AKTUÁLNÍ POZNATKY V PĚSTOVÁNÍ, ŠLECHTĚNÍ, OCHRANĚ ROSTLIN A ZPRACOVÁNÍ PRODUKTŮ

Rozměr: px
Začít zobrazení ze stránky:

Download "AKTUÁLNÍ POZNATKY V PĚSTOVÁNÍ, ŠLECHTĚNÍ, OCHRANĚ ROSTLIN A ZPRACOVÁNÍ PRODUKTŮ"

Transkript

1 Výzkumný ústav pícninářský, spol. s r.o. Troubsko Zemědělský výzkum, spol. s r.o. Troubsko a Odbor rostlinolékařství ČAZV, Pícninářská komise ORV ČAZV a Agrární komora ČR AKTUÁLNÍ POZNATKY V PĚSTOVÁNÍ, ŠLECHTĚNÍ, OCHRANĚ ROSTLIN A ZPRACOVÁNÍ PRODUKTŮ Úroda 12/2012, vědecká příloha časopisu

2 Výzkumný ústav pícninářský, spol. s r.o. Troubsko Zemědělský výzkum, spol. s r.o. Troubsko a Odbor rostlinolékařství ČAZV, Pícninářská komise Odboru rostlinné výroby ČAZV, a Agrární komora ČR Aktuální poznatky v pěstování, šlechtění, ochraně rostlin a zpracování produktů Úroda 12/2012, vědecká příloha časopisu Editor: Ing. Barbora Badalíková Ing. Jaroslava Bartlová Organizační výbor: Ing. Barbora Badalíková - předseda Ing. Jaroslava Bartlová Ing. Pavel Kolařík Ing. Jaroslav Lang Ing. Karel Vejražka, Ph.D Mgr. Tomáš Vymyslický Vědecký výbor: RNDr. Jan Nedělník, Ph.D. - předseda Ing. Barbora Badalíková doc. Ing. Bohumír Cagaš, CSc. Ing. Jaroslav Čepl, CSc. RNDr. Jan Hofbauer, CSc. Ing. Miroslav Hochman Ing. Pavel Kolařík Ing. Slavoj Palík, CSc. Ing. Jan Pelikán, CSc Ing. Karel Vejražka, Ph.D. Příspěvky byly recenzovány členy vědeckého výboru Doporučná citace příspěvků: Autoři příspěvků: Název příspěvku. Úroda 12, 2012, vědecká příloha, s ISSN

3 OBSAH Nedělník J: Úvodní slovo... 9 Sekce "Šlechtění" Referáty Vejražka K., Pelikán J., Hofbauer J.: Je žádoucí šlechtění minoritních plodin? Urban, M. O., Klíma, M., Vítámvás, P., Kučera, V.: Aktuální mrazuvzdornost řepky olejky (LT 50 ) v závislosti na akumulaci dehydrinů Macháčková I., Ptáček V., Bučánková A.: Zkušenosti s využitím čmeláka zemního (Bombus terrestris L., Apidae) ve šlechtění ozimé řepky (Brassica napus L.) Řepková J., Simandlová J., Jakešová H., Nedělník J., Soldánová M., Hajšlová J., Schulzová V.: Vztah rodičovských genomů u mezidruhových hybridů Trifolium pratense x Trifolium medium Pavelek, M., Tejklová, E., Bjelková, M.: Nové směry ve šlechtění olejného lnu Kopecký P., Cenklová V., Dušek K.: Studium odolnosti vybraných genotypů tuřínu vůči nádorovitosti brukvovitých Sekce "Rostlinolékařství" Kolařík P., Rotrekl J.: Rezistence škodlivých organismů vůči pesticidům Bagar M., Psota V.: Alginure prostředek pro zvýšení odolnosti rostlin k houbovým chorobám a jeho využití proti původci strupovitosti jabloně (Venturia inaequalis) Hrudová E., Seidenglanz M., Kolařík P., Tóth P., Rotrekl J., Poslušná J.: Převládající druhy stonkových krytonosců na lokalitách Troubsko, Lednice a Šumperk Kamenová A., Bárta J., Bártová V.: Hodnocení vlivu odrůdových rozdílů termostabilních proteinů hlíz bramboru (Solanum tuberosum l.) na inhibici růstu vybraných druhů fytopatogenních hub Sekce "Technologie pěstování plodin a ekologie" Šarapatka B., Čáp L., Netopil P.: Vliv různých systémů zpracování půdy na půdní vlastnosti a životní prostředí Čížek M., Svobodová A., Čepl J.: Vliv hnojení a sponu výsadby na výnos nadzemní biomasy a hlíz topinamburu Haberle J., Svoboda P.: Distribuce kořenů plodin v půdním profilu a využitelná zásoba dusíku a vody Badalíková B.: Zlepšení půdních vlastností pomocí aplikace podpůrného přípravku Středová H., Středa T., Podhrázská J.: Větrná eroze na jižní Moravě potenciál, monitoring, účinnost biotechnických opatření Strašil Z.: Pěstování ozdobnice (Miscanthus x Giganteus) určené pro energetické využití Zemánek P., Burg P.: Možnosti využití technologií pro získání energetické štěpky z vinic. 103 Holubec V., Paprštein F., Řezníček V., Dušek K.: Krajové odrůdy rostlin jako kulturní dědictví národa

4 Sekce "Kvalita a zpracování produktů" Středa T., Hajzler M., Chloupek O.: Kořenový systém - skrytá polovina rostliny Burg P., Zemánek P.: Hodnocení účinnosti separačního zařízení pro separaci jader z Hroznů Erban V., Eichlerová E., Landfeld A., Čírtková V., Houška M.: Předpověď mikrobiologické kvality potravin pomocí modelování růstu patogenů - listerie Šottníková V., Kučerová J.: Vliv skladování na kvalitu brambor různých Sekce "Šlechtění" Postery Bláha L., Vyvadilová M., Urban M. O.: Vybrané znaky semen řepky ozimé ovlivňující růst, vývoj a výnos v podmínkách sucha Brabcová A., Bárta J., Bártová V., Horáčková V.: Genotypová variabilita lipidacylhydrolasové aktivity u patatinových bílkovin purifikovaných z hlíz vybraných druhů brambor Bradová J., Papoušková L., Faměra O., Dvořáček V., Dotlačil L.: Vztah mezi podjednotkami gluteninů a reologickou kvalitou genetických zdrojů pšenice Ehrenbergerová J., Jirsa O., Martinek P., Balounová M., Stehno Z., Pluháčková H., Laknerová I., Macháň, P.: Netradiční obilniny a možnosti jejich využití Havlíčková L., Jozová, E., Hejna O., Čurn V.: Využití molekularních markerů ve šlechtení F1 hybridních odrůd řepky (B. napus L.) Heřmanská A.1, Bláha L.: Velikost kořenového systému možné selekční kritérium pro suchovzdornost pšenice Jozová E., Havlíčková L., Čurn V., Kučera V., Klíma M., Vyvadilová M.: Využití molekulárních markerů pro hodnocení diverzity genetických zdrojů řepky (Brassica napus L.) Knotová D., Hutyrová H.: Stanovení podobností v české kolekci štírovníku růžkatého (Lotus corniculatus L.) Leišová-Svobodová L., Štočková L., Bradová J.: Variabilita HMW gluteninů pšenice Vaculová K., Kýhos K., Balounová M., Sedláčková I.: Vliv podmínek skladování na klíčivost a obsah živin v zrninách Sekce "Rostlinolékařství" Dostálová R., Ondřej M. a Ondráčková E.: Šlechtění hrachu na rezistenci ke komplexu viróz a antraknóz Cholastová T., Hujslová M.: Využití PCR metody při identifikaci houbových patogenů rodu Fusarium vyskytujících se na trvalých travních porostech Jílková B., Víchová J., Pokorný R., Vejražka K.: Klíčivost konidií Colletotrichum acutatum po aplikaci účinných látek vybraných fungicidů Jonášová K., Horák O.: Druhové spektrum plevelů v máku setém Kmoch M., Šafránková I., Pokorný R.: Vliv odrůdy, ošetření, lokality a ročníku na napadení obilek jarního ječmene patogeny rodu Fusarium Krejzar V., Pánková I., Kůdela V.: Relativní četnost původců černání stonku bramboru v České republice v roce

5 Neischl A., Winkler J., Klepáčková V., Zelená V.: Vliv předplodiny a zpracování půdy na diverzitu a druhové spektrum plevelů Pánková I., Krejzar V., Mertelík J., Kloudová K.: Potvrzený výskyt původce bleeding canker Plachká E., Macháčková I.: Vliv lokality na kontaminaci semen řepky olejky ozimé patogeny Alternaria brassicae, Alternaria brassicicola a Leptosphaeria maculans, Leptosphaeria biglobosa Poslušná J., Plachká E.: Odolnost vybraných genotypů ozimé řepky vůči houbovým patogenům testovaných v mezistaničních zkouškách výkonu v letech Psota V., Bagar M.: Využití metody matení samců proti nesytce jabloňové (Synanthedon myopaeformis) Sapáková E., Hasíková L., Hřivna L., Stavělíková H., Šefrová H.: Intenzita napadení různých odrůd česneku vlnovníkem Aceria tulipae (Keifer) (Acari: Eriophyidae) Sumíková T., Žabka M.: Identifikace původců fuzarióz klasu pomocí multiplex PCR Svoboda J.: Hodnocení odolnosti vybraných novošlechtění okurek nakládaček k viru žluté mozaiky cukety (ZYMV) Svoboda J., Leišová-Svobodová L.: Výskyt fytopatogenních virů na tykvovité zelenině pěstované v České republice Šmahel P., Kolaříková E.: Regulace plevelů u cizrny beraní a hrachoru setého Vrbovský V., Rychlá A., Endlová L.: Obsah glukosinolátů v zelených částech řepky a jejich vliv na vybrané škůdce Winkler J., Blažková H.: Druhové spektrum plevelů ozimých plodin v provozních podmínkách Žabka M., Pavela R., Sumíková T.: Skrining antifungálních vlastností vybraných rostlinných extraktů Sekce "Technologie pěstování plodin a ekologie" Badalíková B., Bartlová J.: Zamezení vodní eroze půdy při využití meziplodin Bartlová J.: Vliv úhorového hospodaření na vodostálost půdních agregátů Brtnický M., Kučerová J., Kynický J., Janzová A., Pokorný E.: Monitoring půdní respirace v CHKO Žďárské vrchy v letech Červinka J., Pospíšil J., Svoboda M.: Techniky zpracování půdy a její vliv na zhutnění Dědouchová M., Kubátová B., Cvrčková H., Máchová P., Vortelová L.: Hodnocení genetické variability autochotonních populací jilmu Frydrych J., Andert D., Gerndtová I., Volková P., Juchelková D., Raclavská H., Zajonc O.: Využití trav pro energetické účely Hakl, J., Šantrůček, J.: Dynamika růstu vojtěšky v první seči v závislosti na stáří porostu. 279 Huňady I., Hochman M., Pozdíšek J., Ponížil A.: Možnosti využití luskovino-obilních směsek ke zvýšení soběstačnosti v produkci krmiv v ekologickém zemědělství Jandák J., Mašíček T., Raus J.: Vliv pěstování kostřavy červené a jetelotravní směsi na nasycenou hydraulickou vodivost Knot P.: Vliv obalení osiva hnojivem na klíčivost a charakteristiky primárního kořene Knotová D.: Produkce osiva svazenky vratičolisté v podmínkách ekologického zemědělství Konvalina P., Moudrý J. jr., Capouchová I., Stehno Z., Suchý K., Moudrý J.: Suchovzdornost genetických zdrojů pšenice Koprna R., Dundálková L., Spíchal L., Strnad M., Svobodová I., Spáčilová V., Valenta R.: Aktuální výsledky aplikace cytokininových derivátů v jarním ječmeni

6 Kučerová J., Pokorný E., Brtnický M.: Sledování některých biologických vlastností u vybraných hlavních půdních jednotek černozemí Kurešová G., Raimanová I.: Růst obilek a ukládání dusíkatých látek v průběhu dozrávání zrna pšenice Lang, J.: Dynamika zastoupení travních komponentů u jetelovinotravních směsí na orné půdě Lošák M., Ševčíková M.: Vliv ošetřování na vývoj botanického složení extenzivních trávníků Madaras M., Mayerová M.: Rozdíly odrůd pšenice ozimé ve schopnosti čerpat draslík z půdních silikátových minerálů v raných stadiích růstu Macháč R., Smočková M., Both Z.: Možnosti pěstování jílku mnohokvětého jednoletého na semeno v režimu ekologického zemědělství Marada P., Valtýniová S., Verner F.: Hodnocení setrvalosti hospodaření na orné půdě Martinek J., Svobodová M., Králíčková T., Šantrůček J.: Vývin metlice trsnaté v trávníku 335 Mašíček T., Toman F., Jandák J., Šácha J.: Vliv trvalého travního porostu a orné půdy na rychlost vsaku vody do půdy Matějková Š., Vocetková M.: Bilance fosforu v půdě dlouhodobého stacionárního pokusu v Hněvčevsi Mühlbachová G., Káš M.: Vliv minerálního a organického hnojení na obsah živin v půdě a výnos pšenice ozimé Mühlbachová G.: Mikrobiální aktivity po aplikaci chelátů do dlouhodobě kontaminované půdy Pelikán J., Hutyrová H.: Možnosti pěstování žita svatojánského k výrobě osiva v ekologickém zemědělství Pospíšilová L., Formánek P., Drápelová I., Živna T.: Vliv aplikace kompostu na biologické parametry půdy Raab S.: Zhodnocení vybraných morfologických charakteristik některých druhů rodu Salvia L Raab S., Machač R.: Výroba osiva hořčice jarní v ekologickém zemědělství Raimanová, I., Kurešová, G.: Zhodnocení výživného stavu révy vinné ve vztahu k obsahu dostupných živin v půdě Sochorec M., Hejduk S.: Vliv rozdílného obhospodařovávání travních porostů na infiltrační schopnost Svoboda P.: Změny obsahu a forem minerálního dusíku v půdním profilu pod rozvezenými polními hnojišti Vach M., Hýsek J.: Nové poznatky o vlivu efektivních technologií zpracování půdy a biofungicidů na ozimou pšenici Vach M., Javůrek M.: Vliv zpracování půdy na omezení následků vodní eroze na půdě typu Cambisol Vlček V., Hybler V.: Změny půdních vlastností a poměrů některých biogenních prvků na erodované půdě na spraši případová studie Volková P., Šrámek P.: Vliv frekvence sečení a úrovně hnojení na výnosy a botanické složení trvalého travního porostu

7 Sekce "Kvalita a zpracování produktů" Cwiková O.: Mikrobiologická jakost luštěninových salátů Gabrovská D., Ouhrabková J., Rysová J., Holasová M., Fiedlerová V., Laknerová I., Winterová R., Pinkrová J., Eichlerová E., Erban V., Strohalm J., Němečková I.: Směsné zeleninové šťávy se zvýšeným obsahem bioaktivních látek Hartman I., Benešová K., Psota V., Sachambula L.: Vliv teploty a délky sladování na obsah vitaminu E ve sladu Hrušková M., Švec I.: Hodnocení retenční kapacity kompozitních směsí pšeničné a konopné mouky Hřivna L., Burešová I., Sapáková E.: Vztah mezi výnosem, kvalitou zrna ječmene a čerpáním N a S během vegetace Kučerová J., Šotníková V., Machková M.: Vliv vybraných surovin a přísad na kvalitu těstovin Laknerová I., Mašková E., Fiedlerová V., Holasová M., Gabrovská D., Winterová R., Ouhrabková J., Vaculová K., Martinek P.: Pekařské výrobky s přídavkem netradičních obilovin, obohacené kyselinou listovou Nedomová Š., Simeonovová J., Cwiková O., Buchar J.: Hodnocení vybraných jakostních znaků těstovin Psota V., Sachambula L., Tvarůžek J.: Vybraná kritéria kvality ječmene pro výrobu sladu. 435 Rysová J., Ouhrabková J.: Využití sojového pudru do pekařských výrobků Skala O., Střalková R., Pivec V.: Zastoupení oleje v semenech révy vinné

8 8

9 ÚVODNÍ SLOVO Předkládaná vědecká příloha časopisu Úroda, jako nedílná součást čísla 12/2012, je dle názoru editora jednou z efektivních možností, jak ukázat úspěšný transfer poznatků a nových technologií do praxe. Více než 110 příspěvků zahrnuje výsledky mnohých výzkumných projektů na široké disciplinární bázi. Využití genetických zdrojů rostlin pro šlechtění, aktuální změny v koncepci rostlinolékařské péče a její reflexe do českého prostředí, možnosti optimalizace pěstebních technologií polních plodin či aktuální pohled na kvalitu rostlinných produktů jsou některá z témat uvedených ve vědecké příloze. Editor spolu s autory doufá, že mnohé příspěvky si najdou svoje čtenáře a mnohé výsledky najdou další uplatnění v praxi.. Podpořit transfer technologií a spolupráci mezi výzkumnými ústavy a aplikačními partnery je jedním z hlavních cílů této přílohy. Vzhledem k počtu příspěvků byla zvolena po dohodě s vydavatelstvím Profi Press, s.r.o. a redakcí časopisu Úroda distribuce v elektronické formě. Všechny příspěvky byly recenzovány. Distribuce několika tisíc CD umožňuje širokému okruhu čtenářů udělat si obrázek o zaměření zemědělského aplikovaného výzkumu. Inovace a jejich aplikaci, nové výzkumné poznatky a efektivní transfer do zemědělské praxe jsou témata i nového programovacího období navazujícího na Program rozvoje venkova. Bez nových poznatků nebude možné udržovat konkurenceschopnost českého zemědělství a také by bylo obtížné udržovat a rozvíjet krajinné celky. Proto by zemědělský výzkum a šlechtění mělo do budoucna sehrávat ještě významnější roli než dosud. Motorem všech inovací musí ale být nutně zpětná vazba, všichni účastníci tvorby a zadávání výzkumných zakázek by se měli podílet i na formulování základních výzkumných směrů. Pokud do výzkumu jsou investovány veřejné zdroje musí být i zpětná kontrola jejich alokace. Věřím, že tato vědecká příloha k takovéto zpětné vazbě přispěje. Mnohé výsledky již také reflektují závěry Strategické výzkumné agendy, kterou zpracovala Česká technologická platforma rostlinných biotechnologií (www.rostlinyprobudoucnost.com), a které ukazují možné směry rozvoje geneticko-šlechtitelského výzkumu. Na tomto místě si dovoluji informovat čtenáře o projektu Podpora transferu inovací v zemědělství, potravinářství a oblasti bioenergií do praxe, který byl podpořen z OP Vzdělávání pro konkurenceschopnost a jehož hlavním cílem je vedle rozvoje lidského potenciálu také transferovat nové poznatky do praxe. V rámci projektu jsou pořádané semináře a odborné konference, na které tímto odbornou veřejnost zveme (www.inovacezvt.cz). Jan Nedělník 9

10 10

11 JE ŽÁDOUCÍ ŠLECHTĚNÍ MINORITNÍCH PLODIN? Is it desirable minor crop breeding? Vejražka K., Pelikán J., Hofbauer J. Zemědělský výzkum, spol. s r.o. Ttroubsko Šlechtění nových odrůd je ekonomicky i časově velmi náročnou záležitostí. Návratnost vložených investic je přímo závislá na uplatnění na pěstebních plochách a době životnosti dané odrůdy. Rozsah pěstování určité odrůdy je výrazně limitován celkovou výměrou dané plodiny. Na základě tohoto faktu je vhodné si určitým způsobem plodiny modelově rozdělit. V podmínkách ČR si dovolíme rozdělit plodiny na dvě skupiny. Mezi velkoobjemové zařadíme pšenici ozimou, ječmen, kukuřici a řepku ozimou. Ostatní plodiny, i když plochy pěstování kolísají od jednotek do tisíců (50) hektarů, zařadíme do maloobjemových. Pro cukrovku, brambory, hrách i další plodiny je toto označení z historického hlediska téměř nepatřičné, ale poměrně dobře vystihuje současnou realitu v České republice. Situace s velkoobjemovými plodinami U tzv. velkoobjemových plodin (pšenice, ječmen, kukuřice, řepka) se výměry jen v ČR pohybují v stovkách tisíc hektarů (Tab. 1). Významné je i uplatnění těchto odrůd na zahraničních trzích s podobnými podmínkami pro pěstování. V případě uchycení odrůdy na zahraničním trhu je šance na návratnost vložených investic poměrně reálná. Tato skutečnost je patrná z počtu/výměr zahraničních odrůd, které jsou v ČR pěstovány. Pěstování takových odrůd sebou nese výhody a nevýhody, avšak v delším časovém období převažují spíše výhody. Dokladem toho je např. nižší mrazuvzdornost zahraničních odrůd pšenice, která cca 1x za 7 let způsobí problémy části zemědělců, avšak zemědělci u těchto odrůd, s výkyvem v následujícím roce, zpravidla zůstávají. Druhým faktorem je délka životnosti odrůdy na trhu. V oblasti velkoobjemových plodin je na trhu velké množství odrůd, které si vzájemně silně konkurují. V roce 2011 bylo v ČR přihlášeno na množení osiv více než 50 odrůd pšenice a více než 20 odrůd ozimého ječmene (Horáková a kol. 2012). Je však třeba zdůraznit, že poměry ploch jednotlivých odrůd můžou být výrazně rozdílné. Množství odrůd lze demonstrovat i na počtu 332, v ČR registrovaných, hybridů kukuřice v roce 2011 (Povolný, Vacek 2011). S ohledem na volný trh Evropské unie do hry navíc mohou vstupovat veškeré odrůdy z Evropského katalogu odrůd. Při takové konkurenci pak není problém najít odrůdy, které z trhu vypadávají po 3-4 letech pěstování. Dochází tak k poměrně výrazné obměně pěstovaných odrůd. U kvalitních odrůd výrazně roste podíl farmářských osiv. Situace s maloobjemovými plodinami U maloobjemových plodin se výměry v ČR pohybují v rozmezí jednotek hektarů až po desítky tisíc hektarů u brambor (cca 23), jetele lučního (45), máku (51) a cukrovky (56). V počtu odrůd lze mezi jednotlivými plodinami nalézt výrazné rozdíly na trhu. U cukrovky a bramboru je registrováno či v registracích přes 150 odrůd, jetel luční (58), u máku pak jen 21, u hořčice bílé 9 a u svazenky 8 odrůd. U dalších plodin je v ČR registrována třeba jen jedna odrůda, např. jetel alexandrijský, vičenec, lesknice, saflor, úročník, čičorka, tomka, komonice (ÚKZÚZ 2012). U cukrovky a bramboru je na takové množství odrůd moc malá pěstební plocha a lze pochybovat o návratnosti v případě, že se odrůdy neuplatní na zahraničních trzích. U cukrovky tato skutečnost přispěla k zániku českého šlechtění a probíhá jen jako součást nadnárodního programu. Většina maloobjemových druhů/odrůd je charakteristická tím, že má, v poměru, k ostatním malé plochy pěstování a malou nebo nulovou konkurenci v podobě jiných odrůd stejného druhu. Podíl farmářských osiv je obecně poměrně nízký. 11

12 Výhody a nevýhody Mezi výhody velkoobjemových plodin je jejich snadné uplatnění produkce na trhu (tradiční využití) a velmi dobře propracované technologie pěstování, které nevyžadují nadstavbové vybavení. Mezi nevýhody velkoobjemových plodin patří jednostranné zatížení/zaměření (jen obilniny a brukvovité) a nízká pestrost ekosystému, o který by měl zemědělec také pečovat. Mezi výhody maloobjemových plodin patří bezproblémový odbyt za nadstandardní ceny z jednotky plochy, pokud je dopředu kontraktován a je dodržena kvalita produkce. Jsou ve většině případů přerušovače obilných (širokolisté, hluboko kořenící, dvouděložné) a brukvovitých sledů plodin. Působí příznivě na strukturní vlastnosti půdy. Skupina druhů z čeledi vikvovité zvyšuje rentabilitu díky fixaci vzdušného dusíku. Mezi hlavní nevýhody patří méně propracované technologie (minimum registrovaných přípravků na OR), problematické časování termínu sklizně, a v některých případech potřeba dnes již specifických strojů. V podnicích bez živočišné výroby mohou způsobovat problémy první seče, které se u vybraných pícnin provádějí. Poslední nevýhodou je čas naučit se pěstování maloobjemových plodin, včetně osivářských porostů, není na jeden rok a vyžaduje trpělivost. Osevní postupy v České republice prochází poměrně viditelnou změnou, což dokladuje tabulka č. 1. Tato změna je charakteristická zjednodušováním, koncentrací plodin v osevním postupu a silnou orientací na okamžitý zisk. Není výjimkou najít osevní postupy typu ozimá řepka, ozimá pšenice, kukuřice, někdy i jarní ječmen s absencí organického hnojení a případným odvozem slámy do spaloven. Lze si představit, co se děje s úrodností těchto pozemků a je chybou vlastníků, že něco podobného dopustí. Přesto i za takového stavu mají maloobjemové plodiny své malé místo na polích a je po nich poptávka. Tato poptávka je z velké části tvořena i nastavením jednotlivých dotačních titulů, u nichž se připravuje výrazná změna právě ve prospěch maloobjemových plodin jako komponent do směsí. Již v současné době je takových komponent na trhu nedostatek a jejich cena stoupá. Ukázka odbytu osiv maloobjemových plodin z Troubska Pro demonstraci prodejů osiv maloobjemových plodin jsme vybrali období let a druhy a odrůdy, které jsou ve vlastnictví Výzkumného ústav pícninářského s.r.o. a Zemědělského výzkumu s.r.o. Troubsko. V tabulce č. 2 je pro jednotlivé odrůdy uvedeno množství produkce a množství exportu osiv z Troubska v kategorii C, resp. v kvalitě odpovídající této kategorii. V tabulce nejsou zahrnuta množství osiv vyšších stupňů množení (SE, E) ani osiva vyprodukována v rámci licenčního množení jinými subjekty. Při znalosti realizačních cen osiv vyjmenovaných druhů a průměrném kurzu 25 Kč/Euro lze spočítat, že průměrný roční export tvořil obrat přes 1 milion Kč. Závěr Při zohlednění nákladů na šlechtění maloobjemových plodin, délku životnosti odrůdy a nízké úrovni farmářských osiv je pravděpodobnost návratnosti vložených investic poměrně vysoká. Tyto plodiny tak představují pro ty pěstitele/množitele, kteří chtějí ještě dělat poctivé zemědělství, finančně zajímavou činnost, jistotu odbytu a jistou míru stavovské elity. Dělat dobře osiva, a navíc maloobjemových plodin, totiž umí jen opravdová špička v oboru. 12

13 Tab. 1 Vývoj osevních ploch zemědělských plodin upraveno dle Českého statistického úřadu (v ha) Plodina Crop Obiloviny celkem Cereals, total pšenice Wheat žito Rye ječmen Barley oves Oats triticale Triticale kukuřice na zrno Grain maize ostatní obiloviny Other cereals Luskoviny celkem Pulses, total hrách setý Peas ostatní luskoviny Other pulses Okopaniny celkem Root crops, total brambory rané 1) Early potatoes 1) brambory ostatní 2) Other potatoes 2) brambory sadbové Seed potatoes cukrovka technická Industrial beet krmná řepa Forage beet ostatní okopaniny Other root crops Technické plodiny celkem Industrial total řepka Rape slunečnice na semeno Sunflower for seed soja Soya mák Poppy hořčice na semeno Mustard for seed len setý olejný Oil flax ostatní olejniny Other crops len setý přadný Fibre flax kořeninové rostliny Spice plants léčivé rostliny Medicinal plants ostatní technické plodiny Other crops sugar crops, oleaginous industrial Pícniny na orné půdě celkem Arable fodder crops kukuřice na zeleno a na siláž ostatní jednoleté pícniny 3) Green and silage maize Other annual fodder crops 3) jetel červený 3) Red clover 3) vojtěška 3) Lucerne 3) ostatní víceleté pícniny 3) Zelenina konzumní celkem Květiny a okrasné rostliny Other perennial fodder crops 3) Market total vegetables, Flowers and ornamental plants 13

14 Tab. 2 Výroba a export osiv vybraných druhů maloobjemových plodin za období (v tunách) druh výroba export Čičorka pestrá Sléz přeslenitý Světlice barvířská 15 8 Žito lesní Lesknice kanárská 37 3,3 Komonice bílá 4,7 2,6 Tolice dětelová 5 4,3 Pozn. Nezahrnuje osiva vyšších stupňů ani osiva vyprodukovaná dalšími subjekty v rámci licenčních množení. Dedikace Příspěvek byl zpracován za institucionální podpory na dlouhodobý koncepční rozvoj výzkumné organizace. Použitá literatura Horáková V., Dvořáčková O., Mezlík T. 2012: Seznam doporučených odrůd 2012, Pšenice ozimá, ječmen jarní, ječmen ozimý, triticale ozimé, oves setý (pluchatý), hrách polní. 1. vyd., Brno, Gill s.r.o., 203 s., ISBN Povolný M., Vacek E. 2011: Přehled odrůd 2011, Kukuřice. 1. vyd., Brno, Gill s.r.o., 82 s., ISBN ÚKZÚZ, 2012: Databáze odrůd na internetu. cit Kontaktní adresa: Ing. Karel Vejražka, Ph.D. Zemědělský výzkum, spol. s r.o. Zahradní 1, Troubsko 14

15 AKTUÁLNÍ MRAZUVZDORNOST ŘEPKY OLEJKY (LT 50 ) V ZÁVISLOSTI NA AKUMULACI DEHYDRINŮ Frost tolerance (LT 50 ) according to dehydrins accumulation Urban, M. O. 1 ; Klíma, M. 2 ; Vítámvás, P. 2 ; Kučera, V. 2 1 PřF UK, Praha 2 2 Výzkumný ústav rostlinné výroby, v. v. i., Praha 6-Ruzyně Abstrakt Cílem této studie bylo ověřit, zda existuje vztah mezi stupněm mrazuvzdornosti, zjištěným pomocí tzv. terčíkové metody, a akumulací specifických proteinů (dehydrinů; DHN) otuženými listy tří vybraných odrůd ozimé řepky olejky. Úroveň akumulace jak součtu všech vizualizovaných dehydrinů, tak i vybraných dehydrinů (DHN 45 a 47 kd) byla u sledovaných odrůd přímo úměrná aktuální mrazuvzdornosti (stanovené pomocí LT 50 ) těchto odrůd. Předběžné výsledky u třech odrůd naznačují, že akumulaci dehydrinů by bylo možné využít jako potenciální marker mrazové odolnosti i u širšího spektra genotypů ozimé řepky. Klíčová slova: řepka olejka ozimá, dehydrin, mrazová odolnost, proteinové markery, aklimace Abstract The aim of this study was to determine whether there is a relationship between the degree of frost tolerance, identified by the leaf spot method, and the accumulation of specific proteins (dehydrins; DHN) in hardened leaves of three selected genotypes of winter oilseed rape. The level of accumulation of the sum of visualized dehydrins, as well as selected dehydrins (DHN 45 and 47 kd) was observed in genotypes proportional to the actual frost resistance (determined by LT 50 ) of these genotypes. Preliminary results in three genotypes suggest that accumulation of dehydrins could be used as a potential marker of frost resistance in a wider range of genotypes of winter oilseed rape. Keywords: winter oilseed rape, dehydrins, frost tolerance, protein marker, acclimation Úvod Spolehlivost stanovení mrazové odolnosti šlechtitelských materiálů ozimé řepky a dalších plodin v polních podmínkách na základě stupně přezimování závisí na průběhu zimy, který je pro každý rok specifický, s účastí řady faktorů různého účinku a délky trvání. Proto je snaha do šlechtitelského procesu zavést relevantnější metody stanovení mrazuvzdornosti. Jako perspektivní se ukazuje sledování akumulace specifických proteinů dehydrinů (DHN) v pletivech rostlin během procesu otužování. Akumulace výše zmíněných proteinů v souvislosti s působením abiotických stresorů (sucho, chlad) je na základě mnoha studií považována za jeden z významných genotypově podmíněných znaků, přispívajících k odolnosti rostlinných buněk vůči ztrátě vody (dehydrataci). Dehydriny tvoří samostatnou skupinu v rámci velké rodiny LEA proteinů (tzv. LEA II nebo LEA-D11 proteiny). Zatímco jejich chemická podstata je již známa, úloha těchto proteinů při stresové zátěži není ještě zcela prozkoumána. DHN se vyskytují u všech vyšších rostlin zejména v povrchových parenchymatických (nebo s povrchem blízce sousedících) pletivech 1a. Tato pletiva jsou většinou jako první vystavena dehydrataci. Schopnost dehydrinů vázat molekuly vody a schopnost interakce s povrchem membrán nebo s dalšími proteiny zabraňuje nadměrným ztrátám vody z buněk takto exponovaných pletiv. DHN také chrání enzymy před chladovými změnami skupenství vody (např. WCS120 u pšenice; 2 ). Navíc jsou DHN schopny neutralizovat reaktivní formy kyslíku a jeho radikály 1a. Díky těmto vlastnostem jsou DHN považovány za významnou skupinu stresově indukovatelných proteinů. Sledování jejich expresních profilů (množství transkriptů DHN v buňkách, pletivech) umožňuje jejich využití 15

16 jako fyziologických markerů odolnosti u některých plodin, případně na základě jejich akumulace v pletivech lze hodnotit hladinu stresové odpovědi. K těmto účelům může sloužit: 1) alelická variabilita DHN sekvencí - různé alely ve výsledku podmiňují odlišnou citlivost či odolnost daného genotypu (např. u vikve; 1b ). Tyto rozdíly v genomu mohou sloužit jako markery při dehydrataci u velmi podobných genotypů. Aby se tyto markery daly využít při šlechtění nových odrůd, kdy jsou na základě exprese těchto kandidátních genů vybírány rodičovské komponenty, musíme znát funkční projevy rozdílných alel. 2) kvantitativní exprese mrna pro DHN (množství mrna a následně translatovaných funkčních DHN proteinů v buňkách). U některých dehydrinů bylo zjištěno, že kvantitativní míra jejich exprese koreluje s mírou stresové tolerance daného genotypu (např. mrazuvzdorností). Výsledky 2 ukázaly, že protein WCS120 je natolik citlivý, že lze na základě míry jeho akumulace rozlišit i dva ozimy s různou úrovní mrazuvzdornosti. Podobně jsou některé specifické mrna pro DHN již využívány jako markery adaptace po působení sucha 3. Tyto změny expresního profilu jsou u chladového stresu spojovány i se změnami a senzory turgorové části vodního potenciálu buněk 4; 5. Cílem této studie bylo ověřit, zda existuje vztah mezi stupněm mrazuvzdornosti, zjištěným pomocí tzv. terčíkové metody, a akumulací specifických proteinů (DHN) otuženými listy tří vybraných odrůd ozimé řepky. Materiál a Metody Rostliny tří kontrastních odrůd ozimé řepky (Brassica napus L.) cv. Benefit, Californium a Navajo byly pěstovány v řízených podmínkách (20/15±1 C den/noc, fotoperioda 12 h, světelná intenzita 400 µmol/m 2 /s) po dobu 4 týdnů, tj. do stádia čtvrtého listu (BBCH 14). Rostliny byly poté otužovány při teplotě 4±1 C, při zachování světelné intenzity a fotoperiody, po dobu 4 týdnů. Rostliny byly přihnojovány roztokem vícesložkového hnojiva (Vegaflor) jednou za dva týdny. Vzorky nejmladšího plně vyvinutého listu byly odebírány těsně před začátkem otužení (den 0) a vzorky listů v růstové fázi BBCH (5. 6. pravý list) na konci chladového působení (den 28) v pěti technických a dvou biologických opakováních. Aktuální mrazuvzdornost otužených rostlin byla stanovena na konci chladové periody (den 28), a to dvakrát u každé odrůdy pomocí metody mrazově podmíněného výtoku elektrolytů z terčíků u nejmladších plně vyvinutých listů v rozmezí teplot -3 až -30 C (tzv. přímý mrazový test; 6 ) Výsledky konduktometrického stanovení byly zpracovány programem pro výpočet LT 50 (lethal temperature; 7 ). Extrakce termostabilních proteinů ze vzorků otužených listů, SDS-PAGE a následná hybridizace rozdělených proteinů s antidehydrin protilátkou na PVDF membráně proběhla dle 2. Koncentrace vzorku ve vzorkovém pufru byla zvýšena 25 oproti postupu, uvedenému v 2. Kvantitativní analýza vizualizovaných dehydrinů programem Quantity One (Bio-Rad) následovala po naskenování membrány kalibrovaným densitometrem (CO). Jednofaktorová ANOVA a rozdíly mezi průměry podle Fisherova testu (LSD) byly vypočítány statistickým programem Statistica 10.0 (StatSoft, Tulsa, OK, USA). Výsledky a diskuze Akumulaci dehydrinů u všech sledovaných odrůd znázorňuje obr. 1. U odrůd Navajo a Californium bylo zjištěno pět dehydrinů s rozdílnou molekulovou hmotností (35, 37, 45, 47 a 91 kd). Ve srovnání s obilninami viz 2, pěstovanými ve stejných podmínkách, bylo celkové množství DHN v proteinové frakci rozpustné po varu cca 100 menší (tj. jedná se zhruba o množství, které lze detekovat v listech pšenice ozimé, pěstované při 20 C). Tato nízká akumulace DHN u odrůd řepky pravděpodobně souvisí s obecně nižší mrazuvzdorností ozimé řepky oproti ozimým obilninám. Protože schopnost rostlin odolávat mrazu je založena polygenně (nezávisí tedy jen na akumulaci DHN), tak mrazuvzdornost řepky není 100 nižší 16

17 (např. odrůda řepky Navajo = -14 C, pšenice Mironovská 808 = -21 C 2 ). Další produkty signálních a metabolických drah, kterými řepka odpovídá na chladový stres, mohou být naopak výrazně navýšené, než je tomu u obilnin. V souladu s uvedenými výsledky byla celková akumulace DHN u odrůdy Benefit (nejméně odolná odrůda, viz graf 1 a 2) statisticky významně nižší než u ostatních odrůd. Zároveň byla zjištěna významná pozitivní korelace (R=0,8756) mezi aktuální mrazuvzdorností (průměrné hodnoty LT 50 odrůdy Navajo -14,01 C, Californium -13,39 C a Benefit -11,5 C) a hladinou DHN v jednotlivých otužených odrůdách (graf č. 3). V grafu č. 2 jsou patrné jednotlivé proteinové oblasti DHN u vybraných tří odrůd Californium (F); Benefit (B a Navajo (N). Číslo jedna se vyskytuje v oblasti molekulové hmotnosti cca 90 kd, číslo 2 a 3 tvoří součet dvou bandů (na membráně jde o dvě velmi blízce vizualizované oblasti DHN). Tyto oblasti mají molekulovou hmotnost cca 47 kd a 37 kd. Z grafu č. 2 je patrné, že nejvyšší predikční i vypovídací schopnost mají DHN o hmotnosti kolem 47 kd. Tyto oblasti DHN dosahují nejvyšších akumulací jak během chladu, tak i při stresu suchem (Urban, nepublikováno). Právě v této oblasti hmotnosti kolem 47 kd odrůda Benefit akumuluje pouze jeden DHN (ostatní odrůdy dva). U této odrůdy byl tedy zjištěn kvalitativní rozdíl v akumulaci DHN ve srovnání s ostatními dvěma odrůdami. Obrázek 1. Densita (koncentrace) dehydrinů (v kd), vizualizovaných na PVDF membráně Graf 1. Součet densit vizualizovaných dehydrinů u jednotlivých odrůd ozimé řepky F Californium; N Navajo; B Benefit; čísla 1 a 2 značí vzorek opakování (z různých rostlin) Chybové úsečky jsou tvořeny hodnotou směrodatné odchylky densit; písmena a, b označují homogenní podskupiny (LSD; P = 0.05) 17

18 Graf 2. Density všech vizualizovaných dehydrinů u jednotlivých odrůd Chybové úsečky jsou tvořeny hodnotou směrodatné odchylky densit, písmena a, b, c označují homogenní podskupiny (LSD; P = 0.05) Graf 3. Vztah LT 50 všech odrůd k akumulaci DHN 18

19 Závěr Posledních deset let se setkáváme v odborné literatuře s velkým zájmem základního i aplikovaného výzkumu, cíleným na sledování těch proteinů, které by mohly být markery reakce jednotlivých pletiv či odrůd na stres nedostatku vody (týká se i chladu). Každá odrůda může upřednostňovat odlišné signální dráhy a strategie akumulace protektivních látek. Vybrané odrůdy řepky olejky korelovaly ve schopnosti akumulace DHN s jejich aktuální mrazuvzdorností. Benefit navíc projevil i kvalitativní změny v akumulaci DHN. V dalších experimentech by proto tato liniová odrůda mohla přispět k upřesnění podílu jednotlivých dehydrinů na celkové odolnosti i u dalších genotypů ozimé řepky Dá se očekávat, že po optimalizaci izolace a detekce dehydrinů u širšího spektra odrůd ozimé řepky (hybridních i liniových) bude pomocí této metody možné primárně selektovat nové výchozí materiály s dostatečnou úrovní mrazuvzdornosti. Aby toho bylo možné dosáhnout, bude třeba optimalizovat i postupy stresového působení tak, aby nedocházelo ke stírání odrůdových rozdílů a aby bylo možné výsledky akumulace DHN vztáhnout i ke skutečné zimovzdornosti jednotlivých odrůd. Komplexní proteomický přístup (např. DIGE) zaměřený na analýzu a kvantifikaci dalších proteinů ovlivňujících odolnost rostlin vůči abiotickým stresům může identifikovat další markery odolnosti, a tím zpřesnit a zrychlit selekci odolných genotypů významných plodin, jako je řepka olejka. Dedikace Práce byla podpořena projekty Mze QH82285 a QI111A075. Použitá literatura /1a/ Kosová, K. Vítámvás, P., Prášil, I. T. The role of dehydrins in plant response to cold. Biologia Plantarum, 51 (4) 2007: /1b/ Ismail, A.M., Hall, A.E., Close, T.J.: Allelic variation of a dehydrin gene cosegregates with chilling tolerance during seedling emergence. Proc. Nat. Acad. Sci. USA Vol. 96 (23), 1999: /2/ Vítámvás, P., Saalbach G., Prášil I. T., Čapková V., Opatrná J., Jahoor A.: WCS120 protein family and proteins soluble upon boiling in cold-acclimated winter wheat. Journal of Plant Physiology Vol. 164 (9), 2007: /3/ Volaire, F.: Drought survival, summer dormancy and dehydrin accumulation in contrasting cultivars of Dactylis glomerata. Physiol. Plant. Vol. 116 (1), 2002: /4/ Cellier, F., Conejero, G., Breitler, J.C., Casse, F.: Molecular and physiological response to water deficit in drought-tolerant and drought-sensitive lines of sunflower. Plant Physiol. Vol. 116 (1), 1998: /5/ Suprunova, T., Krugman, T., Fahima, T., Chen, G., Shams, I., Korol, A., Nevo, E.: Differential expression of dehydrin genes in wild barley, Hordeum spontaneum, associated with resistance to water deficit. Plant, Cell Environ. Vol. 27 (10), 2004: /6/ Prášil, I., Zámečník, J.: The use of a conductivity measurement method for assessing freezing injury. I. Influence of leakage time, segment number, size and shape in a sample on evaluation of the degree on injury, Environ.exp.Bot., 40, 1998:1-10. /7/ Janáček, J., Prášil, I.: Quantification of plant frost injury by nonlinear fitting of an S- shaped function, Cryo-Letters. 12, 1991:

20 Kontaktní adresa: Ing. Milan O. Urban, DiS. Laboratoř molekulární stresové fyziologie Katedra experimentální biologie rostlin PřF UK, Viničná 5 Praha 2 Brassica napus L. 20

21 ZKUŠENOSTI S VYUŽITÍM ČMELÁKA ZEMNÍHO (BOMBUS TERRESTRIS L., APIDAE) VE ŠLECHTĚNÍ OZIMÉ ŘEPKY (BRASSICA NAPUS L.) Experience on using Bombus terrestris L. in breeding of winter oilseed rape (Brassica napus L.) Macháčková I. 1, Ptáček V. 2, Bučánková A. 2 1 Selgen, a.s., Šlechtitelská stanice Chlumec nad Cidlinou, Chlumec nad Cidlinou 2 Zemědělský výzkum spol. s r. o., Zahradní 1, Troubsko Abstrakt Při hybridním šlechtění ozimé řepky způsobem T-cross v technické izolaci byli v letech 2010 a 2011 poprvé použiti čmeláci zemní (Bombus terrestris L.) k transferu pylu uvnitř souborů. V obou letech sloužily tři soubory jako kontrola. V roce 2010 byli do jedné klece vpuštěni pouze samci. Zatímco v izolátorech bez opylovatelů bylo v jednotlivých letech získáno v průměru 59,7 a 86,2 g na m 2, průměrné výnosy se čmeláky byly 326,0 a 349,0 g na m 2. Podobně, průměrné množství semen na rostlinu dosahovalo bez čmeláků hodnot 1,5 a 4,0 g zatímco se čmeláky 12,6 a 14,6 g. V kleci se samci se hodnoty výnosů nacházely mezi oběma skupinami. Rostliny bez opylovatelů vykázaly poněkud vyšší hmotnost tisíce semen. Využití čmeláků dovoluje získat více než čtyřnásobně vyšší šlechtitelský zisk. Pokus rovněž ukazuje značnou potenci zvýšení výnosů semen přenosem pylu u řepky obecně. Klíčová slova:brassica napus, Bombus terrestris, technická izolace, výnos semen, HTS Abstract Using T-cross arrangement in hybrid breeding of canola, bumble bee (Bombus terrestris L.) colonies were used to enable pollen transfer among selected plants in enclosures. As the results showed, without pollinators as an average 59.7 a 86.2 g of seeds per m 2 were harvested, whereas with bumblebees the average yield reached and g per m 2, in the respective years 2010 and Similarly, the average seed yield per plant was 1.5 and 4.0 without pollinators, but 12.6 and 14.6 with them in the respective years. In the cage with males only the results were among the two comparative groups. Somewhat higher mass of 1,000 seeds was found in the plants without pollinators. As the trials showed, using of bumble bees enables more than to quadruple the breeding gain. Also the enormous ability of canola to improve seed yield after proper pollination was confirmed. Key words: Brassica napus, Bombus terrestris, enclosures, seed yield, TSW Úvod Všechny aktuálně pěstované liniové odrůdy řepky olejky (Brassica napus) jsou převážně samosprašné. Při tvorbě výkonných a uniformních odrůd hybridního typu je samosprašnost naopak nežádoucí. Proto se využívají různé genetické bariéry, které samoopylení u řepky znemožňují, jako jsou různé typy pylové sterility cytoplazmatické (CMS) nebo genové (GMS), případně autoinkompatibility (AIK). Při tvorbě hybridů v technické izolací je nezbytné použít opylovatele, protože přenos pylu z fertilních otcovských na sterilní mateřské rostliny v izolačních klecích pomocí větru minimální. Mezi nejčastěji používané opylovatele patří včela medonosná, čmeláci, samotářské včely nebo mouchy (Ptáček, 1983, 1987, 2000; Mesquida, Renard, Pierre, 1988; Soroka a kol. 2001; Drobná, Ptáček 2003; Steffan-Dewenter, 2003). Výhodou použití čmeláků při opylování rostlin v technických izolátorech je zejména fakt, že se v uzavřeném prostoru dobře orientují a po seznámení se s prostředím začínají okamžitě pracovat. Oproti včelám medonosným létají už při teplotách 6 8 C a jsou aktivní i během slabého deště. Do nedávné doby byly omezujícím faktorem pro využití čmeláků vysoké 21

