS

Molekulová spektroskopie 1. Chemická vazba, UV/VIS Molekulová spektroskopie 1 Chemická vazba, UV/VIS 1 Chemická vazba Silová interakce mezi dvěma atomy. Chemické vazby jsou soudržné síly působící mezi jednotlivými atomy nebo ionty v molekulách. Chemická


Výstraha: Příručka je určena pro stereoskopické mikroskopy s transfokátorem SZ4045TR, SZ6045TR asz1145tr. Doporučujeme Vám si příručku důkladně

Výstraha: Příručka je určena pro stereoskopické mikroskopy s transfokátorem SZ4045TR, SZ6045TR asz1145tr. Doporučujeme Vám si příručku důkladně Výstraha: Příručka je určena pro stereoskopické mikroskopy s transfokátorem SZ4045TR, SZ6045TR asz1145tr. Doporučujeme Vám si příručku důkladně prostudovat, abyste dokázali plně využít schopností přístroje.


Sešit pro laboratorní práci z chemie

Sešit pro laboratorní práci z chemie Sešit pro laboratorní práci z chemie téma: Reakce aminokyselin a bílkovin autor: MVDr. Alexandra Gajová vytvořeno při realizaci projektu: Inovace školního vzdělávacího programu biologie a chemie registrační


Základní metody světelné mikroskopie

Základní metody světelné mikroskopie Základní metody světelné mikroskopie Brno 2004 2 Předmluva Předkládáme Vám pomocný text o světelných mikroskopech, abychom Vám umožnili alespoň částečně proniknout do tajů, kterými je obestřena funkce


2 v 1 úlohy experimentální i teoretické

2 v 1 úlohy experimentální i teoretické 2 v 1 úlohy experimentální i teoretické VOJTĚCH ŢÁK Matematicko-fyzikální fakulta UK, Praha Abstrakt V tomto příspěvku jsou uvedeny tři úlohy, které je moţné v rámci středoškolské fyziky řešit jak experimentálně,


8 Mikroskopické metody studia struktury a ultrastruktury

8 Mikroskopické metody studia struktury a ultrastruktury 8. Mikroskopické metody 1/9 8 Mikroskopické metody studia struktury a ultrastruktury buněk struktura buňky struktura cytoplazmy cytoskelet imunofluorescenční mikroskopie, fázový kontrast, interferenční



METABOLISMUS SACHARIDŮ METABOLISMUS SAHARIDŮ A. Odbourávání sacharidů - nejdůležitější zdroj energie pro heterotrofy - oxidací sacharidů až na. získávají aerobní organismy energii ve formě. - úplná oxidace glukosy: složitý proces


CHEMIE. Pracovní list č. 10 - žákovská verze Téma: Bílkoviny. Mgr. Lenka Horutová

CHEMIE. Pracovní list č. 10 - žákovská verze Téma: Bílkoviny. Mgr. Lenka Horutová CHEMIE Pracovní list č. 10 - žákovská verze Téma: Bílkoviny Lektor: Mgr. Lenka Horutová Projekt: Student a konkurenceschopnost Reg. číslo: CZ.1.07/1.1.07/03.0075 Teorie: Název proteiny


2. Určete frakční objem dendritických částic v eutektické slitině Mg-Cu-Zn. Použijte specializované programové vybavení pro obrazovou analýzu.

2. Určete frakční objem dendritických částic v eutektické slitině Mg-Cu-Zn. Použijte specializované programové vybavení pro obrazovou analýzu. 1 Pracovní úkoly 1. Změřte střední velikost zrna připraveného výbrusu polykrystalického vzorku. K vyhodnocení snímku ze skenovacího elektronového mikroskopu použijte kruhovou metodu. 2. Určete frakční


Gymnázium Vysoké Mýto nám. Vaňorného 163, 566 01 Vysoké Mýto

Gymnázium Vysoké Mýto nám. Vaňorného 163, 566 01 Vysoké Mýto Gymnázium Vysoké Mýto nám. Vaňorného 163, 566 01 Vysoké Mýto SUBSTITUČNÍ DERIVÁTY KARBOXYLOVÝCH O KYSELIN R C O X karboxylových kyselin - substituce na vedlejším uhlovodíkovém řetězci aminokyseliny - hydroxykyseliny


Metody využívající rentgenové záření. Rentgenovo záření. Vznik rentgenova záření. Metody využívající RTG záření

Metody využívající rentgenové záření. Rentgenovo záření. Vznik rentgenova záření. Metody využívající RTG záření Metody využívající rentgenové záření Rentgenovo záření Rentgenografie, RTG prášková difrakce 1 2 Rentgenovo záření Vznik rentgenova záření X-Ray Elektromagnetické záření Ionizující záření 10 nm 1 pm Využívá


1.1 Zobrazovací metody v optické mikroskopii

1.1 Zobrazovací metody v optické mikroskopii 1 1.1 Zobrazovací metody v optické mikroskopii 1.1.1 Světlé pole Původní metoda optické mikroskopie. Světelný kužel prochází (v procházejícím světle) nebo se odráží (v odrážejícím světle) a vstupuje do



ROSTLINNÁ FYZIOLOGIE OSMOTICKÉ JEVY Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