22 náklady na pořízení hnízda, které byly ve srovnání s opylovacími pakety včely medonosné 5-10x vyšší (Dušek a kol., 2010). Problematické bylo také načasování a získání dostatečného množství hnízd v období nakvétání porostů. Tyto nedostatky byly odstraněny zavedením hromadného celoročního odchovu čmeláka zemního domácí rasy v ZV Troubsko (Ptáček, 2010). Cílem našich pokusů bylo zjistit, zda lze u souborů rostlin řepky olejky, určených k produkci hybridní F 1 generace v technických izolátorech, použitím čmeláka zemního, získat vyšší výnos semen. Materiál a Metody Pokusy byly prováděny v letech 2010 a 2011 ve šlechtitelské stanici Chlumec nad Cidlinou, firmy Selgen, a.s. Soubory řepky byly vyseté v řádném podzimním termínu na záhony o velikosti 7,2 m 2, přičemž výnos semene byl hodnocen na poloviční výměře. Zpočátku byly rostliny pěstovány volně a v době tvorby poupat byly překryty izolátorem z průhledné netkané textilie se zasíťovanými ventilačními otvory. Konstrukce pro textilní izolátory byly zhotoveny z ocelové kulatiny, měly obloukovitý tvar se středovou výškou 180 cm, šířka 120 cm a délka konstrukce byla 6m. Soubory řepky v jednom izolátoru byly tvořeny z 1/2 fertilními opylovači a z 1/2 cytoplazmaticky sterilními rostlinami, u kterých byl vyhodnocen výnos semene jak na rostlinu, tak na jednotku plochy. Schematicky byly rostliny ve 4 řádcích, na 2 řádky uprostřed byly vysety sterilní opylované rostliny a 2 okrajové řádky byly z opylovačů. Čmeláci byli umístěni do prostoru izolátoru v době asi 10% kvetení, aby mohli ihned získat na květech potravu. Šlo o menší hnízda v úlcích s cca 20 dělnicemi a plodem, ze kterého se líhli noví čmeláci přibližně dalších 14 dnů. Hnízda byla přikrmována cukerným roztokem, aby neuhynula v případě, že řepka nutnou potravu neposkytne. V jednom případě byli do izolátoru vpuštěni pouze samci s předpokladem, že jejich pátrání po nektaru v květech přinese rovněž očekávaný opylovací efekt. Tito přikrmováni nebyli. Po odkvětu byla hnízda čmeláků ponechána k dokončení života volně v přírodě, protože šlo o autochtonní populaci. Po skončení opylování byly izolátory odstraněny a rostliny dokončily vývoj volně. Osivo bylo sklizeno a zváženo zvlášť z jednotlivých opylených rostlin, pak bylo smícháno a ze směsi byla stanovena HTS. Získané hodnoty byly zpracovány základními statistickými metodami. Výsledky a diskuse Výsledky dvouletých experimentů prokázaly pozitivní vliv dělnic čmeláků jako opylovatelů při tvorbě hybridního osiva ozimé řepky v rámci sledovaných souborů. Detailní výsledky pro oba roky jsou uvedeny v tabulce 1 a 2. Hodnoty dvou sledovaných charakteristik (průměrný výnos na rostlinu a průměrný výnos na jednotku plochy izolátoru) byly v obou ročnících výrazně vyšší v případě nasazení čmeláků. Vliv opylovatelů na výše zmíněné charakteristiky byl potvrzen statistickými analýzami jako vysoce významný (t-test, P < 0,01). Např. v roce 2010 bylo dosaženo průměrných výnosů na rostlinu 12,6 g a 341,5 na m 2 v případě využití čmeláků a pouze 1,5 g a 59,7 g v případě kontrol bez opylovatelů (Obrázek 1A a 1B). V izolátorech s hnízdy s dělnicemi bylo roce 2010 získáno 8x více semen v průměru na rostlinu a téměř 6x více semen na jednotku plochy než v klecích bez opylovatelů. Podobných rozdílů bylo dosaženo i v následujícím roce (viz obrázek 1A a 1B). Opět byl prokázán významný vliv opylovatelů na výnosy semen z rostliny i jednotky plochy, stejně jako i na hodnotu hmotnosti tisíce semen (HTS) (t-test, P < 0,01). Hodnoty HTS však byly v negativní korelaci s výnosovými charakteristikami (obrázek 1C). Tuto skutečnost lze vysvětlit dokonalejší výživou menšího množství semen u rostlin s celkově hůře opylenými květy. Poněkud horších výsledků bylo dosaženo při použití trubců místo kompletních rodin (tabulka 1, linie T22). Pozitivní vliv patrný, nelze ho však statisticky ověřit z důvodu nedostatečného 22

23 počtu opakování. Výsledek je však v souladu s předpokladem, že i samci by výnos zvýšili, avšak pro dokonalé prokřížení genotypů v kleci je nutné, aby opylovatelé aktivně hledali pyl pro výživu svého potomstva ve stadiu larev. Podobně, Kanaďané Soroka a kol. (2001), dosáhli u produkce CMS hybridního osiva v klecích násobné zvýšení pomocí čalounic (Megachile rotundata F.) zatímco se čmeláky Bombus impatiens Cr. pouze 10 násobné ve srovnáním s výnosy bez opylovatelů. U pylově fertilní otcovské odrůdy, atraktivní pro čmeláky, byly výnosy stejné bez ohledu na druh opylovatele. Že na druhu záleží, potvrzují výsledky Mesquida, Bernard, Pierre (1988), kteří po opylování včelami medonosnými u ozimé liniové odrůdy Jet Neuf v izolačních klecích zaznamenali (statisticky neprůkazné) zvýšení výnosu o 6 %. Včely medonosné se prakticky pro opylování v izolátorech nehodí. Na druhé straně ve volné přírodě výnosy zvyšují. U nás více než o 50% (Kubišová, Nedbalová, Plesnik, 1980; Kamler 1983). Kotowski (2005) však u nových kultivarů zaznamenal jen neprůkazné zvýšení výnosů při volném opylení. V našich pokusech měl na stupeň proopylení a následné nasazení semen významný vliv i průběh počasí během kvetení, jak vyplývá z meziročních výsledků. V roce 2010 bylo v době kvetení rostlin, tj. v měsíci dubnu a květnu naměřeno 140 a 181 % srážek oproti dlouhodobému normálu, měsíční teplotní průměry byly naopak nižší až o 0,9 C. V roce 2011 srážky dosahovaly v dubnu a květnu jen 38 a 61% dlouhodobého normálu, průměrná teplota byla v dubnu o 2,4 C vyšší než je dlouhodobý průměr a taktéž v květnu byl o 0,4 C vyšší teplotní průměr. Tab. 1. Vybrané výnosové charakteristiky pokusu v roce 2010 Označení izolátoru Původ souboru CMS rostlin Čmeláci Počet opylovaných rostlin Sklizňová plocha [m 2 ] Výnos [g] izolátor rostlina m 2 T1 AD8 ano 82 3, ,50 398,6 4,74 T2 AD16 ano 109 3, ,99 423,6 5,32 T4 AD50 ano 106 3, ,06 413,9 4,98 T7 AD102 ano 125 3, ,08 419,4 4,92 T8 AD105 ano 83 3, ,13 418,1 5,14 T9 AD106 ano 78 3, ,53 184,7 6,48 T13 c19xc20 ano 55 3, ,27 172,2 5,09 T16 c37xc38 ano 102 3, ,28 376,4 5,46 T17 c37xc38 ano 73 3, ,60 255,6 5,54 T20 AD8 ano 138 3, ,20 352,8 6,04 T22 AD50 ano* 74 3, ,31 170,8 6,04 T26 AD103 ne 168 3, ,43 66,7 6,28 T3 AD16 ne 124 3, ,73 59,7 6,01 T6 AD101 ne 130 3, ,46 52,8 6,18 Průměrný výnos při použití dělnic 12,63 341,5 5,43 Průměrný výnos bez opylovatelů 1,54 59,7 6,16 *Pouze trubci; tyto výsledky nejsou zahrnuty do průměru HTS [g] 23

24 Tab. 2. Vybrané výnosové charakteristiky pokusu v roce 2011 Označení izolátoru Původ souboru CMS rostlin Čmeláci Počet opylovaných rostlin Sklizňová plocha [m 2 ] Výnos [g] izolátor rostlina m 2 T1 20 ano 122 3, ,49 365,7 3,98 T2 20 ano 153 3, ,65 334,3 3,98 T3 25 ano 101 3, ,27 238,6 3,58 T4 25 ano 130 3, ,00 297,1 3,58 T5 48 ano 120 3, ,83 268,6 4,58 T6 48 ano 125 3, ,96 284,3 4,58 T7 52 ano 110 3, ,64 240,0 4,48 T8 52 ano 115 3, ,83 290,0 4,48 T12 40 ano 85 3, ,65 331,4 4,66 T14 14 ano 55 3, ,18 442,9 4,86 T15 14 ano 83 3, ,52 462,9 4,86 T16 20 ano 95 3, ,00 352,9 3,78 T17 20 ano 110 3, ,41 421,4 3,78 T20 48 ano 90 3, ,17 364,3 4,10 T21 48 ano 87 3, ,87 320,0 4,10 T22 52 ano 105 3, ,48 314,3 4,78 T23 52 ano 55 3, ,00 251,4 4,78 T25 14 ano 99 3, ,38 237,1 5,18 T27 40 ano 60 3, ,58 352,9 4,74 T31 52 ano 74 3, ,61 330,0 4,86 T32 52 ano 102 3, ,87 404,3 4,86 T33 48 ano 102 3, ,41 420,0 4,42 T34 48 ano 74 3, ,59 414,3 4,42 T35 25 ano 83 3, ,20 384,3 3,54 T36 25 ano 53 3, ,64 342,9 3,54 T37 20 ano 68 3, ,15 391,4 3,76 T38 20 ano 64 3, ,75 342,9 3,76 T39 14 ano 77 3, ,61 431,4 4,66 T40 14 ano 68 3, ,84 424,3 4,66 T42 40 ano 82 3, ,62 412,9 4,34 T41 54 ne 95 3, ,63 71,4 6,60 T18 25 ne 61 3, ,26 74,3 5,38 T19 25 ne 78 3, ,06 112,9 5,38 Průměrný výnos při použití dělnic 14,57 349,0 4,3 Průměrný výnos bez opylovatelů 3,99 86,19 5,79 HTS [g] 24

25 Obr. 1. Vliv čmeláků na vybrané výnosové charakteristiky v letech 2010 a 2011 A průměrný výnos na rostlinu, B průměrný výnos na jednotku plochy izolátoru, C průměrná HTS. Chybové úsečky vyjadřují standardní chybu (SE) (průměr ± 0,95*SE) A B C Závěr Z výsledků je nepochybný vysoce kladný vliv čmeláků jako přenašečů pylu uvnitř daných souborů. V obou letech byla zjištěna poněkud vyšší HTS v klecích bez opylovatelů. Vysvětlením je dokonalejší výživa menšího množství semen u sledovaných rostlin. Významný vliv na stupeň proopylení a následné nasazení semen má i průběh počasí během kvetení řepky ozimé, jak vyplývá z meziročních výsledků. Výraznější rozdíly mezi výnosy s opylovateli a bez nich byly nalezeny v roce 2010, kdy po celou dobu kvetení bylo deštivo doprovázené chladnějším počasím. Podobný průběh počasí je pro volné opylování nevhodný a nezajistí dostatečné nasazení šešulí, což je klíčové při výrobě hybridního osiva. Dedikace Práce vznikla za podpory projektu NAZV QI111A075 Národní agentury pro zemědělský výzkum a TA Technologické agentury České republiky. Použitá literatura Drobná J., Ptáček V., (2003): Experience in using bumblebees as pollinators in the regeneration of the genetic resources of some forage legumes. J. Apic. Sci. 47(1): Dušek K., Krieg P., Dušková E. (2010): Metodika použití hmyzích opylovačů u cizosprašných druhů zelenin, léčivých, aromatických a kořeninových rostlin pěstovaných v technické izolaci. VÚRV v.v.i. ISBN:

26 Kamler F. (1983) - Reakce vybraných odrůd řepky ozimé na opylení včelou medonosnou [The response of selected winter rape cultivars to the pollination by honeybees]. Rostlinná výroba, 29 (56): Kotowski Z. (2005): The effect of pollinating insects on the yield of the winter rape seed (Brassica napus L. var. napus f. biennis) cultivars. J. Apic. Sci. 49 (2): Kubišova S., Nedbalova V., Plesnik R. (1980) - Účinnost včely medonosné (Apis mellifera L.) na řepce (Brassica napus L. var. napus) [The activity of honey bee (Apis mellifera L.) on rape (Brassica napus L. var.napus)]. Pol nohospodárstvo 26(8): Mesquida J., Renard M., Pierre J.S. (1988): Rapeseed (Brassica napus L.) productivity: The effect of honeybees (Apis mellifera L.) and different pollination conditions in cage and field tests. Apidologie 19: Ptáček V. (1983): Pollination of alfalfa in enclosures. Univ. Calif., Davis, Calif., Rep. of 28th Alfalfa Improvement Conf Ptáček V. (1987): Technická izolace ve výzkumu a šlechtění jetelovin.(technical isolation in research and breeding legumes.) Sbor. věd. prac. OSEVA, VŠÚP Troubsko (10): Ptáček V. (2000): Different bee species for pollination in enclosure. In: Insect pollination in greenhouses. Proc. of the specialist's meeting, Soesterbeg, The Netherlands, 30 Sept.- 2 Oct Utrecht, The Netherlands: Apimondia, ICPBR - Pollination Section, 2000: Ptáček V. (2010): Základy hromadného chovu čmeláka zemního (Bombus terrrestris L.) a jeho využití k opylování. VÚP s.r.o., ZV, s.r.o. Troubsko, ISBN: Soroka J.J., Goerzen D.W., Falk K.C., Bett K.E. (2001): Alfalfa leafcutting bee (Hymenoptera: Megachilidae) pollination of oilseed rape (Brassica napus L.) under isolation tents for hybrid seed production. Canad. J. Plant Sci., 81: Steffan-Dewenter I. (2003): Seed set of male-sterile and male-fertile oilseed rape (Brassica napus) in relation to pollinator density. Apidologie 34: Kontaktní adresa: Ing. Ivana Macháčková Selgen, a.s. Šlechtitelská stanice Chlumec nad Cidlinou Chlumec nad Cidlinou 26

27 VZTAH RODIČOVSKÝCH GENOMŮ U MEZIDRUHOVÝCH HYBRIDŮ TRIFOLIUM PRATENSE X TRIFOLIUM MEDIUM Intergenomic relationships in interspecific hybrids of Trifolium pratense x Trifolium medium Řepková J. 1, Simandlová J. 1, Jakešová H. 2, Nedělník J. 3, Soldánová M. 1, Hajšlová J. 4, Schulzová V. 4 1 Ústav experimentální biologie, Masarykova univerzita Brno 2 Ing. Hana Jakešová, CSc, šlechtění, Hladké Životice 3 Zemědělský výzkum, spol. s r.o., Troubsko 4 Vysoká škola chemicko-technologická v Praze Abstrakt Šlechtitelský materiál založený na hybridech Trifolium pratense x T. medium je vhodným zdrojem genetické variability pro kulturní jetel luční (T. pratense). Tito hybridi byli hodnoceni na úrovni cytologické prostřednictvím průtokové cytometrie a genomické in situ hybridizace. Rostliny ve dvou školkách s 99 původy hybridů měly srovnatelné zastoupení, co se týče počtu chromozomů v pěti hodnocených skupinách, to je 2n = 28 (76 a 66% rostlin), s méně než 28 chromozomy (8,5 a 6,4% rostlin), 2n = 29 a 30 (15 a 26% rostlin), 2n = 31 až 40 (0,4 a 1,2% rostlin) a 2n = 41 až 46 (méně než 1% rostlin). Nepodařilo se prozatím identifikovat introdukované chromozomy nebo translokované části. Hybridi obsahovali nižší množství fytoestrogenů než T. pratense, ale byl zaznamenán nárůst formononetinu ve srovnání s T. medium. Pro identifikaci mezidruhové variability budou využity genomické techniky založené na de novo sekvenování obou rodičovských genomů. Klíčová slova: Genomická in situ hybridizace, Průtoková cytometrie, Trifolium medium, Trifolium pratense Abstract Breeding material derived from hybrids Trifolium pratense x T. medium is a promising source of new genetic variability for cultivated red clover (T. pratense). These hybrids were evaluated on the cytological level via flow cytometry and genomic in situ hybridization. Plants of 99 sources in two breeding nurseries had comparable chromosome numbers in five groups: 2n = 28 (76 and 66% of plants), bellow of 28 chromosomes (8.5 and 6.4% of plants), 2n = 29, 30 (15 and 26% of plants), 2n = 31, 40 (0.4 and 1.2% of plants) and 2n = 41 to 46 (0.1 and 0.3% of plants). The identification of introduced chromosomes or translocated parts was unsuccessful. Hybrids contained lover level of phytoestrogens than T. pratense but increased amount of formononetin with comparison of T. medium was evaluated. Interspecific variability will be identified by genomic procedures based on de novo sequencing of the both parental genomes. Key words: Flow cytometry, Genomic in situ hybridisation, Trifolium medium, Trifolium pratense Úvod Genetická rozmanitost kulturních druhů se zužuje vlivem šlechtění. Vhodným zdrojem pro rozšíření jejich genetické variability jsou plané druhy, které prostřednictvím mezidruhové hybridizace umožňují využití genofondu nad rámec druhu a mohou být zdrojem řady nových znaků jako samčí sterilita, rezistence k chorobám, biotickým faktorům a podobně. Trifolium pratense L. je vysoce kvalitní pícnina dávající vysoké výnosy, ale má nízkou vytrvalost, což je možné překonat mezidruhovou hybridizací s druhy, které tvoří podzemní výběžky, např. s T. medium L. Ve VÚP Troubsko byl získán originální rostlinný materiál mezidruhovou hybridizací T. pratense (2n = 4x = 28) a T. medium (2n = 8x = 64) (Řepková et al. 1991; Nedbálková et al. 1995). Volným sprášením hybridů F 2 s T. pratense cv. Amos po pět generací byla získána populace rostlin, která byla využita ke šlechtění, jehož součástí byly i výběry rostlin s odlišným obsahem DNA ve srovnání s tetraploidním T. pratense. Bylo 27

28 získáno novošlechtění, které bylo přihlášené v r do státních odrůdových zkoušek ÚKZÚZ pod názvem Pramedi. Materiál se odlišuje od rodičovských druhů variabilitou v morfologických a agronomických znacích (Řepková et al. 2011) a v současné době je pozornost zaměřena na hodnocení znaků souvisejících s pozitivními agronomickými vlastnostmi, jakými jsou hmotnost rostlin, počet lodyh a hlávek na rostlinu, a s vytrvalostí rostlin. Cílem současných analýz hybridní populace bylo studium jejich genomů za využití průtokové cytometrie a stanovení koncentrace DNA ve vztahu k počtu chromozomů hybridů a k oběma rodičovským druhům. Cytologické analýzy se zaměřily na metodu GISH (genomickou in situ hybridizaci), která umožňuje identifikaci a vizualizaci chromozomů nebo jejich částí a detekci introgrese genetické informace. Analýza znaků hybridních rostlin byla doplněna studiem znaků kvalitativních stanovení obsahu fytoestrogenů v zelené hmotě. Materiál a metody Do analýz byly zahrnuty rodičovské rostliny T. pratense (2n = 4x = 28) a T. medium (2n = 8x = 64, klon 10/8) a rostliny hybridní populace T. pratense x T. medium, 18 původů v kmenové školce JEH1V a 81 původů v kmenové školce JEH1F. Průtoková cytometrie Do misek s perlitem bylo z každého původu vyseto cca 30 semen. Ve stadiu prvních až třetích pravých lístků bylo provedeno měření obsahu DNA u jednotlivých rostlin na průtokovém cytometru Partec PA. DNA každé rostliny byla měřena ve směsném vzorku s diploidním jetelem lučním (Start, 2n = 14). Celkem bylo hodnoceno 800 rostlin JEH1V a 753 rostlin JEH1F. Genomická in situ hybridizace (GISH) Z 67 hybridních rostlin JEH1V a rostlin JEH1F T. pratense x T. medium byly odebrány kořenové špičky, po odstřihnutí byly ponechány 24 hod. na ledu za účelem synchronizace mitóz a pak byly fixovány v Carnoyově fixáži. Byla použita směs lytických enzymů celulázy, pektolyázy a cytohelikázy pro narušení buněčné stěny. Dále byly připraveny hybridizační sondy z DNA izolované metodou CTAB z rostlin T. pratense odrůdy Tatra a T. medium klonu 10/8. Bylo použito nepřímé značení sond - sondy pro odrůdy T. pratense byly značeny digoxigeninem-11-dutp (Roche) a DNA T. medium byla značena biotinem (Roche). Kvalita sond po nick translaci byla kontrolována na 1% agarózovém gelu. Hybridizační směs (Schubert et al. 1998) byla přidána k cytologickému preparátu (10µl/sklíčko). Pro denaturaci chromozomů a sondy byla sklíčka umístěna na 2 min na varnou desku (80 o C), a pak na 6 h ve vlhkém boxu nebo přes noc při 37 o C. Vizualizace preparátů byla provedena pomocí fluorescenčního mikroskopu Olympus BX-51. Kvalitativní znaky Z 10 kmenů mezidruhových hybridů JEH a obou rodičovských druhů byly odebírány vzorky zelené píce pro stanovení obsahu volných a celkových fytoestrogenních látek isoflavonů daidzeinu, genisteinu, glyciteinu, formononetinu, biochaninu A a equolu, pterokarpanů kumestrolu a jejich glykosidů. Pro stanovení celkového obsahu fytoestrogenů ve vzorcích byly glykosidy hydrolyzovány pomocí HCl za tepla, stanovení bylo provedeno pomocí kapalinové chromatografie a tandemovou hmotnostní spektrometrií. Stanovení volných fytoestrogenů bylo provedeno extrakcí metanolem. Výsledky a diskuze Koncentrace DNA měřených hybridních rostlin se pohybovala v rozmezí odpovídajícímu 22 až 47 chromozomům. Na základě těchto počtů byly rostliny rozděleny do pěti skupin (Tab. 1). Zastoupení rostlin v jednotlivých kategoriích bylo u obou školek srovnatelné. Na obr. 1 jsou zastoupeny hybridní rostliny s různým počtem chromozomů. Obsah DNA u T. medium 28

29 odpovídal oktoploidu s 64 chromozomy. Rostliny neobsahovaly stejný podíl chromozomů od obou rodičovských druhů. Podobné závěry byly zjištěny při studiu genomů odrůd založených na mezirodové hybridizaci Lolium multiflorum a Festuca pratensis nebo F. arundinacea (Kopecky et al. 2005). Úspěšná hybridizace mezi T. pratense a T. medium včetně hodnocení intermediální morfologie listů byla popsána v práci Isobe et al. (2001). Introgrese znaků mezidruhovou hybridizací je u rodu Trifolium vzácná a byla popsány spíše mezi druhy T. ambiguum a T. hybridum pro tvorbu oddenků (Paplauskiene et al. 2004) nebo T. repens a T. nigrescens pro odolnost k háďátkům (Hussain et al. 1997). Jednotlivé druhy jetele se lišily jednak v obsahu, jednak v profilu fytoestrogenů. U T. medium bylo po kyselé hydrolýze stanoveno celkově 6190 mg/kg fytoestrogenů, z čehož tvoří 66% biochanin A (4061 mg/kg), 28% formononetin (1746 mg/kg), 5% genistein (323 mg/kg) a <1% daidzein (56 mg/kg). T. pratense obsahuje 2471 mg/kg celkových isoflavonů (stanovených rovněž po kyselé hydrolýze), s opačným zastoupením majoritních isoflavonů než u T. medium. Fytoestrogeny jsou tvořeny z 56% formononetinem (1394 mg/kg), 39% biochaninem A (968 mg/kg), 3,3% genisteinem (83 mg/kg) a z 1% daidzeinem (26 mg/kg). Rostliny hybrida uvedených dvou rodičů obsahovaly nižší množství fytoestrogenů než T. pratense, ale byl zaznamenán nárůst formononetinu ve srovnání s T. medium. Obsah celkových fytoestrogenů je u hybridů 2149 mg/kg se 68% zastoupením formononetinu (1468 mg/kg), 27% biochaninu A (573 mg/kg), 3,9% genisteinu (84 mg/kg) a 1,1% daizeinu (23 mg/kg). Tab. 1: Obsah DNA hybridních rostlin T. pratense x T. medium v populaci novošlechtění měřený průtokovou cytometrií přepočítaný na počet chromozomů vzhledem ke standardu 2n = 14. Počet rostlin s chromozomy 2n = méně než 2n = 28 * 2n = 29 až 30 2n = 31 až 40 2n = 41 až JEH1V 68 (8,5%) 608 (76,0%) 120 (15,0%) 3 (0,4%) 1 (0,1%) JEH1F 48 (6,4%) 495 (65,7%) 199 (26,4%) 9 (1,2%) 2 (0,3%) * počet chromozomů u mateřského genotypu T. pratense Závěr Charakterizace hybridů T. pratense x T. medium byla doplněna o kvalitativní parametry, jako je obsah fytoestrogenů. Výsledky potvrdily mezidruhovou variabilitu, která bude dále studována. Cytologická analýza hybridů ukázala variabilní obsah počtu chromozomů od 20 do 43 v korelaci s metodou průtokové cytometrie, což dokládá introgresi celých chromozomů nebo jejich ztrátu. Introgrese metodou GISH nebyla zatím potvrzena. Probíhá hodnocení introgrese znaku tvorby podzemních výběžků, charakter trsu, a jejich souvislost s vytrvalostí. Pokračují práce s analýzou získaných celogenomových sekvencí obou rodičovských druhů T. pratense a T. medium metodou Illumina. Práce je zaměřena na vypracování postupu využití druhově specifických DNA markerů a DNA čipů jako prostředků selekce hybridních rostlin na znaky kvalitativní i kvantitativní. Dedikace Výzkum je součástí projektu QI111A019 a QI111C016 Ministerstva zemědělství ČR. 29

30 Obr. 1: Počty chromozomů u hybridních rostlin T. pratense x T. medium - C JEH 35/6 (27 chromozomů), D JEH 12/29 (28 chromozomů), E JEH 34/4 (30 chromozomů), F JEH 26/7 (43 chromozomů) ve srovnání s rodiči A T. pratense (28 chromozomů) a B T. medium klon 10/8 (64 chromozomů). Použitá literatura Hussain S.W., Williams W.M., Mercer C.F., White D.W.R. (1997): Transfer of clover cysts nematode resistance from Trifolium nigrescens Viv. to T. repens L. by interspecific hybridisation. Tudor. Appl. Genet. 95: Isobe S., Sawai A., Yamaguchi H., Gau M., Uchiyama K. (2001): Breeding potential of the backcross progenies of a hybrid between Trifolium medium x T. pratense to T. pratense. Canad. J. of Plant Sci. 82: Kopecky D., Lukaszewski A.J., Doležel J. (2005): Genomic constitution of Festulolium cultivars released in the Czech republic. Plant Breed. 124: Nedbalkova B., Repkova J., Bartosova L. (1995): Germplasm TBZP1, TBZP2, TBZP3, TBZP4 of interspecific Trifolium hybrids. Scientific Studies Res. Inst. Fodder Plants 13: Paplauskiene V., Dabkeviciene G., Pasckinskiene I. (2004): Identification of interspecific hybrids of T. ambiguum x T. hybridum by inter-ssr fingerprinting. Grassland Sci. Eur. 9: Řepková J., Nedbálková B., Holub J. (1991): Regeneration of plants from zygotic embryos after interspecific hybridization within the genus Trifolium and electrophoretic evaluation of hybrids. Scientific Studies Res. Inst. Fodder Plants 12: Řepková J., Nedělník J., Jakešová H., Hampel D., Hofbauer J. (2011): Mezidruhoví hybridi Trifolium pratense x Trifolium medium jako zdroj nové diverzity. Úroda 12, vědecká příloha časopisu, Schubert I., Shi F., Fuchs J., Endo T.R. (1998): An efficient screening for terminal deletions and translocations of barley chromosomes added to common wheat. Plant J. 14: Kontaktní adresa: Doc. RNDr. Jana Řepková, CSc. Kampus Bohunice, Kamenice 5, Brno, Česká republika 30

31 NOVÉ SMĚRY VE ŠLECHTĚNÍ OLEJNÉHO LNU New ways of linseed breeding Pavelek, M., Tejklová, E., Bjelková, M. AGRITEC, Plant Research, s.r.o., Šumperk Abstrakt Příspěvek reaguje na změny hospodářského typu u lnu setého Linum usitatissimum L. pěstovaného v České republice. Pěstování a šlechtění přadného lnu bylo v České republice prakticky ukončeno a veškerá pozornost se v současnosti zaměřuje na šlechtění a pěstování olejného lnu. Pro zvýšení užitkovosti olejného lnu jsou v příspěvku prezentovány a diskutovány různé směry šlechtění s cílem diferenciace konečného produktu pro vybranou cílovou skupinu uživatelů. Klíčová slova: Len setý olejný, šlechtění, mastné kyseliny, lignany, kyanogenní glykosidy Abstract The contribution responds to the changes of the type of use in Linum usitatissimum L resulting to linseed growing in the Czech Republic. Growing and breeding of flax practically stopped in the Czech Republic and all attention is now focused on linseed breeding and growing. In order to increase utilization of linseed various directions of linseed breeding are presented and discussed with the aim to differ final product according to the requests for target group of final users. Key words: Linum usitatissimum L., linseed, breeding, fatty acids, lignans, cyanogenic glycosides Úvod Až do nedávna se len setý Linum usitatissimum L. v České republice pěstoval jako dva hospodářské typy, přadný len pro produkci vlákna pro textilní průmysl i netextilní aplikace a olejný len pro produkci semene, v minulosti užívaný zejména v průmyslu barev. Semena obsahují přibližně % oleje bohatého na nenasycené mastné kyseliny. Standardní složení mastných kyselin u komerčních přadných i olejných odrůd je cca 6 % kyseliny palmitové (C16:0), 2 % kyseliny stearové (C18:0), % kyseliny olejové (C18:1), % kyseliny linolové (C18:2) a % kyseliny α linoleové. Hlavními šlechtitelskými cíli u olejného lnu v České republice jsou: vysoký výnos oleje (výnos semene x obsah oleje v semeni), rezistence proti nejzávažnějším houbovým patogenům (Fusarium oxysporum f. sp. lini, Alternaria linicola, Colletotrichum lini, Rhizoctonia linicola, Oidium lini), odolnost proti poléhání a obsah a složení mastných kyselin. Nově byly formulovány další šlechtitelské cíle zvyšující užitkovost olejného lnu, vyšší obsah lignanů, zejména secoisolariciresinolu (SECO) jako antioxidantu a nižší obsah kyanogenních glykosidů. Materiál a metody Záměrnou šlechtitelskou prací při využití mutageneze jsou vytvářeny genotypy s alternativní skladbou mastných kyselin, vysoko linolenové (HLN), nízko linolenové (LLN) a se středním obsahem kyseliny olejové (IOL) hnědosemenné a žlutosemenné HLN typy (55-65 % C18:3), hnědosemenné a žlutosemenné LLN typy (méně než 3 % C18:3), hnědosemenné a žlutosemenné IOL a LLN typy (25-40 % C18:1, méně než 10 % C18:3), hnědosemenné a žlutosemenné HLN a LLN typy se zvýšeným obsahem SECO 31

32 hnědosemenné a žlutosemenné HLN a LLN typy se sníženým obsahem kyanogenních glykosidů Pro změnu skladby mastných kyselin byla použita indukovaná mutageneze etylmetansulfonátem (EMS) za účelem snížení obsahu kyseliny linolenové a zvýšení obsahu kyseliny olejové (TEJKLOVÁ, 1995). Nízkolinolenové typy byly detekovány testem kyselinou thiobarbiturovou (BHATTY, ROWLAND, 1990), která s dvojnými vazbami nenasycených mastných kyselin vytváří barevný komplex, přičemž intenzita zabarvení závisí na počtu dvojných vazeb. Nejintenzivnější zbarvení je při běžném obsahu kyseliny linolenové, zatímco při sníženém obsahu nebo velmi nízkém obsahu pod 3 % je zabarvení velmi slabé, respektive žádné. Výsledky u detekovaných nízkolinolenových typů byly dále prověřovány plynovou chromatografií. Výsledky a diskuse Mastné kyseliny Cílená mutageneze pro změnu skladby mastných kyselin u lnu byla obecně použita v australsko-kanadském šlechtitelském programu (MICKE et al., 1985, GREEN, 1986 a,b, DRIBNENKI, GREEN, 1995). Ve společnosti AGRITEC s.r.o. Šumperk byla tato metoda využívána od roku 1995 (TEJKLOVÁ, 1995). Byli detekováni mutanti s redukovanou aktivitou desaturázy FAD2 a FAD3 pro denaturaci kyseliny olejové na linolovou a linolové na linolenovou. Na základě toho byly nalezeny genotypy s různými hladinami C18:1, C18:2, C18:3. Vzájemným křížením genotypů se sníženým obsahem kyseliny linolenové C18:3 byly získány nesegregující nízkolinolenové genotypy s obsahem C18:3 nižším než 3 % a cca 70 % obsahem C18:2. Při křížení LLN genotypů se standardními odrůdami Linum usitatissimum L. s běžným poměrem mastných kyselin byly získány genotypy se středním obsahem % kyseliny linolové C18:2 i linolenové C18:3. Genotypy se zvýšeným obsahem kyseliny olejové C18:1 byly získány buď indukovanou mutagenezí nebo jako spontánní mutanti vyskytující se v kolekci genetických zdrojů společnosti AGRITEC s.r.o. Šumperk. Cílenou selekcí byli získáni mutanti s obsahem C18:3 1-2 % a obsahem C18:1 do 35 %. Byly objeveny genotypy dosahující obsahu kyseliny olejové C18:1 až 46 %, ovšem obsah kyseliny linolenové C18:3 dosáhl cca 33 %. Všechny tyto šlechtitelské aktivity byly pozitivně ovlivněny redukcí ploch přadného lnu vyúsťující až do úplného ukončení pěstování přadného lnu v ČR v roce 2010, což se promítlo i do změny odrůdové skladby olejného lnu. Po holandských odrůdách Flanders s tradiční skladbou matných kyselin a nízkolinolenové odrůdě Lola (Limagrain Advanta) byly do sortimentu zařazeny další nízkolinolenové, žlutosemenné odrůdy olejného lnu Jantar (2006, Sempra Praha a.s., šlechtitelská stanice Slapy u Tábora) a Amon (2007, AGRITEC s.r.o. Šumperk), (PAVELEK, TEJKLOVÁ, 2007). V roce 2010 získal právní ochranu žlutosemenný materiál olejného lnu pod označením AGT 997/05 (Allan) a jako perspektivní se jeví další nízkolinolenové šlechtitelské linie AGT 997/05 a AGT 987/02 prezentované v tabulce 1. 32

33 Tabulka 1. Charakteristika odrůd olejného lnu registrovaných v ČR a nových, perspektivních linií ve zkouškách pro registraci 2009 Genotyp VS OO VO C16:0 C18:0 C18:1 C18:2 C18:3 VD Lola 2,64 43,2 999,8 6,46 2,63 14,20 71,54 3, Flanders 2,53 45,9 1016,8 4,71 3,66 17,62 15,29 56, Amon 2,48 45,0 971,6 6,20 3,66 15,51 71,26 1, Jantar 2,32 44,3 901,4 5,88 3,94 16,63 70,23 1, AGT 997/05 2,47 42,8 931,4 5,80 3,79 16,71 40,09 32, AGT 2,49 44,4 958,6 6,21 3,59 17,58 69,22 1, /05 AGT 2,45 41,5 868,8 6,16 3,84 18,21 64,43 5, /02 LSD 0,32 3,00 132,0 0,10 0,19 1,05 1,39 1,23 2 0,05 Vysvětlivky: VS-výnos semene (t.ha -1 ), OO-obsah oleje (%), VO-výnos oleje (kg.ha -1 ), C16:0 kyselina palmitová (%), C18:0-kyselina stearová (%), C18:1-kyselina olejová (%), C18:2-kyselina linolová (%), C18:3- kyselina linoleová (%), VD-délka vegetační doby (dny od setí do zralosti) Kyselina linolenová je žádoucí z potravinářského hlediska a i když je nestabilní a redukuje trvanlivost oleje, je žádoucí pro produkci jedlého oleje. Lignany fytoestrogeny Novým šlechtitelským cílem je zvýšení obsahu fytoestrogenů a snížení obsahu kyanogenních glykosidů. Nejznámějším fytoestrogenem je sesoisolariciresinol (SECO), jehož enzymatickým rozkladem vznikají lignany, které mají pozitivní antioxidační účinky v lidském organismu (TOURÉ, XU, 2010). Nová šlechtitelská linie AGT 997/05 ukázala zvýšený obsah SECO ve srovnání se standardní odrůdou Amon (graf 1). Kyanogenní glykosidy Vysoký obsah kyanogenních glykosidů (KG - linustatin, neolinustatin and linamarin) je nežádoucí z důvodu jejich metabolické degradace na kyanovodík (HCN), který je pro organismy toxický. Proto jsou odrůdy olejného lnu s nižším obsahem kyanogenních glykosidů mnohem vhodnější pro použití v potravinářském průmyslu ve srovnání s tradičními odrůdami. V grafu 2 je uveden obsah KG jako suma všech tří výše zmíněných KG u registrovaných odrůd a šlechtitelských linií olejného lnu. Obě novošlechtění AGT 987/02 a AGT 997/05 prokázala nižší obsahy KG ve srovnání se standardními odrůdami. Graf 1. Obsah SECO u registrovaných odrůd a novošlechtění olejného lnu 33

34 Graf 2. Obsah KG u registrovaných odrůd a novošlechtění olejného lnu Kyselina olejová Za účelem detekce genotypů se zvýšeným obsahem kyseliny olejové (C18:1) byl od roku 2007 prováděn průzkum kolekce genetických zdrojů olejného lnu. Výsledky prokázaly vysokou variabilitu v obsahu C18:1 (tab. 3) a byly detekovány genotypy se zvýšeným obsahem kyseliny olejové C18:1 (tab. 2,3). V rámci 19 detekovaných genotypů uvedených v tab. 2, 3 obsah kyseliny olejové C18:1 kolísal v rozmezí 21,5 30 %. Nově vyvinutá linie olejného lnu pod označením AGT 997/05 prokázala ve zkouškách zvýšený obsah SECO, snížený obsah KG a současně jedinečnou skladbu mastných kyselin, zejména střední obsah kyseliny linolové i linolenové. V roce 2011 byla registrována jako nová odrůda s obchodním názvem Raciol (TEJKLOVÁ, BJELKOVÁ, PAVELEK, 2011) Tabulka 2. Složení mastných kyselin u 15 genotypů vybraných z kolekce genetických zdrojů lnu na vyšší obsah kyseliny olejové C18:1 pokusná lokalita Šumperk Obsah mastných kyselin (%) ECN Název C16:0 C18:0 C18:1 C18:2 C18: Sziciliai 6,5 3,9 21,5 16,8 51,3 olajlen I-9 5,8 3,0 21,6 15,1 54, Madéfalvai 5,4 2,6 21,6 14,8 55,6 kékvirágu CI ,1 3,9 21,7 12,3 56, Vajžgantas 4,8 2,8 21,7 20,9 49, Rabat ,0 4,1 21,8 15,7 52, Omega 6,1 3,1 21,9 15,3 53, La Prevision 6,2 4,2 22,1 14,8 52, V ,2 3,8 22,1 15,5 52, Rabat ,6 22,2 14,5 53, Masličnyj 5,6 2,6 22,3 14,6 54, O/228 5,6 3,1 23,0 16,3 52, Rabat ,2 3,8 23,6 16,1 50, CI ,9 4,3 24,0 12,7 53, LCSD-210 4,7 2,2 25,7 14,7 52,8 34

35 Tabulka 3. Složení mastných kyselin u 14 genotypů vybraných z kolekce genetických zdrojů lnu na vyšší obsah kyseliny olejové C18:1 pokusná lokalita Vikýřovice Obsah mastných kyselin (%) ECN Název C16:0 C18:0 C18:1 C18:2 C18: Maď. olejný 5,5 2,7 26,3 12,6 52, Minuano 6,0 4,6 26,3 13,4 49, Liflora 4,7 3,5 26,2 13,9 51, Attana 5,4 2,8 26,4 16,2 49,3 ZZOB Udzan 6,3 4,1 26,6 15,7 47, O/228 5,9 3,2 26,6 15,8 48, CI ,7 5,6 27,0 12,4 48, P-255 5,4 3,0 27,1 14,0 50, Barradas 6,7 4,6 27,4 13,3 48,0 Benafin O/226 5,3 2,9 27,7 15,0 49, VNIIL 6 5,4 4,7 28,3 16,5 45, Royal 6,8 4,8 28,9 14,4 45, Liral Crown 6,6 5,0 28,9 14,0 45, La Prevision 6,3 5,5 30,0 13,9 44,3 Závěr Nedávno registrované české, žlutosemenné, nízkolinolenové odrůdy olejného lnu Jantar (2006) a Amon (2007) jsou srovnatelné s hnědosemennou, nízkolinolenovou, holandskou standardní odrůdou Lola. Všechny tyto odrůdy jsou primárně určeny k použití v potravinářském a především pekárenském průmyslu k posypu do pečiva. Cílenou šlechtitelskou prací se však podařilo zvýšit další využití olejného lnu vyšlechtěním odrůdy se zcela jedinečnou, u lnu jako druhu Linum usitatissimum L., dosud neexistující kvalitou a to se středním obsahem kyseliny linolové C18:2 (cca 40 %) a α linolenové C18:3 (cca 30 %). Takovéto složení mastných kyselin opravňuje využití této nové linie zkoušené v pokusech pro registraci v letech pod označením AGT 997/05 a registrované v roce 2011 jako nová odrůda olejného lnu s názvem Raciol především pro výrobu jedlého, stolního oleje. Jedná se o odrůdu s níže uvedenými vlastnostmi: RACIOL středně raná, modrokvětá, žlutosemenná odrůda rostliny nízké až středně vysoké, odolné k poléhání výnos semene a tuku vysoký obsah tuku středně vysoký obsah kyseliny linolové cca 40 % obsah kyseliny alfa-linolenové cca 30 % jodové číslo středně vysoké velmi nízký obsah antinutričních látek kyanogenních glykosidů vyšší odolnost k chorobám kořenů a báze stonku odrůda k produkci semene na výrobu stolního oleje, pro využití v racionální výživě, v pekárenském průmyslu na posyp pečiva, k přimíchávání do těst Dedikace Tento výzkum byl finančně podpořen granty MŠMT č a 2B

36 Použitá literatura Bhatty Rs, Rowland Gg, 1990: Measurement of α-linolenic acid in the development of edible oil flax. J. Am. Oil Chem. Soc. 67, Dribnenki, J. C. P., Green, A. G, 1995: Linola ((TM)) "497" low linolenic acid flax. Can. J. Plant Sci., 75, Green, A. G, 1986 a: A mutant genotype of flax (Linum usitatissimum L.) containing very low levels of linolenic acid in its seed oil. Can. J. Plant Sci. 66: Green, A. G, 1986 b: Genetic modification of seed fatty acid composition in Linum usitatissimum L. Journal of Australian Institute of Agricultural Science 52 (3), Micke, A., Maluszynski, M., DoninI, B, 1985: Plant cultivars derived from mutation induction or the use of induced mutants in cross breeding. FAO Mutation Breeding Review 3 Pavelek M., Tejklová E, 2007: New varieties, Linum usitatissimum L., linseed Amon, Nové odrůdy, len setý, olejný Amon. Czech J. Genet. Plant Breed., 43, (4), Tejklová E, 1995: Induced mutagenesis in flax (Linum usitatissimum L.). In: Breeding for fibre and oil quality, Proc. 3rd Meeting of the International Flax Breeding Research Group, 7-8 Nov., St. Valéry en Caux, France, Tejklová E., Bjelková M., Pavelek M, 2011: New varieties, Medium - linolenic linseed (Linum usitatissimum L.) Raciol, Nové odrůdy, střednělinolenový olejný len Raciol. Czech J. Genet. Plant Breed., 47, (3), Touré A, XU XM, 2010: Flaxseed lignans: source, biosynthesis, metabolism, antioxidant activity, bio-active components, and health benefits. Compr. Rev. Food Sci. Food Saf. 9, Kontaktní adresa: Ing. Martin Pavelek, CSc. AGRITEC Plant Research s.r.o. Zemědělská Šumperk, Česká republika 36

37 STUDIUM ODOLNOSTI VYBRANÝCH GENOTYPŮ TUŘÍNU VŮČI NÁDOROVITOSTI BRUKVOVITÝCH Study of resistance of selected rutabaga genotypes to clubroot Kopecký P., Cenklová V., Dušek K. Výzkumný ústav rostlinné výroby, v.v.i., Olomouc Abstrakt Nádorovitost brukvovitých (Plasmodiophora brassicae Wor.; PB) je celosvětově rozšířená choroba napadající rostliny čeledi Brassicaceae. Odolnost 12 vybraných položek tuřínu (Brassica napus var. napobrassica (L.) Rchb.) vůči PB byla testována za kontrolovaných podmínek. Odrůdy Debra a Marian se ukázaly jako nejodolnější vůči PB, naopak odrůdy Perfection a Croppa byly nejcitlivější. Indexy napadení v průběhu jednotlivých opakování experimentů většinou vzájemně korelovaly. Hodnoty výrazně kolísaly jen u tří odrůd, což mohlo být způsobeno heterogenitou použitých izolátů PB odvozených z náhodně odebraných vzorků z infekčního pole. Další možnou příčinou variability indexů napadení může být předpokládaná genetická heterogenita rostlinného materiálu v rámci sledovaných odrůd tuřínu. Získané výsledky budou ověřeny v podmínkách infekčního pole. Klíčová slova: Plasmodiophora brassicae Wor., Brassica napus var. napobrassica (L.) Rchb., odrůdy, index napadení Abstract Clubroot (Plasmodiophora brassicae Wor.; PB) is a worldwide distributed disease that affects plants from the family Brassicaceae. Resistance of 12 chosen accessions of rutabaga (Brassica napus var. napobrassica (L.) Rchb.) to PB was tested under controlled conditions. Varieties Debra and Marian were demonstrated as the most resistant to PB, conversely varieties Perfection and Croppa were the most susceptible. During separate sets of experiments recorded disease indexes were correlated, only in three cultivars fluctuated markedly probably due to heterogeneity of the used PB isolates randomly collected from the infested field. The next possible explanation for variation of recorded disease indexes may be a genetic heterogeneity of plant material in the range of observed rutabaga varieties. The obtained results will be verified under field conditions. Key words: Plasmodiophora brassicae Wor., Brassica napus var. napobrassica (L.) Rchb., varieties, disease index Úvod Nádorovka kapustová (Plasmodiophora brassicae (Wor.) - (dále PB) představuje biotrofního vnitrobuněčného parazita většiny druhů a rodů rostlin z čeledi Brassicaceae. PB způsobuje závažné onemocnění u hospodářsky významných i planých druhů nazývané nádorovitost brukvovitých. PB je řazena do třídy Phytomyxea (plasmodiofory) podříše Rhizaria ze skupiny Protista (Neuhauser et al. 2010; Hwang et al. 2012). Ve formě spor běžně přežívá v půdě až desítky let a za vhodných podmínek napadá kořeny rostlin. Způsobuje jejich zbytnění, tvorbu kořenových nádorů, postupný rozpad pletiv a tím omezené zásobení nadzemních částí rostlin živinami a vodou (Hwang et al. 2012). V konečném důsledku dochází ke snižování výnosu napadených rostlin a může docházet až k celkovému zničení porostů. Optimální podmínky pro rozvoj choroby jsou 20 až 25 C, ph 5,0 až 6,0 (Kasinathan 2012) a půdní vlhkost 70 až 90 % (Rod 2006), choroba se nevyskytuje jen na silně alkalických a vápenitých půdách (Dixon 2009). Tím je předurčeno i její celosvětové rozšíření především do oblastí mírného pásma Evropy, Asie, Ameriky a Austrálie, kde jsou zaznamenávány největší negativní dopady na produkci zemědělsky významných brukvovitých plodin (Manzanares-Dauleux 2001, Hatakeyama et al. 2004, Dobson et al. 1983, Strelkov et al. 2011, Donald et al. 2006). 37

38 B. napus je amfidiploid druhů B. oleracea a B. rapa, má nízkou vnitrodruhovou genetickou variabilitu, která je pro jednotlivé taxony postupně rozšiřována o geny pocházející z původních druhů (Diederichsen et al. 2009). Rezistence B. napus k PB je dána převážně rasově specificky. Rezistence je kontrolována jednotlivými nezávislými dominantními geny a částečně kvantitativně pomocí minoritních QTLs (lokusů kvantitativních znaků) s epistatickým efektem (Werner et al. 2008). Obtížnost kontroly rezistence brukvovitých vůči PB je dána také vysokou variabilitou patogenity jednotlivých ras PB, jejich diverzitou a celosvětově jejich dosud málo objasněnou distribucí (Manzanares-Dauleux et al. 2001). Rozšíření virulentních pathotypů PB bylo obecně velmi nízké, okolo 3,5-10 % pozemků používaných k pěstování brukvovitých plodin (Crete 1981), místy dosahovalo zamoření pozemků max. 20 % (Landry et al. 1992), jen v Austrálii až 70 % (Donald et al. 2006). S rozšiřováním pěstování řepky olejky (B. napus ssp. oleifera (DC.) Metzg. var. annum) dochází i přes doporučované střídání plodin ke stále většímu zamořování pěstebních oblastí. Jako ochrana plodin na zamořených pozemcích může sloužit nákladné chemické ošetření půd aplikací fungicidů, zavápnění (Howard et al. 2010; Strelkov et al. 2011) či pěstování vychytávacích předplodin jako ředkev olejná (Raphanus sativus var. oleifera), oves setý (Avena sativa L.) nebo jílek vytrvalý (Lolium perenne L.), které stimulují vyklíčení trvalých spor PB bez jejich dalšího vývoje a jsou tak schopny snižovat koncentraci spor PB v půdě (Chytilová and Dušek 2007). Přesto stále zůstává nejefektivnějším způsobem kontroly pozemků zamořených PB a omezujícím ekonomické ztráty při produkci brukvovitých plodin, pěstování rezistentních kultivarů (Diederichsen et al. 2009). Proto i pro pěstování tuřínu (Brassica napus var. napobrassica (L.) Rchb., vzrůstá význam rezistentních odrůd, jejich výběr a šlechtění. Cílem práce bylo otestovat odolnost 12 vybraných položek tuřínu za kontrolovaných podmínek kultivační komory a následně doporučit vybrané rezistentní genotypy pěstitelům a šlechtitelům k dalšímu šlechtění a využití. Materiál a metody Analýzy byly prováděny u souboru 12 vybraných genotypů tuřínu (Brassica napus var. napobrassica (L.) Rchb.) z genofondové kolekce zelenin VÚRV, v.v.i., Centra aplikovaného výzkumu zelenin a speciálních plodin Olomouc. Pasportní údaje položek jsou uvedeny v databázi EVIGEZ (http://genbank.vurv.cz/genetic/resources/asp2/default_c.htm). Rostliny byly pěstovány za standardních podmínek (14 h osvětlení/23 C, 10 h tma/15 C) v inertním semisterilním materiálu (perlitu) a inokulovány závlahou "spodem" do misek roztokem obsahující 10 7 spor PB v 1 ml. Inokulum bylo připraveno dle metodiky Chytilová a Dušek (2007) ze směsného izolátu odvozeného z náhodně odebraných vzorků z infekčního pole. Následně po 8 týdnech kultivace byla pro jednotlivé genotypy stanovena intenzita napadení rostlin podle stupnice Buczacki et al. (1975) v rozsahu 0-3 a byl proveden výpočet indexu napadení (DI) podle Chytilová a Dušek (2007). Jednotlivé genotypy byly testovány ve třech nezávislých opakováních vyhodnocených: 1. ( ), 2. ( ), 3. ( ). Celkem bylo hodnoceno 1285 rostlin, průměrně 33 rostlin na variantu a jedno opakování. Jako kontrola byla použita univerzální citlivá odrůda pekingského zelí (Brassica rapa var. pekinensis Hanelt) cv. Granaat (09H ). Výsledky a diskuse Předběžné výsledky studia odolnosti vybraných položek tuřínu vůči nádorovitosti brukvovitých vykazovaly široké spektrum odolnosti od velmi rezistentních genotypů po genotypy extrémně citlivé. Při srovnání průměrů procent napadení rostlin z jednotlivých genotypů a indexů napadení (DI = disease indexes), se jako nejodolnější vůči PB a téměř bez příznaků choroby ukázaly odrůdy Debra - evidenční č.: 09H , pocházející z roku

39 z USA a obě položky odrůdy Marian pocházející z různých zdrojů - 09H z Anglie od šlechtitele Hurst z r. 1981; 09H od šlechtitele Charles Sharpe z r. 1985, Unknown cultivar - 09H , pocházející z roku 1996 z USA a Landrace (Terchová) - 09H , pocházející ze sběrové expedice Orava 1995 ze Slovenské republiky. Většina těchto genotypů měla 100 % rostlin se stupněm napadení 0-1, pouze genotyp Landrace (Terchová) měl jen 99 % rostlin se stupněm napadení 0-1. Průměrný index napadení rostlin (DI) pro všechna tři opakování u jmenovaných genotypů byl 1 nebo nižší, jen Landrace (Terchová) měl index napadení 4 (Tab. 1, Obr. 1, 2), což ve všech případech indikuje vysokou odolnost vůči PB. Indexy napadení v průběhu jednotlivých opakování experimentů byly většinou velmi podobné a vzájemně korelovaly. Tab. 1: Srovnání odolnosti odrůd tuřínu k nádorovitosti brukvovitých (PB) podle % stupně napadení a indexu napadení (DI) celkově a u jednotlivých nezávislých opakování experimentu evidenční číslo genotypu název genotypu celkové % rostlin ve stupni napadení 1. a 2. opakování % rostlin ve stupni napadení opakování % rostlin ve stupni napadení průměrný index napadení celkem index napadení (DI) v průběhu opakování číslo H Granaat H Milevský H Landrace (Terchová) H Perfection H Croppa H Apin H Debra H Unknown cultivar H Laurentian H Marian H Marian H Hugry Gap H Dalibor Jako pozitivní kontrola sloužila citlivá odrůda pekingského zelí (Granaat) - 09H Hodnoty v průběhu 1. a 2. opakování experimentu indikovaly vysokou odolnost (zeleně), zatímco v průběhu 3. Opakování vysokou citlivost (žlutě) u odrůd Laurentian, Hugry Gap a Dalibor. Celkové hodnoty (modře). Vysokou rezistenci vykazovaly rovněž genotyp Milevský - 09H , registrovaná odrůda v letech , zařazená do kolekce v roce 1980 od šlechtitele SEMPRA, Turnov, a genotyp Apin - 09H , pocházející z roku 1996 z USA, které měly 92 % a 87 % rostlin vykazujících stupeň napadení 0-1 (Tab. 1, Obr. 1), 2 % a 6 % rostlin bylo hodnoceno také stupněm napadení 2 a oba genotypy měli 6 % a 7 % rostlin hodnocených stupněm napadení 3 (Tab. 1). Všechny tyto citlivé rostliny se překvapivě objevily v rámci jednoho opakování experimentu, kdy index napadení dosahoval 16 a 18. Průměrný index napadení pro odrůdu Milevský byl 8 a pro odrůdu Apin 11 (Tab. 1, Obr. 2). Podobně překvapivý rozdíl v rámci daného experimentu vykazovaly i odrůdy Dalibor - 09H původem z České republiky z roku 2006, HugryGap - 09H pocházející z roku 1985 od šlechtitele DI

40 Charles Sharpe, pravděpodobně z Anglie a Laurentian - 09H pocházející z roku 1996 z USA. Všechny tři odrůdy se jevili ve dvou nezávislých opakováních jako odrůdy vysoce rezistentní s převahou rostlin hodnocených stupněm napadení 0-1 (průměrně 98 %, 76 %, 99 %), stupeň napadení 2 byl průměrně u 1 %, 22 %, 0 % rostlin a stupeň napadení 3 byl u 1 %, 2 % a 1 % rostlin, index napadení u těchto genotypů byl 30, 53 a 40 (Tab. 1). Naopak jedno opakování vykazovalo pouze 31 %, 4 % a 4 % rostlin hodnocených stupněm napadení 0-1, 16 %, 31 % a 21 % rostlin se stupněm napadení 2 a 53 %, 65 % a 75 % rostlin se stupněm napadení 3 (Tab. 1). Tento experiment rovněž vykazoval velmi vysoké hodnoty indexu napadení, 65, 87, a 90, což odpovídá velmi vysoké citlivosti rostlin k PB. Průměrné hodnoty ze všech tří opakování klasifikují odrůdu Dalibor jako částečně rezistentní s průměrně 71 % rostlin hodnocených stupněm napadení 0-1 (Tab. 1, Obr. 1) a s indexem napadení 30 (Tab. 1, Obr. 2) a odrůdy Hugry Gap a Laurentian s průměrně 39 % a 58 % rostlin hodnocených stupněm napadení 0-1 a indexem napadení 53 a 40 (Tab. 1, Obr. 1, 2) jako méně odolné, ale stále rezistentní genotypy. Tato vysoká variabilita v rámci různých nezávislých experimentů mohla být způsobena heterogenitou použitých izolátů PB odvozených z náhodně odebraných vzorků z infekčního pole, které pravděpodobně mohly obsahovat směs různě agresivních a dosud neurčených ras patogena. Částečně mohla ke zvýšení této variability přispět i předpokládaná genetická heterogenita rostlinného materiálu a subjektivní pohled experimentátora v průběhu hodnocení rostlinného materiálu. Obr. 1: Porovnání odolnosti genotypů tuřínu vůči nádorovitosti brukvovitých (PB) podle procenta rostlin hodnocených stupněm napadení 0-1. Jako nejcitlivější k napadení PB byly prokázány dvě odrůdy pocházející z roku 1996 z USA, Croppa - 09H a Perfection - 09H , které měly pouze 17 % a 5 % rostlin hodnocených stupněm napadení 0-1 (Tab. 1, Obr. 1), zatímco 35 % a 28 % rostlin bylo hodnoceno stupněm napadení 2 a 48 % a 67 % rostlin vykazovalo stupeň napadení 3 (Tab. 1). Současně index napadení v jednotlivých nezávislých opakováních ve všech případech většinou přesahoval 65, pro genotyp Croppa to bylo 73, 65 a 77 s průměrnou hodnotou 72 (Tab. 1, Obr. 2) a pro genotyp Perfection to představovalo hodnoty 93, 66, 93 z čehož dvě hodnoty indexu napadení dokonce přesáhly 80, což představuje extrémní citlivost k napadení PB. Průměrná hodnota indexu napadení byla pro genotyp Perfection 86, což je velmi blízké výsledkům získaným pro kontrolní vysoce citlivou odrůdu pekingského zelí - Granaat 40

41 (09H ), kde průměrný index napadení byl 87 (Tab. 1, Obr. 2) a hodnoty pro jednotlivá nezávislá opakování experimentu byly 94, 91 a 78. Zde podobně jako pro odrůdu Perfection, bylo pouze několik rostlin hodnoceno stupněm napadení 0-1 (2%) - (Tab. 1, Obr. 1) a většina rostlin byla hodnocena stupněm napadení 2 (35 % rostlin) a stupněm napadení 3 (63 % rostlin) - (Tab. 1). Obr. 2: Porovnání odolnosti genotypů tuřínu vůči nádorovitosti brukvovitých (PB) podle průměrného indexu napadení (DI). Pro šlechtitele má velký význam doporučení vhodných rezistentních odrůd. Aby bylo možné spolehlivě charakterizovat a dále doporučit konkrétní odrůdu, je třeba naše předběžné výsledky nejprve ověřit v podmínkách infekčního pole. Přestože kultivační komora umožňuje stabilnější podmínky pěstování, teplotu, osvětlení a pravidelnou závlahu, je nezbytné pro jednotlivé genotypy hodnotit výnosy konzumních částí jednotlivých rostlin na infekčním poli ve srovnání s výnosem na nezamořeném pozemku na základě zjišťování koeficientu tolerance (K t ). Teprve komplexní analýza chování rostlin jednotlivých genotypů za různých podmínek kultivace a za různě intenzivního tlaku ze strany patogena může pomoci určit rezistentní odrůdy vhodné pro další šlechtění a pěstování. Závěr Testování vybraných odrůd tuřínu vůči nádorovitosti brukvovitých v kontrolovaných podmínkách v pěstební komoře VÚRV, v.v.i. v Olomouci vyhodnotilo jako nejodolnější položky odrůdy Debra a Marian. Vysokou rezistenci vykazovaly rovněž genotypy Unknown cultivar, Landrace (Terchová), Milevský a Apin. Jako nejcitlivější se ukázaly odrůdy Croppa a Perfection. Aby bylo možné doporučit nejodolnějších položky k rezistenčnímu šlechtění, budou výsledky nejprve ověřeny v polních podmínkách, rostliny budou otestovány na rezistenci k PB na infekčním poli udržovaném na pozemcích VÚRV, v.v.i. v Olomouci. Dedikace Výsledky vznikly s podporou výzkumného záměru MZe ČR , grantu ED0007/01/01 Centrum regionu Haná pro biotechnologický a zemědělský výzkum. 41

42 Použitá literatura Buczacki S.T., Toxopeus H., Mattusch P., Johnston T.D., Dixon, G.R. Hobolth, G.R.: Study of physiological specialization in Plasmodiophora brassicae: proposals for attempted rationalisation through an international approach. Transaction of the British Mycological Society, 65: , Crete R: Worldwide importance of clubroot. Clubroot Newsl 11:6 7, 1981 Diederichsen E., Frauen M., Enrico C., Linders G.A., Hatakeyama K., Hirai M.: Status and perspectives of clubroot resistance breeding in crucifer crops, J. Plant Growth Regul., 28: , Dixon G.R.: Plasmodiophora brassicae in its Environment, J. Plant Growth Regul., 28: , Dobson R.L., Robak J., Gabrielson R.L.: Pathotypes of Plasmodiophora brassicae in Washington, Oregon and California. Plant Dis., 67/3: , Donald E.C., Cross S.J., Lawrence J.M., Porter I.J.: Pathotypes of Plasmodiophora brassicae, the cause of clubroot, in Australia. Ann. Appl. Biol. 148: , Hatakeyama K., Fujimura M., Ishida M., Suzuki T.: New classification method for Plasmodiophora brassicae field isolates in Japan based on resistance of F1 cultivars of chinese cabbage (Brassica rapa) to clubroot. Breed. Sci., 54: , Howard R.J., Strelkov S.E., Harding M.W.: Clubroot of cruciferous crops new perspectives on an old disease. Can. J. Plant Pathol., 32/1: 43-57, Hwang S.F., Strelkov S.E., Feng J.: Plasmodiophora brassicae: a review of an emerging pathogen of the Canadian canola (B. napus) crop. Mol. Plant Path., 13/2: , Chytilová V., Dušek K.: Metodika testování odolnosti brukvovitých plodin k nádorovitosti. Metodika pro praxi, Výzkumný ústav rostlinné výroby, v.v.i., pp.19, Kasinathan H.: Influence of ph, temperature, and biofungicides on clubroot of canola. MSc. Thesis, Guelph, Ontario, Canada: pp. 156, Landry B.S., Hubert N., Crete R., Chiang M.S., Lincoln S.E., Etoh T.: A genetic map for Brassica oleracea based on RFLP markers detected with expressed DNA sequences and mapping of resistance genes to race 2 of Plasmodiophora brassicae (Woronin). Genome 35: , Manzanares-Dauleux M.J., Divaret I., Baron F., Thomas G.: Assessment of biological and molecular variability between and within field isolates of Plasmodiophora brassicae - RAPD. Plant Pathol., 50: , Neuhauser S., Bulman S., Kirchmair M.: Chapter 3 Plasmodiophorids: The challengeto understand soil-borne, obligate biotrophs with a multiphasic life cycle. In: Gherbawy Y., Voigt K. (Eds.), Molecular Identification of Fungi, pp , Rod J.: Plasmodiophora brassicae původce nádorovitosti brukvovitých. In: Lebeda A., Mazáková J., Táborský V. (eds): Protozoa a Chromista. Taxonomie, biologie a hospodářský význam. Č. Fytopatol. Spol., Praha: 92, Strelkov S.E., Hwang S.E., Howard R.J., Haartman M., Turkington T.K.: Progress towards the sustainable management of clubroot (Plasmodiophora brassicae) of canola on the Canadian prairies. Prairie Soils & Crops Journal, 4: , Werner S., Diedrichsen E., Frauen M., Schondelmaier J., Jung C.: Genetic mapping of clubroot resistance genes in oilseed rape. Theor. Appl. Genet., 116: , Kontaktní adresa: Bc. Pavel Kopecký Centrum regionu Haná pro biotechnologický a zemědělský výzkum, Oddělení genetických zdrojů zelenin, léčivých rostlin a speciálních plodin, Výzkumný ústav rostlinné výroby, v.v.i., Šlechtitelů 11, Olomouc, 42

43 REZISTENCE ŠKODLIVÝCH ORGANISMŮ VŮČI PESTICIDŮM Resistance of harmful organisms to pesticides Kolařík P., Rotrekl J. Zemědělský výzkum, spol. s r.o. Troubsko Abstrakt Opakovaným používáním insekticidních přípravků dochází v populaci hmyzích škůdců polních plodin k vyselektování méně citlivých jedinců proti registrovaným přípravkům. Dle dostupných informací můžeme potvrdit rezistentní populace u blýskáčka řepkového, mandelinky bramborové či obaleče jablečného. Ke zmírnění tohoto negativního jevu je nutné dodržovat předem stanovená doporučení v rámci antirezistentní strategie. Jedná se zejména o aplikaci pesticidů pouze na základě monitoringu výskytu škůdce a jeho překročení prahu škodlivosti, střídání přípravků s různým typem účinné látky v jednom roce, ale i mezi roky na větších plochách. Klíčová slova: rezistence; hmyzí škůdci; insekticidy; ozimá řepka; blýskáček řepkový; Abstract Repeated use of insecticides occurs in the population of insect pests of field crops selected by the less sensitive individuals against the insecticides. According to information available, we can confirm resistant pollen beetle populations in OSR, potato beetles, and codling moth. To mitigate this negative effect can be recommended adherence to predetermined recommendations of the strategy antiresistence, application of pesticides only on the basis of monitoring and crossing the threshold of harm, as well as alternating products with different active substance, and in one year and between years on larger surfaces. Keyword: resistence; insect pests; insecticides; OSR; pollen beetles; Rezistence (odolnost) je vlastnost všech živých organismů, od jednobuněčných až po savce. Dle definice Světové zdravotnické organizace (WHO) je to schopnost členovců přežívat dávky insekticidů, které působí hynutí většiny jedinců normální populace. Existuje též rezistence na antibiotika, ostatní léky atd., obecně je to schopnost organismu nereagovat na působení dané látky. Je možné kvantifikovat rezistenci populace z poměru hodnot: LD50 pro sledovanou rezistentní populaci a LD50 pro kontrolní populaci. Jedná se o množství látky, po které uhynulo 50 % testovaných živočichů za 24 hodin po expozici. Zkratka je z anglického Lethal Dose, 50 % (HRUDOVÁ, 2008). Rezistence je dědičná a představuje fyziologické přizpůsobení populace vlivem selekce. Rezistence vzniká mutací genů, nebo následkem rekombinací genů pod selekčním tlakem tzn. dlouhodobá aplikace stejného typu účinných látek (STARÁ a KOCOUREK, 2009). Také může být dědičná. Rychlost vzniku rezistence je závislá na mnoha faktorech. Při trvalém selekčním tlaku rezistentní populace vzniká již ve 12 generaci. V roce 1980 byla zjištěna rezistence u 428 druhů hmyzu, z čehož necelá polovina představovala zdravotní rizika. Ze známých druhů nejčastěji vykazují rezistenci moucha domácí, rus domácí a vši dětské. Obecně ty druhy, které mají krátký generační cyklus a tedy rychlou reprodukci. (HRUDOVÁ, 2008). Protože nové vlastnosti a obranné mechanismy nejsou vždy zcela specifické jen pro jednu látku, může se rezistence projevovat i vůči jiným přípravkům nebo dokonce vůči jiné skupině účinných látek. Tento jev je označován jako zkřížená rezistence. Objevem insekticidů DDT (dichlor-difenyl-trichlorethan) a HCH (hexachlorcyclohexan) ve čtyřicátých letech minulého století se zdálo, že boj s hmyzem je natrvalo vyřešen. Nízká cena, jednoduchá výroba a levné a jednoduché aplikační metody předpokládaly masové využívání těchto přípravků v zemědělství. Uplatňovaly se i při používání v boji s komáry přenášející malárii, ale i dalšími vektory mouchy tse-tse přenášející spavou nemoc a celou řadou 43

44 dalších chorob, včetně vší a blech v mírných pásech světa. Tyto přípravky se používaly i přes vedlejší negativní účinky jejich působení na necílové organismy. I u těchto přípravků se začaly projevovat příznaky resistence proti jejich účinku v místech opakovaného používání. Zjistilo se, že všechny tyto insekticidy ovlivňují nejenom hmyz, ale dochází ke kumulaci v orgánech a jsou tak velmi nebezpečná pro člověka i zvířata (SKUHRAVÝ, 2008). Proto se začaly vyvíjet insekticidy mající jiné chemické složení (karbamáty, organofosfáty a pyrethroidy), přípravky mající dlouho či krátkodobou účinnost nebo specifické vůči jednomu druhu či skupině, avšak tolerantní vůči ostatním druhům a užitečné entomofauně a zároveň neškodné pro včely. V souvislosti se ztrátou citlivosti hmyzích škůdců vůči pyretroidům se považují za důležité především dva mechanismy rezistence. Ztráta citlivosti cílového místa (kdr) a metabolická rezistence. Ve vývoji metabolické rezistence hrají zásadní roli enzymatické skupiny, pro které je typický široký rozsah substrátové specifity cytochrom P450 monooxygenázy, karboxylesterázy a (GST) glutation-s-transferázy (SEIDENGLANZ et al., 2010). Rezistentní kmeny (populace) vykazují sníženou citlivost neuronů k pyrethroidům, pyretrinům a DDT jde o tzv. knock-down resistance (kdr). Pokusy prokázaly existenci super-kdr, která má vyšší úroveň než předchozí. Dalším mechanismem rezistence je snížení permeability (propustnosti) kutikuly. Insekticid není propouštěn, jelikož v buněčných membránách, kutikule hmyzu a v tukovém tělese je tzv. P - glykoprotein. Ten tvoří póry ve dvojvrstvě lipidů, ATP jimi transportuje některé škodliviny (i pesticidy) ven z buněk. Rezistentní populace mají P- glykoproteinu v několikanásobné koncentrace. Mezi další typy rezistencí můžeme zařadit cross rezistenci, kdy po selekci jedním přípravkem je rezistentní populace méně citlivá i k přípravkům, se kterými dosud nepřišla do styku obvykle se vyskytuje společně u organofosfátů a pyretroidů. Kombinovaná rezistence znamená, že dva nebo více mechanismů působí proti jedné účinné látce. Dále můžeme uvést behaviorální rezistenci. To je rezistence podmíněná chováním. Živočich vyvinul mechanismus umožňující vyhnout se kontaktu s toxickou látkou (HRUDOVÁ, 2008). Rezistence vůči insekticidům jako projev je obvykle výsledkem kombinace několika mechanizmů rezistence a není jednoduché odlišit obzvláště na fenotypové úrovni (při hodnocení projevu různým dávkám insekticidům) vlivy jednotlivých podílejících se mechanismů v kvantitativním smyslu (SEIDEGLANZ, POSLUŠNÁ, 2009 b). V souvislosti s rezistencí hmyzích škůdců vůči pyrethroidům se považují za důležité především dva mechanismy rezistence ztráta citlivosti cílového místa a metabolická rezistence (SCOTT, 1991). Pokud zasažení jedinci přežívají i po přímém kontaktu nebo i přítomnosti pesticidu v jejich těle, označuje se taková rezistence jako fyziologická. Jednoduchá rezistence se vztahuje k jedinému mechanismu rezistence, který obvykle chrání organismus před selekční látkou (či látkami příbuznými) a který je odpovědný za specifické spektrum resistence, přičemž povaha spektra závisí na mechanismu rezistence a měla by být nezávislá na použitém selekčním agens. Rezistence podmíněná chováním je změna chování škůdce, kterým se snižuje pravděpodobnost jejich kontaktu s pesticidem. Kombinovaná rezistence podílí se dva nebo více mechanismů na společné ochraně vůči pesticidu. Křížová (cross) nebo také spřažená rezistence, představuje jev, k němuž dochází pokud vývoj fyziologické rezistence vůči dané látce má za následek nutnost v rezistentní populaci zvyšovat dávky ve srovnání s dávkami postačujícími pro úmrtnost populace (LOKAJ, 2007). Jedním z důvodů vývoje rezistence vůči pyrethroidům může být i nařízení Evropské unie o přípravcích na ochranu rostlin, kde se počet účinných látek použitelných pro minimalizaci škod způsobených hmyzími škůdci neustále snižuje. K využívaným metodám diagnostiky rezistence patří biologické, genetické a metabolické metody. U kontaktních biologických metod využíváme např. topikální, tarsální, ponořovací 44

45 test a dále požerový test. Mezi genetické metody řadíme detekci bodových mutací genů metodou PCR. Detekce enzymů a jejich aktivity jsou využívány u metabolických metod, jedná se o tzv. proteomickou metodu (STARÁ a KOCOUREK, 2010). Metoda topikalní aplikace insekticidů se využívá především na housenkách. Pro testy se používají insekticidy rozpustné ve vodě, dále účinné látky rozpuštěné v acetonu nebo tetrahydrofuranu, podle rozpustnosti dané látky. Insekticidní jícha se aplikuje dávkovačem nebo mikropipetou o objemu 1µl. Před aplikací insekticidní jíchy je třeba místo aplikace potřít štětečkem navlhčeným v acetonu, aby byla umožněna penetrace přípravku přes kutikulu. Každá koncentrace je testována na housenkách. Po aplikaci jsou housenky umístěny do plastových misek s ruličkami vlnité lepenky. Každá miska představuje jednu variantu. Inkubace se provádí v klimatizovaném boxu při teplotě 25 C a fotoperiodě 16L:8D. vyhodnocení mortality se provádí po vylíhnutí motýlů v kontrolní neošetřené variantě (STARÁ a KOCOUREK, 2007). Tato metoda je méně vodná pro testování blýskáčků z důvodu velké aktivity imag. Je totiž důležité tyto insekticidy aplikovat na konkrétní část těla. Vhodná metoda testování blýskáčků je podle metody č. 11 (dle IRAC) tzv. lavičkový test. Při této metodě testovaní dospělci přicházejí do styku s účinnou látkou, která je nanášena na povrh testovacích lahviček ve předem stanovených koncentracích. Vlastní vyhodnocení je prováděno v předem stanovených časových intervalech, přičemž vyhodnocení jedinců je prováděno do skupin dle jejich životních projevů (živí, postižení a mrtví). Rezistence blýskáčka proti pyrethroidům se stává velkým problémem v západní Evropě, zejména Francii a Německu (ACKERMANN et al., 2008). Od roku 2009 se začíná významněji projevovat také v ČR rezistence dospělců blýskáčka proti insekticidům (SEIDEGLANZ, POSLUŠNÁ, 2009 b). V České republice jsou používány proti blýskáčkům více jak 20 let pyretroidy typu II. - lambda-cyhalothrin, deltamethrin, alphacypermethrin, zeta-cypermethrin, cypermethrin, esfenvalerate (ŠKUTOVÁ et al., 2009). Obsahují alfakyano 3-fenoxybenzyl skupinu, reverzibilně blokují sodíkové kanály nervových vláken a navíc ovlivňují GABA receptory v nervových vláknech. Dále jsou známé pyrethroidy typu I. neobsahují alfa-kyano skupinu, např. permethrin. Reverzibilně blokují sodíkové kanály nervových vláken. Pyrethroidy jsou syntetické chemické sloučeniny podobné přírodním látkám pyretrinům produkovaným květinami (http://cs.wikipedia.org, 2010). Pyretrin je extrakt z květů chryzantémy starčkolisté (Chrysanthemum cinerariaefolium), proti hmyzu byl poprvé použit kolem roku 1850 (PROKINOVÁ, 2010). Pyrethroidy jsou běžnou složkou komerčních výrobků, například domácích insekticidů a repelentů. V koncentracích používaných v těchto produktech jsou obecně pro člověka neškodné. Pyrethroidy jsou axonovými jedy, účinkují blokací sodíkových kanálů neuronových membrán hmyzu v otevřeném stavu. Sodíkový kanál je malý otvor, kterým mohou sodíkové ionty vstupovat do axonu a způsobovat excitaci. Protože se nervy nemohou odexcitovat, je hmyz paralyzován. Pyrethroidy se obvykle kombinují s piperonylbutoxidem, známým inhibitorem klíčových mikrosomálních oxidázových enzymů. To zabraňuje těmto enzymům odstraňovat pyrethroidy z těla hmyzu a zajišťuje, že účinek pyrethroidů bude smrtelný a ne pouze paralytický (http://cs.wikipedia.org, 2010). Lambda-cyhalothrin je insekticid registrovaný US Environmental Protection Agency (EPA) v roce Je podobný pyrethroidu cyhalothrinu (http://npic.orst.edu, 2001). Jedná se o nesystémový pyrethroid. Usmrcuje hmyz jako dotykový a požerový jed. Působí zejména proti žravým škůdcům - Lepidoptera, Coleoptera jako kontaktní jed s výraznou účinností. Dále má velmi dobrou účinnost na savý hmyz - Homoptera. Výsledkem rezistence hmyzu k insekticidům je snížená účinnost používaných přípravků, ztráty na produkci a zvýšené náklady na ochranu při opakovaných aplikacích (STARÁ a 45

46 KOCOUREK, 2009). K prevenci vzniku rezistence patří střídání přípravků s různými účinnými látkami, omezení četnosti aplikací přípravků. Používání přípravků s nižší perzistencí v prostředí, monitoring úrovně rezistence a zachování refugií pro citlivé populace (HRUDOVÁ, 2008). Příčiny, které způsobují zvýšené riziko vzniku rezistentních populací blýskáčka řepkového jsou vysoká intenzita chemické ochrany proti hmyzím škůdcům na řepce, omezené spektrum účinných látek insekticidů aplikovaných do řepky. Dále mezi ně můžeme zařadit zvýšení ploch osevů ozimou řepkou (vysoký podíl v osevních postupech), koncentrace pěstování řepky v regionu a teplotně příznivější roky. Dospělci i larvy blýskáčka jsou vystaveni selekčnímu tlaku insekticidů po celou dobu květu řepky a nejenom jí. Dospělci blýskáčků se vyskytují i na dalších plodinách (mák, slunečnice, hořčice, jarní řepka, jetele aj.) kde se živí pylem a kde jsou aplikovány další insekticidní přípravky proti dalším významným škůdcům. Selekční tlak na vznik rezistentních populací blýskáčka řepkového se tak i v období poklesu jeho škodlivosti paradoxně zvyšuje (STARÁ a KOCOUREK, 2009). Co se týče konkrétně případu blýskáčka řepkového (Meligethes aeneus F.) a pyrethroidů, vyplývá z posledních studií, že hlavní podíl na rezistenci je zde možné přičítat mechanismu metabolické rezistence a to konkrétně důsledkům zvýšení hladin monooxygenáz u méně citlivých (či až zcela necitlivých) jedinců. Někteří jedinci se tak díky své lepší enzymatické výbavě dokáží s insekticidem vypořádat, odbourat ho (SEIDENGLANZ et al., 2010). V roce 1999 byly k dispozici první zprávy o snížené účinnosti insekticidů pyrethroidů, při používání k ochraně proti blýskáčku řepkovému (Meligethes aeneus) v severovýchodní Francii. V následujících sedmi letech došlo k rychlému šíření rezistentních populací k pyrethroidům v mnoha oblastech Evropy. Selhání syntetických pyrethroidů v ochraně proti blýskáčku řepkovému bylo potvrzeno jako specifický rezistentní mechanismus. Monitoring ukázal, že se rezistentní populace rozšířila v několika evropských zemích, jako je Francie, Německo a Polsko. Populace z Velké Británie a Rakouska zůstávají především citlivé k pyrethroidům (SLATER a NAUEN, 2007). Podle výsledků byly populace zařazeny do pěti skupin citlivosti: vysoce citlivé, citlivé, středně odolné, odolné a vysoce odolné populace (IRAC, 2008). V roce 2007 odpovědělo osm evropských zemí, že problémy s rezistencí blýskáčků proti insekticidům dosud nezaznamenalo. K těmto zemím patřila i Česká republika (dále: Rakousko, Estonsko, Maďarsko, Irsko, Lucembursko, Slovensko a Slovinsko). V Rakousku však ještě v roce 2007 výskyt rezistentních blýskáčků potvrdili. Mezi státy, které v anketě odpověděly, že rezistenci zaznamenaly, patří: Polsko, Francie, Lotyšsko, Dánsko, Švédsko, Belgie, Švýcarsko, Německo, Nizozemsko, Norsko, Chorvatsko a Velká Británie (SEIDENGLANZ a POSLUŠNÁ, 2009 b). V současné době již Česká republika patří k zemím, kde je snížená citlivost blýskáčka řepkového k pyrethroidům potvrzena. U mandelinky bramborové byla prokázána rezistence k celé řadě typů účinných látek. V roce 1988 byla publikována zpráva o rezistenci k několika látkám (carbofuran, endosulfan a další) v Kanadě. V USA byla rezistence zaznamenána v roce 1995 a v posledních letech byla zjištěna také v Evropě. V Rumunsku byla potvrzena rezistence mandelinky bramborové k alpha-cypermethrinu a v Polsku se objevila rezistence k některým pyrethroidům. V roce 1972 byly získány první data potvrzující rezistenci k organofosfátům a karbamátům. Zároveň byla potvrzena rezistence mandelinky bramborové i na několika lokalitách v Srbsku (NAĎOVÁ et al, 2006). V Československu byla rezistence zaznamenána k lindanu (BHC) a k DDT. Od té doby se situací k tomuto škůdci v České republice nikdo nezabýval. Dle posledních studií byla zjištěna snížená citlivost mandelinky k acetamipridu, kdy mortalita testovaných vzorků 46

47 dosahovala pouze 2 %. Přípravek Nurelle D nebyl v doporučené dávce dostatečně účinný na většinu testovaných vzorků. V řadě evropských zemí byla v 90. letech zjištěna rezistence u obaleče jablečného k širokému spektru přípravků, zahrnujících vedle organofosfátů, pyrethroidů a karbamátů i inhibitory syntézy chitinu a juvenoidy. V Itálii byla zjištěna rezistence k diflubenzuronu (Dimilin) a dalším účinným látkám, jako je indoxacarb (Steward) a tebufenozid (Mimic) v roce V roce 1996 se rezistence obaleče jablečného k diflubenzuronu vyskytla také ve Švýcarsku a byla potvrzena rovněž rezistence k tebufenozidu, fenoxycarbu (Insegar), deltamethrinu (Decis) a phosalonu (Zolone). V roce 1998 byl zjištěn nárůst rezistence obaleče k diflubenzuronu, deltametrinu a phosalonu také ve Francii. Cross-rezistence byla zaznamenána i vůči dalším účinným látkám, jako je teflubenzuron (Nomolt), tebufenozid, bifenthrin (Talstar) a lambda-cyhalothrin (Karate). V České republice nebyla vzhledem k relativně nízké intenzitě chemické ochrany rezistence k insekticidům tak závažným problémem, jako například v USA a v zemích západní Evropy. V posledních letech však přibývají v ČR zprávy o snížené účinnosti některých insekticidů proti obaleči jablečnému, což působí pěstitelům ztráty. V současné době je riziko výskytu rezistentních populací obaleče jablečného u nás naštěstí poněkud sníženo díky registraci nových insekticidů (Integro, Steward) a pomocných prostředků ochrany rostlin (Isomate C plus). Přesto nás zkušenosti ze zahraničí varují, že rezistence obaleče může vzniknout i k látkám, u kterých se s podobným rizikem nepočítalo. Důkazem je vznik rezistence obaleče jablečného v Německu k přípravku na bázi viru granulózy, který byl dosud považován z hlediska možné rezistence za bezrizikový. Je tedy třeba s podobnými riziky počítat a včas je eliminovat pomocí řady opatření, kterým říkáme antirezistentní strategie. Základem je dodržování pravidel integrované ochrany, tj. aplikace pesticidů pouze na základě monitoringu výskytu obaleče a překročení prahu škodlivosti, střídání přípravků s různým typem účinné látky jednom roce, ale i mezi roky na větších plochách. Důležitá je zásada použití přípravků z jedné skupiny účinných látek maximálně dvakrát za sezónu. Preventivní metodou pro zabránění nástupu rezistence je metoda dezorientace založená na narušení sexuální komunikace obaleče plošnou aplikací syntetického feromonu (u nás registrován Isomate C plus). Tato metoda je z hlediska rizika nástupu rezistence bezpečná, protože dosud nebyla prokázána rezistence obaleče k feromonu. Další perspektivou jsou přípravky na bázi viru granulózy obaleče jablečného, jejichž registrace v ČR se v současné době připravuje. Jelikož již byla prokázána rezistence obaleče jablečného k viru granulózy, je tedy třeba s těmito preparáty zacházet obdobně jako s chemickými přípravky a dodržovat střídání s jiným prostředky ochrany. Nepřímo má vliv na zabránění výskytu rezistence také používání přípravků selektivních pro přirozené nepřátele škůdců. Podpora přirozených regulačních mechanismů umožňuje snížit potřebu použití chemických prostředků ochrany a v konečném důsledku tedy vede ke snížení rizika nástupu rezistence. Dedikace Výsledek byl získán za institucionální podpory na dlouhodobý koncepční rozvoj výzkumné organizace. Literatura Ackermann, P. et al.: Metodická příručka ochrany rostlin proti chorobám, škůdcům a plevelům. 1. vyd. Praha: Česká společnost rostlinolékařská, s. ISBN Hrudová, E.: Epidemiologie a gradologie: Prognóza vzniku rezistence škůdců vůči zoocidům. Výukové texty pro obor Rostlinolékařství. MZLU Brno,

48 IRAC, Controlling pollen beetle and combating insecticide resistance in oilseed rape. [online] [ ]. Dostupné z: IRAC, IRAC Pollen Beetle Working GroupPollen Beetle Resistance Monitoring [online] [ ]. Dostupné z: IRAC, IRAC Pollen Beetle Working GroupPollen Beetle Resistance Monitoring [online] [ ]. Dostupné z: Lokaj, Z. (2007): Taháky z fytofarmacie IV. Rostlinolékař, Praha ISSN Prokinová, E.: Pesticid je Úroda, 2010, Vol. LVIII, č. 1, s ISSN Seidenglanz, M., Poslušná, J.: Posuny v citlivosti blýskáčka na insekticidy. Úroda, 2009 a, Vol. LVII, č. 8, s ISSN Seidenglanz, M., Poslušná, J.: Výskyt reistence blýskáčka řepkového proti insekticidům v Evropě. Rostlinolékař, 2009 b, č. 1, s ISSN Seidenglanz, M., Šmirous, P., Rotrekl, J., Havel, J., Hrudová, E., Poslušná, J., Kolařík, P., Kolaříková, E., Mlýnská, J., Škutová, J.: Jak přeměnit antirezistentní strategii na antirezistentní postup v případě blýskáčka na řepce. Ochrana rostlin v pojetí nových předpisů Evropské unie. Soubor referátů přednesených na semináři pořádaném Českou společností rostlinolékařskou ve dnech 2. a 3. března 2010 v Praze Slater, R., Nauen, R.: The development and nature of pyrethroid resistance in the pollen beetle (Meligethes aeneus) in Europe. EPPO Workshop on insekticide resistence of Meligethes spp. (pollen beetle) on oilseed rape, Berlin. [online] [ ]. Dostupné.z: Stará, J., Kocourek, F.: Metodika hodnocení rezistence obaleče jablečného k insekticidům a návrhy antirezistentních strategií, s. 13. ISBN: [online] [ ]. Stará, J., Kocourek, F. Rizika výskytu rezistentních populací blýskáčka řepkového v ČR. [online] [ ]. Dostupné z:: Škutová., J. Kolaříková, E., Mlýnská, J., Hrudová, E., Seidenglanz, M., Poslušná, J., Kolařík, P.: Rezistence blýskáčka řepkového k pyrethroidům v okolí Brna. [online].2009.[ ].dostupné.z: Kontaktní adresa: Ing. Pavel Kolařík Agriculture Research, Ltd. Troubsko Troubsko, Zahradní 1 48

49 ALGINURE PROSTŘEDEK PRO ZVÝŠENÍ ODOLNOSTI ROSTLIN K HOUBOVÝM CHOROBÁM A JEHO VYUŽITÍ PROTI PŮVODCI STRUPOVITOSTI JABLONĚ (VENTURIA INAEQUALIS) Plant resistence improver Alginure and its use against Venturia inaequalis Bagar M., Psota V. BIOCONT LABORATORY, Brno Abstrakt Pomocný prostředek pro zvyšování odolnosti rostlin vůči chorobám Alginure byl testován pro využití proti původci strupovitosti jabloně Venturia inaequalis v ČR jako vhodný doplněk ochrany zejména v systému ekologického a nízkoreziduálního pěstování. Testována byla solo aplikace v maloparcelkovém pokuse v roce 2010, kde bylo dosaženo účinnosti 71% při dávce 3 l/ha a 87 % při dávce 5 l/ha. V letech 2011 a 2012 byl v poloprovozních pokusech testován efekt kombinace prostředku Alginure s kontaktními fungicidy na účinnost systému ochrany proti strupovitosti. 3-5 aplikací Alginure v dávce 4 l/ha výrazně zvyšuje efekt fungicidní ochrany oproti běžnému fungicidnímu systému. Výsledky z roku 2012 naznačují možnost snižování dávky. Klíčová slova: strupovitost, ochrana, ekologické pěstování, jabloně, ovoce Abstract Plant resistance improver Alginure was tested for use in apple scab (Venturia inaequalis) control in Czech Republic as a component of ecological and low residues apple production. Solo application was tested in small plot trial in The efficacy was 71% with 3 l/ha and 87% with 5 l/ha respectively. A combination of Alginure with chemical fungicides for effect on scab was tested in semifield trials in years 2011 and applications in dosage 4 l/ha significantly improves the effect of the scab control comparing to the standard fungicide control. The results from 2012 show that reduction of dosage is possible. Key words: apple scab, control, ecological, apple, fruit Úvod Původce strupovitosti jabloně, houba Venturia inaequalis je nejvýznamnější patogen na jabloních v podmínkách České republiky. Problémů v ochraně proti tomuto patogenu je několik. Jednak došlo k prolomení genu rezistence Vf, takže odrůdy nesoucí tento gen se v současnosti neobejdou bez přímé fungicidní ochrany (Vávra a Boček, 2009). Často také nastávají situace, kdy i přes intenzivní fungicidní ochranu dochází k významnějšímu poškození. Příčin může být více. Například to, že nepříznivé počasí znemožní včasné provedení ochrany. V řadě případů se díky selekci rezistentních ras patogena potvrzuje nižší účinnost některých fungicidů (Kloutvorová a kol., 2009). Do budoucna může hrát roli i tlak na snižování obsahu reziduí pesticidů ve sklizeném ovoci. Výrazné zlepšení účinnosti systémů ochrany proti patogenu Venturia inaequalis mohou přinést přípravky zvyšující obranyschopnost rostliny (PRI plant resistence improvers). Tyto přípravky mají na rozdíl od běžných fungicidů jiný mechanismus účinku. Nepůsobí přímo proti patogenu. Po jejich aplikaci dochází v rostlině k aktivaci obranných mechanizmů a tvorbě obranných látek. Takovouto rostlinu pak patogen nenapadá nebo jen velmi těžko. Přípravky typu PRI je tedy potřeba aplikovat v dostatečném předstihu před vznikem infekce. V rámci našeho výzkumu jsme sledovali účinnost aplikace přípravku typu PRI Alginure proti původci strupovitosti jabloně patogenu Venturia inaequalis v letech Přípravek Alginure jsme hodnotili ve dvou různých situacích. Jednak jako solo-aplikaci v rámci maloparcelkového pokusu. Pak jako součást systému integrované ochrany. 49

50 Materiál a metody Výzkum probíhal v produkčních výsadbách jabloní v letech 2010 až Vliv a účinnost byla ověřována u přípravku Alginure, který obsahuje 24 % extraktu z mořských řas, 7 % rostlinných aminokyselin a 20 % fosfonátů. Výrobcem je německá firma Tilco Biochemie GmbH. V roce 2010 byl na lokalitě Nosislav proveden maloparcelkový pokus u odrůdy Idared ve sponu 3 4,5 m. V rámci tohoto pokusu bylo zkoušeno 5 variant: Alginure 3 l/ha, Alginure 5 l/ha, Sulikol K 6 kg/ha (50% síra), Polisenio 8 l/ha (27% polysulfid vápenatý) a VitiSan 5 kg/ha (hydrogenuhličitan draselný). Každá varianta měla 3 opakování po 4 stromech. Aplikace byla provedena pomocí motorového zádového rosiče. Celkem bylo provedeno 16 ošetření ve dnech 16., 22. a 27. dubna, 3., 6., 11., 15., 19., 24., 28., a 31. května, 7., 17. a 25. června a 19. a 29. července. Hodnocení bylo provedeno dne 11. června a 2. srpna. Napadení bylo hodnoceno na plodech. V rámci každého opakování vždy 100 náhodně vybraných plodů, kde bylo stanoveno, zda mají příznaky napadení či ne. V letech 2011 a 2012 byly provedeny 4 poloprovozní pokusy v rámci systému integrované ochrany. Vybrané lokality byly Určice, Stošíkovice a Bašnice. Na každé lokalitě probíhal poloprovozní pokus na ploše 3 4 ha, přičemž jedna část plochy byla ošetřována sledem fungicidních přípravků v rámci integrované ochrany. Druhá část plochy byla ošetřována totožně, avšak do systému byl přidán 3 5 přípravek Alginure (tab 1. a 2.) v dávce 4 l/ha. V roce 2012 byly ověřovány kombinace poloviční dávky fungicidů s přípravkem Alginure a naopak snížená dávka přípravku Alginure (3 l/ha) se standardní dávkou fungicidu. Na jednotlivých lokalitách byly použity tyto fungicidní přípravky: Champion 50 WP (Hydroxid měďnatý, Agro CS), Novozir MN 80 New (Mankozeb, Dow AgroSciences), Kumulus WG (síra, BASF SE), Funguran-OH 50 WP (hydroxid měďnatý, Spiess-Urania Chemicals), Thiram Granulfo (thiram, AGRO CS), Polyram WG (Metiram, BASF SE), Delan 700 WDG (Dithianon, BASF SE), Mythos 30 SC (Pyrimethanil, BASF SE), Captan 80 WG (Captan, Arysta LifeSciences), Discus (Kresoxim-methyl, BASF SE), Zato 50 WG (Trifloxystrobin, Bayer CropSciences), Score 250 EC (Difenokonazol, Syngenta Crop Protection), Syllit 65 WP (Dodin, Agriphar), Tercel (Dithianon, Pyraklostrobin, BASF SE), Dithane DG Neotec (Mankozeb, Dow AgroSciences), Merpan 80 WG (Kaptan) a Flint (Kaptan, Trifloxystrobin, AGRO CS), Chorus 50 WG (Cyprodinil, Syngenta Crop Protection AG), Merpan 80 WG (Kaptan, Makhteshim Agan Industries) a Talent (Myklobutanil, Dow AgroSciences). Hodnocení bylo provedeno na lokalitách Určice a Stošíkovice třikrát a na lokalitě Bašnice dvakrát. V roce 2012 proběhly dvě hodnocení na lokalitě Stošíkovice. Napadení listů bylo hodnoceno podle stupnice 0 4 a stupeň napadení byl stanoven dle Townsend-Heubergerova vzorce (Townsend, Heuberger, 1943). Získaná data byla zhodnocena analýzou variance a byl proveden Fischerův LSD test na úrovni α 0,05. 50

51 Tabulka 1. Sled ošetření na pokusných lokalitách v roce 2011 DATUM LOKALITA Bašnice Určice Stošíkovice Champion Novozir, Kumulus Fuguran Thiram Granuflo, Kumulus Kumulus, Alginure 4 l/ha Polyram Delan, Mythos, Alginure 4 l/ha Dithane, Alginure 4 Mythos l/ha Captan, Kumulus, Alginure 4 l/ha Captan, Alginure 4 l/ha Delan, Alginure 4 l/ha Discus, Delan, Alginure 4 l/ha Polyram, Alginure 4 l/ha Zato, Score, Alginure 4 l/ha Delan, Alginure 4 l/ha Tercel, Alginure 4 l/ha Syllit Novozir, Dithane, Kumulus Merpan, Score Syllit Tercel, Alginure 4 l/ha Polyram Syllit Kumulus Score, Delan Syllit Kumulus Delan, Kumulus WG Polyram Kumulus Captan, Kumulus Delan Delan Thiram granuflo, Kumulus, Alginure 2 l/ha Captan Discus Flint 51

52 Tabulka 2. Sled ošetření na pokusné lokalitě Stošíkovice v roce 2012 DATUM VARIANTA ½ dávka nižší dávka Alginure 4 l/ha standard fungicidu Alginure Delan 0,35 kg/ha; Delan 0,7 kg/ha, Delan 0,7 kg/ha, Delan 0,7 kg/ha Alginure 4 l/ha Alginure 3 l/ha Alginure 4 l/ha Chorus 0,225 Chorus 0,45 kg/ha; Chorus 0,45 Chorus 0,45 kg/ha kg/ha, Alginure 4 l/ha Alginure 3 l/ha kg/ha; Alginure 4 l/ha 4.5. Merpan 0,75 Merpan 1,5 kg/ha; Merpan 1,5 Merpan 1,5 kg/ha; kg/ha; Talent 0,22 Talent 0,45 l/ha kg/ha; Talent Talent 0,45 l/ha l/ha Alginure 4 Alginure 3 l/ha 0,45 l/ha l/ha Alginure 4 l/ha Delan 0,35 kg/ha; Discus 0,1 kg/ha, Delan 0,7 kg/ha; Discus 0,2 kg/ha, Delan 0,7 kg/ha; Discus 0,2 kg/ha, Delan 0,7 kg/ha; Discus 0,2 kg/ha Alginure 4 l/ha Alginure 3 l/ha Alginure 4 l/ha Score 0,2 l/ha Score 0,2 l/ha Score 0,2 l/ha, Score 0,2 l/ha 6.6. Talent 0,45 l/ha Talent 0,45 l/ha Talent 0,45 l/ha Talent 0,45 l/ha Kumulus 4,5 Kumulus 4,5 kg/ha Kumulus 4,5 Kumulus 4,5 kg/ha kg/ha kg/ha 3.7. Kumulus 4 kg/ha Kumulus 4 kg/ha Kumulus 4 kg/ha Kumulus 4 kg/ha Merpan 1,5 kg/ha Merpan 1,5 kg/ha Merpan 1,5 Merpan 1,5 kg/ha kg/ha Polisenio 7 l/ha Polisenio 7 l/ha Polisenio 7 l/ha Polisenio 7 l/ha Výsledky a diskuze V maloparcelkovém pokuse v roce 2010 nebyl v případě přípravku Alginure při hodnocení dne zjištěn statisticky významný rozdíl od neošetřené kontroly, ačkoli v dávce 5 l/ha byla zaznamenána účinnost 80 % (ANOVA: F 25,15; p 0,0003). Naopak při hodnocení se již obě dvě dávky přípravku Alginure statisticky průkazně lišily od neošetřované kontrolní varianty (ANOVA F 30,73; p 0,0001). Souhrn výsledků je uveden v tab. 3. Podobných výsledků dosáhl Ruemer (2009), který ve svých pokusech srovnával Alginure s jinými prostředky použitelnými v ekologickém pěstování a dosáhl účinnosti 65 % při hodnocení plodů a 95 % při hodnocení listů. Tabulka 3. Napadení plodů strupovitostí jabloně a účinnost jednotlivých variant v roce 2010 na lokalitě Nosislav. Varianta 11. června 2. srpna napadení % účinnost % napadení % účinnost % Polisenio 1,00B 85,01 2,00B 80,64 Sulikol K 5,00A 25,04 4,00B 61,28 VitiSan 3,66A 45,13 5,33A 48,40 Alginure 3 l/ha 4,00A 40,03 3,00B 70,96 Alginure 5 l/ha 1,33A 80,00 1,33B 87,12 kontrola 6,67A 10,33A V roce 2011 bylo na lokalitě Bašnice dne zjištěno v průměru 50,2% snížení stupně napadení na variantě s přípravkem Alginure oproti variantě s běžnými fungicidy. Dne 15 září činil tento rozdíl 27,8 %. Avšak ani v jednom termínu nebyly rozdíly statisticky významné. 52