Návod k měření na modernizovaném dílenském mikroskopu Zeiss

Návod k měření na modernizovaném dílenském mikroskopu Zeiss Návod k měření na modernizovaném dílenském mikroskopu Zeiss Dílenský mikroskop je v různém provedení jedním z důležitých přístrojů pro měření v kontrolních laboratořích. Je to velmi univerzální přístroj


- nejdůležitější zdroj E biologická oxidace (= štěpení cukrů, mastných kyselin a aminokyselin za spotřebování kyslíku)

- nejdůležitější zdroj E biologická oxidace (= štěpení cukrů, mastných kyselin a aminokyselin za spotřebování kyslíku) / přeměna látek spočívá v těchto dějích: 1. z jednoduchých látek - látky tělu vlastní vznik stavebních součástí buněk a tkání 2. vytváření látek biologického významu hormony, enzymy, krevní barvivo. 3.


Inovovaný školní vzdělávací program chemie

Inovovaný školní vzdělávací program chemie Inovovaný školní vzdělávací program chemie Příloha ŠVP Arcibiskupského gymnázia v Kroměříži 79 41 K/41 s číslem jednacím 1/2009 ŠVP a názvem Tradice a prosperita. ŠVP je platné pro Arcibiskupské gymnázium


Eva Benešová. Dýchací řetězec

Eva Benešová. Dýchací řetězec Eva Benešová Dýchací řetězec Dýchací řetězec Během oxidace látek vstupujících do různých metabolických cyklů (glykolýza, CC, beta-oxidace MK) vznikají NADH a FADH 2, které následně vstupují do DŘ. V DŘ


Optické přístroje. Oko

Optické přístroje. Oko Optické přístroje Oko Oko je orgán živočichů reagující na světlo. Obratlovci a hlavonožci mají jednoduché oči, členovci, kteří mají menší rozměry a jednoduché oko by trpělo difrakčními jevy, mají složené



STEREOSKOPICKÝ MIKROSKOP SMZ645 / SMZ660 NÁVOD K POUŽITÍ STEREOSKOPICKÝ MIKROSKOP SMZ645 / SMZ660 NÁVOD K POUŽITÍ Děkujeme Vám, že jste si zakoupili výrobek firmy Nikon. Tento návod k použití je napsán pro uživatele stereoskopických mikroskopů značky Nikon.


Bílkoviny a nukleové kyseliny

Bílkoviny a nukleové kyseliny Na zaslal(a): Nemám - Samanta - BÍLKOVINY: Bílkoviny a nukleové kyseliny - Bílkoviny, odborně proteiny, patří mezi biopolymery. Jedná se o vysokomolekulární přírodní látky složené



NERO. ZPOŤ SE! MÁKNI! DOBIJ SE! Pot je dobrý. Pot je společníkem dříčů, pro které není první krůpěj důvodem přestat, ale důkazem, že jsme ze sebe něco vydali a blahodárným povzbuzením. Povzbuzením, jenž se stalo tělesnou rozkoší, která


1.03 Důkaz tuků ve stravě. Projekt Trojlístek

1.03 Důkaz tuků ve stravě. Projekt Trojlístek 1. Chemie a společnost 1.03 Důkaz tuků ve stravě. Projekt úroveň 1 2 3 1. Předmět výuky Metodika je určena pro vzdělávací obsah vzdělávacího předmětu Chemie. Chemie 2. Cílová skupina Metodika je určena


Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený


Výuka genetiky na Přírodovědecké fakultě MU

Výuka genetiky na Přírodovědecké fakultě MU MASARYKOVA UNIVERZITA Přírodovědecká fakulta Výuka genetiky na Přírodovědecké fakultě MU Jiří Doškař Ústav experimentální biologie, Oddělení genetiky a molekulární biologie 1 V akademickém roce 1964/1965


~ II 1. Souprava pro pokusy z :I optiky opliky. Pavel Kflž, Křfž, František Špulák, Katedra fyziky, PF fu JU České Budějovice

~ II 1. Souprava pro pokusy z :I optiky opliky. Pavel Kflž, Křfž, František Špulák, Katedra fyziky, PF fu JU České Budějovice Veletrh nápadů učitelů fyziky Souprava pro pokusy z : optiky opliky Pavel Kflž, Křfž, František Špulák, Katedra fyziky, PF fu JU České Budějovice Seznam součástí číslo kusů název obr.č. 1 1 kyveta 1 2


Název: Vlastnosti oka, porovnání s fotoaparátem

Název: Vlastnosti oka, porovnání s fotoaparátem Název: Vlastnosti oka, porovnání s fotoaparátem Autor: Mgr. Petr Majer Název školy: Gymnázium Jana Nerudy, škola hl. města Prahy Předmět (mezipředmětové vztahy) : Fyzika (Biologie) Tematický celek: Optika


Didaktické testy z biochemie 1

Didaktické testy z biochemie 1 Didaktické testy z biochemie 1 Trávení Milada Roštejnská elena Klímová Trávení br. 1. Trávicí soustava Rubrika A Z pěti možných odpovědí (alternativ) vyberte tu nejsprávnější. A B D E 1 Mezi monosacharidy