53 Na lokalitách Stošíkovice a Určice byly mezi variantami již statistické rozdíly zjištěny. Snížení stupně napadení bylo ve Stošíkovicích zjištěno následující: %, ,3 % a , 8 %. V Určicích bylo snížení ,8 %, ,9 % a ,1 %. Souhrnné výsledky jsou uvedeny v tabulkách 4, 5 a 6. Tabulka 4. Stupeň napadení strupovitostí jabloně na listech na lokalitě Bašnice v roce (ANOVA: F 0,003; p 0,997) Odrůda Varianta datum hodnocení Idared Alginure + fungicidy 4,2A 7,3A pouze fungicidy 8,5A 11,3A Golden Alginure + fungicidy 1A 1,3A delicious pouze fungicidy 2A 1,8A Jonagold Alginure + fungicidy 1A 9,8A pouze fungicidy 2A 12,3A Tabulka 5. Stupeň napadení strupovitostí jabloně na listech na lokalitě Stošíkovice v roce (ANOVA: F 1;433 p 0,239) Odrůda Varianta datum hodnocení Gala Alginure + fungicidy 0A 2,5A 2A pouze fungicidy 2,8A 7B 7,5B Golden delicious Alginure + fungicidy 1A 2A 4,3A pouze fungicidy 6,3B 6,3A 10,3B Tabulka 6. Stupeň napadení strupovitostí jabloně na listech na lokalitě Stošíkovice v roce (ANOVA: F 2,610 p 0,017) Odrůda Varianta datum hodnocení Golden Alginure + fungicidy 6A 6,5A 4,5A delicious pouze fungicidy 9,5B 11,8B 10,5A Tato zjištění odpovídají výsledkům pokusů, které prováděli výzkumníci v KOB Bavendorf a OVB Jork, jak je pretentoval Welte (2009) a to, že při kombinaci kontaktních fungicidů a pomocného prostředku Alginure dojde k výraznému snížení napadení oproti chemickému ošetření bez použití Alginure. Zároveň bylo zjištěno, že použití více než 5 aplikací Alginure v kombinaci s fungicidy přestává být ekonomicky přínosné, ačkoli stále přináší snížení napadení. Jiné pokusy v OVB Jork ukazují, že aplikace Alginure má významný stop efekt při použití po začátku infekce. V roce 2012 dne bylo na lokalitě Stošíkovice na variantě kombinace nižší dávky přípravku Alginure s fungicidy zjištěn nulový stupeň napadení. Na variantě se standardní dávkou Alginure a fungicidy byl zjištěn stupeň napadení 1,0. Statisticky významný rozdíl mezi těmito variantami není, naopak obě dvě se průkazně liší od standardních fungicidů. Souhrn výsledků je uveden v tabulce 7. 53

54 Tabulka 7. Stupeň napadení strupovitostí jabloně na listech na lokalitě Stošíkovice v roce (ANOVA 7. 6.: F 14,997; p 0,0001; ANOVA : F 40,807, p 0,000001) Odrůda Varianta datum hodnocení Gala ½ fungicidy + Alginure 4 l/ha 1,3A 1,8B fungicidy + Alginure 4 l/ha 1,0B 1,8B fungicidy + Alginure 3 l/ha pouze fungicidy 0,0B 3,0A 1,0B 7,8A Závěr Prostředek pro zvýšení odolnosti rostlin vůči houbovým chorobám na bázi výtažků z mořských řas a fosfonátů Alginure má významný vliv na napadení jabloní původcem strupovitosti Venturia inaequalis. Je možno jej použít jak samostatně, což je využitelné zejména v ekologickém pěstování. Zároveň se však příznivě projevuje v kombinaci s preventivně působícími fungicidy, kdy při použití v době intenzivního infekčního tlaku při 3-5 aplikacích dojde k významnému snížení napadení. Tento efekt se projevuje dlouhodobě, což může mít využití zejména v systémech produkce s nízkým obsahem reziduí. Pro další praktické využití kombinací fungicidních přípravků s Alginure je třeba testovat možnosti snížení dávek jak prostředku Alginure, tak chemických přípravků, případně rozšíření aplikačních intervalů. Výsledky z roku 2012 naznačují, že tato cesta by mohla vést k reálným výsledkům. To by vedlo ke snížení nákladů na ochranu proti strupovitosti a zátěže pro životní prostředí. To bude předmětem dalšího výzkumu. Dedikace Touto cestou bychom chtěli poděkovat zejména pěstitelům, kteří svou spoluprací a poskytnutím pěstebních ploch umožnili provedení pokusů, tj. Agro Stošíkovice, ZD Určice, ZD Bašnice, Sady Velké Němčice. Výzkum byl podpořen z projektu NAZV QJ Použitá literatura Kloutvorová, J., Lánský, M., Kupková, R., Vávra, R., Svoboda, A., Boček, S., 2009: Monitoring citlivosti populací houby Venturia inaequalis k vybraným pesticidům. Vědecké práce ovocnářské, 21: Ruemer T.: Bekaempfung vor Schorf und Regneflecken mit Pflanzenstarkungsmitteln, Výzkumná zpráva Landwirtschaftliches Versuchszentrum Graz-Heidegg 2009 Townsend, G. R., Heuberger, J. W., 1943: Methods for estimating losses cased by diseases in fungicide experimetns. Plant disease reporter, 27(17): Vávra, R., Boček, S., 2009: Symptomy strupovitosti jabloní na odrůdách a genotypech nesoucí různé geny rezistence. Vědecké práce ovocnářské, 21: Welte, H.: Frutogard Pflantenstaerkungsmittel auf Algenbasis, seminář KOB Bavendorf a Spiess-urania, Bavendorf, Kontaktní adresa: Ing. Martin Bagar, Ph.D. BIOCONT LABORATORY Šmahova Brno 54

55 PŘEVLÁDAJÍCÍ DRUHY STONKOVÝCH KRYTONOSCŮ NA LOKALITÁCH TROUBSKO, LEDNICE A ŠUMPERK Dominant species of stem weevils in Troubsko, Lednice and Šumperk Hrudová E. 1, Seidenglanz M. 3, Kolařík P. 2, Tóth P. 1, Rotrekl J. 2, Poslušná J. 3 1 Mendelova univerzita v Brně 2 Zemědělský výzkum, spol. s r.o. Troubsko 3 Agritec Plant Research Šumperk Abstrakt Na lokalitách Troubsko a Šumperk ( ) a dále Lednice ( ) byl monitorován výskyt krytonosců v řepce olejce. Zjišťována byla dominance jednotlivých druhů. Eudominantními druhy byli Ceutorrhynchus pallidactylus, Marsham, 1802 a C.obstrictus Marsham, 1802 na všech lokalitách. V Troubsku a Lednici byl eudominantní C. napi, Gyllenhal, 1837, zatímco v Šumperku byl tento druh ve všech letech subdominantní. Klíčová slova: Ceutorrhynchus napi, C. pallidactylus, dominance, krytonosci, řepka olejka Abstract The occurrences of curculionid weevils in oilseed rape were observed. The dominance of individual species was determined. Ceutorrhynchus pallidactylus, Marsham, 1802 and C.obstrictus Marsham, 1802 were eudominant at all of localities. In Troubsko and Lednice Ceutorrhynchus napi, Gyllenhal, 1837 was also eudominant but in Šumperk was subdominant during the whole period of observation. Key words: Ceutorrhynchus napi, C. pallidactylus, dominance, curculionid weevils in oil-seed rape Úvod Krytonosec řepkový (Ceutorrhynchus napi, Gyllenhal, 1837) a krytonosec čtyřzubý (C. pallidactylus, Marsham, 1802) jsou jedněmi z nejvýznamnějších škůdců řepky. V Evropě se vyskytují oba druhy, přičemž krytonosec řepkový se vyskytuje zejména ve střední a západní Evropě a krytonosec čtyřzubý na celém území Evropy, včetně evropské části Ruska a evropské části Turecka (Juran, et al. 2011). Oba působí značné škody na stonku řepky a zapříčiňují významné ztráty na výnosu. Jak uvádí (Gotlin Čuljak, et al. 2010) působí v Chorvatsku ztrátu až 800 kg semen/ha. Kromě nich se v porostu řepky vyskytují ještě další druhy krytonosců. Významnými jsou krytonosec šešulový (Ceutorhynchus obstrictus Marsham, 1802, syn. C.assimilis) jako škůdce šešulí a krytonosec zelný (C. pleurostigma Marsham 1802). Kromě těchto druhů byly při monitoringu zjištěny ještě další druhy krytonosců a to krytonosec brukvový (Ceutorhynchus sulcicolis, Paykull 1800), krytonosec černý (C. picitarsis Gyllenhal 1837) a krytonosci z rodu Baris. Pravidelně, i když jde o relativně velmi nízké výskyty, se lze při monitoringu v řepce setkat ještě i s dalšími druhy: C. sulcatus C. Brisout de Barneville, 1869, C. floralis syn. C. typhae (Herbst, 1795) a C. erysimi (Fabricius, 1787). Krytonosec řepkový (C. napi) je největším druhem rodu Ceutorhynchus škodícím na řepce. Jeho tělo je dlouhé 3-4 mm, oválné, na šedých krovkách má rýhování, přičemž každá rýha je pokryta třemi podélnými řadami světle šedých chloupků. Vajíčka krytonosce řepkového jsou oválná, zelenobílá, 0,7-0,8 mm dlouhá, 0,4-0,5 mm široká. Dorostlé larvy měří 8 mm (Juran, et al. 2011). Krytonosec čtyřzubý (C. pallidactylus) je oválný, dlouhý asi 3,5 mm, samečci jsou výrazně menší než samičky. Tělo je pokryto šedými a rezavohnědými šupinkami, na rýhách krovek jsou bělavé chloupky. Tarsy a tibie jsou rezavě - červené. Vajíčka jsou bílá, oválná, dlouhá až 0,6 mm. Dorostlé larvy jsou velké až 8 mm (Juran, et al. 2011). 55

56 Oba druhy krytonosců mají podobnou bionomii a ekologické nároky. Ročně mají jednu generaci. Dospělci krytonosce řepkového přezimují v půdě v okolí rostlin, kde se vyvíjely jeho larvy. Dospělci krytonosce čtyřzubého přezimují mělce v půdě nebo v opadu rostlin v blízkosti porostů řepky, nebo jiných brukvovitých rostlin, na nichž se vyvíjely larvy. Na jaře odtud přelétají na nové porosty řepky. Krytonosec šešulový (C. obstrictus) má oválné tělo pokryté hustými šedými chloupky, výrazné jsou hrbolky na štítu. Velký je 2,5-3 mm. Larvy se vyvíjejí v šešulích, dorostlé jsou velké 3-4,5 mm. Kuklí se v půdě, kde následně přezimují i dospělci. Krytonosec zelný (C. pleurostigma) je velký 2,3-3 mm, má černé, téměř lesklé tělo a na štítu podélnou rýhu. Dorostlá larva měří 4-5 mm a jako škůdce kořenů se podílí se na vyzimování řepky. Krytonosec brukvový (C. sulcicollis) je 2,7-3,2 mm velký, tělo má oválné, s kovově modrým leskem. Larvy žijí ve stoncích různých brukvovitých rostlin. Krytonosec černý (C. picitarsis) je velký 2,4-3,5 mm, oválný, černě lesklý, tarsy má rezavohnědé. Larva žije v srdéčcích brukvovitých rostlin, dorostlá je dlouhá 4-5 mm. C. floralis je velký asi 1 mm, šedý s řídkými, jemnými, chloupky a nápadným bílým pruhem na švu krovek. Vývojem je vázán na kokošku pastuší tobolku. Krytonosci Baris sp. Mají podlouhlé tělo, kovově modře nebo kovově zelenavě zbarvené, výrazně lesklé, bez šupin. V porostech řepky se vyskytují krytonosec modravý (Baris coerulescens Scopoli, 1763) a krytonosec dřeňový (B. chlorizans Germar, 1824). Přesto, že jsou svým larválním vývojem vázáni na řepku, či jiné brukvovité rostliny, jejich výskyt je ojedinělý a škodlivost mizivá. Které hostitelské rostliny přitahují do porostů řepky druhy C. sulcatus C. Brisout de Barneville, 1869 a C. erysimi (Fabricius, 1787) a jaký je jejich vztah k samotné řepce se neví téměř nic. Materiál a metody V letech byl monitorován výskyt a početnost stonkových krytonosců C. napi a C. pallidactylus. Výskyt byl prováděn na lokalitách Troubsko 49 10'11.579"N, 16 29'59.488"E, Lednice 48 49'45.558"N, 16 48'39.688"E a Šumperk 49 58'54.645"N, 17 0'12.901"E. Sledování proběhlo dle metodiky doporučované pro běžnou zemědělskou praxi. Bylo použito žlutých misek. Ty byly umístěny na teleskopických držácích umožňujících vertikální posun misek tak, aby byly vždy v úrovni vrcholů rostlin. Jako smrticí medium sloužila voda s přídavkem tenzidu pro snížení jejího povrchového napětí. Misky byly do porostu umístěny před počátkem předpokládaného náletu brouků, sledovány ve třídenních intervalech a odstraněny po skončení náletu brouků. Sběry byly dále zpracovány v laboratoři, pro determinaci jednotlivých druhů bylo využito morfologických znaků. Ze získaných dat byl vypočítán index dominance jednotlivých druhů na sledovaných lokalitách, který vyjadřuje jejich zastoupení (Losos 1985)v celkovém počtu jedinců jednotlivých druhů v biocenóze. Pro jeho výpočet byl použit vzorec: ni D 100 % kde n i je hodnota významnosti druhu tj. počet jedinců sledovaného druhu, a n je součet hodnot významnosti všech druhů tj. celkový počet odchycených jedinců, 100 je koeficient (Losos 1985) (Losos et al., 1985). Jednotlivé druhy jsou řazeny do pěti tříd dominance dle procentického zastoupení: Eudominantní > 10,1 %, dominantní 5,1-10 %, subdominantní 2,1-5 %, recedentní 1,1-2 % a subrecedentní < 1 %, jak tyto třídy uvádí (Losos 1985). 56

57 Výsledky a diskuze Jak ukazují grafy 1-4, bylo zjištěno, že v roce 2009 byl v Troubsku eudominantním druhem krytonosec řepkový (CEUTNA). K. čtyřzubý (CEUTQU) byl eudominantním jak v Troubsku, tak v Šumperku. Dalším eudominantním druhem byl v tomto roce na obou lokalitách k. šešulový (CEUTAS). V Šumperku byl dominantním druhem k. zelný (CEUTPL), v Troubsku krytonosec C.typhae (CEUTFL). Ten byl v Šumperku subdominantní. V roce 2010 byl CEUTNA dominantní v Troubsku, subdominantní v Šumperku a recedentní v Lednici. CEUTQU a CEUTAS byli eudominantní na všech sledovaných lokalitách. CEUTFL byl dominantní v Lednici. V roce 2011byl CEUTNA eudominantní v Troubsku, v Šumperku šlo o subrecedentní druh. CEUTQU a CEUTAS byli eudominantní na všech sledovaných lokalitách. CEUTFL byl subdominantním v Lednici. V roce 2012 byl CEUTNA eudominantní v Troubsku a Lednici, subdominantní v Šumperku. CEUTQU byl eudominantním druhem na všech sledovaných lokalitách, CEUTAS v Šumperku, zatímco v Troubsku subdominantní. Ostatní zjištěné druhy byly vyhodnoceny jako recedentní nebo subrecedentní. Graf 1. Dominance krytonosců v r na lokalitách Troubsko a Šumperk 57

58 Graf 2. Dominance krytonosců v r na lokalitách Troubsko, Lednice a Šumperk Graf 3. Dominance krytonosců v r na lokalitách Troubsko, Lednice a Šumperk 58

59 Graf 4. Dominance krytonosců v r na lokalitách Troubsko, Lednice a Šumperk Ve studii prováděné (Marczali et al. 2007) v Maďarsku bylo zjištěno, že ve sběrech převažují druhy C. pallidactylus a C. obstrictus, v menším počtu se vyskytují C. napi a C. pleurostigma. Také z některých německých prací vyplývá, že zastoupení zejména časně jarních druhů, C. pallidactylus a C. napi, může být v různých regionech dlouhodobě odlišné (Büchs,1998). Také další autoři se zabývali druhovým složením krytonosců v porostech řepky, zpravidla však na jedné lokalitě (Čuljak, et al. 2010, Rotrekl 2008) Závěr Jak vyplývá ze sledování, má převahu na jižní Moravě C. napi, zatímco v Šumperku (severní Morava) je jeho početnost nižší. C. pallidactylus je hojně zastoupen na jižní i severní Moravě. Lze se tedy domnívat, že v severní části území bude tento druh převažovat a z hlediska škodlivosti bude významnější a naopak význam C. napi, obecně považovaného za nebezpečnějšího škůdce, zde bude výrazně nižší. To by se mělo odrazit i v odlišném přístupu k ochraně porostů řepky proti stonky poškozujícím krytonoscům v těchto oblastech. Dedikace Výsledky publikované v tomto příspěvku byly získány při řešení projektů č.qh a č. QJ podporovaných NAZV (MZe ČR). Použitá literatura Büchs, W. (1998): Strategies to control the cabbage stem weevil (Ceutorhynchus pallidactylus) and the oilseed rape stem weevil (Ceutorhynchus napi) by a reduced input of insecticides. IOBC Bulletin, 21 : Čuljak, T. G.,I. Juran,D. Grubišić,S. Slovic and S. Jelovčan Proljetne pipe - važni štetnici uljane repice. In B. Cvjetković, (Ed.): Sažeci 54. Seminara bilnje zaštite., pp , Opatija, Chorvatsko. Gotlin Čuljak, T.,I. Juran,D. Grubišić,S. Slovic and S. Jelovčan Proljetne pipe - važni štetnici uljane repice. In B. Cvjetković, (Ed.): Seminara bilnje zaštite, Opatija, Chorvatsko. 59

60 Juran, I.,T. GotlinČuljak and D. Grubišić Rape stem weevil (Ceutorhynchus napi Gyll. 1837) and cabbage stem weevil (Ceutorhynchus pallidactylus Marsh. 1802) (Coleoptera: Curculionidae) - important oilseed rape pests. Agriculturae Conspectus Scientificus 76: Losos, B., Maget, J., Ryšavý J Ekologie živočichů, 1 ed. Státní pedagogické nakladatelství, Praha. Marczali, Z.,M. Nádasy,F. Simon and S. Keszthelyi Incidence and life cycle of ceutorhynchus species on rape. VI. Alps-Adria Scientific Workshop. Cereal Research Communications 35: Rotrekl, J Škůdci ozimé řepky v jarním období. pp VUP Troubsko Kontaktní adresa: Ing. Eva Hrudová, Ph.D. Ústav pěstování, šlechtění rostlin a rostlinolékařství Agronomická fakulta, Mendelova univerzita v Brně 60

61 HODNOCENÍ VLIVU ODRŮDOVÝCH ROZDÍLŮ TERMOSTABILNÍCH PROTEINŮ HLÍZ BRAMBORU (SOLANUM TUBEROSUM L.) NA INHIBICI RŮSTU VYBRANÝCH DRUHŮ FYTOPATOGENNÍCH HUB The variety assessments of thermostable proteins gained from different potato tuber cultivars (Solanum tuberosum L.) and their influence on growth inhibition of selected phytopathogenic fungi Kamenová A., Bárta J., Bártová V. Jihočeská univerzita v Českých Budějovicích, Zemědělská fakulta Abstrakt Příspěvek se zabýval hodnocením rozdílů antifungálních vlastností dvou odrůd bramboru hlíznatého (Solanum tuberosum L.) Fabia a Laura lišící se užitkovým směrem a délkou vegetační doby a porovnáním antimikrobiálních aktivit u dvou teplotních variant hlízové šťávy. Izolace proteinů probíhala za podmínek sníženého ph a působení vysoké teploty (80 C) a pro porovnání pouze za podmínek sníženého ph. Izolované termostabilní proteiny byly detekovány analýzou SDS-PAGE na peptidovém gelu v oblasti 6 a 14 kda a u tepelně nezpracované hlízové šťávy od 17 do 26 kda. Testované vzorky byly aplikovány v různých koncentracích ke čtyřem druhům fytopatogenních hub Fusarium graminearum, Fusarium oxysporum, Fusarium solani a Rhizoctonia solani. Největší inhibice růstu mycelia bylo dosaženo při koncentraci 10 mg/ml, v průměru měla vyšší antifungální účinnost odrůda Laura, všeobecně byly k těmto termostabilním proteinům citlivější houbové kultury F. graminearum a R. solani, antifungální aktivita však nebyla zaznamenána u směsi proteinů tepelně nezpracované hlízové šťávy Klíčová slova: hlízová šťáva, Solanum tuberosum L., antifungální aktivita, termostabilní proteiny, odrůdové rozdíly Abstract The contribution deals with the variety assessments of antifungal potential of two potato cultivars (Solanum tuberosum L.) Fabia and Laura differing in the market and maturity and comparison of two potato fruit juice alternatives differing in processing temperature. Combination of ph adjustment and high temperature (80 C) or ph adjustment only was used for protein isolation. Isolated thermostable proteins were detected in the SDS-PAGE analysis on peptide gel in range of 6 and 14 kda and in range from 17 to 26 kda in the sample of the thermally untreated potato fruit juice. Different protein concentrations were applied to four different phytopathogenic fungi Fusarium graminearum, Fusarium oxysporum, Fusarium solani and Rhizoctonia solani. The greatest inhibition of mycelial growth was achieved at a concentration of 10 mg/ml, Laura variety had greater antifungal effect in average, phytopathogenic fungi F. graminearum and R. solani were more sensitive to the thermostable proteins in general but inhibition effect of thermally untreated substance was not registered. Key words: potato fruit juice, Solanum tuberosum L., antifungal activity, thermostable proteins, cultivar variability Úvod Majoritní složkou termostabilních proteinů jsou skupiny inhibitorů proteas, které jsou variabilní skupinou proteinů a hrají důležitou roli i v obraně proti predátorům a patogenům. Inhibitory proteas jsou charakterizovány molekulovou hmotností v rozmezí od 3 do 25 kda a tvoří v hlízách bramboru velmi významnou, převážně konstitutivně syntetizovanou složku hlízových proteinů představující asi 50 % všech proteinů v hlízové šťávě (Pouvreau 2004). Studie, které se do současnosti zabývaly antimikrobiální aktivitou hlízových bílkovin brambor, pracovaly pouze s jednou odrůdou bramboru hlíznatého (Kim et al. 2005; 2006; Speranskaya et al. 2006, Jin et al. 2009, Ohh et al. 2009) nebo byla, jako zdroj proteinů, 61

62 použita hlízová voda z průmyslového zpracování brambor na škrob, která je směsí odrůd druhu Solanum tuberosum L. (Kamenová et al. 2011, Bárta et al. 2012) a vzájemné porovnání antimikrobiálních vlastností odrůd mezi sebou publikováno nebylo. Antimikrobiální vlastnosti byly dosud popsány pouze u některých kultur fytopatogenních hub - Kim et al. (2005) ve své práci popsal antimikrobiální aktivitu bramborového inhibitoru proteas I (PI-1) proti fytopatogenní houbě Rhizoctonia solani, Mendieta et al. (2006) a Seliternnikoff (2001) potvrdili pozitivní antifungální účinek hlízových proteinů na druh Fusarium solani, Speranskaya et al. (2006) potvrdili ve své práci vliv hlízových inhibitorů Kunitzova typu na růst a vývoj fytopatogenní houby Fusarium culmorum. Cílem příspěvku bylo vzájemné porovnání antimikrobiální aktivity proteinů izolovaných z hlízové šťávy dvou odrůd brambor připravené ve dvou teplotních variantách-před tepelnou koagulací a po tepelné koagulaci při 80 C. Antimikrobiální aktivita byla testována na čtyřech kmenech fytopatogenních hub Fusarium graminearum, Fusarium oxysporum, Fusarium solani a Rhizoctonia solani. Materiál a metody Rostlinným materiálem pro zdroj proteinů byla hlízová šťáva připravená ze dvou odrůd bramboru hlíznatého (Solanum tuberosum L.). Obě odrůdy brambor byly vypěstovány za přesně definovaných podmínek v roce 2011 formou maloparcelkových pokusů na stanovišti v Českých Budějovicích (380 m n. m.). Odrůda Fabia je raná a používá se pro zpracování na škrob, Laura je poloraná a je odrůdou konzumní. Z hlíz brambor každé odrůdy byly odšťavněním na kuchyňském odšťavňovači připraveny hlízové šťávy, které byly centrifugací (4500 rpm, 30 minut) a filtrací zbaveny škrobu, vlákniny a dalších ve vodě nerozpustných látek. U takto získaných šťáv byla upravena reakce na ph 5 a následně byl materiál rozdělen na hlízovou šťávu, která nebyla tepelně zpracována (tzv. varianta 0) a na šťávu, u které se provedla deproteinizace tepelnou koagulací (oddělení majoritních, termolabilních proteinů) vytemperováním vzorku ve vodní lázni na 80 C. U získaného supernatantu obou variant se provedla dialýza (3,5 K MWCO, Pierce SnakeSkin Dialysis Tubing, Thermo Scientific) a vzorek se zakoncentroval lyofilizací. Získaná směs proteinů a peptidů byla rozpuštěna v ultra čisté vodě, roztok byl sterilizován bakteriálním filtrem (0,22 µm, Millex Filter Units, Millipore) a aplikován v objemu 30 µl do každé z jamek, které byly přesně umístěny na okraj rostoucího mycelia. Jako kontrola byla, u každé varianty pokusu, aplikována sterilní, destilovaná voda. Antifungální testy byly prováděny na fytopatogenních kmenech hub Fusarium graminearum, Fusarium oxysporum, Fusarium solani a Rhizoctonia solani. Testované kmeny byly získány z České sbírky mikroorganismů v Brně. Izolované směsi proteinů byly aplikovány v koncentracích 1 mg/ml, 5 mg/ml a 10 mg/ml a byl sledován vliv na růst mikroskopických hub. Antifungální aktivita byla hodnocena po 24 hodinách kultivace při 26 C (Hunth et al. 1996). Inhibice růstu mycelia byla vyhodnocována na digitálních fotografiích pomocí počítačového software metodou měření ploch inhibičních zón u jednotlivých opakování. Izolované peptidy a proteiny byly analyzovány pomocí SDS-PAGE na 16% peptidovém gelu. Výsledky a diskuze Proteiny tepelně nezpracované hlízové šťávy byly detekovány v oblasti 14 kda a další výrazná zóna bandů byla v oblasti od 17 do 26 kda u obou odrůd (obrázek 1). Antifungální aktivita izolovaných proteinů byla testována na čtyřech fytopatogenních kmenech hub (Fusarium graminearum F-683, Fusarium oxysporum F-65, Fusarium solani 8079 a Rhizoctonia solani F-1). U žádného z testovaných kmenů nebyla pozorována inhibice růstu mycelia po 24 hodinách kultivace při aplikaci proteinového izolátu odrůdy Fabia a Laura v koncentracích 1; 5 a 10 mg/ml účinné látky (obrázky 2 a 3). 62

63 Obrázek 1: Detekce proteinů pomocí SDS- PAGE na peptidovém gelu. (HM - hmotnostní marker) Obrázek 2: Ukázka účinku tepelně nezpracované hlízové šťávy z odrůdy Laura v koncentracích účinné látky 1; 5; 10 mg/ml a 0 značící kontrolu na houbové kultuře Rhizoctonia solani. Obrázek 3: Ukázka účinku tepelně nezpracované hlízové šťávy z odrůdy Fabia v koncentracích účinné látky 1; 5; 10 mg/ml a 0 značící kontrolu na houbové kultuře Fusarium solani. Termostabilní proteiny byly detekovány pomocí SDS-PAGE na 16% peptidovém gelu v oblasti kolem 6 kda a 14 kda a ve dvou výrazných zónách s vyšší intenzitou bandů u odrůdy Fabia a méně intenzivní bandy byly detekovány v oblasti 26 kda u obou odrůd (obrázek 1). V práci Kim et al. (2005) byly detekovány termostabilní antimikrobiální peptidy o molekulové hmotnosti 5,6 kda. Antifungální aktivita izolovaných proteinů byla testována na stejných čtyřech výše uvedených fytopatogenních kmenech hub. Inhibice růstu mycelia byla pozorována u všech testovaných houbových kultur, koncentrací a odrůd po 24 hodinách kultivace (obrázky 4-7). 63

64 Obrázek 4: Ukázka účinku tepelně zpracované hlízové šťávy při 80 C z odrůdy Fabia v koncentracích účinné látky 1; 5; 10 mg/ml a 0 značící kontrolu na houbové kultuře Fusarium graminearum. Obrázek 5: Ukázka účinku tepelně zpracované hlízové šťávy při 80 C z odrůdy Laura v koncentracích účinné látky 1; 5; 10 mg/ml a 0 značící kontrolu na houbové kultuře Fusarium graminearum. Obrázek 6: Ukázka účinku tepelně zpracované hlízové šťávy při 80 C z odrůdy Fabia v koncentracích účinné látky 1; 5; 10 mg/ml a 0 značící kontrolu, na houbové kultuře Rhizoctonia solani. Obrázek 7: Ukázka účinku tepelně zpracované hlízové šťávy při 80 C z odrůdy Laura v koncentracích účinné látky 1; 5; 10 mg/ml a 0 značící kontrolu, na houbové kultuře Fusarium oxysporum. Digitální fotografie s testovanými kulturami byly vyhodnoceny citlivým počítačovým software a to tak, že byla měřena velikost plochy inhibičních zón u jednotlivých opakování a koncentrací, průměry měření těchto opakování jsou zaznamenány v tabulce 1. Největší antifungální účinek se projevil při koncentraci účinné látky 10 mg/ml u obou testovaných odrůd, větší plochy inhibičních zón byly u odrůdy Laura. K izolátům proteinů byla výrazně nejcitlivější kultura F. graminearum (obrázky 4 a 5), naopak nejméně citlivou kulturou bylo F. solani. Při koncentraci 5 a 10 mg/ml měla větší antifungální účinek odrůda Laura s výjimkou účinku na F. solani při koncentraci účinné látky 10 mg/ml (rozdíl mezi odrůdami 2,9 mm 2 ). Tabulka 1: Plocha inhibičních zón u testovaných houbových kultur při aplikaci termostabilních proteinů odrůd Fabia a Laura v koncentracích 1; 5 a 10 mg/ml. Odrůda Solanum Fabia Laura Fabia Laura Fabia Laura tuberosum L. 1mg/ml 1mg/ml 5mg/ml 5mg/ml 10mg/ml 10mg/ml Houbová kultura plocha inhibiční zóny [mm 2 ] Fusarium graminearum F ,1hi 17,1hi 54,9cde 73,0bc 62,9bcd 106,7a Fusarium oxysporum F-65 7,6i 17,8hi 20,5ghi 40,5efg 29,2fgh 67,1bcd Fusarium solani ,0i 5,5i 22,6ghi 29,8fgh 54,3cde 51,4de Rhizoctonia solani F-1 8,1i 6,5i 34,4efgh 49,1def 74,9bc 83,47ab 64

65 Poznámka: Písmena indikují statistickou průkaznost na hladině významnosti P<0,05 (Fisher LSD test). Písmena jsou seřazena v abecedním pořádku podle snižující se hodnoty plochy inhibiční zóny. Z výsledků vyplývá, že širší spektrum proteinů izolovaných z tepelně nezpracované hlízové šťávy nemá prokazatelný antifungální účinek v testovaných koncentracích na rozdíl od termostabilních frakcí proteinů odrůd Fabia a Laura, u kterých byly sledovány výrazné antifungální vlastnosti. Největší inhibice růstu mycelia bylo dosaženo při koncentraci 10 mg/ml, v průměru má vyšší antifungální účinnost odrůda Laura, všeobecně jsou k těmto termostabilním proteinům citlivější houbové kultury F. graminearum a R. solani. Závěr Příspěvek se zabýval hodnocením rozdílů antifungálních vlastností proteinů hlíz bramboru (Solanum tuberosum L.) získaných z hlízové šťávy odrůd Fabia a Laura získaných pomocí tepelné koagulace (při 80 C). Izolované termostabilní proteiny byly detekovány analýzou SDS-PAGE na peptidovém gelu v oblasti 6 a 14 kda a od 17 do 26 kda u tepelně nezpracované hlízové šťávy. Při termokoagulaci a následné centrifugaci došlo k izolaci a zakoncentrování termostabilních proteinů, které si i přes expozici teplotě 80 C uchovaly svou antifungální aktivitu, která byla prokázána na fytopatogenních druzích hub Fusarium graminearum, Fusarium oxysporum, Fusarium solani a Rhizoctonia solani inhibicí růstu mycelia při aplikaci testované látky v koncentracích 1; 5 a 10 mg/ml po kultivaci 24 hodin při teplotě 26 C. V průměru měla větší inhibiční aktivitu odrůda Laura u všech testovaných koncentrací, nejcitlivější byla z testovaných fytopatogenů kultura Fusarium graminearum u které byla zaznamenána největší inhibice růstu při aplikaci testované látky odrůdy Laura v koncentraci 10 mg/ml. Ze získaných výsledků vyplývá, že antifungální vlastnosti hlízové šťávy jsou závislé na tepelném zpracování, izolaci a následném zakoncentrování proteinů s těmito vlastnostmi. Bylo zjištěno, že se od sebe odrůdy ve svých antifungálních vlastnostech liší a to přímo úměrně s rostoucím množstvím účinné látky v testovaném vzorku. Závěry naznačují, že je do budoucna vhodné cíleně využívat k výzkumu a následným biotechnologickým aplikacím konkrétní odrůdy bramboru, které se vyznačují větším množstvím termostabilních inhibitorů proteas s vykazujícími antimikrobiálními vlastnostmi. Dedikace Výsledky byly získány v rámci řešení výzkumných projektů GAJU 030/2012/Z a GAČR 522/09/1693. Použitá literatura Bárta, J., Bártová V., Kamenová A., Zdráhal Z., Brabcová A., Čurn V. Jihočeská univerzita v Českých Budějovicích Zemědělská fakulta. Izolát proteinů z brambor s antimikrobiální účinností. Česká republika. Užitný vzor, CZ U1. Zapsáno Dostupné z: [online ] Huynth Q. K., Borgmeyer J. R., Smith C. E., Bell L. D., Shah D. M (1996): Isolation and characterization of a 30 kda protein with antifungal activity from leaves of Engelmannia pinnatifida. Biochemical Journal, 316: Jin Z., Shinde P. L., Yang Y. X., Choi J. Y., Yoon S. Y., Hahn T.-W., Lim H. T., Park Y. K., Hahm K. S., Joo J. W., Chae P. J. (2009): Use of refined potato (Solanum tuberosum L. cv. Gogu valley) protein as an alternative to antibiotics in weanling pigs. Livestock Science, 124: Kamenová A., Bártová V., Bárta J. (2011): Antifungální potenciál nízkomolekulárních proteinů a peptidů hlíz bramboru (Solanum tuberosum L.). Úroda, 12:

66 Kim J.-Y., Park S.-C., Kim M.-H., Lim H.-T., Park Y., Hahm K.-S. (2005): Antimicrobial activity studies on a trypsin-chymotrypsin protease inhibitor obtained from potato. Biochemical and Biophysical Research Communications, 330: Kim M.-H., Park S.-C., Kim J.-Y., Lee S. Y., Lim H.-T., Cheong H., Hahm K.-S., Park Y (2006): Purification and characterization of a heat-stable serine protease inhibitor from the tubers of new potato variety Golden Valley. Biochemical and Biophysical Research Communications, 346: Mendieta J. R., Pagano M. R., Muñoz F. F., Daleo G. R., Guevara M. G. (2006): Antimicrobial activity of potato aspartic proteases (StAPs) involves membrane permeabilization. Microbiology, 1052: Ohh S. H., Shinde P. L., Jin Z., Choi J. Y., Hahn T.-W., Lim H. T., Kim G. Y., Park Y., Hahm K.-S., Chae B. J. (2009): Potato (Solanum tuberosum L. cv. Gogu valley) protein as an antimicrobial agent in the diets of broilers. Poultry Science, 88: Pouvreau L. (2004): Occurrence and physic-chemical properties of protease inhibitors from potato tuber (Solanum tuberosum). Ph.D. thesis, Wageningen University, The Netherlands, 157. Selitrennikoff C. P (2001): Antifungal Proteins. Applied and Environmental Microbiology, 67: Speranskaya A. S., Krinitsina A. A., Revina T. A., Gerasimova N. G., Keruchenko Y. A. S., Shevelev A. B., Valueva T. A. (2006): Heterologous xpression, purification, and properties of a potato protein inhibitor of serine proteinases. Biochemisty (Moscow), 11: Kontaktní adresa: Ing. Andrea Kamenová Oddělení pěstování rostlin Katedra rostlinné výroby a agroekologie Zemědělská fakulta Jihočeská univerzita v Českých Budějovicích Studentská České Budějovice 66

67 VLIV RŮZNÝCH SYSTÉMŮ ZPRACOVÁNÍ PŮDY NA PŮDNÍ VLASTNOSTI A ŽIVOTNÍ PROSTŘEDÍ The influence of various tillage systems on soil characteristics and the environment Šarapatka B., Čáp L., Netopil P. Přírodovědecká fakulta Univerzity Palackého v Olomouci Abstrakt V posledních letech jsou diskutovány otázky vlivu různých zemědělských systémů na kvalitu půdy s důrazem na udržitelné hospodaření. V našem výzkumu jsme se zaměřili na vliv agrotechnických opatření na půdní vlastnosti a erozní procesy. V první části práce se jedná o vliv tří forem zpracování půdy (orba, podrývání, minimalizační technologie) na vybrané vlastnosti půdy. Ze čtyřletého sledování je patrné, že různé způsoby zpracování půdy ovlivnily aktivitu většiny půdních enzymů a některé další charakteristiky půdy. Půdoochranným technologiím se věnujeme i ve druhé části příspěvku, a to z pohledu protierozní ochrany. Na konkrétním příkladu dokládáme, že pro účinnou ochranu půdy je nutný návrh kombinace protierozních opatření, v nichž mohou tyto technologie hrát pouze omezenou roli. Klíčová slova: půdoochranné technologie, orba, podrývání, minimalizace, charakteristiky, eroze, GAEC Abstract In recent years there has been much debate on the influence of various agricultural systems on soil quality with emphasis on sustainable management. In our research we have focused on various tillage systems and their influence on soil characteristics and on erosion processes. In the first part this deals with the influence of three forms of soil tillage (ploughing, subsoiling and reduced tillage) on selected soil characteristics. From four years of observation it is apparent that various ways of working the soil affected the activity of most soil enzymes and some other soil characteristics. Soil protection technology is also dealt with in the second part of our submission from the point of view of protection against erosion. On the basis of specific example we state that, for effective soil protection, it is essential to propose a combination of anti-erosion measures in which these technologies play only a partial role. Key words: soil protection, ploughing, subsoiling, reduced tillage, characteristics, erosion, GAEC Úvod Kvalita půdy, její ochrana a udržitelné hospodaření nabývají s ohledem na vývoj půdního fondu v posledních letech stále více na významu. Ve spojitosti s ovlivňováním půdních vlastností a životního prostředí jsou odbornou veřejností diskutovány i půdoochranné technologie. Ty s ohledem na půdní prostředí můžeme studovat pomocí indikátorů, mezi něž zařazujeme fyzikální, chemické i biologické vlastnosti půdy. Fyzikální stav má přímé i nepřímé vlivy na produkci rostlin a další charakteristiky. Strukturní půdy vykazují optimální poměry mezi půdním vzduchem a vodou s vlivy na koloběhy živin, růst kořenů atd. Změny těchto charakteristik se často odrážejí i u dalších procesů probíhajících v půdním prostředí, např. s charakteristikami souvisejícími s půdní organickou hmotou či s přijatelnými prvky nutnými pro růst rostlin. Kritéria fyzikálních a chemických charakteristik ve vztahu ke kvalitě půdy byla diskutována např. v roce 1992 Ashadem a Coenem. Ke klíčovému faktoru kvality půdy patří její organická hmota, která je nejen zdrojem živin, ale vykazuje i řadu dalších funkcí souvisejících s vodou v půdě, omezováním eroze, je potravním zdrojem edafonu atd. Organická hmota a biologická aktivita má vliv na koloběhy prvků v půdním prostředí. Jelikož v půdním prostředí probíhá řada velmi složitých biologických procesů, jsou velmi důležité i charakteristiky biologické a biochemické. Jedná se například o aktivitu půdních enzymů, které 67

68 jsou součástí biologických procesů v půdě, mají význam v dekompozici organických látek, mineralizaci a v kolobězích živin. Aktivita půdních enzymů může být citlivým indikátorem narušení biologických funkcí půdy. Vedle ph, kvality půdní organické hmoty, obsahu živin, vlhkostních poměrů, vegetačního krytu atd. může být aktivita enzymů výrazně ovlivněna zpracováním půdy a hnojením (Melero et al., 2006). Z dalších biologických charakteristik, které jsme do sledování rovněž zahrnuli, patří procesy v koloběhu dusíku amonifikace a nitrifikace a dále respirace půdy, která napovídá o biologické aktivitě půdy. V první popisované části výzkumu jsme se zaměřili na studium změn půdního systému při obhospodařování půdy třemi agrotechnickými způsoby, a to s využitím orby, podrývání a redukovaného zpracování půdy. Druhá část našeho výzkumu se zabývala využitím půdoochranných technologií při plánování protierozní ochrany v silně erozně ohrožených lokalitách. Tímto problémem se detailněji zabýváme proto, že eroze půdy je celosvětově nejzávažnějším degradačním faktorem a ohrožuje kvalitu půdy a produkci plodin na ní pěstovaných. Oldeman (1994) uvádí, že eroze se podílí 82 % na degradaci půdy antropogenním vlivem. V evropském prostoru představuje člověkem ovlivněná degradace půdy erozí 114,5 milionů hektarů. Je to vážný problém i v rámci České republiky, neboť ohrožuje zhruba polovinu ploch orné půdy (Šarapatka a kol., 2002) s tím, že v posledních letech se její intenzita v důsledku změn využívání krajiny a způsobu pěstování plodin ještě zvýšila. Šetrné využívání půdního fondu včetně správně navržené protierozní ochrany napomáhá těmto škodlivým vlivům předcházet. O způsobu návrhů protierozní ochrany je rozsáhlá odborná literatura, protierozních opatření v naší krajině je však velmi málo. V posledních letech musí zemědělci žádající o dotace splňovat Podmínky dobrého zemědělského a environmentálního stavu (GAEC), které vycházejí z Nařízení Rady (ES) 73/2009 a zahrnují rovněž erozi půdy. V publikovaných podmínkách je zejména nepěstování širokořádkových plodin na silně erozně ohrožených pozemcích a využívání půdoochranných technologií na určitých plochách u vybraných plodin. Na srovnání protierozní účinnosti podle těchto požadavků zahrnujících rovněž půdoochranné technologie s klasicky navrhovanou protierozní ochranou využívající organizační, agrotechnická i technická opatření jsme se zaměřili v našem výzkumu. Materiál a metody První částí výzkumu je sledování vlivu různých způsobů zpracování půdy na půdní charakteristiky, které jsme studovali v letech , a to na třech lokalitách v různých výrobních podmínkách s rozdílnými půdními typy. Jednalo se o lokality Unčovice (okres Olomouc), 227 m n. m., půdní typ černozem luvická, Hrušovany nad Jevišovkou (okres Znojmo), 210 m n. m., půdní typ černozem modální, Lesonice (okres Třebíč), 510 m n. m., půdní typ luvizem modální. V rámci osevního postupu se stejnými plodinami na všech lokalitách byly studovány půdní vlastnosti u tří způsobů agrotechniky, a to u klasického zpracování půdy s orbou do 0,22 m, u redukovaného zpracování půdy (minimalizace) do hloubky 0,15 m a u podrývání do hloubky 0,35 0,40 m. Vzorky půdy byly odebírány minimálně 2 x ročně z ploch 30 x 100 m. Po studiu literatury o hodnocení kvality půdy a s ohledem na zaměření ve výzkumu zúčastněných laboratoří jsme zvolili následující fyzikální a chemické charakteristiky - ph/kcl, K, Ca, Mg, P, K, Ca, kationtová výměnná kapacita, Corg., obsah humusu, suma huminových kyselin a fulvokyselin a jejich poměr, mikroagregáty, objemová hmotnost redukovaná, momentální obsah vody, vodostálost agregátů a kompakce půdy - s využitím metodik Zbíral a kol. ( ). Zvolili jsme i charakteristiky půdně biologické, v rámci nichž jsme studovali aktivitu vybraných půdních enzymů (dehydrogenáza, kyselá a alkalická fosfatáza, ureáza, proteáza, nitrát reduktáza, celuláza) a dále amonifikaci, nitrifikaci a půdní respiraci s využitím metodik 68

69 publikovaných pod editorstvím Schinner et al. (1995). Pro statistické hodnocení a zjišťování korelací byl využit Kruskal-Wallisův test s využitím softwaru STATISTICA. Druhý výzkum jsme prováděli na zemědělské půdě ve vybraných oblastech jižní Moravy (katastry obcí Archlebov, Velké Hostěrádky), a dále ve vyšších nadmořských výškách (Sasov, Rychtářov). V těchto lokalitách byla po vyhodnocení potenciální eroze navržena protierozní ochrana (PEO) a zároveň byla hodnocena účinnost opatření podle Standardů dobrého zemědělského a environmentálního stavu (GAEC). Jednotlivé návrhy PEO, které posloužily jako možná alternativa ke koncepci GAEC, vycházely ze čtyř kategorií, jež kombinovaly opatření agrotechnického a technického charakteru - orná půda bez opatření, orná půda s protierozními opatřeními, trvalý travní porost a liniová opatření. Ta zahrnovala zasakovací pásy, svodné a záchytné průlehy a stabilizaci drah soustředěného odtoku. Pro zhodnocení původního stavu bez půdoochranného managementu byla využita pro minimalizaci ztráty půdy a návrh PEO rovnice USLE. Stav bez protierozního managementu byl srovnáván s opatřeními GAEC (WMS sever VÚMOP). Pro srovnávací analýzu byla využita digitální data a programové prostředí ArcGIS 9.3 (ESRI), kde rastrové vrstvy GAEC byly prolnuty s polygonovou vrstvou půdních bloků zájmových území, a to pro potřeby získání informace o výskytu kategorie silně a mírně erozně ohrožené půdy. Ty byly dále pomocí geostatistických nástrojů vyhodnoceny. Výsledky a Diskuze V našem výzkumu různých systémů zpracování půdy jsme se soustředili zejména na to, jak se se změnou hospodaření mění půdní vlastnosti, a to do hloubky 5 cm a ve vrstvě 0-20 cm. Následující tabulka 1 ukazuje, které z charakteristik se statisticky významně odlišovaly při různém managementu. Tab. 1 Statisticky významné rozdíly půdních charakteristik v závislosti na způsobu hospodaření v horizontu 0-20 cm. Charakteristiky / zpracování půdy orba podrývání minimalizace Aktivita celulázy Ø Aktivita proteázy Ø Aktivita nitrát reduktázy Aktivita kyselé fosfatázy Aktivita alkalické fosfatázy Σ huminových kyselin Mikroagregáty mm Ø Mikroagregáty < 0,1 mm Ø Objemová hmotnost Ø Vodostálost agregátů - nižší hodnoty půdních charakteristik, - vyšší hodnoty charakteristik, Ø - hodnoty zasahovaly jak do skupiny, tak. Ze statistického zpracování výsledků za 4 roky sledování vyplývá u variant s minimalizačními zpracováním půdy a u podrývání řada korelací a změn u aktivity půdních enzymů, což odpovídá i literárním údajům. Statisticky jsme sice za dobu výzkumu neprokázali vyšší obsah uhlíku, což odpovídá rovněž řadě výsledků krátkodobějších výzkumů (např. Green et al., 2007), z publikovaných dat více výzkumů je ale možné říci, že půdoochranné technologie obecně zvyšují obsah půdní organické hmoty v povrchové vrstvě půdy. Větší množství posklizňových zbytků v této vrstvě tak mohlo ovlivnit aktivitu půdních enzymů, které podle výzkumů signifikantně korelují s půdní organickou hmotou (Acosta-Martinez et al., 2003). Aktivita vybraných půdních enzymů se tak v našem sledování jevila jako dobrý indikátor kvality půdy, neboť mj. citlivě reaguje na změny managementu a tyto změny byly 69

70 zaznamenatelné dříve než je tomu u jiných půdních vlastností. Těmi byly např. chemické vlastnosti, u nichž nebyly během doby výzkumu zaznamenány statisticky průkazné rozdíly, s výjimkou Mg a výměnného Mg. Statisticky průkazné změny však byly zaznamenány u některých fyzikálních charakteristik, a to u objemové hmotnosti, mikroagregátů a jejich stability. U objemové hmotnosti, jako u základní fyzikální charakteristiky, popisují výsledky některých experimentů vyšší hodnoty u minimalizačních technologií, další výzkumy rozdíly mezi systémy nepotvrzují (např. Ferreras et al., 2000). Naše výsledky ukazují v horizontu 0-20 cm na nižší hodnoty objemové hmotnosti u orby, což odpovídá výše uvedeným pracím, v povrchové vrstvě do 5 cm však nebyly tyto rozdíly zaznamenány. I další charakteristika týkající se půdních agregátů je ovlivňována managementem a může být více stabilní u půdoochranných technologií (např. Pagliai et al., 2004). Obdobná zjištění jsme zaznamenali i v našem výzkumu pro mikroagregáty mm, u mikroagregátů < 0.1 mm byly výsledky ve prospěch varianty s orbou. Z literatury je možné konstatovat, že stabilita agregátů je silně ovlivňována obsahem a dodávkou organické hmoty (Haynes et al., 1996) a je předpoklad jejich vyšší stability v povrchových vrstvách minimalizačních technologií.v dlouhodobější perspektivě Výsledky po čtyřech letech výzkumu tomu nasvědčují. Pozitivně může na půdní vlastnosti rovněž působit podle našich i v literatuře publikovaných výsledků podrývání, kdy může eliminovat utužení po mnoha letech hospodaření. Druhá část příspěvku se týká protierozní ochrany, včetně využití půdoochranných technologií v rámci směrnice GAEC, kde jejich účinnost nemusí být dostačující. Po vyhodnocení erozního smyvu na modelových farmách je zřejmá vysoká erozní ohroženost, zejména v intenzivně obhospodařovaných územích černozemních oblastí jižní Moravy. V těchto lokalitách je nutná náročnější protierozní ochrana a účinnost opatření GAEC se jeví jako nedostatečná. Jako příklad uvedeme katastr Velkých Hostěrádek, který lze považovat za velmi ohrožené území vodní erozí. Průměrný erozní smyv je zde 20,3 t.ha -1 za rok a celková ztráta půdy v řešeném území je t za rok. Komplexním návrhem protierozních opatření může dojít ke snížení průměrné hodnoty erozního smyvu na 5,4 t.ha -1 za rok a ke snížení celkové ztráty půdy na t za rok, to je snížení o 73,4 %. Podle požadovaného managementu standardů Dobrého zemědělského a environmentálního stavu (GAEC) s využitím půdoochranných technologií dochází ke snížení průměrné hodnoty erozního smyvu na 11,6 t.ha -1 za rok a ke snížení celkové ztráty půdy v řešeném území na t za rok, tj. snížení hodnot erozního smyvu o 42,9 %. Průměrný smyv tedy zůstává nad povoleným limitem a v katastru se stále vyskytují extrémně erozně ohrožené lokality (Obr. 1 a 2). Pro efektivní ochranu půdního fondu formou různých agrotechnických i vyloženě technických prvků je nezbytně nutná znalost místních podmínek v měřítku okresu, katastru, povodí či konkrétní farmy. Vliv rozdílných agrotechnických postupů, i v rámci malých farem (povodí), je na ztrátu půdy a základních živin zcela zásadní (Bechmann et al., 2009). Tím se dá účinně předcházet environmentálním a ekonomickým škodám. Striktně daná pravidla vyplácení zemědělské podpory vycházející z jednotné evropské zemědělské politiky, ze které čerpá i strategie tzv. Dobrého zemědělského a environmentálního stavu (GAEC), mohou zásadně ovlivňovat nejen míru ochrany zemědělské půdy před erozí. Míra účinnosti však také záleží na náročnosti nastavení pravidel protierozní ochrany a jejich důsledném dodržování v praxi. Budoucí diskuze vztahující se k efektivitě půdoochranných technologií s využitím znalostí o měnících se vlastnostech půdy musí tedy být nezbytnou součástí účinné a v praxi fungující protierozní ochrany. 70

71 Obr. 1 a 2: Erozní smyv ve vybraném území bez provedení protierozní ochrany a po zavedení pravidel GAEC Závěr V následujících dekádách bude muset rostlinná produkce zásobovat stále větší populaci na omezenějších plochách. Z důvodů produkčních, environmentálních, ale i ekonomických jsou propracovávány různé produkční systémy i způsoby zpracování půdy. Mezi ně patří i systémy s minimalizovaným zpracováním půdy a využití podrývání, to jsou technologie, kterými jsme se zabývali v našem výzkumu. Naše výsledky, z nichž některé jsou uvedeny v tomto článku, ukazují na zvyšující se biologickou aktivitu vyjádřenou aktivitou půdních enzymů u variant s omezeným zpracováním půdy a s podrýváním ve srovnání s klasickým zpracováním půdy s využitím orby. Další průkazné rozdíly se týkají i některých fyzikálních charakteristik. Vedle popsaných rozdílů mezi jednotlivými variantami agrotechniky, které byly zaznamenány v průběhu čtyřletého sledování, je důležité zjištění týkající se aktivity půdních enzymů. Tyto charakteristiky citlivě reagovaly na změny v půdním prostředí a potvrdila se jejich využitelnost při sledování kvality půdy, což zapadá i do koncepce indikátorů kvality půdy. Půdoochranné technologie jsou zaváděny i jako součást GAEC. Z našich sledování jasně vyplývá, že tato opatření se mohou stát součástí protierozní ochrany, důležitý je ale komplexní přístup. V něm je klíčové klást větší důraz na místní podmínky a snažit se o navržení kombinace optimálních protierozních opatření organizačního, agrotechnického i technického typu, čímž se podstatně zvyšuje míra ochrany zemědělské půdy. Půdoochranné technologie jsou tedy jedním a ne jediným opatřením. Důležitým faktorem pro úspěšné zavedení takovéhoto přístupu k protierozní ochraně do praxe musí být samozřejmě i náležitý kontakt a komunikace s jednotlivými zemědělci a s dalšími zúčastněnými stranami (např. zástupci obcí). Z dlouhodobého hlediska by totiž neměla být stimulem (cílem) pouze finanční motivace v podobě dotačních plateb, ale i posun v uvažování při ochraně a udržitelném využívání zemědělského půdního fondu, který je nutné brát v i delším časovém horizontu jako neobnovitelný přírodní zdroj. 71

72 Poděkování Autoři článku děkují Národní agentuře pro zemědělský výzkum, která umožnila studium půdních vlastností při různých způsobech zpracování půdy a řešení problematiky eroze. Tento výzkum byl podpořen granty QH a QJ Děkujeme rovněž spoluřešitelům úkolu z Výzkumného ústavu pícninářského v Troubsku a z Mendelovy univerzity v Brně za poskytnutí některých dat. Použitá literatura Acosta-Martinez, V., Zobeck, T.M., Gill, T.E., Kennedy, A.C., Enzyme activities and microbial community structure in semiarid agricultural soils. Biology and Fertility of Soils 38/4, Ashad, M.A., Coen, G.M., Characterization of soil quality: physical and chemical criteria. Am. J. Altern. Agric. 7, Bechmann, M., Stalnacke, P., Kvoerno, S., Eggestad, H. O., Oygarden, L., Integrated tool for risk assessment in agricultural management of soil erosion and losses of phosphorus and nitrogen. Sci. Total Environ. 407(2), Ferreras, L.A., Costa, J.L., Garcia, F.O., Pecorari, C., Effect of no-tillage on some soil physical properties of a structural degraded petrocalcic paleudoll of the south pampa of Argentina. Soil Till. Res. 54(1-2), Green, V.S., Stott, D.E., Cruz, J.C., Curi, N., Tillage impacts on soil biological activity and aggregation in a Brazilian Cerrado Oxisol. Soil Till Res 92, Haynes, R.J., Beare, M.H., Aggregation and organic matter storage in meso-thermal humid soils. In: Structure and Organic Matter Storage in Agricultural Soils, (ed. Carter MR., Stewart BA.), CRC Press/Lewis Publications,Boca Raton, Melero, S., Porras, J.C.R., Herencia, J.F., Madejon, E., Chemical and biochemical properties in a silty loam under conventional and organic management. Soil Tillage Res. 90 (1-2), Oldeman, L. R., An international methodology for an assessment of soil degradation, land georeferenced soils and terrain data base. In: The collection and analysis of land degradation data. FAO-RAPA Publication 1994/3, Bangkok, Pagliai, M., Vignozzi, N., Pellegrini, S., Soil structure and the effect of management practices. Soil Tillage Res. 79, Schinner, F., Öhlinger, R., Kandeler, E., Margesin, R., eds., Methods in soil biology. Springer, 426 p. Šarapatka, B., Dlapa, P., Bedrna, Z., Kvalita a degradace půdy. (Soil quality and degradation). Palacký University Press, 346 p. (in Czech). Zbiral, J., ed., Methods of soil analysis. Central institute for supervising and testing in agriculture Brno. 3 parts. Kontaktní adresa: Prof. Dr. Ing. Bořivoj Šarapatka, CSc., Přírodovědecká fakulta Univerzity Palackého v Olomouci tř. Svobody 26, Olomouc 72

73 VLIV HNOJENÍ A SPONU VÝSADBY NA VÝNOS NADZEMNÍ BIOMASY A HLÍZ TOPINAMBURU Effect of fertilization and planting density on the yield of above-ground biomass and tubers of Jerusalem artichoke Čížek M., Svobodová A., Čepl J. Výzkumný ústav bramborářský Havlíčkův Brod Abstrakt Topinambur (Helianthus tuberosus) nepatří mezi široce pěstované plodiny. Je univerzálně použitelný, v lidské stravě (zdroj inulinu), pro krmení hospodářských zvířat a jako energetická plodina. V polních pokusech prováděných ve Výzkumné stanici Valečov při VÚB Havlíčkův Brod, v průběhu byl sledován vliv genotypu a pěstebních technologií topinamburu. Souhrnně bylo použito 10 klonů. Sklizeň nadzemní hmoty byla provedena na podzim, hlízy byly sklizeny na jaře. V závislosti na roce a klonu, výnosy nadzemní části dosáhly 15,3-71,9 t čerstvé hmoty/ha (5,4-24,7 t sušiny/ha).výnos na jaře sklizených hlíz se pohyboval mezi 17,0 a 63,8 t/ha (4,4-7,9 t sušiny/ha). Byly ověřeny pěstební technologie topinamburu ve vztahu k optimalizaci porostů pro získání vysokých výnosů. Nejúčinnější variantou hnojení bylo 100 kg N/ha a foliární aplikace močoviny, mezi spony výsadby (hustotou porostu) nebyly zaznamenány statisticky významné rozdíly ve výnosu nadzemní biomasy a hlíz topinamburu. Klíčová slova: topinambur; hlízy; klony; hnojení; spony výsadby Abstract Jerusalem artichoke (Helianthus tuberosus) is a not widely grown crop. It is universally usable, in human diet (source of inulin), for livestock feeding and as an energy crop. In field trials performed in Valecov Research Station belonging to PRI Havlickuv Brod, during an effect of genotype and growing technology was studied on Jerusalem artichoke production characteristics. Totally, 10 clones were used. The harvest of aboveground mass was done in autumn, tubers were harvested in spring (though deep soil freezing, the tubers are not frost-killed). In dependence on year and clone, yields of aboveground part reached 15,3 71,9 t FW/ha (5,4 24,7 t DW/ha). The yield of springharvested tubers ranged between 17,0 and 63,3 t/ha (4,4 7,9 t DW/ha). Growing technologies for Jerusalem artichoke were verified, in relation to optimization of cultural practices for obtaining high yields. The most effective fertilization variant was 100 kg N/ha and foliar application of urea, between planting densities no significant differences were recorded for yields. Key words: Jerusalem artichoke; tubers; clone; fertilization; planting densities Úvod Topinambur hlíznatý (Helianthus tuberosus L.) pochází ze Severní Ameriky, do Evropy byl dovezen v 16 století z Mexika. Topinambur je všestranně využitelný a to jak k lidské výživě a ke krmení hospodářských zvířat i jako energetická plodina (Čepl, 1997). V malém rozsahu je pěstován prakticky na celém světě včetně České republiky, větším pěstitelem je Francie. Topinambur je mohutná rostlina z čeledi hvězdnicovité (Asteraceae), vysoká přes dva metry. Nekoření hluboko, ale má mohutnou síť kořenů, které velmi dobře resorbují vodu a živiny z půdy. Listy má vstřícné, podlouhle vejčité, drsné, žluté květy jsou v malých úborech. Topinambur je rostlina krátkého dne, rozkvétá pozdě na podzim (říjen, listopad), takže plody (nažky) dozrávají jen v teplých oblastech. Hlízy jsou nepravidelné, podlouhlé, s hlubokými očky, bílé, žluté nebo červené. Topinambur je druh nenáročný na prostředí, je velmi plastický. Snáší vlhké i suché polohy, hlízy v půdě nejsou poškozovány ani silnými mrazy. Je vhodný pro pěstování v horských i podhorských oblastech (Moudrý, 1996). Nejvíce publikovaných výzkumných prací se týká využití topinamburu pro potravinářské účely. Z hlíz topinamburu se získává polysacharid inulin, složený převážně z molekul fruktózy (Moudrý, 1996). Inulin u rostlin z čeledi hvězdnicovitých a zvonkovitých nahrazuje 73

74 škrob jako zásobní látku. Inulin je cenná látka, zejména pro diabetiky. Neštěpí v tenkém střevě, není resorbován a využíván. Jeho kalorická hodnota je velmi nízká až nulová, nezvyšuje hladinu krevního cukru. Zároveň je sladký, dá se proto použít jako náhrada cukru nebo jako náhrada tuku (pro nízkotučné výrobky). Odrůdy/klony topinamburu nejsou v Evropě příliš centrem zájmu výzkumu. Je to zejména proto, že Evropský společný katalog odrůd druhů zemědělských rostlin odrůdy topinamburu oficiálně neuvádí. V podmínkách Asie jsou známy odrůdy, které rozdílně reagují na vodní stres (Xiuyan, Yulin), jak uvádí Zhang, et al. (2011). Gao et al. (2011) sledoval vliv závlahy a dusíkatého hnojení na výnos biomasy nadzemní i podzemní části rostlin topinamburu. Zaměřil se i na sledování vztahů mezi kořeny, stonky, hlízami a listy. Průkazné rozdíly byly zjištěny pouze v podmínkách závlahy. Zatímco Losavio et al. (1997) uvádí, že výnos hlíz topinamburu nebyl statisticky ovlivněn hnojením N, Rodrigues et al. tvrdí, že hnojení N průkazně zvýšilo výnos hlíz topinamburu. Denoroy (1991) uvádí jako hlavní fenologickou fází, která má vliv na výnos a kvalitu hlíz topinamburu počátek kvetení. V České republice mají výzkumné práce týkající se topinamburu tradici. Nejprve se jim ve větší míře zabýval Votoupal (1986), později Moudrý et al. (1996) a Čepl (1997). V současné době jsou ve VÚB práce v rámci výzkumného projektu zaměřeny na polní pokusy s klony a spony výsadby topinamburu, jednoleté i víceleté pěstování topinamburu a rovněž na krmivářské využití. Materiál a metody Polní pokus s odrůdami a klony topinamburu a s dvěma variantami sponu výsadby byl založen na pozemku VÚB Havlíčkův Brod ve výzkumné stanici Valečov. Nadmořská výška: 460 m Zemědělská výrobní oblast: bramborářská (BVT) Průměrná roční teplota vzduchu: 7,0 C Průměrná teplota vzduchu za vegetační období: 13,2 C Průměrná roční suma srážek: 652 mm Průměrná suma srážek za vegetační období: 426 mm Odrůdy (klony) zařazené do pokusu: Běloslupké, Reka, Refla, K 24, C63, Karina, Úrodný, Völkenroder Spindel, Lola a Gigant. Agrotechnické zásahy byly prováděny jednotně ve všech pokusných letech. Celá pokusná plocha byla pohnojena minerálními hnojivy. Aplikováno bylo: 2,18 q močoviny a 4,0 q patentkali, čímž bylo dodáno 100 kg N, 120 kg K 2 O a 40 kg MgO na ha. Porost byl preemergentně ošetřen herbicidem Afalon 45 SC v dávce 1,0 l/ha. Během vegetace již nebyly provedeny žádné další agrotechnické zásahy ani nebyly aplikovány žádné další pesticidy. Zároveň byl založen polní pokus s dvěma variantami sponů výsadby (750 x 350 mm a 750 x 700 mm). Při sponu výsadby 750 x 350 mm je počítáno rostlin na jeden hektar; při sponu 750 x 700 mm je počítáno rostlin na jeden hektar. Dále byla srovnávána dávka N 100 kg/ha se zvýšenou dávkou 200 kg N/ha a s foliární aplikací N během vegetace. Foliární aplikace N byla provedena 9% roztokem močoviny v dávce 400 l/ha (16,56 kg N/ha) ve dvou termínech. Pro tento pokus byla použita odrůda Karina (výnosově dlouhodobě stabilní, příznivý tvar hlíz pro univerzální použití). Sklizeň pokusu s odrůdami a klony topinamburu, stejně jako se spony výsadby a variantami hnojení N byla vždy provedena na jaře následujícího roku (duben). Pro hodnocení produkce nadzemní hmoty topinamburu byly každým rokem provedeny odběry v listopadu před zmrznutím natě. 74

75 Výsledky a diskuze Výnosová úroveň hlíz (tab. 1) jednotlivých klonů se výrazně lišila v jednotlivých ročnících pokusu. Nejvyššího výnosu hlíz (54,3 t/ha v průměru odrůd) bylo dosaženo v roce Rovněž v roce 2011 bylo dosaženo vysoké výnosové úrovně (47,8 t/ha v průměru odrůd). V obou těchto letech byly pro růst a vývoj topinamburu příznivé povětrnostní podmínky. Vývoj porostu byl ve vegetaci vyrovnaný a zejména v podzimním období (září, říjen) došlo k vysokému nárůstu hlíz. Naproti tomu v roce 2009 byl pro vývoj porostu topinamburu méně příznivý již začátek vegetačního období, který navíc způsobil i opožděný termín výsadby pokusů. V roce 2010 růst výrazně ovlivnilo velmi suché období června a července (potvrzeny závěry Gao et al. (2011) o potřebě vody pro růst topinamburu). Rovněž podzim 2010 se vyznačoval poměrně časným nástupem minimálních nočních a ranních teplot vzduchu s častými přízemními mrazíky, které ukončily nárůst hlíz. Výnos hlíz jednotlivých klonů se v průměru sledovaných let pohyboval od 33,4 t/ha (Reka), do 47, 5 t/ha (Urodny). Průměrný výnos hlíz u tohoto klonu byl statisticky průkazně vyšší ve srovnání s ostatními sledovanými klony a rovněž u něho byl dosažen absolutně nejvyšší výnos hlíz za sledované období - 63,8 t/ha v roce Výnos hlíz vyšší než průměr sledovaných klonů byl dále zjištěn u klonů Gigant (43,8 t/ha), Völkenroder Spindel (43,7 t/ha) a původní české odrůdy Běloslupké (42,3 t/ha). Naopak nejnižší průměrný výnos hlíz byl zjištěn u klonu Reka. Tento klon se z pohledu výnosu hlíz jeví jako nestabilní, neboť ve třech ze čtyř pokusných let (2009 a 2010) dosáhl druhého nejnižšího výnosu, v roce 2011 byl výnos jeho hlíz nejnižší ze sledovaných klonů, zatímco v roce 2008 výnosově převyšoval průměr klonů. Tab. 1: Vliv klonů na výnosové ukazatele topinamburu hlízy ( ) Výnos hlíz Klon Průměr let t/ha t/ha t/ha t/ha t/ha Běloslupká 57,74 a 28,53 cd 31,13 ab 51,83 abcd 42,31 a Reka 56,02 a 23,48 d 19,05 bc 34,87 e 33,36 a Refla 55,81 a 21,79 d 21,99 bc 52,60 abc 38,05 a K 24 59,10 a 37,36 ab 20,07 bc 36,88 e 38,35 a C 63 44,91 a 33,83 abc 17,01 c 52,36 abcd 37,03 a Karina 53,98 a 38,09 a 24,83 bc 38,15 de 38,76 a Urodny 48,76 a 38,27 a 39,07 a 63,85 a 47,49 b Völken. Spindel 61,67 a 36,17 abc 29,88 ab 47,11 bcde 43,71 a Lola 53,50 a 29,24 bcd 22,96 bc 40,92 cde 36,65 a Gigant 51,60 a 36,39 abc 27,52 abc 59,59 ab 43,78 a Průměr klonů 54,31 32,32 25,35 47,82 39,95 Výnos nadzemní hmoty byl statisticky ovlivněn pěstovanými klony na hladině významnosti α = 0,05 (obr. 1). Mezi nejvýnosnější patří klon Karina, který dosáhl v průměru let výnosu 63,8 t/ha čerstvé hmoty (20,3 t/ha sušiny). Dále se vysokou produkcí nadzemní biomasy vyznačovaly klony K 24 a Lola, u nichž výnos čerstvé natě přesahoval 50 t/ha. Mezi odrůdami byly značné rozdíly mezi obsahem sušiny natě v době odběru. Sušina se pohybovala od 30,9 % (Karina) až po 68,9 % (Urodny) tento klon spolu s klonem označeným C 63 měly nejnižší produkci nadzemní hmoty v čerstvém stavu i její sušiny. 75

76 Obr. 1 Vliv klonů na výnos nadzemní části topinamburu (a) a sušiny (b) 90 Současný efekt: F(9, 30)=5,8587, p=,00011 Dekompozice efektivní hypotézy Vertikální sloupce označují 0,95 intervaly spolehlivosti t/ha Běloslupká Reka Refla K24 C63 Karina Urodny Lola Völken. spindel Gigant Odrůda 30 Současný efekt: F(9, 30)=4,7486, p=,00056 Dekompozice efektivní hypotézy Vertikální sloupce označují 0,95 intervaly spolehlivosti t/ha Běloslupká Reka Refla K24 C63 Karina Urodny Lola Völken. spindel Gigant Odrůda Tab. 2 Vliv hnojení dusíkem na výnos hlíz topinamburu v průměru let Varianty hnojení Výnos (t/ha) F p N 100 N 200 N100 + foliární apl. 38,6 a 37,7 a 39,7 a 0,227 0,978 Sledované dávky dusíku neovlivnily výnos hlíz natolik, aby byla zjištěna statistická průkaznost (tab. 2). Základní dávka dusíku 100 kg/ha se projevila jako dostačující. Zdvojnásobením dávky na 200 kg nebylo v podmínkách pokusu dosaženo zvýšení výnosu hlíz. Tendenčně vyšší výnos hlíz byl každoročně zaznamenán při foliární aplikaci dusíku, která doplňovala základní dávku 100 kg N/ha před sázením. Toto zvýšení výnosu se v průměru pokusných let pohybovalo na úrovni 3 % bez výraznějších ročníkových výkyvů. 76

77 Obr. 2 Vliv sponu výsadby na výnos hlíz topinamburu v průměru let Výnos (t/ha) Krabicový graf : Výnos hlíz x35 Spon 75x70 Průměr Průměr±SmCh Průměr±1,96*SmCh Spon výsadby ovlivnil výnos hlíz výrazně, ačkoliv průměrné výsledky za sledované období nebyly statisticky průkazné. Hustší spon výsadby (750 x 350 mm tj jedinců na ha) přinesl podstatně vyšší výnos hlíz (v průměru variant o 7, 5 t hlíz /ha). I když lze u řidšího sponu výsadby (750 x 700 mm, tj, jedinců na ha) kalkulovat s polovičními náklady na sadbové hlízy, tento výnosový rozdíl úsporu předčí. Na základě výsledků však lze konstatovat, že u sponu výsadby 750 x 350 mm není využit výnosový potenciál zařazené odrůdy topinamburu, protože průměrný výnos hlíz z jedné rostliny byl 1,0 kg, zatímco u sponu 750 x 700 mm bylo z jedné rostliny sklizeno 1,6 kg hlíz. Pro optimalizaci výnosu hlíz z plochy se optimální hodnota počtu rostlin na hektar (spon výsadby) pohybuje mezi stanovenými variantami. Závěr Nejvyšší výnosová úroveň hlíz topinamburu byla zaznamenána u klonů Völkenroder Spindel, Urodny a původního českého klonu Běloslupké. Nelze však konstatovat, že výnosy u těchto tří klonů byly stabilně vysoké ve všech letech pokusu, ale z hlediska požadavků na tvorbu biomasy hlíz je možné tyto klony doporučit jako produkčně nejvyšší. Hmotnost nadzemní části byla nejvyšší u klonu Karina, dále Lola a K 24, z tohoto hlediska je možné tyto klony doporučit pro energetické využití. Požadavky na univerzální využitelnost pro produkci hlíz i nadzemní části splňují klony Karina, která má průměrný výnos hlíz, navíc stabilní ve všech sledovaných letech. Dále klon Völkenroder Spindel, který má vysoce nadprůměrnou produkci hlíz i vysokou produkci nadzemní biomasy. Sledované dávky dusíku neměly vliv na výnos hlíz. Dávka dusíku 100 kg/ha se projevila jako dostačující, zdvojnásobením dávky na 200 kg nebylo dosaženo žádného efektu. Foliární aplikací dusíku v průběhu vegetace bylo docíleno tendenční zvýšení výnosu hlíz na úrovni 3 %. Sponem výsadby (počtem rostlin na plochu) lze ovlivnit výnos hlíz. Ve výsledcích však nebylo dosaženo statistické průkaznosti. 77

78 Dedikace Výsledky byly získány v rámci řešení projektu NAZV QH podporovaného Mze ČR. Použitá literatura Conde, J.R., Tenorio, J.L., Rodriguez-maribona, B., Ayerbet, L., 1991: Tuber yields of Jerusalem artichoke (Helianthus Tuberosus L.) in relation to water stress. Biomass and Bioenergy, 1, 3, Čepl, J., Vacek, J., Bouma, J., 1997: Technologie pěstování a užití topinamburu. Metodiky pro zemědělskou praxi, ÚZPI Praha 2, 20 s. ISBN Denoroy, P., 1996: The crop physiology of Helianthus tuberosus L.: A model oriented view. Biomass and Bioenergy, 11, 1, Gao K., Zhu T.X., Han G.D, 2011: Water and nitrogen interactively increased the biomass production of Jerusalem artichoke (Helianthus tuberosus L.) in semi-arid area. African J. Biotech. 10: Losavio, N., Lamascese, N., Vonella, A.V., 1996: Water requirements and nitrogen fertilization in Jerusalem artichoke (Helianthus tuberosus L.) grown under Mediterranean conditions. In Second International Symposium on Irrigation of Horticultural Crops, Vols 1 and 2, Acta Horticulturae, 449, , part 1 and 2. Moudrý, J., Strašil, Z., 1996: Alternativní plodiny. JČU České Budějovice, 90 s. Rodrigues, M.A., Sousa, L., Cabanas, J.E., Arrobas, M., 2007: Tuber yield and leaf mineral composition of Jerusalem artichoke (Helianthus tuberosus L.) grown under different cropping practises. Spanish Journal of Agricultural Research, 5, 4, Votoupal, B., 1986: Topinambur (Helianthus tuberosus L.). In: Špaldon E. et al.: Rostlinná výroba. Statni zemedelske nakladatelstvi Praha, s Zhang M.D., Chen Q.A., Shen S.H., 2011: Physiological responses of two Jerusalem artichoke cultivars to drought stress induced by polyethylene glycol. Acta Physiologia Plantarum 33: Kontaktní adresa: Ing. Milan Čížek, Ph.D. Výzkumný ústav bramborářský Havlíčkův Brod, s.r.o. Dobrovského 2366, Havlíčkův Brod 78

79 DISTRIBUCE KOŘENŮ PLODIN V PŮDNÍM PROFILU A VYUŽITELNÁ ZÁSOBA DUSÍKU A VODY The distribution of roots in soil profile and available supply of nitrogen and water Haberle J., Svoboda P. Výzkumný ústav rostlinné výroby, v.v.i., Praha Abstrakt V polním pokusu s ozimou pšenicí bylo určeno využití vody a minerálního dusíku z vrstev půdního profilu do hloubky 130 cm. Byla použita bilanční metoda, odběr vody a dusíku byl vypočítán z rozdílu zásoby na počátku jarní vegetace s nejvyšším obsahem uvedených zdrojů a obsahu ve zrání. Byla určena hustota kořenů. Výsledky prokázaly, že v případě nedostatku dusíku nebo vody je porost pšenice schopen využívat zásobu v hlubších vrstvách podorničí, kde je nízká hustota kořenů, pod 1 cm/cm 3 půdy. Bilanční využití dostupné vody z vrstvy cm se pohybovalo mezi 72-80%, u dusíku to bylo 68-92%. Ve vrstvách cm a cm to bylo u vody 56% a 39%, u dusíku 73% a 28%. Využití dostupné zásoby obou zdrojů z podorničí bylo podobné (r > +0,94). Klíčová slova: hustota kořenů, podorničí, minerální dusík, pšenice, efektivnost Abstract The utilization of nitrogen and water from layers of a soil profile to depth 130 cm was determined in field experiment with winter wheat. The apparent depletion of water and nitrogen was calculated with balance method, as the difference between content at the start of spring growth, with the highest supply of the sources, and the content at the period of grain filling. Rooting depth at grain filling was determined. The results of experiment proved that wheat crop is able to utilise supply of water and nitrogen in deep subsoil layers with a low rooting density under 1 cm/cm 3 of soil. Apparent depletion of water from cm layer was between 72-80%, the utilisation of nitrogen was 68-92%. The utilisation of available water in layers cm a cm was 56% a 39%, and 73% a 28% of mineral nitrogen supply at spring. The utilization of available supply of both sources from subsoil layers was similar (r > +0,94). Key words: root density, subsoil, mineral nitrogen, wheat, effectiveness Úvod Dostupnost vody a živin, především dusíku, je limitujícím faktorem výnosu plodin. Větší či menší nedostatek vody se projevuje nepravidelně, ale často, ve většině zemědělských oblastí České republiky, naposledy v roce Kromě specifických podmínek závlahového hospodaření nelze množství dostupné vody pro plodiny přímo ovlivnit. Proto je nutné studovat vliv dalších faktorů, které ovlivňují příjem a využití zásoby půdní vody kořenovým systémem. To například umožní přesněji odhadnout nástup vodního stresu a zaměřit agrotechniku na vhodná opatření pro šetření vodou a efektivní využití půdní zásoby. Podobně, co největší využití minerálního dusíku z kořenové zóny zvyšuje efektivnost hnojení a snižuje náklady na hnojení, současně snižuje obsah reziduálního N v půdě po sklizni a tím riziko jeho vyplavení mimo dosah kořenů. Při hodnocení dostupnosti dusíku a vody v hlubších vrstvách podorničí se často zásoba těchto zdrojů ve vrstvách s nízkou hustotou kořenů považuje za prakticky nevyužitelnou. Cílem této práce bylo určit schopnost porostu pšenice využívat zásobu dusíku a vody v podorničí a určit distribuci hustoty kořenů ve vrstvách půdního profilu. 79

80 Vrstva (cm) Úroda 12/2012, vědecká příloha časopisu Materiál a metody Polní pokus probíhal v letech v Praze Ruzyni (334 m n.m., teplá, mírně suchá oblast, hlinito-jílovitá půda na spraši). Podrobné meteorologické údaje jsou dostupné na Nedostatek vody byl indukován pomocí mobilního krytu (pokus měl dále variantu s optimální dodávkou vody a kontrolu závislou pouze na srážkách). Kryt byl používán podle potřeby, s cílem dosáhnout od počátku kvetení a dále úrovně mm vody ve vrstvě 0-90 cm.vlhkost půdy byla řízena na základě údajů o vlhkosti půdy, referenční evapotranspiraci a odběru vody porostem pšenice v minulých letech. V pokusných letech bylo sledováno více odrůd ozimé pšenice (Triticum aestivum L.), kromě roku 2007 byl stres indukován vždy u dvou odrůd. Pro hodnocení byly použity průměrné údaje z obou odrůd. Pšenice byla hnojena 30 kg/ha (N1) a 140 kg/ha (N2). Pokus měl čtyři opakování (parcelky 5,5 x 6 m), u stresované varianty byla dvě opakování byla tvořena rozdělením zakrývané plochy o velikosti 44 m 2. Obsah minerálního dusíku (N min = N-NO 3 + N-NH 4 ) byl určován v průběhu růstu ve vrstvě 0-10 cm a dále po vrstvách 20 cm do hloubky 130 cm. Fravimetrická vlhkost půdy byla přepočtena na objemovou vlhkost na základě objemové hmotnosti půdy. Byla určena distribuce kořenů ve fází nalévání zrna do hloubky nejméně 130 cm, kořeny se vyplavovaly na sadě sít a po dočištění se měřila délka kořenů, hustota byla vypočtena z objemu vzorku.v pokusech byla uplatněna běžná agrotechnika, podrobnější údaje o pokusu jsou uvedeny v publikacích Raimanová a Haberle (2010), Haberle a Svoboda (2011) a Haberle (2010). Práce vycházela z předpokladu, že nedostatek vody nebo dusíku, kdy není naplněn požadavek rostlin na daný zdroj, stimuluje využití v celé kořenové zóně a indikuje tak jeho maximální využití. Bylo vypočteno využití vody a dusíku z vrstev půdního profilu do hloubky 130 cm bilanční metodou. Odběr vody a dusíku byl vypočítán z rozdílu zásoby na počátku jarní vegetace, kdy je v daných podmínkách ve většině let nejvyšší obsah uvedených zdrojů a obsahu v době nalévání zrna, kdy kořeny dosahují největší hloubky a celkové hustoty. Maximální dostupná zásoba vody v jednotlivých vrstvách byla vypočtena jako rozdíl nejvyšší (na jaře) a nejnižší (ve zrání) vlhkosti v dané vrstvě zaznamenané v pokusném období. Výsledky a diskuze Využití dusíku z půdního profilu Obsah minerálního N (N min ) na jaře na daném pozemku se v jednotlivých letech výrazně lišil, jak z hlediska distribuce v půdním profilu tak celkového množství (obr.1). Podle podmínek pro posun nitrátového N do hloubky v meziporostním období byl v některých letech největší podíl N min v povrchových vrstvách a mělkém podorničí do hloubky 50 nebo 70 cm (2007-8, 2012), naopak v letech a 2011 byl větší podíl v hlubších vrstvách pod 50 cm. V hlubokých vrstvách a především cm však byl obsah N min ve srovnání se zónou do 90 cm nízký. Obr.1 Nejnižší (Min) a nejvyšší (Max) obsah N min na počátku jarní vegetace (vlevo) a průměrný obsah na jaře v době zrání (vpravo) ve vrstvách půdy v letech kg N/ha kg N/ha Min Max Jaro Zrání N1 Zrání N2 80

81 Vrstva (cm) Úroda 12/2012, vědecká příloha časopisu Nejvyšší úbytek (na základě bilance), který hodnotíme jako N odebraný rostlinami, byl v zóně m, což odpovídá vysokým hodnotám obsahu na jaře před počátkem hlavního období růstu (obr.1 a 2). Relativní vyjádření, jako podíl ze zásoby N min na jaře, ukázal využití 68-92% z vrstvy cm, ve vrstvách cm a cm to bylo 73% a 28% (obr.2). Menší využití v ornice, v povrchové vrstvě 10 cm a částečně i ve vrstvě cm, odpovídá pozorovanému zvyšování obsahu N min v průběhu zrání ve většině let, v důsledku mineralizace a vysychání, které zhoršuje funkce kořenů a příjem. Nižší příjem v hlubších vrstvách odpovídá nízké hustotě kořenů, kratší době po kterou kořeny v dané vrstvě rostou a klesající potřebě porostu. Je také patrné, že v případě dodávky N hnojením byl požadavek porostu na příjem z podorničí menší a tedy i výsledné využití zásoby N min (obr.1 a 2). Obr.2 Průměrné využití (odběr) dusíku z celkového množství minerálního N na jaře v kg N/ha (vlevo) a využití v % z této zásoby na jaře (vpravo). Standardní odchylky jsou vypočteny z průměrných hodnot pokusných let kg N/ha % N1 N2 N1 N2 Dynamika minerálního dusíku v půdě je, kromě příjmu rostlinami, více či méně ovlivněna dalšími faktory, jako je mineralizace, imobilizace, denitrifikace, transport profilem a vyplavení. V hlubších vrstvách podorničí v daných podmínkách a v krátkém období tvorby zrna pšenice lze předpokládat, že uvedené faktory mají na bilanci N jen malý nebo žádný vliv, a rozhodující roli hraje příjem rostlinami (např. Kuhlman et al. 1989). Např. intenzivní odběr vody porostem vylučuje ve většině let posun (nitrátového) dusíku do hloubky. Využití vody z půdního profilu Rozdíly mezi ročníky v objemové vlhkosti vrstev půdy na počátku jarního růstu (obr. 3 a 4) nebyly tak výrazné jako u minerálního dusíku. Obsah dosahoval ve většině vrstev hodnot okolo 32%. Podobné hodnoty v ornici a podorničí jsou v souladu s podobným zrnitostním složením vrstev půdy pokusného pozemku. Hodnoty vlhkosti půdy na jaře (v případě dostatečných srážek) se doporučuje používat jako ukazatel polní vodní kapacity, tedy množství vody, které je půda schopna dlouhodobě zadržet. Poněkud nižší hodnoty v povrchové vrstvě a v hlubokém podorničí v některých letech (2007, 2010) byly důsledkem nižších podzimních a zimních srážek, vysychání povrchu půdy na jaře a počátku odběru vody rostlinami. Je potřeba uvést, že laboratorně určené hodnoty sacího tlaku neporušených vzorků půdy odpovídaly vyšším hodnotám polní vodní kapacity. Vzorky byly odebírány na tomto pozemku v roce 2000, důvod vyšších hodnot vodní kapacity je neznámý, ale rozpor mezi laboratorními a empiricky určenými hodnotami je zmiňován i dalšími autory. 81

82 Vrstva (cm) Vrstva (cm) Úroda 12/2012, vědecká příloha časopisu Obr. 3 Nejvyšší (Max) a nejnižší (Min) hodnoty obsahu vody ve vrstvách půdního profilu na počátku jarní vegetace zaznamenané v letech % obj Min Max Míru vyčerpání dostupné vody ukazuje obrázek 4. Ročníková variabilita byla zřejmě způsobena odlišným požadavkem porostu na vodu a zásobou vody v hlubších vrstvách (pod 90 cm). To dokumentují nízké hodnoty v suchém a nadprůměrně teplém ročníku 2007 (neprezentováno). Vysoký požadavek porostu na vodu, který stimuloval maximální využití zásoby v kořenové zóně, byl výsledkem nedostatku vody v horních vrstvách půdy, indukovaný pomocí zakrývání porostu mobilním krytem. Průměrná vlhkost půdy na jaře a v době zrání v letech ukazuje podobné odčerpání vody ve vrstvách do hloubky 90 cm, 72-80% (obr.5). Nižší využití zásoby vody bylo ve vrstvě cm a především cm. Přesto i v těchto vrstvách průměrné bilanční využití vody činí 56% a 39% z dostupné zásoby (počítané jako rozdíl nejvyšší a nejnižší vlhkosti zaznamenané v dané vrstvě v pokusném období). Využití zásoby vody a dusíku v podorničních vrstvách půdního profilu bylo podobné, jak ukazuje vysoká hodnota lineární korelace odpovídajících hodnot v jednotlivých vrstvách (r>0,94) (obr.6). Pouze v povrchové vrstvě na variantě hnojené dusíkatými hnojivy byl obsah N v době zrání vyšší než na jaře, zřejmě jako důsledek mineralizace a nevyčerpání N z hnojiv (obr.1 a 2). Obr. 4 Průměrný obsah vody na počátku jarní vegetace (jaro) a v době zrání (léto) v pokusných letech. Standardní odchylky jsou vypočteny z průměrných hodnot pokusných let % obj Jaro Léto Uvedené údaje představují potenciální využití vody a N z kořenové zóny v případě nedostatku, tedy za podmínek, kdy již dochází k redukci výnosu. Tyto údaje umožňují zpřesnit nastavení hnojení dusíkem a zvýšit efektivnost jeho využití z půdní zásoby. Z hlediska využití vody jsou výsledky použitelné pro zpřesnění dostupné zásoby vody a predikci nástupu nedostatku vody. 82

83 využití vody (%) Vrstva (cm) Úroda 12/2012, vědecká příloha časopisu Obr.5 Průměrné využití (odběr) vody z celkového množství vody na jaře v mm a v % z této zásoby na jaře (vlevo) a průměrné využití z dostupné zásoby (počítané jako rozdíl nejvyšší a nejnižší vlhkosti v dané vrstvě v pokusném období) (vpravo). Standardní odchylky jsou vypočteny z průměrných hodnot pokusných let mm., % % obj., % mm % % obj. % Obr. 6 Vztah relativního využití dostupné zásoby dusíku a vody z vrstev půdního profilu (regresní křivky jsou vypočteny bez údajů pro ornici) 60,0 40,0 y = 0,5785x + 8,5769 R 2 = 0, ,0 0,0 y = 0,3765x + 10,163 R 2 = 0,8866 N1 N2 ornice N1 ornice N2-20,0 0,0 20,0 40,0 60,0 80,0 100,0 využití dusíku (%) Distribuce a hustota kořenů v půdním profilu Rozdělení kořenů ozimé pšenice v půdním profilu mělo obvyklý tvar, vysoká hustota kořenů v ornici a postupný pokles s hloubkou (Svoboda, Haberle 2006). Ročníkovou variabilitu ukazuje obrázek 7, i přes tyto rozdíly mezi roky byl uvedený tvar distribuce kořenů vždy podobný. Vztah mezi rozdíly v distribuci kořenů a využitím vody a dusíku v jednotlivých letech nebyl průkazný. To ukazuje, že odběr z podorničí v období tvorby zrna je výsledkem více faktorů, podmínek ve vegetativní fázi, hustoty kořenů, růstu nadzemních částí a potřeby dusíku a vody, který závisí na dalších podmínkách. Distribuce kořenů, s průměrnou hustotou pod 1cm/cm 3 půdy ve vrstvách pod 100 cm odpovídá obecně menšímu využití vody a dusíku z těchto hlubokých vrstev. Současně zde působí časový a prostorový faktor, kořeny se dostávají do nejhlubších vrstev pozdě, až v průběhu zrání, kdy už je požadavek na zdroje nižší. Jde také o nejmladší kořeny, které nejsou rozvětvené nebo jen v omezené míře, což redukuje schopnost plně využít zdroje. Kořeny také v těchto vrstvách často využívají pro růst biopóry, s menším odporem k pronikání, kde může být zhoršený kontakt s okolní půdou. Na druhou stranu se uplatňuje i difúze vody i nitrátových iontů ke kořenům z hlubších vrstev. Rychlost difúze je vysoká při strmém gradientu koncentrace nebo sacího tlaku, proto je v 83

84 Vrstva (cm) Úroda 12/2012, vědecká příloha časopisu daných podmínkách význam tohoto jevu (na rozdíl například od situace s vysokou hladinou spodní vody) pravděpodobně malý. Závěr Výsledky sledování potvrdily, že bilanční odběr vody a dusíku z hlubokých vrstev podorničí odpovídá distribuci kořenů a porost pšenice využívá, v případě nedostatku, tyto zdroje i z vrstev s nízkou hustotou kořenů, pod 1cm/cm 3 půdy. Obr. 7 Distribuce kořenů ozimé pšenice. Průměrné, nejmenší (Min) a nejvyšší (Max) hodnoty hustoty kořenů zaznamenané v letech cm/cm 3 0,0 2,0 4,0 6,0 8,0 10,0 12,0 14,0 16, Min Max Průměr Dedikace: Příspěvek byl připraven s podporou projektu NAZV QI111C080 a Výzkumného záměru VÚRV MZE Použitá literatura Raimanová I., Haberle J. (2010): The effects of differentiated water supply after anthesis and nitrogen fertilization on δ15n of wheat grain. Rapid Commun. Mass Spectrom, 24: Haberle J. (2010): Simulace vlivu diferencované zásoby vody po kvetení na výnos zrna ozimé pšenic. In: Bioklima 2010, Bioklíma 2010, Praha 7. až , (CD). (ISBN: ). Haberle J., Svoboda P. (2011): Observed and simulated depletion of mineral nitrogen by winter wheat from soil profile. In: Škarpa, P. (ed.) Soil, Plant and Food Interactions Mendelova univerzita v Brně, Brno, 2011, Kuhlman H., Barraclough P.B., Weir A.H. (1989): Utilization of mineral nitrogen in the subsoil by winter wheat. Z. Pflanzenernaehr. Bodenk., 152: Svoboda P., Haberle J. (2006): The effect of nitrogen fertilization on root distribution of winter wheat. Plant, Soil and Environment, 52: Kontaktní adresa: Ing. Jan Haberle, CSc., Výzkumný ústav rostlinné výroby, v.v.i. Drnovská 507, Praha 6 - Ruzyně 84

85 ZLEPŠENÍ PŮDNÍCH VLASTNOSTÍ POMOCÍ APLIKACE PODPŮRNÉHO PŘÍPRAVKU Badalíková B. Zemědělský výzkum spol. s r.o. Troubsko Abstrakt V letech byl sledován vliv pomocného půdního přípravku na bázi organického materiálu a přídavných živin na půdní prostředí. Z výsledků bylo zjištěno, že přípravek měl pozitivní vliv na snížení utužení půdy, zvýšení půdní vlhkosti, lepší strukturotvornosti a zvýšení obsahu humusu v půdě. Také výnosy byly vyšší u variant s aplikací tohoto přípravku. Klíčová slova: půdní přípravek, fyzikální vlastnosti půdy, vlhkost půdy, půdní struktura, obsah humusu v půdě, výnosy kukuřice na zrno Absract During year was followed influence of subsidiary soil preparation on the soil environment. This preparation is on the base of organic matter and additional nutrient. It was found from results that preparation have positive effect on decrease of soil compaction, increase of soil moisture, better structure formation and increase of humus content in soil. Also the yields were higher in variants with application of this preparation. Key words: soil preparation, physical soil properties, soil moisture, soil structure, humus content in soil, grain maize yields Úvod Mechanizmy degradace půd jsou v podstatě dvojí: přirozené, související s půdotvornými procesy a s vlivem nejrůznějších faktorů prostředí na půdy a jejich vývoj, např. pozvolné změny půdní textury i struktury, vymývání látek a přesuny koloidů v půdním profilu, změny v množství půdních organismů a struktuře jejich společenstev a mechanizmy spjaté s činností člověka. Zatímco přirozené mechanizmy degradace půd může člověk většinou ovlivnit jen málo nebo vůbec, člověkem vyvolané mechanizmy degradace půd jsou (alespoň teoreticky) v rukou člověka může je potlačit nebo naopak zesílit (Vopravil a kol., 2010). Tak jako půdy nejsou jen kvalitní nebo nekvalitní, také degradace půdy nabývá různého stupně. Zjednodušeně však lze říci, že vše, co snižuje kvalitu půdy, je degradací půdy. Z definice kvality půdy (např. Doran, Safley, 1997) vyplývá, že aby půda mohla být označena za kvalitní, musí plnit své přirozené funkce. Salvati, Carlucci (2009) ve své práci ilustrují proceduru dvoustupňového principu měření půdní degradace z pohledu rizika pro zemědělství, která odhaduje potenciální náklady spojené s půdní degradací. Jednou z příčin degradace půdy je její utužení nebo-li zhutnění. Jak uvádí Wang a kol. (2010) stupeň utužení půdy je ovlivněn mnoha faktory, k nimž patří zejména půdní druh, vlhkost půdy, obsah a kvalita organické hmoty a stupeň prokořenění. Pedokompakci můžeme omezovat správnou strukturou plodin v osevních postupech, dostatečným organickým hnojením a vápněním. Dobrým zásobováním organickou hmotou se rozvíjí mikrobiální život v půdě, který ovlivňuje velikost utužení půdy (Novosádová a kol., 2010). Cílem je zachování, resp. zvyšování obsahu humusu v půdě. Tam, kde se nedostává organického materiálu z posklizňových zbytků nebo z nedostatku hnoje nastupuje pomocný půdní přípravek PRP SOL, který může nahradit zmíněné nedostatky (Václavík, Petrtýl, 2009). Materiál a metody V rámci sledování vlivu pomocného půdního přípravku na bázi organického materiálu a přídavných živin (PRP SOL) na půdní prostředí byl založen v roce 2011 poloprovozní pokus na pozemcích Agrocentra v Hrušovanech nad Jevišovkou v katastru obce Litobratřice. 85

86 0C mm Úroda 12/2012, vědecká příloha časopisu Hodnocené výsledky byly získány během let 2011 a Odběry vzorků půd byly realizovány vždy na začátku a na konci vegetačního období. V rámci hodnocení vlivu aplikace a dávek PRP SOL na půdní prostředí byly založeny čtyři pokusné varianty: A Varianta kontrolní bez PRP SOL pouze minerální hnojení N na široko, P pod patu B Varianta N kg přípravku PRP SOL, aplikace pod patu, bez P a K C Varianta N kg přípravku PRP SOL, aplikace pod patu, bez P a K D Varianta N kg přípravku PRP SOL, aplikace na široko, bez P a K Na pokusném pozemku byla opakovaně pěstována kukuřice na zrno. U každé varianty byly sledovány fyzikální vlastnosti půdy pomocí válečků dle Kopeckého z hloubek 0-0,10, 0,10-0,20 a 0,20-0,30 m v pěti opakováních, dále půdní struktura, která byla stanovena prosíváním suché zeminy na sítech o otvorech 0,25, 0,5, 2, 5, 10, 20 mm ze dvou hloubek 0-0,15 a 0,15-0,30 m ve třech opakováních, kde pro vlastní hodnocení byl vypočítán koeficient strukturnosti, který vyjadřuje vztah mezi agronomicky hodnotnými (0,25-10 mm) a méně hodnotnými strukturními elementy (>10 a <0,25 mm), hmotnostní vlhkost půdy zjišťována gravimetrickou metodou, obsah humusu, resp. Cox, byl stanoven metodou upravenou dle Nováka a výnosy kukuřice přepočtené na standardní vlhkost 14%. Charakteristika stanoviště Klimatické podmínky: stanoviště se nachází v kukuřičné výrobní oblasti, v nadmořské výšce 210 m a patří do klimatické oblasti T4 - nejteplejší. Uplatňuje se zde srážkový stín Českomoravské vrchoviny. Srážky se pohybují v průměru kolem 461 mm, z toho během vegetace 302,3 mm. Průměrná roční teplota činí 8,9 C, z toho ve vegetačním období 15,3 C. Půdní podmínky: černozem modální na spraši, středně těžká až těžká, zrnitostně hlinitá až jílovitohlinitá půda, orniční horizont sahá do 40 cm. V grafech 1 a 2 je grafické znázornění průběhu počasí v oblasti stanoviště v Litobratřicích během sledovaných let. Graf 1: Průměrné měsíční teploty I II III IV V VI VII VIII IX Měsíce Litobratřice Graf 2: Průměrný měsíční úhrn srážek I II III IV V VI VII VIII IX Měsíce Výsledky a diskuze Z hlediska zachování kvality půdy bylo v pokusu sledováno působení půdního přípravku PRP SOL, který je směsí vápenatých a hořečnatých uhličitanů, vyváženého poměru mikroprvků a rostlinného pojiva. Současně je známo, že rozšíření biologické diverzity a nárůst mikrobiální aktivity pomáhá zlepšit činnost mikro a makrofauny, transformační cykly organické hmoty, geochemické cykly prvků (uhlík, dusík, fosfor ), strukturu půdy a v neposlední řadě rozvoj vegetace (Václavík, Petrtýl, 2009)

87 Hodnoty fyzikálních vlastností půdy jsou uvedeny v tabulkách 1 a 2. Výchozí hodnoty v roce 2011 korespondují se založenými variantami. Z hodnot lze usoudit, že varianty se zapraveným přípravkem byly méně utužené, což dokazují hodnoty objemové hmotnosti redukované (OHr). U varianty A byla hodnota OHr nejvyšší a nejnižší pórovitost. To se projevilo i na minimální vzdušné kapacitě, která byla nejnižší a momentálním objemu vzduchu. Nejlepší vlastnosti vykazovala varianta C s vyšší dávkou zapraveného přípravku do půdy. Tab. 1: Fyzikální vlastnosti půdy - Litobratřice 2011 varianta A B C D Hloubka (m) Objemová hmotnost red. (g.cm -3 ) Celková pórovitost (%) 87 Momentální obsah vody %obj. vzduchu Max.kapilár. kapacita %obj. Min.vzduš. kapacita 0-0,1 1,37 48,70 31,00 17,70 33,97 14,73 0,1-0,2 1,57 41,05 29,02 12,03 33,00 8,05 0,2-0,3 1,54 42,89 25,48 17,41 32,47 10,41 0-0,3 1,50 44,21 28,50 15,71 33,15 11,07 0-0,1 1,33 49,98 31,38 18,60 36,87 13,11 0,1-0,2 1,42 46,94 28,06 18,87 35,52 11,41 0,2-0,3 1,36 48,70 24,34 24,36 34,96 13,74 0-0,3 1,37 48,54 27,93 20,61 35,79 12,75 0-0,1 1,27 52,40 31,91 20,49 39,41 13,00 0,1-0,2 1,39 48,11 35,68 12,43 33,55 14,56 0,2-0,3 1,39 47,71 33,84 13,88 35,10 12,61 0-0,3 1,35 49,41 33,81 15,60 36,02 13,39 0-0,1 1,20 54,93 28,60 26,34 39,34 15,60 0,1-0,2 1,33 50,18 25,10 25,08 33,74 16,44 0,2-0,3 1,43 46,26 25,70 20,56 33,85 12,41 0-0,3 1,32 50,46 26,47 23,99 35,65 14,81 V roce 2012 (tab. 2) byla opět nejvyšší OHr u varianty A a nejnižší u varianty C, což korelovalo s ostatními sledovanými veličinami fyzikálních vlastností půdy. Obsah celkové pórovitosti, momentální objem vody i min. vzdušná kapacita byla nejlepší u varianty C. Největší rozdíly OHr byly zaznamenány mezi orniční vrstvou a podorničím. Z hodnot je patrné, že půdní přípravek působí pozitivně na provzdušněnosti a nižší utuženost orniční vrstvy. To potvrdili i Straková a kol. (2010), kteří ve své práci popisují zlepšení půdních vlastností pomocí aplikace půdních kondicionérů a dalších pomocných látek. Limit u hlinitých půd podle Lhotského (2000) 1,45 g.cm -3 byl překročen v podorničí u varianty A, a to v obou letech. Tab. 2: Fyzikální vlastnosti půdy - Litobratřice 2012 varianta A B C D Hloubka půdy (m) Objemová hmotnost red. (g.cm-3) Celková pórovitost (%) Momentální obsah vody %obj. vzduchu Max.kapilár. kapacita %obj. Min.vzduš. kapacita 0-0,1 1,29 51,67 10,75 40,92 36,98 14,69 0,1-0,2 1,49 44,13 20,94 23,19 34,84 9,28 0,2-0,3 1,57 40,93 24,92 16,01 34,65 6,28 0-0,3 1,45 45,58 18,87 26,71 35,49 10,08 0-0,1 1,20 55,08 16,37 38,72 42,23 12,85 0,1-0,2 1,37 48,76 21,80 26,96 37,16 11,60 0,2-0,3 1,48 45,12 23,38 21,74 35,40 9,72 0-0,3 1,35 49,65 20,52 29,14 38,26 11,39 0-0,1 1,19 55,26 16,20 39,05 40,55 14,71 0,1-0,2 1,37 48,52 21,98 26,54 35,12 13,40 0,2-0,3 1,47 44,92 23,94 20,98 33,88 11,04 0-0,3 1,34 49,57 20,71 28,86 36,52 13,05 0-0,1 1,32 50,24 18,69 31,55 39,34 10,89 0,1-0,2 1,49 44,08 24,47 19,60 35,54 8,54 0,2-0,3 1,43 46,07 21,94 24,13 36,60 9,47 0-0,3 1,42 46,79 21,70 25,09 37,16 9,63

88 % hmot. koeficient strukturnosti Úroda 12/2012, vědecká příloha časopisu V grafu 3 jsou znázorněny hodnoty koeficientu strukturnosti zjištěného z hodnot půdní struktury na jednotlivých sítech. V roce 2012 byly zjištěny mírně zvýšené hodnoty koeficientu strukturnosti u variant A, B, C. U varianty D došlo k mírnému poklesu koeficientu, pravděpodobně kvůli odlišné aplikaci pomocného přípravku (aplikace na široko), což v suchém roce 2012 ke zlepšení půdní struktury nepřispělo. Zlepšení struktury bylo zaznamenáno u variant B a C oproti roku 2011 vzhledem k zapravení přípravku do půdy. Je tedy patrné, že půdní přípravek zapravený do ornice pozitivně ovlivňuje strukturotvornost. Co se týče půdního profilu, vyšší koeficient strukturnosti byl zaznamenán ve svrchní vrstvě půdy u všech variant mimo variantu A (kontrolní). Graf. 3: Koeficient strukturnosti Litobratřice, ,50 2,25 2,00 1,75 1,50 1,25 1,00 0,75 0,50 0,25 0,00 A B C D Varianty Graf 4 představuje průměrné hodnoty vlhkosti půdy v hmotnostních procentech, které byly měřené na začátku a na konci vegetace u jednotlivých variant. Vlhkost půdy hmotností koreluje s vlhkostí objemovou (viz tab. 1, 2), kde jsou vypočteny skutečné obsahy půdní vody. Z grafu je patrná nižší vlhkost půdy v roce 2012 oproti roku 2011 v důsledku nižšího úhrnu srážek v tomto roce, což se následně projevilo na ostatních půdních vlastnostech i na výnosech. Varianty se zapraveným půdním prostředkem vykazují vyšší nárůst vlhkosti v orničním profilu. Graf 4: Vlhkosti půdy - Litobratřice, ,00 24,00 22,00 20,00 18,00 16,00 14,00 12,00 10,00 A B C D Varianty

89 Varianty Úroda 12/2012, vědecká příloha časopisu V grafu 5 jsou znázorněny výnosy kukuřice na zrno. Z výsledků vyplývá, že u variant s vyšším podílem půdního přípravku (var. C, D) byly výnosy vyšší oproti kontrole (var. A). Z grafu je také patrné, že výnosy v roce 2012 byly nižší ve srovnání s rokem 2011, vzhledem k vývoji počasí od počátku vegetace. Rok 2012 se vyznačoval nedostatkem vodních srážek již při vzcházení, prudkým snížením teplot od poloviny dubna a v polovině května a nástupem vysokých teplot v průběhu dalších měsíců. Přesto se pozitivně projevil půdní přípravek ve výši výnosů, a to u varianty B o 6 %, u varianty C o 33 % a u varianty D o 27 %. Snížení výnosů bylo způsobeno nejen nevyrovnaností a nízkými vodními srážkami, ale především snižováním obsahu vzduchu v kořenové zóně, což se potvrdilo u varianty A bez podpůrného přípravku. Byla také potvrzena spojitost s maximální kapilární kapacitou a absolutní vzdušností, které ovlivňovaly celkovou pórovitost. Na základě toho lze konstatovat, že zhoršení fyzikálních vlastností změnou distribuce pórů vede k poklesu výnosů (Pokorný, 2011). Graf 5: Výnosy kukuřice na zrno Litobratřice, Tab. 3: Obsah humusu D C B A 2,0 3,0 4,0 5,0 6,0 7,0 8,0 9,0 10,0 11,0 12,0 13,0 t.ha varianta A B C D hloubka (m) ,15 1,69 1,67 0,15-0,30 1,37 1,39 průměr 1,53 1,53 0-0,15 1,64 1,74 0,15-0,30 1,45 1,51 průměr 1,55 1,63 0-0,15 1,38 1,88 0,15-0,30 0,92 1,45 průměr 1,15 1,67 0-0,15 1,57 1,62 0,15-0,30 1,38 1,55 průměr 1,48 1,59 V tabulce 3 jsou uvedeny hodnoty obsahu humusu (přepočteného Cox). Během dvou let se významně změnil obsah humusu u variant s vyšší dávkou zapraveného půdního přípravku (var. C). Půdní přípravek PRP SOL může zlepšit rozklad a využití živin z organických hnojiv, která pak mohou do jisté míry nahradit produkci statkových hnojiv z živočišné výroby, kterých značně ubývá. Při použití přípravku PRP SOL jako pomocné látky je důležité stanovit nejen množství, ale i způsob aplikace v zájmu řízení nákladů na plodinové zastoupení. Závěr Z dvouletého hodnocení aplikace podpůrného půdního přípravku bylo zjištěno, že došlo k poklesu objemové hmotnosti v ornici a mírně i v podorničí, pórovitost byla vyšší u variant se zapraveným půdním přípravkem, objem vody a vzduchu koreloval s pórovitostí, struktura půdy dle zjištěného koeficientu strukturnosti se v druhém roce nepatrně zvýšila hlavně u variant se zapraveným přípravkem, vlhkost půdy se zvyšovala se zvýšenou aplikací přípravku, výnosy byly nižší v roce 2012 v důsledku špatných klimatických podmínek, současně však byly vyšší v obou letech u variant s aplikací podpůrného přípravku. Také byl zjištěn kladný vztah mezi výnosem, podpůrným přípravkem a počasím. Obsah humusu byl prokázán vyšší u variant s aplikací vyšší dávky podpůrného přípravku. Z výsledků je tedy patrné, že podpůrný půdní přípravek působí pozitivně na provzdušněnost půdy a snižování jejího utužení, na zvyšování organické hmoty v půdě a na vyšší výnosy zrna kukuřice. 89

90 Dedikace Výsledky byly získány za (částečné) institucionální podpory na dlouhodobý koncepční rozvoj výzkumné organizace a v rámci mezinárodního projektu pro Porovnání různých dávek a způsobů aplikace přípravku PRP SOL Použitá literatura Doran, J.W. and Safley, M., 1997: Defining and assessing soil health and sustainableproductivity. In: Pankhurst, C. et al. (eds.). Biological indicators of soil health.wallingford, UK: CAB International. p Lhotský, J., 2000: Zhutnění půd a opatření proti němu. Studijní zpráva UZPI Praha, 61s. Novosádová, I., Záhora, J., Sinoga, J.D.R., 2010: Mikrobiální přeměny dusíku v degradované půdě semiaridního klimatu. In Brtnický, M., Brtnická, H., Foukalová, J., Kynický, J., Micková, Ž. Degradace a regenerace krajiny a dílčích krajinných sfér. Mendelova univerzita v Brně, 1. vyd., s. 27. ISBN Pokorný, E., Střalková R., Brtnický, M., Foukalová, J., Denešová O., Podešvová, J., 2011: Monografie Analýza dlouhodobých srážkových a teplotních řad a hodnocení jejich dopadu na změny vlastností půd vybraného agroekosystému, Mendelova univerzita v Brně, 1. vyd., 118 s. ISBN Salvati, L., Carlucci, :M., 2009: Estimating land degradation risk for agriculture in Italy using an indirect approach. Ecological Economics 69, Issue 3, s Straková, M., Salaš, P., Kohut, M., Pekař, M., Ševčíková, M., Pelikán, J., Studium problematiky biologické degradace půdy v podmínkách aridního klimatu. Úroda 12,, Vědecká příloha Aktuální poznatky v pěstování, šlechtění, ochraně rostlin a zpracování produktů, s , ISSN Václavík, F., Petrtýl, I., 2009: Alternativní zdroje živin a dopad na půdní vlastnosti. Úroda 12, Vědecká příloha Aktuální poznatky v pěstování, šlechtění, ochraně rostlin a zpracování produktů, s , ISSN: Vopravil, J., Vrabcová, T., Khel, T., Novotný, I., Manýrová, J., 2010: Vývoj a degradace půd v podmínkách očekávaných změn klimatu. Rožnovský, J., Litschmann, T. (ed): Voda v Krajině, s. 24, ISBN Wang, J., He, T., Chunyan, Lv., Yonggi, Ch., Wu, J., 2010: Mapping soil organic matter based on land degradation spectral response units using Hyperion images. International Journal of Applien Earth Observation and Geoinformation 12, Supplement 2, s Kontaktní adresa: Ing. Barbora Badalíková Zemědělský výzkum, spol. s r. o. Zahradní 1, Troubsko 90

91 VĚTRNÁ EROZE NA JIŽNÍ MORAVĚ POTENCIÁL, MONITORING, ÚČINNOST BIOTECHNICKÝCH OPATŘENÍ Wind erosion in South Moravia potential, monitoring, the effectiveness of biotechnical measures Středová H. 1, Středa T. 1, Podhrázská J. 2 1 Mendelova univerzita v Brně, 2 Výzkumný ústav meliorací a ochrany půdy Abstrakt Na základě aktuálních půdních a klimatických podmínek byla pro území jižní Moravy definována potenciální ohroženost půd větrnou erozí. Nejrizikovějšími oblastmi jsou lokality s lehkými písčitými půdami v teplých a suchých oblastech. Pro relativní kvantifikaci množství unášených půdních částic a jejich analýzu bylo modifikováno a otestováno zařízení deflametr. Deflametrické záznamy byly následně vyhodnoceny digitální analýzou obrazu a byla provedena analýza velikostního spektra zachycených erodovaných částic. V polních podmínkách byla hodnocena protierozní účinnost biotechnických opatření. Hodnocení účinnosti větrolamů bylo založeno vztahu mezi jejich optickou porozitou a redukcí větru na návětrné a závětrné straně větrolamu. Klíčová slova: větrná eroze, deflametr, větrolam, optická porozita Abstract Soil wind erosion risk in South Moravia was defined based on actual soil and climatic conditions. Soil type plays a big part in assessing the susceptibility to erosion. As the most vulnerable soils are considered light, drying soils with low amount of clay particles in dry and warm territories. A relative quantification of discharged soil particles and their analysis was assessed by deflameter the equipment for the soil particles capturing. The effectiveness of biotechnical erosion control measures was evaluated by direct measurement of wind parameters in field conditions. Determination of aerodynamic parameters of windbreak was based on their optical porosity. Key words: Wind erosion, deflameter, windreak, optical porosity Úvod Větrná eroze nepředstavuje plošně tak velké riziko jako eroze vodní, avšak celosvětově je jí alespoň částečně poškozeno asi 500 milionů hektarů. K oblastem nejvíce postihovaným větrnou erozí patří aridní a semiaridní části severní Afriky; Blízký východ; části východní, střední a jižní Asie; severovýchodní Čína; Austrálie; jih jižní Ameriky i Severní Amerika. Jen v USA je větrnou erozí ohroženo 30 milionů hektarů (Toy et al., 2002) V České republice je větrnou erozí ohroženo téměř 29 % zemědělské půdy, přičemž na Moravě je to asi 40 % a v Čechách 23 % (Pasák, 1984). Větrná eroze se vyskytuje především v území, kde je počasí charakterizováno nízkými a proměnlivými srážkami, proměnlivou a vysokou rychlostí větru, častým výskytem sucha, rychlými a extrémními změnami teploty a vysokým výparem. Větrná eroze obnažuje podorničí s nízkou přirozenou úrodností a vyšší kyselostí, způsobuje škody nejen v zemědělství odnosem ornice, hnojiv, osiv a poškozováním zemědělských plodin a půdy, ale zanášením komunikací a vodních recipientů, podílí se také na eutrofizaci vod a na znečištění ovzduší. Přenášený prach přispívá k riziku vzniku respiračních onemocnění (Riksen et al., 2001). Dlouhodobým působením eroze se mění kvantitativní i kvalitativní vlastnosti půd. K nejúčinnějším opatřením proti větrné erozi patří ochranné lesní pásy větrolamy, které vytvářejí trvalou ochranu půdy proti větrné erozi. Obecně se jedná o různě široké pásy stromů a keřů orientované kolmo na převládající směr větru s protierozní a půdoochrannou funkcí. Účinnost větrolamů na snížení rychlosti větru silně závisí na jejich skladbě, především na jejich propustnosti. Za nejlepší větrolamy jsou někde považovány ty, kde převažují jehličnany 91

92 (Mercer, 2009). Důvodem je jejich protierozní účinnost i v mimovegetačním období. Větrolamy nepůsobí pouze na omezení erozních procesů, ale ovlivňují také mikroklima blízkého okolí - teplotu a vlhkost vzduchu, evapotranspiraci, teplotu půdy apod. (Litschmann a Rožnovský, 2005; Cleugh, 2002). Aktuální forma křivky rychlosti větru u větrolamu je dána vztahem systému proudění vzduchu větrolam. Roli v tomto systému hrají charakteristiky příchozího proudění, jako je rychlost větru, směr větru, intenzita turbulence a atmosférická stabilita a vnější vlastnosti větrolamu jako je tvar větrolamu, šířka a délka (Vigiak, 2003). Průběžný monitoring míry větrné eroze v terénu je poměrně náročný, protože doposud nejsou vyvinuty funkční rigorózní metody a měřící zařízení. Dílčí možnosti uvádí např. Funk et al. (2004), kteří kvantifikovali větrnou erozi na základě transportu půdních částic přímo na poli a množství částic ukládaných na okraji pozemku. Zjišťovali hmotnost zachycených částic i rychlost a směr větru. Ohrožení území větrnou erozí je však zpravidla kvantifikováno pouze jako potenciální riziko prostřednictvím výpočtů na bázi půdních, klimatických, vegetačních a charakter pozemku specifikujících podmínek (zatíženo vysokou mírou nejistoty a zobecnění). Případně jsou polní podmínky s následným hodnocením intenzity eroze simulovány v aerodynamickém tunelu (vysoké náklady, nemožnost dokonalého nasimulování podmínek). Pro maloparcelové experimentální účely bylo v zahraničí (Polsko) v minulosti například vyvinuto a použito zařízení integrující funkci aerodynamického tunelu a cyklónového odlučovače (vysoké náklady na konstrukci, provoz a omezená manipulace). V zahraničí jsou pro monitoring unášených částic také dále sporadicky provozována zařízení rozmanitých konstrukcí s různou mírou přesnosti (deflametry, samplery dust samplers, lapače interceptors, pasti dust traps nebo sand traps ). I v ČR bylo v 80. a 90. letech 20. století testováno jednoduché zařízení na záchyt půdních částic unášených větrem v podobě soustavy vertikálně situovaných záchytných boxů. Ideální konstrukce deflametru umožňuje nejen kvantifikovat množství deflátů za určité období, ale specifikovat jejich množství v čase s ohledem na aktuální meteorologické podmínky. Jistým řešením by byl deflametr s kontinuálním monitoringem hmotnosti zachycených částic (nevýhodou je vysoká cena). V roce 2012 byl Úřadem pro průmyslové vlastnictví zaregistrován užitný vzor Deflametr s aktivním lapačem půdních částic a časovým záznamem autorů Středová, Středa, Podhrázská. Jedinečnost řešení zařízení spočívá v přesném určení termínu transportu, možnosti relativně kvantifikovat množství a pomocí následné digitální analýzy obrazu zachycených částic stanovit velikost, tvar a další parametry deflátů. V kombinaci s meteorologickým měřením (rychlost větru, vlhkost půdy, teplota půdy, stav povrchu půdy atd.) je potom dále možné striktně specifikovat podmínky v době epizody. Materiál a metody Vymezení oblastí potenciálně náchylných k větrné erozi Teritoriální vymezení oblastí potenciálně náchylných k větrné erozi je primárně založeno na analýze klíčových meteorologických veličin resp. klimatologických faktorů. Tyto údaje spolu s pedologickými informacemi umožňují definovat oblasti potenciálně náchylné k větrné erozi. Souhrnně lze tyto zásadní klimatologické a pedologické údaje získat rozklíčováním dílčích pozic kódu bonitovaných půdně ekologických jednotek BPEJ (resp. 1. až 3. pozice tj. klimatický region KR a hlavní půdní jednotka HPJ). Podle metodiky vymezování a mapování BPEJ (Mašát a kol., 2002) byly pro jižní Moravu nejprve stanoveny či vypočteny následující klimatické charakteristiky určující KR v ČR: Průměrná roční teplota vzduchu ve C Průměrný roční úhrn srážek v mm Suma průměrných denních teplot rovných nebo vyšších než 10º C (TS10) Vláhová jistota Pravděpodobnost suchých vegetačních období 92

93 Původní vymezení KR bylo provedeno pro období 1901 až Pro vymezení aktuálního stavu byly pro účely vymezení oblastí náchylných k větrné erozi mapově vyjádřeny modifikované KR na základě dat z období 1961 až 2000 (Obr. 1). Náchylnost půdy k větrné erozi je velmi úzce závislá na zrnitostním složení. Za nejvíce náchylné jsou považovány lehké písčité půdy s nízkým obsahem jílnatých částic. V České republice je popsáno 78 HPJ na základě jejichž charakteristik může být určena náchylnost k erozi. Náchylnost půdy k erozi dána půdními podmínkami je na Obr. 2 vyjádřena jako stupeň náchylnosti půdy k erozi. Obr. 1 Mapa modifikovaných KR na jižní Moravě pro období 1961 až 2000 (vlevo) Obr. 2 Stupeň náchylnosti půdy k erozi dle pedologických podkladů (vpravo) Stupeň náchylnosti půdy k erozi Monitoring a měření větrné eroze Podstata použitého lapače odnášených půdních částic deflametru spočívá v jednoduchém zařízení, umožňujícím zachycování půdních částic erodovaných větrem pomocí aktivního nasávání vzduchu na pomalu se otáčející lepovou pásku s časovou osou. Zařízení se skládá z otočné hlavice, v níž je zabudován hodinový strojek otáčející bubínkem, na němž je uchycena speciální páska z průhledného materiálu, opatřená lepovou vrstvou. Bubínek je umístěn oproti nasávacímu otvoru štěrbině vyfrézované v těle hlavice. Hlavice je umístěna na stojanu, v němž je ventilátor, vytvářející v otočné hlavici podtlak. Hlavice je opatřena směrovkou, která ji natáčí štěrbinou proti větru. Hodinový strojek otáčí bubínkem jednou za 25 hodin. Působením podtlaku vyvolaného ventilátorem jsou větrem unášené částice nasávány štěrbinou a zachyceny v lepové vrstvě. Po ukončení měření se páska s lepovou vrstvou sejme z bubínku a vyhodnotí mikroskopicky, popřípadě pomocí digitální analýzy obrazu. Napájení ventilátoru je zajištěno 12 V bezúdržbovým trakčním akumulátorem, tolerujícím i hluboké vybití. Vyhodnocení účinnosti větrolamů na základě jejich optické porozity OP Údaje o vlivu větrolamů na pole větru byly získány přímým měřením rychlostí větru u čtyř větrolamů (na jižní Moravě v katastrech obcí Micmanice MC, Suchá Loz SL, Dolní Dunajovice DD a Blatnice pod Svatým Antonínkem BS) a jejich snímkováním. Výška jednotlivých větrolamů se pohybuje od 12 do 25 m, šířka od 12 do 20 m. Detailní popis jednotlivých větrolamů je uveden v práci Litschmann et al. (2007). Od roku 2006 byla u modelových větrolamů prováděna profilová měření rychlostí větru ve výšce 2 m nad povrchem půdy. Použito bylo šest souprav, měřících ve vzdálenostech 150 a 50 metrů od větrolamu na návětrné straně a 50, 100, 150 a 200 m od větrolamu na straně závětrné. Pro měření byly voleny termíny, kdy vítr vanul kolmo k linii větrolamu a jeho průměrná rychlost převyšovala 2 m.s -1. Z monitoringu v letech 2006 až 2010 bylo pro stanovení OP analyzováno 30 fotografií z různých fází vegetace větrolamu. Výsledné snímky byly převedeny do 93

94 černobílého spektra, rozčleněny na 9 11 svislých sloupců a 7 9 vodorovných řad. Výsledná hodnota OP pro každý snímek pak byla stanovena jako aritmetický průměr všech čtverců. Výsledky a diskuze Potenciální ohrožení půdy větrnou erozí bylo definováno na základě kombinace klimatických a půdních podmínek. Jako KR náchylné k erozi jsou považovány pouze teplé a suché oblasti tj., KR 0 až 4. Půdy byly na základě obsahu jílnatých částic klasifikovány stupněm náchylnosti k erozi (0 neohrožené, 2 středně ohrožené, 4 ohrožené, 6 silně ohrožené). Kombinace KR a HPJ náchylných k větrné erozi byly klasifikovány jednotlivými stupni potenciálního ohrožení půd větrnou erozí (1 až 6), přičemž vyšší číslo znamená vyšší náchylnost k erozi (Obr. 3). Obr. 3 Stupeň potenciálního ohrožení půd větrnou erozí Monitoring erozního působení větru v reálných polních podmínkách byl prováděn pomocí deflametru. Jedná se o deflametr se směrovkou aktivním nasáváním vzduchu. Pomocí tohoto zářízení, které je vybaveno i anemometrem je možné anylyzovat velikostní spektrum erodovanych částic i jeho ralativní množství v souvislosti s měřeným směrem a rychlostí větru. Deflametr podle technického řešení byl v roce 2011 v praxi úspěšně ověřen při měření v lokalitě Malešovice (Brno-venkov) a Žabčice (Brno-venkov), jak ukazuje následující Tab. 1 a Histogram četností velikostních kategorií zachycených částic (Obr. 4). Tab. 1 Údaje získané na základě měření deflametrem Max. náraz Délka měření Lokalita Datum větru (m.s -1 ) (min) Množství částic (ks) Velikost částic (μm) Malešovice , Žabčice ,

95 Obr. 4 Histogram četností spektra půdních částic zachycených (Malešovice) Optical porosity (%) Počet pozorování N = 452; AVG = 104; Sm. odch. = 89; Max = 821; Min = Velikost částic [µm] Jako jedny z nejúčinnějších opatření proti větrné erozi se používají biotechnická protierozní opatření. Nejvýznamnější z nich jsou ochranné lesní pásy větrolamy. Na Obr. 5 je zjištěná účinnost větrolamů vyjádřena jako redukce rychlosti větru v různých vzdálenostech od větrolamu v závislosti na hodnotě OP větrolamu. Redukce rychlosti větru na základě OP a vzdálenosti od větrolamu. Obr. 5 naznačuje nejvyšší redukci rychlosti větru ve vzdálenosti cca m za větrolamem. Při průměrné výšce hodnocených větrolamů byla nejklidovější zóna zjištěna v oblasti okolo čtyřnásobku výšky (4H) větrolamu. S rostoucí porozitou efekt větrolamu klesá. Výsledky tak zcela korespondují s výsledky jiných autorů. Obr. 5 Úroveň redukce rychlosti větru (v %) v různých vzdálenostech od větrolamu v závislosti na OP (Surfer) Windbreak distance (m) Závěr Míra potenciálního ohrožení půd větrnou erozí je závislá na aktuálních půdních a klimatických podmínkách. Obecně se za půdy náchylná k erozi označují lehké písčité půdy v suchých a teplých oblastech. Tyto oblasti byly vymezeny na základě kombinace

96 modifikovaných KR pro období a zrnitostního složení půd. Vznikla tak syntetická mapa udávající stupeň náchylnosti půd k větrné erozi. Navržený deflametr s aktivním lapačem půdních částic a časovým záznamem umožňuje monitorovat kvalitativní i kvantitativní vlastnosti včetně časového záznamu výskytu makroskopických i mikroskopických půdních částic unášených větrem. Lze jej využít pro přímé měření v terénu v rámci studií, které vyžadují údaje o množství a spektrálním složení unášených částic, typicky erozní účinky větru, studie účinnosti větrolamů apod. Hodnocení účinnosti větrolamů bylo vyjádřeno pomocí redukce rychlosti proudění. Na základě vztahů mezi optickou porozitou větrolamu a zeslabením rychlosti větru v různých vzdálenostech za větrolamem je možno konstatovat, že vliv větrolamu se uplatňuje při plném olistění ještě ve vzdálenosti m. U neolistěného větrolamu je tato vzdálenost jen kolem 50 m. Dedikace Příspěvek vznikl s podporou projektu NAZV QH82099 Kriteria rozvoje větrné eroze na těžkých půdách a možnosti jejího omezení biotechnickými opatřeními. Použitá literatura Pasák V. a kol., 1984: Ochrana půdy před erozí. Praha. Státní zemědělské nakladatelství. Toy, T. J., Foster, G. R., Renard, K. G., 2002: Soil erosion: processes, predicition, measurement, and control. New York: John Wiley & Sons, c2002, 338 s. ISBN Mercer, G.N., 2009: Modelling to determine the optimal porosity of shelterbelts for the capture of agricultural spray drift. Environmental Modelling and Software dostupné z: (citováno ). Riksen, M.J.P.M., De Graaff, J., 2001: On-site and off-site effects of wind erosion on European light soils. Land Degradation & Development 12 (1), 1 11.) Litschmann, T., Rožnovský, J., 2005: Optická hustota (porosita) větrolamu a její vliv na charakter proudění. In: Rožnovský, J., Litschmann, T. (ed): Bioklimatologie současnosti a budoucnosti, Křtiny , ISBN Funk, E.L., Skidmore, L.J. Hagen, 2004: Comparison of wind erosion measurements in Germany with simulated soil losses by WEPS, Environmental Modelling and Software 19 (2), pp Vigiak, O. et al., 2003: Spatial modeling of wind speed around windbreaks. Catena, vol 52, p Cleugh, H. A., 2002: Field measurements of windbreak effects on airflow, turbulent exchanges and microclimates. Australian-Journal-of-Experimental-Agriculture. 42 (6): Mašát, K. et al., 2002: Metodika vymezování a mapování bonitovaných půdně ekologických jednotek. 3. přepracované vydání. VÚMOP Praha, 113 s. ISBN Kontaktní adresa: Ing. Hana Středová, Ph.D. Mendelova univerzita v Brně, Ústav aplikované a krajinné ekologie Zemědělská 1, Brno 96

97 PĚSTOVÁNÍ OZDOBNICE (MISCANTHUS X GIGANTEUS) URČENÉ PRO ENERGETICKÉ VYUŽITÍ Growing of Miscanthus (Miscanthus giganteus) determined for energy utilization Strašil Z. Výzkumný ústav rostlinné výroby, v.v.i. Praha Ruzyně Abstrakt Polní pokusy s ozdobnicí (Miscanthus x giganteus) probíhaly v letech na dvou odlišných stanovištích. V pokusech byly sledovány tři úrovně hnojení dusíkem (0, 50, 100 kg.ha -1.rok -1 ) a dva termíny sklizně (na podzim a na jaře). Byl hodnocen vliv stanoviště a hnojení dusíkem na produkci biomasy a další sledované ukazatele (počet a délka stébel) a dále vliv termínů sklizně na obsah vody a základních živin ve sklizeném materiálu, ztráty fytomasy přes zimní období. Průměrný výnos sušiny fytomasy ozdobnice za sledované období byl v Ruzyni 21,02 t.ha -1, v Lukavci 17,81 t.ha -1. Ztráty fytomasy za zimní období byly v průměru 33,6 %. Dávka 100 kg.ha -1 N zvyšovala v průměru výnosy přepočtené na sušinu o 2,67 t.ha -1 (12,8 %) oproti nehnojeným parcelám. Klíčová slova: ozdobnice, výnosy fytomasy, hnojení N, termíny sklizně Abstract In the period the field experiments with Miscanthus x giganteus were performed at two different sites with three levels of nitrogen fertilization (0, 50, 100 kg.ha -1.year -1 ) and two terms of harvest (in autumn and in spring). The effect of nitrogen fertilization and site conditions on above ground biomass production was determined. For overall evaluation the influence of the harvest terms on water content in harvested material, on losses of phytomass during the winter period and on the content of main nutrients in plants was determined. Other evaluated parameters were number of stems and plant length. The average yield of dry matter of Miscanthus over monitored period was t.ha - 1 at Ruzyně and t.ha -1 at Lukavec. The average loss of phytomass of Miscanthus during winter period was 33.6 %. Used dose of nitrogen (100 kg.ha -1 ) increased yield about 2.67 t.ha -1 (12.8 %) in average as compared to non fertilized plots. Key words: Miscanthus, phytomass yields, N-fertilization, terms of harvest Úvod Jednou z rostlin, na kterou byla zaměřena pozornost z hlediska nepotravinového a energetického využití, je ozdobnice (Miscanthus). Rod Miscanthus je přirozeně rozšířen převážně v tropických a mírných oblastech. Zahrnuje celkem 33 taxonů. Ozdobnice je vytrvalá rostlina typu přeměny uhlíku C 4. Botanicky se ozdobnice (Miscanthus) řadí do třídy jednoděložné (Monoxyledonae), čeleď lipnicovité (Poaceae), tribus vousatkovité (Andropogoneae). Ozdobnici lze obecně charakterizovat jako vytrvalou vysokovzrůstnou trávu dosahující za příznivých podmínek přes 30 tun výnosu sušiny, která dobře využívá sluneční energii, vodu, živiny, jež je značně odolná proti chorobám a škůdcům. Při jejím pěstování je možno využívat mnoha výhod, jako je po plném zapojení porostu dosahování každoročních vysokých výnosů sušiny fytomasy, sklizeň běžně používanými sklizňovými mechanizmy apod. Materiál a metody Polní pokusy s ozdobnicí (kultivar Giganteus ) uvažovanou pro energetické využití (spalování) byly založeny pomocí oddenků 7 až 10 cm dlouhých na dvou stanovištích, v roce 2001 v Lukavci u Pacova a následně v roce 2003 v Praze-Ruzyni při výsadbě 1 rostliny na 1 m 2. Charakteristika jednotlivých stanovišť je uvedena v tab. 1. K porostům bylo na 97

98 vybraných parcelách aplikováno každoročně na jaře před vzcházením rostlin jednorázově pouze hnojení N ledkem amonným s vápencem. Použité dávky N byly následující: N0 - bez hnojení, N1-50 kg.ha -1, N2-100 kg.ha -1. Porosty byly sklízeny ve dvou termínech a to na podzim (koncem listopadu) a na jaře (začátkem března). Sledoval se vliv stanoviště, hnojení N na výnosy nadzemní fytomasy a další sledované ukazatele (délka rostlin, počet stébel). Dále se sledoval vliv termínu sklizně na obsah vody ve sklizeném materiálu, ztráty fytomasy přes zimní období, obsah základních živin ve sklízené fytomase. Do statistického hodnocení bylo započteno prvních 9 let od výsadby rostlin na jednotlivých stanovištích. K výpočtům byl použit test minimální průkazné diference balíčku UNISTAT 5.1. Tab. 1. Stanovištní podmínky pokusných míst Ukazatel Praha-Ruzyně Lukavec u Pacova Zeměpisná šířka 50 o o 37 Zeměpisná délka 14 o o 03 Nadmořská výška (m n.m.) Půdní druh jílovito-hlinitá písčito-hlinitá Půdní typ hnědozem kambizem Průměrná roční teplota vzduchu ( o C) 8,2 7,4 Průměrný roční úhrn srážek (mm) Agrochemické vlastnosti půdy: Obsah humusu (%) 3,04 3,32 ph (KCl) 6,22 5,89 Obsah P (Mehlich III, mg.kg -1 půdy) 124,9 141,0 Obsah K (Mehlich III, mg.kg -1 půdy) 362,0 246,8 Výsledky a diskuse Stav porostu během sledování Porosty nově založené z rhizomů v Lukavci v roce 2001 a v Ruzyni v roce 2003 dobře vzešly (vzcházivost byla na obou stanovištích vyšší než 95 %) a ani přes první zimní období jsme nezaznamenali průkazný úhyn rostlin. Z průběhu počasí v obou zimních obdobích 2000/2001 a 2003/2004 lze konstatovat, že nemohlo prověřit zimovzdornost sledovaného klonu ozdobnice, neboť tato zimní období byla v porovnání s dlouhodobým průměrem teplotně a srážkově mírně nadnormální a přes zimní období bylo relativně dostatek sněhu. V literatuře jsou uváděny případy, kdy nově založené porosty ozdobnice během první zimy mohou být v některých nepříznivých letech značně poškozeny. Např. Eppel-Hotz a kol. (1998) uvádí, že během zimy 1995/96 došlo ke ztrátám mladých jednoletých rostlinek až 40 %, zatímco pětiletý porost na stejném stanovišti přezimoval beze ztrát. Po celou dobu našeho pokusu s ozdobnicí nebyl zaznamenán silnější výskyt chorob nebo škůdců. Výnosy a další sledované ukazatele Prvním rokem bylo dosaženo na podzim výnosu ozdobnice v průměru za stanoviště pouze 1,187 t.ha -1 (tab. 3). Z uvedených výsledků je patrné, že výnosy fytomasy ozdobnice rostly od roku výsadby až do třetího roku v Ruzyni, resp. čtvrtého roku v Lukavci, kdy výnosy sušiny přesáhly většinou 20 tun. V následném období výnosy fytomasy kolísaly v závislosti na počasí v jednotlivých letech a nejvyšších hodnot zatím dosáhly v devátém roce, kdy v tomto roce přesáhly na obou stanovištích hodnotu 30 t.ha -1 sušiny (tab. 3). V průměru za sledované devítileté období bylo dosaženo v Ruzyni 21,02 t.ha -1, v Lukavci 17,81 t.ha -1 výnosu sušiny (tab. 3). Pro porovnání podle Clifton-Brown a kol. (2001) byly průměrné výnosy v prvém roce v několika zemích kolem 2 t.ha -1 sušiny. Výnosy dále rostly a v druhém roce byly 9 t.ha -1 a 98

99 ve třetím roce 18 t.ha -1 sušiny. Největší výnosy ve třetím roce byly dosaženy ve Švédsku 24,7 t.ha -1, Dánsku 18,2 t.ha -1, Anglii 18,7 t.ha -1 a Německu 29,1 t.ha -1 sušiny (Clifton-Brown a kol., 2001). Nejvýnosnější genotypy ozdobnice pěstované v Dánsku a Švédsku patřily mezi nejméně výnosné v Portugalsku a Německu, což poukazuje na silné interakce mezi genotypy a prostředím. V polních pokusech v Rakousku (Schwarz a kol., 1994) bylo dosaženo v druhém roce po výsadbě výnosu 8 t.ha -1 sušiny fytomasy, ve třetím roce 22 t.ha -1. Výnosy byly největší v srpnu a potom neustále klesaly až do února v důsledku opadu listů. V pokusech byl také sledován počet vytvořených stébel a délka rostlin. Obdobně jako výnosy byly sledované ukazatele ovlivněny hlavně počasím v jednotlivých letech (tab. 2). Obecně se dá konstatovat, že na stanovišti v Lukavci byly v průměru zjištěny vyšší počet stébel i délka rostlin v porovnání se stanovištěm Ruzyně (tab. 2). Vyšší počet stébel a větší délka rostlin byly v Lukavci zjišťovány od čtvrtého roku od založení porostu. Použité hnojení dusíkem nemělo průkazný vliv na délku rostlin ani na počet stébel (tab. 4). Tab. 2. Průměrné hodnoty počtu stébel (ks na rostlinu) a výšky rostlin (cm) za sledované období na jednotlivých stanovištích Počet stébel 1. rok 2. rok 3. rok 4. rok 5. rok 6. rok 7. rok 8. rok 9. rok Průměr Ruzyně 9,2 25,5 44,0 41,8 46,2 37,7 42,5 39,5 56,5 38,1 Lukavec 8,5 25,8 20,2 51,3 51,2 65,2 68,0 78,0 60,1 47,6 Průměr 8,8 25,7 32,1 46,6 48,7 51,4 55,3 58,7 58,3 42,8 Výška rostlin Ruzyně 100,5 184,0 275,5 244,5 201,7 215,2 236,0 240,3 332,7 225,6 Lukavec 96,2 163,7 176,7 159,7 354,0 318,0 300,8 310,0 331,0 245,6 Průměr 98,4 173,8 226,1 202,1 277,8 266,6 268,4 275,1 331,8 235,6 Vliv hnojení N na výnosy a další sledované ukazatele Výsledky vykazující vliv použitého hnojení N na výnosy sušiny ozdobnice z maloparcelkových polních pokusů jsou uvedeny v tab. 3. Výnosy jsou uvedeny v jednotlivých letech i jako průměr za 9-ti leté období. Každoroční přihnojení N na jaře v dávce 50 kg.ha -1 resp. 100 kg.ha -1 zvyšovalo v průměru stanovišť výnosy fytomasy o 4,9 % resp. o 12,8 % v porovnání s nehnojenými variantami (tab. 3). Použité dávky dusíku neměly průkazný vliv na výnosy fytomasy (tab. 4). Z našich obdobných pokusů lze konstatovat, že na úrodnějších půdách obecně postačí k ozdobnici každoroční přihnojení 50 kg.ha -1 N na méně úrodných půdách kolem 80 kg.ha -1 N (Strašil, 1999; Strašil, 2009). Také zahraniční prameny (Pignatelli a kol., 1998) udávají, že při vyšších dávkách N (nad 100 kg.ha -1 ) již nedochází k podstatnému nárůstu fytomasy. Vliv hnojení N na výnosy ozdobnice hodnotí také např. (Schwarz a kol., 1994). Konstatuje, že stupňované každoroční dávky minerálního dusíku aplikované vždy na začátku dubna od 0, 60, 90, 120 až 180 kg.ha -1 neměly průkazný vliv na výnosy. Vliv termínu sklizně na výnosy a další ukazatele Porovnání výnosů ozdobnice sklízené na podzim a na jaře je uveden v tab. 5. Z výsledků vyplývá, že v průměru za sledované období a stanoviště došlo k poklesu výnosu na jaře asi o třetinu ( o 6,59 t.ha -1, tj. 33,6 %). Vyšší ztráty přes zimní období byly zaznamenány na stanovišti v Lukavci 37,3 % oproti Ruzyni 31,1 %. Toto lze přičíst nepříznivějším podmínkám v zimním období v Lukavci, hlavně silnějším větrům a mrazům, které zapřičiňují vyšší opad listů a lámavost stonků. 99

100 Tab. 3. Vliv hnojení N v jednotlivých letech na výnosy fytomasy ozdobnice při podzimním termínu sklizně přepočtené na sušinu (t.ha -1 ) na daných stanovištích průměrné hodnoty Hnojení N N0 N1 N2 Stanoviště 1. rok 2. rok 3. rok 4. rok 5. rok 6. rok 7. rok 8. rok 9. rok Průměr Ruzyně 1,08 8,59 17,79 22,00 18,04 30,07 23,58 19,82 36,25 19,69 Lukavec 1,15 4,04 4,83 24,08 24,44 15,93 21,35 22,50 31,57 16,73 Průměr 1,12 6,31 11,31 23,40 21,24 23,00 22,46 21,16 33,91 18,21 Ruzyně 1,08 10,29 18,51 23,12 19,77 30,46 24,33 27,40 28,56 20,39 Lukavec 1,15 4,44 6,42 25,80 24,18 24,17 22,93 24,75 27,37 17,91 Průměr 1,12 7,37 12,46 24,46 21,97 27,32 23,63 26,07 27,96 19,15 Ruzyně 1,51 11,07 20,55 25,33 22,05 30,88 31,06 26,59 37,77 22,98 Lukavec 1,15 5,21 6,89 26,60 25,99 27,34 19,24 26,95 29,70 18,79 Průměr 1,33 8,14 13,72 25,97 24,02 29,11 25,15 26,77 33,74 20,88 1,19 7,27 12,50 24,61 22,41 26,48 23,75 24,67 31,87 19,42 Průměr N Legenda: N0=0, N1=50, N2=100 kg.ha -1 N Tab. 4. Statistické zhodnocení použitého hnojení N na sledované ukazatele Minimální průkazná diference (MD) Výnosy Počet stébel Délka rostlin Skupina Příp. Průměr Průměr Průměr N ,212 43,0 246,7 N ,151 44,6 247,0 N ,884 48,6 249,9 MD 4,891 9,83 34,24 Legenda: N0=0, N1=50, N2=100 kg.ha -1 N Pro jižní Evropu jsou uváděny ztráty fytomasy ozdobnice při jarní sklizni 30 až 50 % v porovnání se sklizní na podzim (Lewandowski a kol., 2000). Bischoff, Emmerling (1995) udávají ztráty 33 %. Třicetiprocentní ztráty přes zimu opadem udává také Himken a kol. (1997). V našich dřívějších pokusech v polních podmínkách jsme zjistili ztráty fytomasy ozdobnice (M. x giganteus) přes zimní období v rozmezí 24 až 36 % (Strašil, 1999). Pro uskladnění a následné zpracování fytomasy pro energetické využití je třeba, aby obsah vody ve sklízeném materiálu byl pokud možno nízký. Z tohoto důvodu se doporučuje, aby porosty ozdobnice zůstaly na poli přes zimu. Proto převažuje sklizeň po zimě (únor, březen), neboť tak odpadnou problémy s případným dosoušením. Podle našich sledování měla fytomasa ozdobnice v průměru za sledované období a stanoviště sklízená na podzim 51,9 % sušiny, na jaře 79,5 % sušiny. Schwarz (1994) udává vlhkost fytomasy ozdobnice při sklizni v září mezi 55 až 60 %. Na konci února činila vlhkost v druhém roce po vysazení kolem 42%, ve třetím roce 30 %, ve čtvrtém roce 25 %, v pátém roce 30 %. Tab. 5. Porovnání výnosů přepočtených na sušinu (t.ha -1 ) na podzim a na jaře na daných stanovištích (průměrné hodnoty) Období Stanoviště 1. rok 2. rok 3. rok 4. rok 5. rok 6. rok 7. rok 8. rok 9. rok Průměr Ruzyně 1,22 9,98 18,95 23,48 19,95 30,47 26,32 24,60 34,20 21,02 Podzim Lukavec 1,15 4,57 6,04 25,73 24,87 22,48 21,17 24,73 29,55 17,81 Průměr 1,19 7,27 12,00 24,61 22,41 26,12 23,75 24,67 31,87 19,42 Jaro Ruzyně 0,51 7,20 13,09 11,31 14,67 24,93 20,43 18,83 19,33 14,48 Lukavec 0,65 3,13 3,59 7,52 12,82 20,82 10,94 18,82 22,30 11,18 100

101 Průměr 0,58 5,16 8,34 9,42 13,75 22,87 15,68 18,83 20,82 12,83 Obsah prvků v rostlinách je dalším z důležitých faktorů jednak pro stanovení odběru živin výnosy, jednak z hlediska spalování fytomasy. Pro spalování je výhodné pokud obsah N ve fytomase je co nejmenší (tvoří se méně N ox ), pokud je malý obsah S a Cl (snižuje se možnost koroze spalovacího zařízení) a pokud je také nízký obsah K, Mg apod. (ovlivňuje teplotu tavení popele). U ozdobnice se snižoval s oddálením termínu sklizně obsah prvků ve fytomase (tab. 6). Obsah dusíku a dalších sledovaných prvků v rostlinách ozdobnice klesal se stářím rostliny a termínem sklizně, což je také výhodné pro samotný proces spalování a tvorbu emisí. Tab. 6. Obsah prvků v rostlinách ozdobnice v různých termínech sklizně průměrné hodnoty Termín Obsah prvků v % sušiny sklizně N P K Ca Mg Podzim 0,876 0,086 0,631 0,358 0,103 Jaro 0,829 0,079 0,292 0,228 0,086 Průměr 0,853 0,083 0,462 0,293 0,095 Závěr Vysokých výnosů fytomasy ozdobnice dosahuje od 3 roku po založení porostu. Výnosový potenciál ozdobnice předstihuje možnosti většiny domácích druhů, včetně rychle rostoucích dřevin. Ozdobnice se jeví jako perspektivní rostlina pro energetické využití. Při jejím pěstování je možno využívat mnoha výhod jako je dosahování vysokých výnosů sušiny fytomasy, vysoce efektivní využívání vody při tvorbě fytomasy, sklizeň běžně používanými sklizňovými mechanizmy apod. Velkou výhodou při pěstování ozdobnice je také relativně nízký nárok na hnojení a pesticidy. Snížení výnosů fytomasy na jaře v porovnání s podzimním termínem sklizně je vyváženo zvýšenou kvalitou paliva (z hlediska technického a tvorby emisí). Při jarním termínu sklizně odpadne také dosoušení, které je ekonomicky nákladné. Kvalita fytopaliva ozdobnice je srovnatelná s fytomasou dřevin. Z výsledků lze konstatovat, že ozdobnici je třeba považovat za významný zdroj obnovitelných surovin pro průmyslové a energetické využití. Dedikace Tento příspěvek byl finančně podpořen výzkumným projektem MZe ČR č. QJ Použitá literatura Bischoff R., Emmerling, R Demands and performance of Miscanthus sinensis - fiveyear results at a dry site. Kongressband 1995 Garmisch-Partenkirchen. Vortrage zum Generalthema des 107. VDLUFA-Kongresses vom in Garmisch- Partenkirchen: Grunland als Produktionsstandort und Landschaftselement. 1995: Clifton-Brown J. C., Lewandowski I., Andersson, B., Basch G., Christian D. G., Kjeldsen J. B., Jørgensen U., Mortensen J. V., Riche A. B., Schwarz K. U., Tayebi K., Teixeira F Performance of 15 Miscanthus genotypes at five sites in Europe. Agronomy Journal. 93, 5: Eppel-Hotz A., Jodl S., Kuhn W Miscanthus: New cultivars and results of research experiments for improving the establishment rate. In: Sustainable agriculture for food, energy and industry. Proceedings of the International Conference. Braunschweig, Germany:

102 Himken M., Lammel J., Neukirchen D., Czypionka-Krause U., Olfs H. W Cultivation of Miscanthus under West European conditions: seasonal changes in dry matter production, nutrient uptake and remobilization. Plant and Soil. 189, 1: Lewandowski I., Clifton-Brown, J. C., Scurlock, J. M. O., Huisman, W Miscanthus: European experience with a novel energy crop. Biomass and Bioenergy. 19, 4: Pignatelli V., Piscioneri I., Fogacci G Miscanthus x gigantheus productivity over different fertiliser treatment under Italian conditions. In: Sustainable agriculture for food, energy and industry. Proceedings of the International Conference. Braunschweig, Germany: Schwarz H Fertilization effect on production of miscanthus sinensis gigantheus.. In: European conference on biomass for energy, environment, agriculture and indiustry. Book of Abstracts from International Conference. Viena-Austria, October 1994: Schwarz H., Liebhard P., Ehrendorfer K., Ruckenbauer P The effect of fertilization on yield and quality of Miscanthus sinensis 'Giganteus'. Industrial-Crops-and-Products. 2: 3, Strašil Z Production of aboveground biomass in Miscanthus sinensis under field conditions. (Produkce nadzemní fytomasy ozdobnice čínské (Miscanthus sinensis) v polních podmínkách). Rostl. Výr. 45, (12): Strašil Z Základy pěstování a možnosti využití ozdobnice (Miscanthus). Uplatněná metodika pro zemědělskou praxi. Ed.: VÚZT Praha, 2009, 48 s. Miscanthus sinensis Kontaktní adresa: Ing. Zdeněk Strašil, CSc. Výzkumný ústav rostlinné výroby Praha - Ruzyně, v.v.i., Drnovská 507, Praha 6 - Ruzyně 102

103 MOŽNOSTI VYUŽITÍ TECHNOLOGIÍ PRO ZÍSKÁNÍ ENERGETICKÉ ŠTĚPKY Z VINIC The possibilities for utilizing of technologies for harvesting of energy wood chips from grape cane Zemánek P., Burg P. Zahradnická fakulta, Mendelova univerzita v Brně Abstrakt Práce shrnuje výsledky provozních sledování strojních souprav u technologií pro získání energetické štěpky z réví vinic. Z výsledků sledování bylo provedeno hodnocení provozních nákladů u 2 variant technologických postupů využívajících drtič se zásobníkem a svinovací lis. Pro jednotlivé varianty byly modelovány provozní náklady v závislosti na výkonnosti a dopravní vzdálenosti při odvozu štěpky nebo balíků. Klíčová slova: vinohradnictví, odpadní dřevní hmota, dřevní štěpka, balíky dřevní hmoty Abstract This paper is focused on procedure proposal for implementation of technologies for utilization of waste vine cane from vineyards for the energy purposes, including an assessment of their effectiveness. Evaluated were 2 variants of technological procedures with using the shredder with container and the vine cane baler. For the individual variants were modeled operating costs, depending on the extent of the annual use that reflects the size of the vineyard. Key words: viticulture, waste wood, wood chips, wood roll Úvod V posledních letech roste snaha po využívání všech obnovitelných zdrojů energie a odpadní dřevo ve formě réví z vinic mezi ně právem patří (WALG, 2007). Réví z vinic a dřevo z ovocných výsadeb představují stabilní zdroj dřevní hmoty. Rozvoj technologií jeho zpracování pro energetické účely je v tradičních vinařských zemích patrný a odráží se zejména ve vývoji moderních strojních systémů a návazně také vhodných spalovacích zařízení MAGA a kol. (2008). Plocha produkčních porostů vinic v ČR činí ha. Výnos odpadního réví je výrazně ovlivněn sponem výsadby (počet keřů na 1 ha), odrůdou, vedením apod. a pohybuje se od 1,8 2,5 t.ha -1 (HERZÁN, 1993, ŽUFÁNEK, 1998). Využití tohoto energetického potenciálu závisí především na dostupnosti a efektivitě používaných technologií. Stávající technologie se donedávna vyznačovaly vysokou pracností. BURG (2007) naznačuje, na základě sledování nasazení vinohradnické techniky v moravských vinohradnických regionech, v posledních 4 letech narůst zájmu o pořizování strojů pro zpracování réví. Cílem práce je posouzení možností zavedení dvou variant technologií pro využití odpadního réví z vinic k energetický účelům a zhodnocení jejich provozních nákladů, stanovení bilance množství získané štěpky nebo balíků a energetického potenciálu včetně výkonu kotle. Materiál a metody Při návrhu zavedení technologií musí uživatel posuzovat řadu technických i ekonomických podkladů, na základě kterých provede rozhodnutí o použité technologii a technice. Bilance množství odpadního dřeva a energetického potenciálu Součástí návrhu musí být stanovení bilance množství získané štěpky nebo balíků, energetického potenciálu a výkonu kotle. 103

104 a) stanovení produkce odpadního dřeva Při stanovení produkce odpadního dřeva je nutné vycházet z počtu keřů na pěstební ploše a z průměrného množství dřeva získaného z keře. Produkce odpadního dřeva je pak dána vztahem n G i 1 S i Q i (t) kde: S i pěstitelská plocha (ha) Q i výnos odpadního dřeva (t.ha -1 ) n počet pozemků s trvalými porosty (-) b) stanovení energetického potenciálu z produkce odpadního dřeva, výkonu kotle Z celkové produkce odpadního dřeva lze na základě výhřevnosti určit energetický potenciál (E P ). E p G H (GJ) kde: G produkce odpadního dřeva (t) H výhřevnost štěpky nebo balíků (GJ.t -1 ) Výhřevnost odpadního dřeva je stanovena pro surovinu s vlhkostí %. Její hodnoty pro vybrané produkty uvádí Tab.1. Tab.1: Výhřevnost, objemová hmotnost a nároky na skladovací prostor u dřevní štěpky a balíků réví Palivo Výhřevnost (MJ.kg -1 ) Objemová hmotnost (kg.m -3 ) Energetický obsah (GJ.m -3 ) Energetický obsah (MWh.m -3 ) Skladovací prostor (m 3.GJ -1 ) Skladovací prostor (m 3.MWh -1 ) Dřevní štěpka ,95 0,82 0,34 1,22 Réví balíky ,90 1,36 0,20 0,73 Réví štěpka ,80 1,63 0,17 0,61 Dřevo brikety, pelety ,85 4,96 0,06 0,20 c) stanovení možného výkonu kotle Za předpokladu využití celého množství odpadního dřeva pro vytápění stavebního objektu lze také stanovit maximální výkon kotle pro toto množství podle vztahu: 6 EP.10 P (kw) d. h.3600 kde: E p energetický potenciál získaného odpadního dřeva (GJ) d počet dnů topné sezony v roce, běžně , při celoročním vytápění 365 h počet hodin plného provozu kotle v průběhu dne, běžně h Z výše uvedeného vztahu lze také určit minimální pěstitelskou plochu pro požadovaný výkon kotle: d. h P S (ha) 6 Q. H

105 kde: d počet dnů topné sezony v roce (-) h počet hodin plného provozu kotle v průběhu dne, běžně (-) P požadovaný výkon kotle (kw) Q průměrný výnos odpadního dřeva (t.ha -1 ) H výhřevnost štěpky nebo balíků (GJ.t -1 ) Návrh technického zajištění zvolené technologie V současné době se jako nejvýhodnější jeví především tyto technologické postupy: Technologický postup drcení réví do zásobníku s odvozem, při kterém se využívá nesených drtičů se zásobníkem o objemu 1,0 2,5 m 3. Do zásobníku je ukládána vznikající dřevní štěpka, jeho vyprázdnění do transportního prostředku, nejčastěji traktorového přívěsu, nebo návěsu s klecovou nástavbou, se provádí na okraji pozemku. Technologický postup se sběrem a lisováním réví do balíků využívá svinovacích lisů pro sběr a svinování réví. Vznikají tak válcové balíky o průměru 0,40 m a délce 0,60 m s hmotností 30 kg. Ty jsou následně odváženy traktorem a přívěsem s klecovou nástavbou. Výhodou je zde nižší energetická náročnost operace, protože není nutné materiál drtit. Při výběru technologie a použitých strojů se vychází z obecných zásad tvorby strojních linek, kdy nejdůležitějším článkem linky bude drtič nebo lis. Součástí návrhu linky je také řešení dopravy získávaného produktu. Pro balíky lisovaného dřeva je nutno řešit také nakládku, u drtičů se zásobníkem se volba dopravního prostředku řídí výsypnou výškou zásobníku. Ekonomické hodnocení technologií Ekonomické hodnocení navržených technologií je zaměřeno především na stanovení provozních nákladů používaných souprav. Pro modelování nákladů bylo využito programu AGROTEKIS. Výsledkem jsou hodnoty provozních nákladů strojních souprav vyjádřené v Kč na 1 hodinu nasazení a na 1 hektar operace. Součástí ekonomického hodnocení je i stanovení nákladů na dopravu, které je provedeno pro dopravní vzdálenosti 3 km; 5 km a 8 km. Výsledky a diskuse Technicko-ekonomické údaje a vypočítané provozní náklady pro 2 sledované technologie jsou uvedeny v Tab.2 a Tab.3. Tab.2: Provozní náklady pracovních operací pro variantu I - drcení do zásobníku s odvozem Technické prostředky pro zabezpečení operace Varianta B NEW HOLLAND TN 75V + drtič se sběrným košem PERUZZO COBRA 1200 Výkonnost stroje nebo strojní soupravy (W04) Spotřeba paliva Provozní náklady ha.h -1 t.h -1 l.h -1 l.ha -1 Kč.h -1 Kč.ha -1 0,6 1,5 8,0 13, ,8 2,0 8,6 10, ,0 2,5 9,2 9,

106 Osobní náklady obsluhy - řidič 0, , , NEW HOLLAND TN55V + traktorový přívěs 5-10 t 3 km 3,0 7,5 5,0 1, km 2,0 5,0 5,0 2, km 1,4 3,5 5,0 3, Osobní náklady obsluhy - řidič 3, , , Tab.3: Provozní náklady pracovních operací pro variantu II - Technologický postup se sběrem a lisováním réví do balíků včetně odvozu Technické prostředky pro zabezpečení operace Varianta C NEW HOLLAND TN 55V lis CAEB MP 400/S Výkonnost stroje nebo strojní soupravy (W04) Spotřeba paliva Provozní náklady ha.h -1 t.h -1 l.h -1 l.ha -1 Kč.h -1 Kč.ha -1 0,5 1,25 5,5 11, ,6 1,5 5,8 9, ,7 1,75 6,2 8, Osobní náklady obsluhy - řidič 0, , , NEW HOLLAND TN55V + traktorový přívěs 5-10 t 3 km 1,5 3,75 5,5 3, km 1,3 3,3 5,5 4, km 1,1 2,9 5,5 5, Osobní náklady obsluhy řidič + 2 pracovníci pro nakládání (1 h) 1,5 3, ,3 3, ,1 2, Výpočet nákladů na dopravu štěpky a balíků byl proveden pro každou variantu následovně: Varianta I: Výkonnost dopravní soupravy je stanovena z doby dvou cyklů: dovoz prázdného přívěsu a jízda zpět, odvoz plného přívěsu. Z doby dopravního cyklu a z nosnosti použitého ložného prostředku je pak stanovena výkonnost dopravní soupravy. Např. pro vzdálenost 3 km je potřebu času 40 minut, při nosnosti 5,0 t je výkonnost dopravní soupravy 7,50 t.h -1, při 106

107 celkové náklady Kč/ha celkové náklady Kč/ha Úroda 12/2012, vědecká příloha časopisu výnosu 2,5 t réví z 1 ha to znamená výkonnost 3,0 ha.h -1. Není zde logicky započítána doba plnění přívěsu (traktor je využit jinde). Varianta II: Náklady na dopravu jsou vyčísleny podle výnosu réví z 1 ha, pro 2,5 t.ha -1 a hmotnosti balíku 30 kg je to cca 80 ks.ha -1, přívěs o nosnosti 5 t pojme cca 160 kusů balíků. Nakládání traktorového přívěsu dvěma pracovníky 60 minut, přeprava na zadanou dopravní vzdálenost 3km; 5km a 8 km,, vyprazdňování přívěsu, zpětná jízda. Např. pro vzdálenost 8 km je potřebu času 104 minut, při nosnosti 5,0 t je výkonnost dopravní soupravy 2,90 t.h -1, při výnosu 2,5 t réví z 1 ha to znamená výkonnost 1,1 ha.h -1. Z údajů uvedených v Tab.2 a Tab.3 byly stanoveny celkové náklady v závislosti na výkonnosti a dopravní vzdálenosti. Porovnání těchto nákladů ukazuje Graf 1. Graf 1: Celkové náklady - Varianta I Varianta II Varianta I Varianta II výkonnost 0,6 ha/h výkonnost 0,8 ha/h výkonnost 1 ha/h výkonnost 0,5 ha/h výkonnost 0,6 ha/h výkonnost 0,7 ha/h km 5 km 8 km 0 3 km 5 km 8 km dopravní vzdálenost dopravní vzdálenost Při výpočtech nákladů pro jednotlivé soupravy byla rozdílnost pěstitelských podmínek vyjadřována různou výkonností. Soupravy pro drcení nebo lisování réví dosahují, podobně jako ostatní stroje ve vinohradnictví, různou výkonnost zejména podle délky řad, podmínek pro otáčení a najíždění a podle svažitosti terénu. Krátké řady a horší terénní podmínky snižují výkonnost až o % (ZEMÁNEK, BURG, MICHÁLEK, 2010). Z porovnání celkové výše nákladů u hodnocených variant je zřejmé, že při stejných dopravních vzdálenostech jsou nižší celkové náklady u varianty I. S ohledem na pořizovací ceny drtiče je však nutné zajistit jeho efektivní roční nasazení alespoň hodin ročně. Při volbě typu drtiče je často diskutován objem zásobníku. Standardní modely s objemem 1,0 1,5 m 3 poskytují při délce meziřadí m velmi dobré možnosti naplnění jedním průjezdem (BURG, 2007). Objem zásobníku zde ovlivňuje provozní náklady pouze nepatrně, navíc modely s větším objemem (2,0 4,0 m 3 ) vyžadují agregaci s traktory vyšších výkonových tříd. Obtížné otáčení a najíždění do meziřadí snižuje výhodu úspory pracovního času při vyprazdňování koše. Pro větší délky meziřadí a při vyšší produkci réví je pak nutno uvažovat s využitím drtičů s výfukovým hrdlem, umožňujících plnění štěpky do přívěsu jedoucího ve vedlejším meziřadí (WALG, 2007). Celkové náklady jsou ovlivněny i hodnotou dopravních nákladů, která bude dána použitým dopravním prostředkem a dopravní vzdáleností (SOUČEK, 2007). U sledovaných technologií byly dopravní náklady na úrovni Kč.t -1 při dopravních vzdálenostech 5 8 km. Efektivita sledovaných souprav bude záviset především na tržní ceně štěpky jako hlavního získávaného produktu. Z předběžných propočtů, při ceně štěpky v rozmezí Kč.t -1, lze usuzovat na možnost efektivního nasazení sledovaného drtiče již od 40 ha sklízené plochy, u lisu podle jeho pořizovací ceny asi od 50 ha sklízené plochy ročně. 107

108 Výsledky práce naznačují, že uvedené technologie mohou být dostupné i pro stávající střední a velké vinohradnické podniky v ČR. Závěr Práce se zabývá nejdůležitějšími aspekty návrhu dvou technologií pro získání energetické štěpky z réví vinic. Součástí práce bylo hodnocení provozních nákladů u 2 variant technologických postupů využívajících drtič se zásobníkem a svinovací lis. Pro jednotlivé varianty byly modelovány provozní náklady v závislosti na výkonnosti a dopravní vzdálenosti při odvozu štěpky nebo balíků. Výsledky jsou významným podkladem pro všechny uživatele popsaných technologií a umožňují jim posoudit investiční záměr směřující k zavedení popsaných nebo obdobných technologií. Dedikace Příspěvek vychází z řešení výzkumného projektu NAZV č. QH Technické prostředky pro sklizeň a zpracování odpadního dřeva z vinic Použitá literatura Burg, P., 2007: Perspektivní mechanizační prostředky ve vinohradnictví a jejich vliv na ekonomiku a kvalitu produkce. Habilitační práce. MZLU v Brně, 205 s. Herzán, Z., 1987: Využití dřevního odpadu v zahradnické výrobě pro energetické účely. Diplomová práce. Brno: ZF VŠZ Brno, 77 s. Maga, J. a kol., 2008: Komplexný model využitia biomasy na energetické účely. Nitra: SPÚ v Nitra. 1. vydání. 183 s. ISBN Souček, J., 2007: Zpracování rostlinného materiálu štěpkovači a drtiči. Komunální technika. Praha: Profi Press. Roč. 1, č. 9, s ISSN Souček, J., 2010: Doprava jako součást logistiky energetických surovin v zemědělství. Biom.cz [online] [cit ]. Dostupné z WWW: <http://biom.cz/cz/odborne-clanky/doprava-jako-soucast-logistiky-energetickych-surovinv-zemedelstvi>. ISSN: Walg, O., 2007: Taschenbuch der Weinbautechnik. 2. vyd. Kaiserslautern: Rohr Druck. 620 s. ISBN Zemánek, P., Burg, P., Michálek, M., 2010: Hodnocení technologických postupů využívaných při zpracování réví pro energetické účely. Společnost pro techniku prostředí. Konference alternetivní zdroje energie 2010, Kroměříž s sb. celkem 379 s. ISBN Žufánek, J., 1998: Bilance zdrojů biologických odpadů ve vinohradnictví a ovocnictví. Sborník z mezinárodní konference "Ekologické aspekty výzkumu, vývoje a provozu zahradnické techniky", konané u příležitosti setkání kateder a ústavů VŠ a výzkumných pracovišť v Lednici 23. a , s Kontaktní adresa: Doc. Ing. Pavel Zemánek, Ph.D. Ústav zahradnické techniky, Zahradnická fakulta, Mendelova univerzita v Brně Valtická 337, Lednice, Česká republika 108

109 KRAJOVÉ ODRŮDY ROSTLIN JAKO KULTURNÍ DĚDICTVÍ NÁRODA Plant landraces as a national cultural herritage Holubec V. 1, Paprštein F. 2, Řezníček V. 3, Dušek K. 1 1 Výzkumný ústav rostlinné výroby, v. v. i., Praha a Olomouc 2 Výzkumný a šlechtitelský ústav ovocnářský Holovousy s. r. o. 3 Mendelova univerzita v Brně Abstrakt Krajové odrůdy jsou ceněny jako místní specialita a vyjadřují národní identitu země a identitu regionu. Území České republiky se významnou měrou podílelo na vzniku řady odrůd. Ovocné stromy se sázely jako aleje podél silnic, na mezích polí nebo jako sady v extravilánu vesnic a vytvářely typický ráz české krajiny. Za účelem inventarizace krajových materiálů a starých odrůd je přepracovávána databáze z listin povolených odrůd Inventarizace historického výskytu a pěstování krajových odrůd ovoce v ČR byla prováděna v terénu v oblasti Podkrkonoší, Polabí Orlických hor a Tišnovska. Při porovnání starých fotografií se současným stavem byl zjištěn 90 až 100 % úbytek sadů z extravilánu obcí. Na základě prováděné inventarizace a posouzení v terénu dojde navržení in situ konzervace nejcennějších sadů, alejí a roztroušených výsadeb a převedení vybraných genotypů do ex situ výsadeb. Klíčová slova: krajové formy, staré odrůdy, konzervace, krajové zvláštnosti, národní identita Abstract Landraces are valuable as local specialities representing national identity of a county or region. The territory of the Czech Republic has a significant influence on creation of many landraces/cultivars. Fruit trees have been planted often along roads in the country, between fields and as orchards around villages forming typical Czech rural landscape. The inventory database of landraces and obsolete cultivars colatetd in 90ties from Lists of registered cultivars was updated and analysed. Historical and present occurrence and growing of fruit landraces was verified in the field in the region of Podkrkonoší, Polabí, Orlické Mts. and Tišnov region. Comparing of old photographs with present air mapping revealed a decrease of orchards around villages by 90 to 100 %. On the basis of our inventory and field research, proposals for in situ conservation of the most valuable orchards and other plantations will be elaborated and selected genotypes will be taken to ex situ plantations. Key words: landraces, obsolete cultivars, conservation, regional specialities, national identity Úvod Krajové formy vznikaly od počátku zemědělství výběrem z planých ekotypů a jejich pěstováním farmáři v jejich domácím regionu. Farmáři opakovali pozitivní i negativní výběr vědomě i neuvědoměle, až se ustálily krajové formy, a ty si navzájem vyměňovali. Staré tradiční odrůdy naopak vznikaly na profesionální bázi, zprvu cíleným výběrem a později záměrným křížením šlechtiteli. Hranice mezi těmito farmářskými a šlechtitelskými materiály je nejasná. Pravých krajových materiálů se dochovalo málo a je o nich mnohem méně informací než o starých šlechtěných odrůdách. Všechny tyto materiály vzniklé na historickém území českých zemí představují objekty naší kulturní identity. Mnohé krajové odrůdy jsou svázány s jejich tradičním využitím a s technologiemi zpracování. Krajové odrůdy jsou ceněny jako místní specialita (Kühn 1974) a vyjadřují národní identitu země a identitu regionu. Pamětníci dodnes vzpomínají na pšenici dvouzrnku, která byla v Bílých Karpatech užívána do jelit a prejtu a není nahrazena ekvivalentním materiálem. Zatímco polní plodiny vymizely postupně z kultury, ovocné dřeviny se nacházejí v krajině do dnes. Z dalších plodin se v kultuře dochovaly kořeninové a léčivé druhy a některé minoritní zeleniny v zahradách. Těmto skupinám plodin je věnována v příspěvku hlavní pozornost. 109

110 Ovocné stromy se v české a moravské krajině uplatňovaly velmi významně již od 7. století (Říha, 1919). Slivoňové, ořechové, jabloňové aleje vtiskly mnohým regionům typický ráz. V minulosti byly ovocné aleje právě jednou z forem ovocnářských produkčních výsadeb. Dnes je jejich hospodářský význam méně akcentovaný a jsou považovány především za krajinný element (Salašová, 2000). Staré sady jsou významné z hlediska zachování genofondu kulturních odrůd ovocných dřevin (Tetera, 2003). Tyto dřeviny jsou znakem autenticity místa. Návrat původních druhů do krajinných prostor, ze kterých byly lidskou činností vytlačeny, znamená podstatné zvýšení druhové, fytocenologické diverzity a obnovu, případně záchranu genofondu autochtonní flóry (Salašová, 2000). K historicky pěstovaným rostlinám na našem území patří také zeleniny a kořeninové plodiny. V nálezech zuhelnatělých semen v Mikulčicích byly nalezeny okurky. Významnou úlohu v rozšiřování a pěstování plodin měly klášterní a zámecké zahrady. Ze sedleckého kláštera u Kutné Hory se již ve 12. století zavádělo specializované pěstování křenu v Malíně, z kláštera v Moravském Krumlově pěstování chřestu v Ivančicích (Moravec, 2001). U nás probíhala etapa vzniku krajových odrůd zelenin převážně v průběhu 19. století, jejich využívání trvalo až do poloviny 20. století. Koření a léčivé rostliny byly získávány sběrem v přírodě, mnohé dosud. Počátky šlechtění vyvolala větší spotřeba druhů, zvláště jejich průmyslové zpracování. V předválečném Československu se ročně spotřebovalo na 400 tun suchých léčivek s největší poptávkou po 14 druzích koření (Moravec, 2001). Po druhé světové válce došlo k velkým změnám v zemědělství, industrializace vyžadovala nové kultivary pěstovaných plodin. Začátkem druhé poloviny 20. století pocítila krajina vliv socializace venkova. Nastal proces scelování, likvidace mezí, meliorace a jiné pozemkové úpravy. Na polích vznikaly monokultury, došlo k úbytku selských sadů, ovocných stromořadí a rozptýlené krajinné zeleně vůbec (Tetera a kol, 2006). V současné době se změnou zemědělských priorit se však trh pro zajímavé krajové odrůdy otevírá, zejména ve spojení s organickým a ekologickým zemědělstvím, rozšiřujícím se vegetariánstvím a požadavkem na diversifikaci druhů a plodin. Materiál a metody V počáteční fázi řešení projektu bylo nezbytné shromáždit informace o starých odrůdách z historických pramenů, zejména katalogů zahradnických firem, listin povolených odrůd, a obecně materiálů v regionálních archivech a dále od pracovníků Správ národních parků a chráněných krajinných oblastí. Databáze starých odrůd byla následně porovnána s Almanachem šlechtění (Němec et al. 2000). Výskyt starých odrůd ovocných dřevin byl prověřován v terénu na mnoha místech České republiky a bylo prováděno určování odrůd. Jednotlivé stromy byly zaměřeny kvalitním přístrojem GPS a vymapovány do programu Geobáze Mapa ČR 1: Na základě zkušeností s regenerací materiálu v genofondových výsadbách jsou zpracovány metodiky přípravy rostlinného materiálu pro výsadby do on farm sadů, ošetření materiálu ve školce a následná nezbytná ošetření po výsadbě. Výsledky a diskuze 1. Inventarizace krajových a starých šlechtěných odrůd o počátků šlechtění v ČR z písemných zdrojů Údaje o historickém materiálu krajových forem a šlechtěných odrůd od počátku šlechtění na našem území (Československa a České republiky) do roku 2000 byly shromážděny, převedeny do formy databáze a zkontrolovány řešiteli specializovaných kolekcí. Databáze byla analyzována z hlediska podílu odrůd, plodin a skupin plodin, životnosti odrůd (délka registrace). Průměrná životnost odrůdy byla spočítána na 8,1 let. Rozložení životnosti 110

111 jednotlivých odrůd podle skupin plodin ukazuje graf 1. Výsledky jsou zatíženy chybou absence exaktní informace v databázi před rokem Řada materiálů byla uvedena v listinách jen jednou a to v letech 1941, 1948 nebo výjimečně pozdějších (658 odrůd). Tyto odrůdy lze považovat za nejstarší krajové a mohly mít naopak životnost dlouhou, let před publikací první Listiny. Němec et al. (2000) uvádí registraci nejstarších odrůd obilnin od roku 1922 a luskovin od roku Některé odrůdy se udržely v sortimentu po celou sledovanou dobu do roku 2000, tj 45 let, jedná se zejména o minoritní druhy koření např. mateřídouška tymián Krajový, lékořice Hladkoplodá krajová, pelyněk kozalec Krajový. Krajové odrůdy ovocných dřevin a révy však mohou mít skutečnou životnost let, ale neexistují odpovídající záznamy Graf 1. Rozložení životnosti jednotlivých odrůd podle skupin plodin v přehledu povolených odrůd z let V rámci tohoto projektu představují hlavní objekt zájmu ovocné dřeviny, jakožto podstatný faktor v krajině. Ovocné dřeviny v nejrůznějších typech výsadeb (sady, aleje, roztroušená zeleň a staré solitérní stromy) tvořily po staletí typický ráz české vesnické krajiny. Z přehledu povolených odrůd od roku 1941 je patrné, že převažují jabloně, hrušně a slivoně. Teplomilné ovocné druhy se v sortimentu odrůd uplatňují později, zejména v 80. a 90. letech. 2. Inventarizace historického výskytu a pěstování krajových odrůd ovoce v ČR. Území České republiky se již od středověku významnou měrou podílelo na vzniku řady odrůd ovocných dřevin. Dokládá to značný počet krajových odrůd, které se v hojné míře pěstovaly ještě na přelomu 18 a 19 století. Na základě studia starých dobových fotografií pořízených při leteckém snímkování těsně před druhou světovou válkou (1938) byl zjištěn četný výskyt extenzivních sadů v nezastavěných částech obcí extravilánu až po vnější hranici jejich katastrálního území. Tyto sady tvořily často souvislé pásy kolem intravilánu obcí. Při porovnání těchto fotografií se současným stavem (letecké snímky pořízené po roce 2000) byl zjištěn 90 až 100 % úbytek tohoto důležitého environmentálního prvku z české kulturní 111

112 krajiny. Je patrné, že remízky, roztroušená zeleň a extenzivní sady byly od 50 let postupně nahrazovány rozsáhlými lány polí s monokulturami obilnin a olejnin. Bylo analyzováno rozšíření a historické pěstování ovocných plodin ve vybraných regionech ČR. Získávání informací bylo v roce 2011 zaměřeno na oblasti v Čechách: Podkrkonoší (obr. 1), Polabí a Orlické hory. Při terénním průzkumu byly zapsány výskyty stromů, v době plodnosti určeny odrůdy, zapsána charakteristika stromu a zdravotní stav. Některé odrůdy ovocných plodin jsou významně spjaty s národnostními menšinami na území ČR (zejména německá). Z oblastí Podkrkonoší a Orlických hor se jedná například o odrůdy jabloně Řehtáč soudkovitý ( Prinzenapfel ), Landsberská reneta ( Renette Landsberger ) a Vilémovo ( Wilhelmapfel ) nalézané v oblastech osídlených německou menšinou. Výskyt starých odrůd ovocných dřevin na Moravě byl prověřován na Tišnovsku (obr. 2). V katastrálním území 14 obcí byla vizualizována lokalizace stromů s využitím ortofotomap z Google. Staré výsadby zahrnovaly sady, aleje, soukromé zahrady v intravilánu vesnic, roztroušenou zeleň a solitérní stromy. Vzorky plodů byly sebrány pro potvrzení určení do odrůd a byla pořízena fotodokumentace. 3. Charakteristika vybraných lokálních odrůd, které byly nalezeny v oblastech Podkrkonoší, Polabí, Orlických hor a Tišnovska. Třešně: Ladeho pozdní. Velmi stará česká odrůda, červená chrupka neznámého původu zrající v 9 týdnu po odrůdě Van. Jedná se o nejpozději zrající odrůdu třešně. Plody jsou středně velké až menší průměrné chuti. Buketova. Velmi stará lokální česká odrůda třešně, která nese na jedné stopce většinou 2 až 3 plody. Zraje asi 5 dní před odrůdou Van. Plody jsou malé (kolem 3 g). Chuť dužniny je průměrná, navinule sladká. Šťáva barví velmi dobře. Višně: Vackova. Původ východní Čechy, nahodilý semenáč višně Ostheimské z roku Zraje několik dní před odrůdou třešní Napoleon. Plody jsou středně velké až větší (5 6 g), barvy tmavě červené. Dužnina je měkčí, chuti navinulé, příjemně kořenité, velmi dobré. Strom roste středně silně až silněji, vytváří typické kulovité koruny, silně zahušťuje. Plodnost je velmi raná, bohatá. Cizosprašná odrůda. Jabloně: Smiřické vzácné. Česká lokální odrůda z konce 19. století rozšířena především v severovýchodních Čechách. Plody jsou větší ( g). Tvar ploše kulovitý, pravidelný. Dužnina je bílá, šťavnatá. Chuť má sladce navinulou. Konzumně zraje v prosinci, vydrží do března. Tvar koruny je ploše kulovitý, roste bujně. Míšeňské. Velmi stará odrůda neznámého původu. Pěstovala se v Čechách již začátkem 15. století. Dužninu má bělavou, tuhou, chuti navinule sladkou, dobrou. Zraje v listopadu, vydrží do dubna. Vytváří hustší kulovité koruny. Roste bujně. Velmi odolná k poškození mrazem. Malinové holovouské. Místní odrůda objevena majitelem panství Františkem Josefem z Leveneuru a Grünwallu v Holovousích na sklonku 18. století. Na zemské říšské výstavě ve Vídni v r získala nejvyšší ocenění. Jak se v historických záznamech uvádí i císař František Josef II. ji za výbornou uznal a rázem dobyla zvučného jména a rozšíření. Plody jsou středně velké až větší ( g), kulovitého tvaru. Dužnina je navinule sladká s malinovou příchutí, vynikající. Konzumní zralost říjen až listopad. Hrušně: Špinka. Velmi stará odrůda, která se pěstuje v Čechách nejméně 400 let. Plody jsou menší, kratšího kuželovitého tvaru, vynikají velmi dobrou chutí. Typickým znakem je velký otevřený kalich. Zraje postupně od poloviny srpna do začátku září. Stromy rostou velmi bujně a vytvářejí mohutné, široce jehlancovité koruny. Stromy dosahují vysokého stáří, 150 a více let. Jakubka Plod je baňatý, pravidelný, přechod do stopky výrazně zhrbolacený, barva slupky jasně zelená až žlutá, na sluneční straně načervenalá. Stopka středně dlouhá, kalich povrchový 112

113 s výskytem drobných úštů. Dužnina nažloutlá, šťavnatá, sladká hniličí. Ovoce po sklizni rychle dozrává. Nachází se ve starých zahradách. Knížatka Plody jsou protáhlého lahvicového tvaru, slupka světlezelené barvy s výrazným tečkováním., na sluneční straně plodu se nachází jasně červené líčko. Stopka je dlouhá, tenká. Kalich povrchový pootevřený. Úšty jsou tenké drobné. Dužnina je bělavá, velmi šťavnatá, chutná, po dozrání hniličí. Vysazovala se do zahrad v blízkosti domu, (obr. 3). 4. Inventarizace pěstování kořeninových a léčivých plodin a minoritních zelenin Při studiu literárních pramenů je uváděno pěstování a využívání krajových odrůd zelenin a LAKR (léčivých, aromatických a kořeninových rostlin) na území celé republiky až do období devadesátých let minulého století. Terénní průzkum v letech prováděný ve vybraných oblastech tradičně zaměřených na pěstovánízelenin a LAKR (Prostějovsko, Olomoucko a Polabí) ukázal, že velká část těchto materiálů je v současné době nahrazena komerčně dodávanými osivy a sadbou, tradiční odrůdy úplně vymizely a jsou nenávratně ztraceny. Pro potřeby konzervace a záchrany původních krajových materiálů se podařilo získat šalotku (Allium ascalonicum L.) z lokality Lešany (okres Prostějov), česnek kuchyňský (Allium sativum L.) z lokality Zákřov (okres Olomouc) agenotypy křenu z Lysé nad Labem (okres Nymburk) a Tupadly (okres Mělník). Na záchranu genofondu krajových odrůd je třeba nahlížet v širších souvislostech. Z celosvětového hlediska jde o povinnost každého národa postarat se o výsledky práce předchozích generací farmářů a šlechtitelů jako kulturní dědictví daného regionu a národa. Maxted et al. (2008) charakterizují současné nutné směrování vývoje na Zemi jednou větou: "Pro zachování dynamického environmenálního světa se stále zvyšující se populací a omezenými zdroji musíme konzervovat veškerou genetickou diversitu pro naši vlastní existenci, zabezpečení jídla a životního prostoru". Podobně Ceccarelli (2012) konstatuje, že globální potravinová bezpečnost je ohrožena vlivem klesající agrobiodiversity v kombinaci s klimatickými změnami. Nyní je ve světě pěstováno méně než 15 druhů, přičemž většina lidstva je potravinově závislá pouze na 12 plodinách. Tudíž různorodost genofondu se stává žhavým tématem dnešní doby. Závěry Analyzovaná databáze českého krajového a vyšlechtěného genofondu bude podkladem pro následnou konzervaci a vyhledávání nezvěstného a ztraceného materiálu. Terénní průzkum zajistil regionálně cenný materiál krajových odrůd ovoce, prověřil existenci a odrůdové složení vybraných sadů, alejí a roztroušených výsadeb. Přenos vybraných materiálů do ex situ výsadeb bude pojistkou pro navrhovanou in situ konzervaci - pro uchování národního dědictví starých odrůd. Dedikace Tato práce vznikla při řešení projektu Ministerstva kultury č. DF11P01OVV006. Použitá literatura Ceccarelli S Landraces: Importance and use in breeding and environmentally friendly agronomic systems. In: Maxted N., DullooM.E., Ford-Lloyd B.V., Freese L., Iriondo J., Carvalho M.A.A.P. Agrobiodiversity Conservation, CABI UK, pp Kühn F Genové zdroje místních plodin v Československu. In: Getické zdroje ve šlechtění rostlin. Sbor. Věd. Prací Celost. Konf. Praha p

114 Maxted N., Iriondo J.M., and Dulloo M.E Introduction: the integration of PGR conservation with protected area management. In: IriondoJ.M., Maxted N., and Dulloo M. E. (eds) Conserving plant genetic diversity in protected areas: Population management of crop wild relatives. CABI, Wallingsford, pp Moravec J Historie genetických zdrojů zelenin. In: Historie a současný stav práce s genofondy v ČR. Genetické zdroje 86, VÚRV Praha s Němec V., Bouma J., Amler P., Damborský F., Palán D., Tyler F., Lužný J., Zadina J., Světlík V., Moravec J. Křehlík L Almanach českého a moravského šlechtění rostlin. Českomoravská šlechtitelská a semenářská asociace, 220 s. Řiha J., Česke ovoce. Praha. Salašová, A Koncepcia krajinného plánovania. In: Koncepce uceleného krajinného plánování. Česká společnost krajinných inženýrů, s. 33. Tetera V Záchrana starých a krajových odrůd ovocných dřevin. Metodika ČSOP č. 4. Veselí nad Moravou TeteraV., Boček S., Jongepierová I., Krška B., Němec J., Pešek R., Řezníček V., Tomčala L Ovoce Bílých Karpat. ČSOP Bílé Karpaty ve Veselí nad Moravou. s. 309, ISBN Obr. 1. Mapování krajových odrůd ovocných a planých genetických zdrojů v oblasti Krkonoš Obr. 2. Nejstarší jabloň Velník, obec Křížovice Obr. 3. Krajová odrůda hrušně Knížatka Kontaktní adresa: Ing. Vojtěch Holubec, CSc. Genová banka, Výzkumný ústav rostlinné výroby v. v. i Praha 6 Ruzyně

115 KOŘENOVÝ SYSTÉM - SKRYTÁ POLOVINA ROSTLINY Plant roots the plant hidden half Středa T., Hajzler M., Chloupek O. Mendelova univerzita v Brně Abstrakt Na Ústavu pěstování, šlechtění rostlin a rostlinolékařství Mendelovy univerzity v Brně je prováděn dlouhodobý výzkum kořenového systému ve vazbě na odolnost k suchu, tvorbu výnosu a kvalitu polních plodin. V příspěvku jsou uvedeny nejvýznamnější výsledky hodnocení u pšenice, ječmene, řepky a hořčice bílé. U některých plodin byl zjištěn průkazný vztah mezi velikostí kořenového systému, výnosem zrna a kvalitou zrna. V suchém roce 2007 byla velikost kořenového systému pšenice seté průkazně korelována s výnosem odrůd (r2 = 0.285*) a s výnosem škrobu (r2 = 0.248*). Odrůdy ječmene s větším kořenovým systémem poskytly ve výrazně suchém roce průkazně vyšší výnos zrna. S využitím metody analýzy obrazu byla zjištěna průkazná negativní korelace (r = -0,46*) mezi hmotností nadzemní biomasy a prokořeněním v hloubce do 10 cm u hořčice bílé. U řepky nebyl zjištěn statisticky průkazný vztah mezi elektrickou kapacitou kořenů a výnosem semen. Klíčová slova: kořenový systém, výnos, kvalita, sucho, prostředí Abstract A long-term research of the root system parameters in connection with drought tolerance is carried out at Mendel University in Brno, Department of Crop Science, Breeding and Plant Medicine. The paper summarizes the most important founding of this research for wheat, barley, oil rape and white mustard. A statistical significant relationship between root system size (RSS) of several crops, yield and quality of grains was found out. RSS of the wheat significantly correlated with grain yield (r 2 = 0.285*) and with starch yield (r 2 = 0.248*) in dry year Barley a crop with larger root system size provide much higher yield of grain in dry years when the RSS is larger. Significant negative correlation of aboveground biomass yield of white mustard and amount of root to 10 cm depth was found out (r=-0.46*). In case of oil rape any statistically significant relationship between RSS and yield was not fond out. Key words: root system, yield, quality, drought, environment Úvod Primárním selekčním znakem při šlechtění polních plodin je výnos a kvalita produkce. Selekční zisk se však může zvýšit využitím sekundárního selekčního kritéria. Hodnotu takového selekčního kritéria lze zjistit stanovením korelace (mezi výnosem za stresu a jeho úrovní) a heritability mezi potomstvy určité populace. Preferovat je třeba sekundární kritéria, která vedou spíše k vyššímu výnosu, než k lepšímu přežití stresu (Středa et al., 2009). Na Ústavu pěstování, šlechtění rostlin a rostlinolékařství Mendelovy univerzity v Brně je ve spolupráci se šlechtitelskými podniky využívána jako sekundární selekční kritérium velikost kořenového systému. Hodnocení a selekce odrůd se uplatňuje při šlechtění ozimé pšenice, jarního ječmene i ozimé řepky. Hodnotí se odrůdy jako potenciální rodiče (i nové linie) a vybrané se rekombinují pro získání štěpící populace a výběr rostlin s heterózí v tomto znaku. Větší kořenový systém je faktorem výnosové stability, protože během suchých období může zajišťovat dostupnost vody z hlubších vrstev půdy, pokud se tam vyskytuje (Chloupek et al, 2010; Středa et al., 2012). Současně ovšem není větší velikost kořenového systému výhodou ve všech případech - pokud sucho nenastane, je zbytečnou investicí rostliny na úkor jiné translokace produktů fotosyntézy. Lze předpokládat, že význam kořenů jako osvojovacího aparátu poroste v budoucnu s rostoucí teplotou prostředí a současnou změnou distribuce srážek v průběhu roku, tak jak předpokládají klimatické modely. Větší kořenový systém 115

116 umožňuje lepší využití živin a menší kontaminaci prostředí živinami, hlavně dusíkem a fosforem. Také z těchto důvodů, v souvislosti s nitrátovou směrnicí a možným vyplavováním živin do spodních vod, jsou parametry kořenového systému předmětem zájmu i u meziplodin (Hajzler et al., 2012). Materiál a metody Kořenový systém je hodnocen na základě měření jeho elektrické kapacity (Chloupek, 1972; Bodner et al., 2008) přístrojem ELC-131D. Jednoduchá, levná a nedestruktivní metoda umožňuje změřit velikost kořenů u tisíců jedinců během jednoho dne in situ, tj. v místě růstu rostlin. Na rostlinu je připevněna jedna elektroda (kleště nebo jehla) a druhá elektroda je zasunuta asi v polovině sponu do půdy. V obvodu, kde prochází střídavý proud o frekvenci 1 khz mezi kořenovým systémem a půdou se měří elektrická paralelní kapacita. Jednu desku představuje povrch kořenového systému a druhou tvoří substrát, v němž kořeny rostou. Hodnocena je tak pouze živá část kořene, která vykazuje určitou elektrickou aktivitu na membránách, protože dochází k polarizaci živých membrán nebo živých buněk. Pro sledování architektury kořenového systému a jeho případného vlivu na tvorbu výnosu v různých podmínkách je ve spolupráci s Universität für Bodenkultur Wien používána a vylepšována metoda měření kořenového systému prostřednictvím analýzy obrazu vyplavených a naskenovaných kořenů (Dostál et al., 2008). Metoda umožňuje hodnocení kořenových charakteristik jako je délka, povrch, průměr nebo počet kořenových špiček pomocí software WinRHIZO (Régent Instruments Inc., Quebec, Kanada). Vzorky kořenů se odebírají z rostlin v různých fázích růstu (dle plodiny) během vegetace přímo na poli nebo z nádobových pokusů a z různých hloubek půdního profilu. Speciální vzorkovací tyč má průměr 63 mm a odběr byl prováděn do hloubky 60 cm. Takto získaný půdní blok byl rozdělen na 6 dílů o délce 10 cm, zamražen při teplotě -20 C a uchován k dalšímu zpracování. Po rozmražení byl blok plaven přes soustavu sít o průměru ok 1,6 a 0,6 mm. Před vlastní analýzou pomocí skeneru musí dojít k obarvení kořenů methylenovou modří. Po naskenování jsou kořeny analyzovány programem WinRHIZO a identifikovány podle intenzity zbarvení. Zjištěné údaje o celkové délce a ploše kořenového systému byly využity pro výpočet RLD (Root Lenght Density), RSD (Root Surface Density), SRL (Specific Root Lenght) (Gregory, 2006). RLD a RSD hodnotí hustotu prokořenění na jednotku objemu půdy, SRL specifikuje délku kořenového systému na jednotku jeho hmotnosti. U všech vzorků kořenového systému byla zjištěna hmotnost sušiny. Data byla statisticky zpracována ANOVA and post hoc LSD test in program Statistica version 9 (StatSoft Inc., Tulsa, UK). Korelační koeficienty byly spočítány dle Chloupek (1996), který uvádí jako nejvhodnější korelační koeficient r zbytek (rz). Tento koeficient vznikl z jednotlivých údajů po odstranění efektů odrůd a prostředí. V průběhu celé vegetace je na pokusných plochách monitorována vlhkost půdy elektromagnetickými TDT senzory VIRRIB s dataloggerem. Čidla registrují objemovou vlhkost půdy a umožňují přesně kvantifikovat nástup a intenzitu případného půdního sucha (vyjádřeno jako bod snížené dostupnosti vody pro rostliny 60 % využitelné vodní kapacity a méně). Výsledky a diskuze Hodnocení parametrů kořenového systému pšenice seté Velikost kořenového systému odrůd pšenice ozimé (20, 20, 20 a 18 odrůd v letech 2007, 2008, 2009 a 2010) byla hodnocena metodou měření elektrické kapacity. Výsledky byly korelovány s výnosem a kvalitou zrna z pokusů na stanicích ÚKZÚZ (20, 22, 23 a 23 stanic v letech 2007, 2008, 2009 a 2010). Pro srovnání byly použity výsledky z low i high input vyrianty ÚKZÚZ a také výnosové a kvalitativní výsledky z varianty pozdního setí a s použitím různých předplodin. Velikost kořenového systému byla nejvíce ovlivněna lokalitou 116

117 její vliv činil 2,6 15,6 % proměnlivosti velikosti kořenového systému. V suchém roce 2007 byla velikost kořenového systému průkazně korelována s výnosem odrůd (r 2 = 0.285*) a s výnosem škrobu (r 2 = 0.248*) na všech stanicích. V roce 2008 byla negativní korelace (r = *) mezi velikostí kořenového systému a výnosem zrna na třech stanicích s nejnižší nadmořskou výškou a s nejvyšší teplotou. V roce 2009 byla velikost kořenového systému a výnos zrna statisticky průkazně korelována (r 2 = 0.391**) na pěti stanicích s výskytem sucha. Ve vlhkém roce 2010 nebyl zjištěn průkazný vztah v žádné variantě. Tři odrůdy s největší velikostí kořenového systému měly v průměru o 21 % větší kořenový systém než tři odrůdy s nejmenším kořenovým systémem. Výnos zrna byl v roce 2007 u těchto odrůd s velkým kořenovým systémem o 420 kg.ha -1 vyšší. Tab. 1 Vztah mezi průměrnou velikostí kořenového systému skupin odrůd a výnosem a kvalitou z dvaceti lokalit ÚKZÚZ v roce 2007 Skupina/Počet Vel. koř. syst. (nf) Výnos zrna Obsah (%) Výnos (t.ha -1 ) odrůd Rozpětí Průměr (t.ha -1 ) N-látek Škrobu N-látek Škrobu I/ II/ III/ Hodnocení parametrů kořenového systému ječmene setého Vztah mezi velikostí kořenového systému, výnosem zrna, kvalitou zrna v souvislosti s tolerancí odrůd k suchu byl hodnocen v letech Velikost kořenového systému byla měřena u odrůd jarního ječmene na dvou lokalitách. Ke srovnání s výnosovými a kvalitativními parametry zrna byly použity výsledky ÚKZÚZ ze 7 19 stanic. Odrůdy s větším kořenovým systémem poskytly ve výrazně suchém roce 2007 průkazně vyšší výnos zrna. Sladovnické odrůdy s větším kořenovým systémem měly průkazně vyšší obsah škrobu, sladového extraktu a vyšší výnos bílkovin. Je tak možno říci, že menší kořenový systém odrůd ječmene může v suchých letech způsobovat menší výnos zrna a nižší sladovnickou kvalitu. Skupina/Počet odrůd Vel. koř. syst. (nf) Obsah (%) Výnos zrna Rozpětí Průměr (t.ha -1 ) Bílkoviny Škrob 117 Sladový extrakt I/5 4,64 5,02 4,78 5,31 11,72 63,5 81,7 II/6 5,04 5,18 5,12 5,63 11,38 64,2 82,2 III/5 5,19 5,50 5,28 5,79 11,34 64,1 82,5 Korelace s velikostí kořen. systému 0,822** -0,475 0,635** 0,503* Hodnocení parametrů kořenového systému hořčice bílé V pokusu byla hodnocena velikost kořenového systému osmi odrůd hořčice bílé (Sinapis alba L.). Dvouletý pokus (2010 a 2011) byl realizován na dvou agroekologicky výrazně odlišných lokalitách: Troubsko řepařská výrobní oblast a Horní Třešňovec obilnářská výrobní oblast. Nebyl zjištěn statisticky průkazný vztah mezi velikostí kořenového systému a množstvím nadzemní biomasy. Sledován byl také vztah mezi velikostí kořenového systému a obsahem NO 3- a NH 4+ iontů v půdě po sklizni. Byla zjištěna negativní závislost RSS na množství odebraného nitrátového dusíku z půdy. Tato závislost však nebyla statisticky průkazná. Při hodnocení napříč lokalitami byla pozorována korelace hmotnosti nadzemní biomasy s množstvím zůstatkových nitrátových iontů (r = 0,54). V Troubsku byla pozorována průkazná negativní korelace RSS s obsahem amonných iontů (r = -0,81*). S využitím metody analýzy obrazu byla zjištěna průkazná negativní korelace (r = -0,46*) mezi hmotností nadzemní biomasy a prokořeněním (RLD) v hloubce do 10 cm. Možný je vliv

118 strategie investice do morfologických struktur, které zajistí lepší přístup k omezeně přístupnému růstovému faktoru (teorie Wilson, 1988). Hořčice v úrodné půdě produkovala více nadzemní biomasy na úkor kořenového systému. Zjištěna byla vysoce průkazná negativní korelace (r = -0,632**) mezi SRL a nadzemní biomasou. Vysoce průkazný byl korelační koeficient mezi SRL a RLD (v hloubce 0-20 cm), (r= 0,524**). Lze tak usuzovat na pozitivní vztah mezi hustotou prokořenění a jemností kořenového systému. Hodnocení parametrů kořenového systému řepky olejné Pokusy s odrůdami řepky ozimé byly založeny v roce 2008/2009 u Opavy v řepařské výrobní oblasti, na středně těžké hlinité půdě v nadmořské výšce 273 m n. m. Bylo hodnoceno devět odrůd ve třech opakováních. Sledované odrůdy byly pěstovány v odrůdových pokusech v systému s nižší intenzitou vstupů (bez fungicidního ošetření). Rostliny řepky ozimé byly měřeny třikrát během vegetace. První měření bylo na podzim ve fázi listové růžice, druhé měření během butonizace a třetí v plném květu. Z výsledků měření byly zjištěny odrůdové rozdíly ve velikosti kořenového systému ve všech třech termínech měření. Byly zjištěny průkazné korelace mezi termíny měření. Mezi prvním a druhým termínem byla korelace statisticky nevýznamná r = 0,106. První a třetí termín byl statisticky významně korelován r = 0,455* (21 % z celkové proměnlivosti), mezi druhým a třetím termínem byla zjištěna významná korelace r = 0,412* (17 % proměnlivosti). Zjištěn byl negativní vztah elektrické kapacity kořenů a výnosu řepky, což naznačují i korelační koeficienty pro jednotlivé termíny měření -0,175; -0,183 a -0,085. Koeficienty jsou velmi nízké a nejsou statisticky průkazné. Z dosažených (jednoletých) výsledků lze usuzovat, že na úrodnějších půdách anebo v období, kdy rostliny nejsou stresovány suchem je velký kořenový systém nevýhodou a spotřebovává asimiláty, které mohou být využity pro tvorbu výnosu. Výsledky hodnocení velikosti kořenového systému u řepky mohou být ovlivněny charakterem kořenu řepky (kůlový kořen s tendencí k dřevnatění). Pro řepku je tak tato metoda pouze omezeně použitelná. Závěr Uvedené výsledky prokázaly, že vhodným selekčním kritériem u obilnin pro suché podmínky byla velikost kořenového systému, měřená podle jeho elektrické kapacity. Odrůdy s větší velikostí kořenového systému poskytly vyšší výnos a obsahovaly více fotosyntátů a méně dusíkatých látek, jak tomu bývá při závlaze v suchých podmínkách. Je pravděpodobné, že selekce na větší velikost kořenového systému by mohla v nehumidním prostředí ročníků a lokalit zvýšit výnos extraktu a škrobu a byla by tedy vhodná např. pro šlechtění na produkci bioethanolu. Každé nové selekční kritérium zpočátku rychle zvětšuje proměnlivost a proto je také ohlas na selekci na nové selekční kritérium poměrně (ve srovnání s jinými selekčními kritérii) rychlý. Metoda digitální analýzy obrazu poskytuje relevantní údaje o intenzitě prokořenění v jednotlivých vrstvách půdy. Při hodnocení hustoty prokořenění obilnin bylo nalezeno průměrně 70 % kořenového systému rostlin ve vrstvě 0 20 cm, což odpovídá výsledkům studií prováděných jinými autory. Ojediněle na některých lokalitách a letech byla zaznamenána změna distribuce kořenů ve vertikálním profilu s vyšším podílem biomasy v nejhlubších vrstvách půdy. Lze se domnívat, že kořenový systém takto pružně reaguje na změny v půdních horizontech nebo na systém zpracování půdy. Konfrontací dvou metod měření velikosti kořenového systému metodami měření elektrické kapacity a digitální analýzy obrazu (v zahraničí zpravidla referenční metoda), byla zjištěna dobrá shoda výsledků. Metodu měření elektrické kapacity tak lze doporučit jako rychlou a levnou metodu stanovení meziodrůdových diferencí velikosti kořenového systému. 118

119 Dedikace Práce vznikla s podporou projektu NAZV QI111C080 Zpřesnění dostupné zásoby vody v půdním profilu na základě modelu kořenového systému plodin pro efektivní hospodaření s vodou a dusíkem. Použitá literatura Bodner, G., Středa, T., Dostál, V., Chloupek, O., Kaul, H. Bestimmung der Wurzelsystemgröße von Winterweizen: Anwendung und Interpretation einer elektrischen in-situ Methode. In ALVA Tagung, Ernähren uns in der Zukunft Energiepflanzen? Raumberg-Gumpenstein: ALVA (Hrsg.), 2008, s Dostál, V., Středa, T., Chloupek, O., Bodner, G. Metody pro hodnocení velikosti kořenového systému u ječmene jarního (Hordeum vulgare L.). In 16. Posterový deň s medzinárodnou účasťou a Deň otvorených dverí na ÚH SAV "Transport vody, chemikálií a energie v systéme pôda-rastlina-atmosféra". Bratislava: ÚH a GFÚ SAV, Bratislava, 2008, s , CD ROM. Gregory, P. J. Plant roots, growth, activity and interaction with soils. 2006, Blackwell Publishing, Oxford, p Hajzler, M., Klimešová, J., Středa, T. Biomass production of white mustard (Sinapis alba L.) varieties in relation to the root system size. In 62. Tagung der Vereinigung der Pflanzenzüchter und Saatgutkaufleute Österreichs. Raumberg-Gumpenstein: Lehr- und Forschungszentrum für Landwirtschaft, 2012, s Chloupek, O. The relationship between electric capacitance and some other parameters of plant roots. Biologia Plantarum, 1972, 14, Chloupek, O.: Zemědělský výzkum. Praha: Academia, s. Chloupek, O., Dostál, V., Středa, T., Psota, V., Dvořáčková, O. Drought tolerance of barley varieties in relation to their root system size. Plant breeding sv. 129, č. 6, s Středa, T., Dostál, V., Chloupek, O., Bodner, G. Šlechtění a výběr odrůd obilnin s větší tolerancí k suchu. Úroda sv. LVII, č. 5, s Středa, T., Dostál, V., Horáková, V., Chloupek, O. Effective use of water by wheat varieties with different root system sizes in rain-fed experiments in Central Europe. Agricultural Water Management sv. 104, č. 2, s Wilson, J. B. A review of evidence on the control of shoot:root ratio, in relation to models. Annals of Botany. Vol p Kontaktní adresa: Ing. Tomáš Středa, Ph.D. Mendelova univerzita v Brně, Ústav pěstování, šlechtění rostlin a rostlinolékařství Zemědělská 1, , Brno 119

120 120

121 HODNOCENÍ ÚČINNOSTI SEPARAČNÍHO ZAŘÍZENÍ PRO SEPARACI JADER Z HROZNŮ The Classification of Efficiency by Separator for Seeds Separation from Grape Pomace Burg P., Zemánek P. Ústav zahradnické techniky, Zahradnická fakulta, Mendelova univerzita v Brně Abstrakt Příspěvek se zabývá návrhem a ověřením účinnosti separačního zařízení s pasivními poloválcovými síty při separaci vinných jader potřebných pro lisování vinného oleje. Pro úvodní experiment byly navrženy 3 varianty sít s otvory o rozdílného tvaru a velikosti. Dílčí výsledky získané při ověřování účinnosti separačního zařízení nelze v současné fázi považovat za uspokojivé. V jádrech odseparovaných na sítech s rozdílným tvarem i velikosti otvorů byl ve všech případech poměrně vysoký podíl nečistot (slupek). Vysoké byly rovněž ztráty jader, které během separace nebyly odloučeny. Klíčová slova: vinařství, semena révy vinné, separace jader Abstract The contribution deals with the design and verification of the effectiveness of separation the equipment with passive semi cylindrical sieves. The equipment was monitored during the grape seeds separation for pressing grape seed oil. For the initial experiment were designed three variants of sieves with apertures of different shapes and sizes. Partial results obtained during verifying of the effectiveness of separation equipment can t be, at this stage, regarded as satisfactory. In the obtained material (seeds) separated on sieves with different shape and size of holes was in all cases relatively high proportion of impurities (grape skins). Also seeds losses were relatively high, lot of seeds weren t separated. Key words: viniculture, grape seed, seed separation Úvod V souladu s nejnovějšími principy odpadového hospodářství uplatňovaného v rámci EU jsou prioritně hledány nové bezodpadové technologie. Pozornost je tak v několika posledních letech zaměřena také na možnosti efektivního využití matolin. Z pohledu odpadového hospodářství představuje matolina druhotný biotický odpad produkovaný v sektoru FDM (Food Drink Milk). Matolina je tvořena zbytky dužnin, slupek, jader, popř. i třapin, které společně představují přibližně čtvrtinu hmoty vinných hroznů (Arvanitoyannis a kol., 2006). Také Schieber a kol. (2001), Baydar a kol. (2007) uvádějí, že z celkového množství zpracovávaných hroznů činí podíl matolin v závislosti na odrůdě, stupni zralosti, použitém lisovacím zařízení, počtu lisovacích cyklů aj % o objemové hmotnosti kg.m -3. Matoliny jsou významným zdrojem bioaktivních látech, obsahujících mimo jiné polyfenolické látky nebo vitamin E s bohatým zastoupením tokotrienolů Anastasiadi et al. (2010). Matolinu je možné zpracovávat kompostováním, extrakcí na olej, nebo ji lze využít pro oddělení vinných jader s jejich následným lisováním na olej (Zemánek, 2009, Russ a kol., 2004). Poslední z jmenovaných technologií není doposud v podmínkách ČR uplatňována, výzkum směřuje hledání možností technického zajištění tohoto procesu, protože na trhu vzrůstá poptávka po oleji z vinných jader i ostatních produktech vyrobených z pokrutin, které představují odpadní produkt po lisování např. mouka, hořčice, těstoviny, palivové peletky aj. Trainor (2005). 121

122 Olej z vinných jader má vysoký obsah esenciálních mastných kyselin a tetrafenolů. Pro své dietetické hodnoty je zajímavou surovinou využívanou v gastonomii i farmacii. Protože je svým charakterem polovysýchavý, je o něj zájem i v kosmetice a při výrobě alkydových pryskyřic, do barev a fermeží (Žufánek, 1998, Rubio a kol., 2009). Většímu využití této netradiční suroviny brání skutečnost, že matolina představuje odpad vinařského průmyslu, který pro další zpracování (lisování vinných jader) vyžaduje úpravu (separaci, sušení) prováděnou pokud možno přímo ve vinařských podnicích, které však pro tuto činnost nejsou vybaveny potřebnými zařízeními ani potřebnou výrobní kapacitou (Boulton a kol., 1999). Cílem práce byl návrh a ověření účinnosti separačního zařízení s pasivními poloválcovými síty při separaci vinných jader potřebných pro lisování vinného oleje. Materiál a metody Výběr stroje pro realizaci úpravy Na základě studia dostupných zařízení, s ohledem na rozsah experimentálních prací a na požadavky výkonnosti byl vybrán pro realizaci úprav mlýnkoodstopkovač typ ARNO-15 (celkové rozměry 1200x600x850 mm; elektropohon 220 V/1,4 kw). Zařízení je tvořeno násypkou doplněnou ve spodní části o šnekový dopravník, který umožňuje snadnější transport zpracovávaného produktu. Přístup do pracovního prostoru je řešen tak, že umožňuje výměnu sít a instalaci záchytného zařízení pro podsítnou frakci. Toto konstrukční řešení umožňuje rychlé a snadné čištění sít, to znamená výhodu při realizaci plánovaných experimentů. Návrh úpravy 3 varianty sít Pro experiment byly navrženy 3 varianty sít s otvory o rozdílného tvaru a velikosti (var.a otvory štěrbinové 4 x 12 mm, var.b otvory kruhového tvaru o průměru 5 mm kolmé k podélné ose síta, var.c otvory kruhového tvaru o průměru 5 mm souběžné s podélnou osou síta), které byly odvozeny z dosavadních zkušeností a úvodních měření (granulometrická měření, experimentální síta aj.). Síta byla zadána do výroby v měsíci VII., úprava se realizovala v měsíci IX. Nad poloválcovým sítem je umístněna rotující hřídel opatřená rozšířenými lopatkami rozmístněnými ve šroubovici. Počet otáček hřídele činí 500 za minutu. Lopatky se pohybují těsně po vnitřním povrchu síta a napomáhají posouvání separovaného produktu event. protláčení vinných jader přes otvory v sítě. Nadsítná frakce odchází po povrchu síta a vypadává v jeho zadní části, podsítná frakce je soustředěna ve spodní části odstopkovače do záchytné vany. Ověření variant Experiment navázal na separaci semen odrůdy Frankovka a byl v termínu od zaměřen na separaci semen z odrůdy Zweigeltrebe s objemovou hmotností 510 kg.m -3 a vlhkostí 36 %, která byla získána po vylisování hroznů v pneumatickém lisu VASLIN při maximálním pracovním tlaku 1,6 baru. Pro potřeby separace bylo odváženo 50 kg matolin pro každé z opakování. Účinnost separace byla ověřována u obou typů sít celkem ve třech opakováních (3 x 50 kg). Po provedení separačního zásahu bylo provedeno vyhodnocení podílu podsítné frakce (tvořena odseparovanými semeny s podílem zbytků slupek) granulometricky. Podíl jader a slupek ve sledovaném vzorku matolin (odrůda Zweigeltrebe) byl u kontrolního vzorku stanoven rozborem na vibračních laboratorních sítech s průměrem ok 6 2 mm. To 122

123 umožnilo vyčíslit podíl jader pro 100 % čistotu separace. S touto hodnotou byly poté porovnávány výsledky ostatních vzorků. Z podsítné frakce byly odebrány směsné vzorky o hmotnosti 250 g, u kterých byla na vibračních laboratorních sítech s průměrem ok 6 2 mm hodnocena hmotnost jader a slupek. Výsledky a diskuze Proces ověřování účinnosti separačního zařízení s pasivními poloválcovými síty při separaci vinných jader byl realizován ve 3 opakováních a získané výsledky v každé variantě jsou zpracovány v Tab. 1 a Tab. 2. Tab. 1: Výsledky měření Kontrolní vzorek (granulometricky) Varianta - síto Hmotnost jader (g) - 74,1 100 Čistota (%) separace A 54, opakování B 40,0 54 C 53,9 73 A 55, opakování B 41,5 56 C 57,0 77 A 56, opakování B 38,9 52 C 56,5 76 Pozn.: var.a: otvory štěrbinové 4 x 12 mm, var.b: otvory kruhového tvaru o průměru 5 mm kolmé k podélné ose síta, var.c: otvory kruhového tvaru o průměru 5 mm souběžné s podélnou osou síta Ověřovaný princip ukazuje vyšší podíl jader v podsítné frakci u síta A a C, jádra však nejsou odseparována úplně, propad vykazuje podíl slupek. Čistota separace dosahuje %. Tab. 2: Celkové vyhodnocení Pokusná varianta 1. opakování 2. opakování 3. opakování Průměr Směrodatná odchylka síto A 54,3 55,4 56,2 55,3 0,95 síto B 40,0 41,5 38,9 40,1 1,31 síto C 53,9 57,0 56,5 55,8 1,66 K vyhodnocení průkaznosti rozdílů mezi hodnocenými variantami pokusu byla použita analýza variance (hladina významnosti α=0,05). Jako metoda následného testování byl použit Tukeyův HSD test na hladině významnosti α=0,05. Uvedené metody statistického vyhodnocení byly aplikovány pomocí počítačového softwaru Unistat 4.53 pro Excel a MS Excel (Tab.3 a Tab.4). 123

124 Tab. 3: Analýza rozptylu klasicky uspořádaný experiment Zdroj Součet Stupně Průměrný Stat F Významn. variability čtverců volnosti čtverec Hlavní efekty 475, , ,554 0,0000 S1 475, , ,554 0,0000 Vysvětleno 475, , ,554 0,0000 Chyba 10, ,794 Celkem 486, ,811 Z výsledků statistického vyhodnocení (Tab.3) vyplývá, statistická průkaznost vlivu velikosti a tvaru otvorů u sít na účinnost separačního zásahu. Tab. 4: Následné testování 95 % Tukey-HSD test Skupina Příp Průměr B A C B 3 40,1333 * * A 3 55,3000 * C 3 55,8000 * Pozn: * označuje významně odlišné páry Obr. 1: Experimentální zařízení (po vytažení síta) Dílčí výsledky získané při ověřování účinnosti separačního zařízení s pasivními poloválcovými síty při separaci vinných jader nelze v současné fázi považovat za uspokojivé. V jádrech odseparovaných na sítech s rozdílným tvarem i velikosti otvorů byl v obou případech poměrně vysoký podíl nečistot (slupek). Vysoké byly rovněž ztráty jader, které během separace nebyly odloučeny. Teoretickým rozborem procesu separace vinných jader se v zahraničí zabýval např. Plíva, Jelínek (1999), Baydar a kol. (2007). Z výsledků jejich studií vyplývá, že lze vlastní separaci jader z matoliny provádět na sítech, aspirátorech, či pneumatických odlučovačích, rotačních třídičích nebo kombinovaných čističkách na základě stejných principů jako u obilovin. Rozborem matoliny a separací jader se aktuálně zabýval např. Dědina (2010). Prováděl rozbor matoliny na rovinných sítech. Využíval při něm sít s průměrem ok 2, 3,5 a 5 mm, ovšem pro separaci používali již vysušené matoliny s obsahem vysušených vinných jader. Z výsledků 124

125 jejich měření shodně vyplývá, že byl největší podíl jader zachycen na sítech s průměrem ok 3,5 mm. Otázkou separace vinných jader na laboratorních sítech zabýval také Trainor (2005). Z výsledků jeho experimentálních měření vyplývá, že na sítech s průměrem ok 5 a 6 mm dochází k hrubé separaci jader, kdy se odstraní převážná většina slupek, případných zbytků dužniny a třapin. Největší podíl jader zůstává soustředěn na sítě s průměrem ok 3,5 mm. Využití vinných jader pro výrobu olejů je závislé především na technologických možnostech dodavatelů, zpracovatelů a na celkových objemech, které by bylo možno získat (Wiemer a kol., 2005). Proto je nutno před dalšími úvahami o realizaci tyto otázky vyjasnit. Ze statistických údajů je zřejmé, že v ČR se ročně ve velkých vinařských závodech zpracovává cca t vinných hroznů, což představuje t nesušených jader tj t suchých jader. Z tohoto množství se dá při optimální výtěžnosti získat 290 t surového oleje. I když se zatím nepodařilo zjistit, jakou část dovozu může tato kapacita pokrýt, je zřejmé, že výzkum jak separace jader, tak vlastního lisování, může přinést producentům vína další činnost, která se vyplatí jak z ekonomického, tak i ekologického hlediska. Závěr Z výsledků vyplývají možnosti zaměření experimentů pro separaci v dalším období: a) hledat tvar a velikost otvorů síta pro maximální zvýšení podílu jader v propadu b) ověřit účinnost 2stupňové separace uplatněním 2 různých sít s cílem dosáhnout maximální čistoty separace c) navrhnout a realizovat úpravu zařízení pro snížení otáček lopatkového hřídele d) hledat jiný způsob separace s vyšší účinností Sledovaný způsob využití upraveného malého (středního) odstopkovače hroznů pro separaci jader jednoduchou výměnou síta (nebo 2 sít) má význam pro možnost lokálního zpracování matolin (získání jader) u malovinařů. Ti mohou v budoucnu vnímat možnost prodeje jader jako prostředek zlepšení efektů při pěstování a zpracování hroznů. Dedikace Příspěvek vychází z řešení výzkumného projektu QI 111B107 Výzkum získávání a využití biologicky aktivních látek (BAL) ze semen vinných hroznů pro zlepšení metabolismu hospodářských zvířat jako podklad pro návrh nejlepší dostupné techniky (BAT). Použitá literatura Anastasiadi M., Pratsinis H., Kletsas D., Skaltsounis A-L., 2010: Bioactive non-coloured polyphenols content of grapes, wines and vinification by-products: Evaluation of the antioxiadant activities of their extracts. Food Research International, 43: Arvanitoyannis, I.S., Ladas, D., Mavromatis, A., 2006: Potential uses and applications of treated wine waste. a review. International Journal of Food Science and Technology 41, Baydar N. G., Özkan G., Çetin E. S., 2007: Characterization of grape seed and pomace oil extracts. Grasas y aceites, 58: Boulton, R.B., Singleton, V.L., Bisson, L.F., Kunkee, R.E., Principles and Practices of Winemaking. Kluwer Academic/Plenum Publishers, New York. Dědina, M., 2010: Separace vinných jader v laboratorních podmínkách. Periodická zpráva. Praha: VÚRV. 12 s. Plíva P., Jelínek A., 1999: Vinný olej- žádaná surovina na trhu. Agromagazín, 3/1:

126 Rubio M., Álvarez-Orti M., Pardo J. E., 2009: A review on the utilization of grape seed oil as an alternative to conventional edible vegetable oils. La rivista italiana delle sostanze grasse, 84: Russ, W., Meyer-Pittroff, R., Utilizing waste products from the food production and processing industries. Critical Reviews in Food Science and Nutrition 44, Schieber A., Stintzing F.C., Carle R., 2001: By-products of plant food processing as a source of functional compounds- recent developments. Trends in food science and technology, 12: Trainor, P., 2005: Study of Techniques in Separation of Grape Seed for Mass Production of Cold Pressed Grape seed Oil. ISS Institute, Depart. of Education, Science and Training, Australia, 25 p. Wiemer et al., 2005: Small Scale Processing of Oilfruit and Oilseeds. Deutsche Gesellschaft fur Technische Zusammenarbeit. pp Zemánek, P., 2001: Využití technických prostředků při kompostování zbytkové biomasy, Habilitační práce, Zahradnická fakulta MZLU Brno, červen 2001, 231s. Žufánek, J., 1998: Bilance zdrojů biologických odpadů ve vinohradnictví a ovocnictví. Sborník z mezinárodní konference "Ekologické aspekty výzkumu, vývoje a provozu zahradnické techniky", konané u příležitosti setkání kateder a ústavů VŠ a výzkumných pracovišť v Lednici 23. a , s Kontaktní adresa: doc. Ing. Patrik Burg, Ph.D., Ústav zahradnické techniky, Zahradnická fakulta, Lednice MENDELU v Brně, CZ 126

127 PŘEDPOVĚĎ MIKROBIOLOGICKÉ KVALITY POTRAVIN POMOCÍ MODELOVÁNÍ RŮSTU PATOGENŮ - LISTERIE Prediction of microbiological quality of foods by mathematical modeling of the pathogens grow Listeria Erban V., Eichlerová E., Landfeld A., Čírtková V., Houška M. Výzkumný ústav potravinářský Praha, v. v. i. Abstrakt Cílem práce bylo vytvořit matematický předpovědní model růstu různých kmenů Listerií, za různých podmínek prostředí ( teplota, vodní aktivita a ph) Klíčová slova: matematický předpovědní model, Listeria, podmínky prostředí Abstract The goal of this study was formation of mathematical predictive model of growing various Listeria under influence various surroundings as temperature, water activity and ph Key words: mathematical predictive model, Listeria, conditions of surroundings Úvod Jako u všech mikroorganismů jsou podmínky růstu dány jednak zdrojem živin a jednak fyzikálně chemickými podmínkami prostředí. Listerie svými fyziologickými charakteristikami růstu, vysokou adaptabilitou na prostředí a specifickou patogenitou kmene L.monocytogenes jsou významným rizikem pro zdravotní bezpečnost potravin. Materiál a metody Pro studium podmínek růstu Listerií je nutné porovnávat jejich růstové parametry za různých podmínek prostředí. Tyto parametry jsou klíčovou odpovědí na nebezpečí růstu Listerií v konkrétním výrobku za konkrétních provozních a skladovacích podmínek. Vytváření modelů se skládá z následujících kroků: 1. Odhad rozsahu fyzikálních podmínek růstu (ph, Aw a teplota). 2. Naměřit soubor růstových křivek (primární modely). 3. Ze souboru primárních modelů se vytváří sekundární modely, které charakterizují fyziologické vlastnosti mikroorganismu (lag fáze, rychlost růstu, maximální nárůst a další fyziologické charakteristiky) 4. Vytvoření vlastního matematického modelu (terciárního modelu) 5. Na základě tohoto modelu jednak hodnotit adaptační schopnosti modelového organismu a vytipovat kritické oblasti, ve kterých je nutné hodnotit získané izoláty tak, aby bylo možné zjistit, zda různé izoláty mají i různé fyziologické charakteristiky a tím i různou míru nebezpečí pro výrobek ve kterém se vyskytují. Na základě výchozích úvah byly měřeny růstové křivky v mediu tryptose phosphate broth TPB (Oxoid). Při přípravě medií bylo vycházeno z dvojnásobné koncentrace surovin, které byly upravovány na vhodnou hodnotu aktivity vody Aw pomocí přídavku solí. Konečná Aw 127

128 ,94 0,96 0, OD wideband GT[hod] Úroda 12/2012, vědecká příloha časopisu byla kontrolována měřením. Poté byla media rozdělena na alikvotní objemy upravené pomocí HCl a NaOH na požadované ph. Hotová media byla sterilována 15min při 121 C. Médium bylo rozplněno do mikro destiček po 0,2ml, inokulováno 1% různých kmenů Listeria. Inkubace probíhala v Bioscreenu za nepravidelného třepání při širokopásmové vlnové délce, odečty optické denzity OD probíhaly jednou za hodinu. Výsledky a diskuze Primární modely (obr. 1) jsou souhrnem růstových křivek mikroorganismu při různých fyzikálních podmínkách prostředí. Obr. 1: Ukázka primárního modelu Recalculated OD values G. curves L.i.; Aw=0,998;30 C 0,800 0,700 0,600 0,500 0,400 0,300 0,200 0,100 0, , , , ,5 Experiment name Sample short name 0,700-0,800 0,600-0,700 0,500-0,600 0,400-0,500 0,300-0,400 Time (hours) 0,200-0,300 0,100-0,200 0,000-0,100 Obr. 2: Ukázka sekundárního modelu pro teplotu 30 C mingt Aw ph 43:12:00 38:24:00 33:36:00 28:48:00 24:00:00 19:12:00 14:24:00 9:36:00 4:48:00 0:00:00 38:24:00-43:12:00 33:36:00-38:24:00 28:48:00-33:36:00 24:00:00-28:48:00 19:12:00-24:00:00 14:24:00-19:12:00 9:36:00-14:24:00 4:48:00-9:36:00 0:00:00-4:48:00 Na základě těchto primárních modelů je možné vytvořit sekundární modely (Obr.2), které vyjadřují fyziologické charakteristiky MO (lag fáze, rychlost růstu, maximální nárůst a další fyziologické charakteristiky). I tyto modely však vyjadřují danou charakteristiku pouze pro jednu teplotu. Matematické modely Vzhledem ke značnému množství dat a obtížné orientaci v přehledových grafech s malou přesností odečtu byl po statistickém vyhodnocení vytvořen matematický model růstu pro každý kmen Listerie. Pro odhad růstu patogenů slouží počítačové terciární modely předpovědní mikrobiologie (PM). Jejich podstatou je matematický popis růstu počtu mikrobů v potravinách za specifických podmínek prostředí, které zahrnuje vnitřní faktory (ph, a w ) a vnější, faktory, (teplota, inhibiční látky). K inhibici růstu patogenů dochází i při kombinaci těchto faktorů, z nichž žádný sám o sobě nemá dostatečnou úroveň samostatné inhibice. Matematické modely nejlépe zajišťují dosažení realistické předpovědi růstu mikroorganismu při různé kombinaci těchto faktorů. Byl vytvořen Excelový soubor, ve kterém se zadá teplota, Aw, ph, čas pro který má být spočtena OD, a výchozí OD. Model nabízí hodnotu OD k zadanému času, dobu lag fáze, čas, kdy je růst kultury nejrychlejší, dobu zdvojení OD kultury a maximální nárůst OD až pro 6 Gompertzův růstový model křivek zároveň. Pro modely byl použit Gompertzův růstový model s parametry A, B, C a M, (Tabulka 1) log(od) = A + C.exp(-exp (-B.(t-M))) Z těchto parametrů matematického modelu je možné spočítat parametry růstových křivek pomocí A parametr následujících Gompertzova vztahů:trvání modelu - inoculum fáze lagu (TFL) = M - [ 1/B]. Exponenciální log (OD) růstová rychlost B parametr (ERR)=BC/e. Gompertzova Generační modelu čas růstová (GT)=Log rychlost 10 (2) e/bc) (McMeekin log T.A. (OD)/t a spol. 1993) Z důvodu C parametr velkého Gompertzova počtu dat modelu bylo maximální využito přírůstek makro ve (ODVBA max -Od o ) pro výpočet log nelineární (OD) regrese v rámci M parametr Excelu. Gompertzova Byly tak určovány modelu čas parametry maximální růstové Gompertzova rychlosti modelu B, C a t M pro každou 128

129 růstovou křivku (viz označení). Parametry B, C, M pak byly korelovány k teplotě, aktivitě vody a ph Vztahy byly použity při tvorbě matematického modelu růstu Listeria monocytogenes a Listeria innocua. Získané parametry B, C a M (Parametr A byl zvolen -1 pro všechny růstové křivky) byly použité pro výpočet zjednodušených kvadratických modelů v transformaci přirozených logaritmů pro Gompertzovy parametry B, M a C použité pro předpověď TFL, ERR a GT, tak jak jsou ovlivněny teplotou, ph a Aw pro každý kmen rostoucí v BHI. Tabulka 1: Tabulka ovládání předpovědního růstového modelu Růstový model L. monocytogenes 2219: (platnost modelu: a w = < 0,92-0,98 >, ph = < 4,5-6,5 >, t = < 5-37 C >) Přepočítej tabulku Vytvo ytvoř ř graf teplota ( C) a w (-) ph (-) čas (hodiny) výchozí OD OD (v čase) lagfáze (hodiny) čas do GT (hodiny) GT (hodiny) ODmax 25 0,92 6,5 48 0,1 0,50 32,17 35,67 3,97 0, , ,1 0,58 29,37 32,58 3,41 0, ,92 5,5 48 0,1 0,50 26,44 29,76 3,87 0, , ,1 0,33 23,29 27,18 6,19 0, ,92 4,5 48 0,1 0,16 19,20 24,83 22,02 0,16 Získané modely byly použity pro porovnání růstu jednotlivých kmenů L. mon. a L. inn. Byla zvolena kritická hodnosta růstu při Aw = 0,92, při různých ph a teplotě 25 C. Pro každý kmen byly vygenerovány růstové křivky při zvolených parametrech a ty byly následně porovnávány (Graf č. 1, 2, 4, 5, 6, 7 a 8). Inokula byla použita se stejnou historií Graf č. 1: Růstové křivky L. monocytogenes 2219 při 25 C, Aw = 0,92, a ph = 4,5-6,5 Graf č. 2 Růstové křivky L. monocytogenes 2182 při 25 C, Aw = 0,92, a ph = 4,5-6,5 Graf č. 3: Modelové růstové křivky L. monocytogenes 2023 při 25 C, Aw = 0,92, a ph = 4,5-6,5 Graf č. 4: Modelové růstové křivky L. monocytogenes 2002 při 25 C, Aw = 0,92, a ph = 4,5-6,5 Graf č. 5: Modelové růstové křivky L. monocytogenes 1225 při 25 C, Aw = 0,92, a ph = 4,5-6,5 Graf č. 6: Modelové růstové křivky L. innocua 4549 při 25 C, Aw = 0,92, a ph = 4,5-6,5 Graf č. 7: Modelové růstové křivky L. innocua 4030 při 25 C, Aw = 0,92, a ph = 4,5-6,5 129

130 Z porovnání maximálních hodnot D pro jednotlivé kmeny vyplývá, že kromě kmene L. mon a L. inn dosahují všechny kmeny maximálního nárůstu při hodnotě ph 6. To naznačuje, že pro nárůst listerií je tato hodnota optimální. Z porovnání je zřejmé, že různé kmeny L. mon. se chovají odlišně, mají různou TFL, ERR i max. OD. Podobně se chovají i testované kmeny L. inn. To znamená, že nelze vybrat typový kmen ani zvolit průměrnou směsnou kulturu pro testování podmínek růstu v konkrétním případě technologického procesu. Testované kmeny listerií je možné rozdělit do dvou hlavních podskupin podle TFL; kmeny s krátkou dobou TFL do 5-ti hodin (Graf č. 2, Graf č. 4, Graf č. 5 a Graf č. 8) a do skupiny s dlouhou dobou TFL mezi 20 a 30 hodinami (Graf č. 1, Graf č. 6 a Graf č. 7). Je zajímavé, že kmeny L.mon s krátkou dobou TFL citlivěji reagují růstovou rychlostí na snižování ph. Kdežto kmeny s dlouhým TFL mají ERR mnohem vyrovnanější a odpovídají maximální ERR listerií ze skupiny s krátkým TFL. To je ve shodě s představou, že čím delší TFL tím lepší adaptace na prostředí tím a tím rychlejší růst. Závěr Pro kvalifikovaný odhad předpovědi růstu listerií v konkrétních podmínkách je nutno vždy volit konkrétní model pro daný kmen listerií nebo alespoň z odpovídající skupiny podle TFL. Tento fakt je také nutno zohlednit při testování růstu listerií na konkrétním potravinářském produktu a modely využívat s velkou opatrností pouze mikrobiology jako podklad pro další analýzy. Z uvedených příkladů vyplývá význam a nutnost bližší identifikace kmenů a k nim vytvářet prediktivní modely. Dedikace Práce byla podpořena grantovou agenturou MŠMT č. 2B08050 Použitá literatura McMeekin T.A., Olley J.N., Ross T., Ratkowsky D.A., Predictive mikrobiology theory and application, Reseach Studies Press LTD, ANON1991: Recommendations by The National Advisory Committee on microbiological criteria for foods: The pathogenesis and virulence of Listeria monocytogenes, N7/2/efb5c39e5bc64991b40c25af075906b1 Aarnisalo,K., Vihavainen,E., Rantala,L., Maijala,R., Suihko,M. L., Hielm,S., Tuominen,P., Ranta,J., Raaska,L., Use of results of microbiological analyses for risk-based control of Listeria monocytogenes in marinated broiler legs, International Journal of Food Microbiology, 3, , 2008 Angelidis,A., Boutsiouki,P., Papageorgiou,D.,: Loss of viability of Listeria monocytogenes in contaminated processed cheese during storage at 4, 12 and 22 C. Food Microbiology, 27, , 2010 Augustin,J. Ch., Rosso,L., Carlier,V.: A model describing the effect of temperature history on lag time for Listeria monocytogenes International Journal of Food Microbiology 57, , 2000, Kontaktní adresa: RNDr. Vladimír Erban, CSc. Výzkumný ústav potravinářský Praha Radiová Praha

131 VLIV SKLADOVÁNÍ NA KVALITU BRAMBOR RŮZNÝCH VARNÝCH TYPŮ Effect of storage on quality of potatoes of different cooking types Šottníková V., Kučerová J. Mendelova univerzita v Brně Abstrakt Byl sledován vliv skladování na obsah redukujících cukrů, škrobu a vařivost různých varných typů brambor. Senzoricky byla hodnocena konzistence, vlhkost, moučnatost a stabilita po uvaření. K nejnižšímu poklesu obsahu škrobu došlo u odrůdy Ditta (varný typ AB) a nejnižšímu nárůstu obsahu cukru u odrůdy Ditta (varný typ AB). Nejlépe senzoricky byla hodnocená odrůda Princess (varný typ A). Klíčová slova: brambory, varný typ, kvalita Abstract The effect of storage on the content of reducing sugars, starch and cooking different cooking types of potatoes. Sensory analysis was evaluated consistency, moisture, and stability of mealiness after cooking. The lowest decrease in starch content was observed in a variety Ditta (cooking type AB), the lowest increase in the variety of sugar Ditta (cooking type AB). Top sensory variety Princess was assessed (cooking type A). Key words: potatoes, cooking type, duality Úvod Celosvětově patří brambory mezi významné plodiny a to nejen z pohledu lidské výživy, ale i krmivářství. Podle statistických údajů FAO je druh Solanum tuberosum, se svojí roční úrodou kolem 320 milionů tun, na čtvrté příčce celosvětově významných plodin, hned za pšenicí, rýží a kukuřicí. Tak jako zmírnily hladomory po svém příchodu do Evropy, mohly by v současnosti sehrát podobnou roli i v rozvojových zemích. Částečně se to daří již dnes, ačkoliv je spotřeba brambor v rozvojových zemích stále až čtyřikrát nižší než v rozvinutých průmyslových zemích (PRUGAR, 2009). O významu brambor svědčí i to, že před více než 40ti lety bylo v Peru nedaleko hlavního města Limy založeno Mezinárodní bramborářské centrum CIP (Centro Internacional de la Papa) (HEJNÝ, 1994). V genové bance CIP je přes vyšlechtěných i planých odrůd brambor, jejichž vzájemným křížením by se do budoucna měla vyšlechtit ideální odrůda brambor jak po stránce pěstitelské, tak nutriční a kulinární (JŮN, 2007). Materiál a metody Vzorky brambor byly odebírány ve firmě SENECO, spol. s r.o. v hospodářském roce Firma SENECO, spol. s r.o. má sídlo v Polné na Vysočině, v nadmořské výšce 490 m n.m., což je ryze bramborářská oblast. Brambory byly skladovány v bramborárně v ohradových paletách o nosnosti cca 1000 kg. Klima v bramborárně je řízeno ručně, podle počasí, které je venku, je tedy zcela odkázáno na pracovní sílu. Vzorky brambor byly odebírány bezprostředně po sklizni, a pak každý následující měsíc až do vyskladnění celé bramborárny. Pro hodnocení byly zařazeny odrůdy Princess (A), Ditta (AB), Dali (BA), Laura (B) a Agria (BC), patřící každá do jednoho z varných typů. U daných odrůd ve sledovaném období bylo stanoveno % škrobu polarimetricky, dle ČSN Procento redukujících cukrů bylo stanoveno dle ČSN Stanovení konzistence, struktury, vlhkosti, moučnatosti a stability odrůd bylo stanoveno dle ČSN Vzorky hlíz byly středně velké, nepoškozené, 131

132 škrobnatost v % % skutečného obsahu cukrů Úroda 12/2012, vědecká příloha časopisu bez vizuálních příznaků chorob, nedeformované. Hlízy byly skladovány při teplotě 6 C a jeden den před zkouškou vyjmuty ze skladu a umístěny do pokojové teploty. Hodnocení provádělo pět osob. Brambory byly vařeny ve slupce a v páře. Hodnotila se konzistence, která vyjadřuje odolnost dužniny tlaku, spolu s moučnatostí určuje zařazení odrůdy do varného typ, struktura vyjadřuje jemnost nebo hrubost dužniny. Vlhkost je znak, který souvisí s obsahem sušiny. Škrob má souvislost jak s konzistencí, strukturou, tak i s moučnatostí a vlhkostí. Dle těchto znaků lze hlízy zařadit do varného typu (DOMKÁŘOVÁ, 2009). Naměřené výsledky byly zpracované pomocí Analýzy hlavních komponent, což je metoda pro zachycení nejdůležitější informace ze získaných dat. Graf PCA, je výstupem z této analýzy. Výsledky a diskuse Stanovením obsahu škrobu v hlízách brambor a následnými výpočty bylo zjištěno, že u odrůdy Agria došlo k největšímu poklesu obsahu škrobu, a to o 15,72 %, což činí pokles z 15,9 % obsahu škrobu na 13,4 % obsahu škrobu. U odrůdy Ditta byl nejnižší pokles obsahu škrobu v průměru o 12,23 %, ve sledovaném období, což činí pokles škrobu v hlízách bramboru z původních 13,9 % na konečných 12,2% (obr. 1). Stanovením obsahu redukujících cukrů před a po inverzi a následnými výpočty bylo zjištěno, že u odrůdy Laura došlo k největšímu nárůstu obsahu všech cukrů o 311%, z původních 0,26 % na 1,07 %. Nejnižšího nárůstu obsahu cukru bylo zaznamenáno u odrůdy Ditta o 112%, kdy počáteční stav všech cukrů byl 0,55 % a konečný obsah cukrů 1,17 % (obr.2). Obsah škrobu se symetricky snižoval, a naopak se obsah cukrů v hlízách brambor zvyšoval. S výjimkou měsíce února, kdy bylo extrémně mrazivé počasí a teplota v bramborárně klesla k 0 C (venkovní teplota vzduchu klesla na mínus 22 C obr. 6), hodnota sledovaných parametrů, a to především obsahu cukrů se výrazně zvýšila, což je patrné z obr. 2. K tomuto jevu dochází vždy, když klesne skladovací teplota pod 2 C (WANG et. al 2005). Obr. 1: Obsah škrobu za sledované období Stanovení škrobnatosti brambor za rok (měsíce 9-3) 15,5 14,5 13,5 12,5 11,5 Agrie Dali Ditta Laura Princess Obr. 2: Skutečný obsah cukrů za sledované období Stanovení množství cukrů v bramborách za rok (měsíce 9-3) 1,6 1,4 1,2 1 0,8 0,6 0,4 0,2 0 Agria Dali Ditta Laura Princess Po venkovním oteplení, stoupla i teplota skladování, a tím se obsah cukru v hlízách všech odrůd vrátil k hodnotám, které byly před mrazem. Skladování brambor při nízké teplotě (pod 2 C) má nevýhodu, která spočívá v redukci cukrů a následném sládnutí hlíz. Proto je nutné konzumní brambory skladovat při vyšší teplotě. U běžných odrůd dochází k rovnováze mezi redukcí cukrů a jejich prodýcháváním nad 7 C. To je důležité hlavně u odrůd brambor určených na výrobu smažených výrobků. U nich totiž dochází při vysokých teplotách během smažení k reakci mezi aminokyselinami a redukovanými cukry, vlivem této reakce dochází k hořknutí a hnědnutí produktů. Proto se bramborám skladovaným pro tyto účely zachovává skladovací teplota mezi 7 10 C (hranolky 7 9 C, chipsy 8 10 C) a 132

133 případné klíčení se omezuje chemicky (MARANGONI, et al., 1997, HAJIREZAEI et al. 2003). Skladování brambor ovlivňuje především teplota v průběhu skladovacího období a opatření umožňující výměnu vzduchu v mezihlízovém prostoru, odvod oxidu uhličitého a vody vzniklé dýcháním hlíz (ČEPL, 2009). Při prodýchávání brambor ve skladu, vznikají rozkladem škrobu redukující cukry. Nízká teplota ( 4-6 C) při skladování tento fyziologický proces brzdí (ŠTEFÁNEK, 1999). Na obr. 3 je znázorněno snížení senzorické kvality u odrůdy Agrie (modře vybarvená plocha), když teplota ve skladu klesla na z 6 C na 0 C, a to o celé 2 body v hodnocení stability a ke snížení moučnatosti a vlhkosti o 1,4 bodu. Na obr. 4 je reakce odrůdy Princess na změnu teploty při skladování. Nejvíce se zhoršila struktura a vlhkost o 1,6 bodu, stabilita odrůdy se snížila o 1,4 bodu, konzistence o 1 bod a moučnatost se nezměnila. Bylo zjištěno, že z hodnocených odrůd je tato odrůda nejlépe přizpůsobivá změnám teploty při skladování. Obr. 3: Senzorické hodnocení odrůdy Agrie Obr. 4: Senzorické hodnocení odrůdy Princess Obr. 5:Projekce proměnných do faktorové roviny Obr. 6 Teploty vzduchu ve sledovaném skladovacím období Pomoci metody Analýzy hlavních komponent byl zjištěn vztah mezi sledovanými parametry. Komponenty, které jsou ve stejném směru se chovají podobně (například cukr a čas mají stejný směr, což značí, že když roste čas roste i koncentrace cukru), pokud směřuji na opačnou stranu, mají opačný vliv (teplota směřuje na jednu stranu a cukr na opačnou, tedy jeden přispívá k vysvětleni hlavní informace v datech záporně a druhý kladně, podobně je to se škroby (škroby mají záporný vliv, cukr kladný jdou proti sobě ) což je vidět z obr. 5. Závěr Nejlépe přizpůsobivá, co se týče sledovaných parametrů, konzistence, struktury, moučnatosti, vlhkosti a stability odrůdy byla odrůda Princess, která ani v podmínkách, kdy teplota 133

134 v bramborárně klesla k 0 C výrazně nezměnila senzoricky sledované hodnoty. Nejhůře se s výkyvem teploty vyrovnala odrůda Agria. Analýzou hlavních komponent bylo zjištěno, že koncentrace zvyšujícího se množství cukru je ovlivněna časem i teplotou a současně čas má také vliv na snižující se množství škrobu. Zároveň bylo zjištěno, že vlhkost, moučnatost, konzistence, struktura ani stabilita odrůdy neovlivňuje obsah cukru. Vlhkost, moučnatost, konzistence, struktura jsou závislé na množství škrobu a teplotě při skladování. Použitá literatura Čepl, J., Brambory zdravá potravina, (2005). Bramborářství, 13 (6): Domkářová, J., Horáčková, V., Habětínek, J., (2003). Úroveň a vývojové trendy stolní hodnoty odrůd Solanum tuberosum L. v genofondu bramboru, Výzkumný ústav bramborářský Havlíčkův Brod, Vědecké práce 14: Hajirezaei Mr, Börnke F, Peisker M, Takahata Y, Lerchl J, Kirakosyan A, Sonnewald U., (2003). Decreased sucrose content triggers starch breakdown and respiration in stored potato tubers (Solanum tuberosum). J Exp Bot., Jan, 54 (382): Hejný, S., (1994). Co všechno víme a nevíme o bramboru, Živa, 42 (3): Jun, J., (2007). Peru nebo Chile? Co k původu a historii brambor říká odborná literatura slovy prof. Ing. Josefa Pulkrábka, CSc., ČZU Praha, Bramborářství,, 15 ( 2): Leeman, M., Östman, E., Björck, I., (2008). Glycaemic and satiating properties of potato products. European Journal of Clinical Nutrition, 62 (1): Marangoni, A.G., Duplessis, P.M.,Yada, R.Y., (1997). Sugars in crop plants, Kinetic model for carbon partitioning in Solanum tuberosum tubers stored at 2 C and the mechanism for low temperature stress-induced accumulation of reducing sugars, Biophys Chem. Apr 22; 65 (2-3): Prugar, J., (2009). Ohlédnutí za bramborovým rokem Výživa a potraviny, 64 (1): Štefánek, F., (1999). Pěstování brambor, Sativa Keřkov a.s., Humpolec. Wang, Q.,Huang, H.Y.,Zhang, J.W.,Li, X.C., (2005). Effects of antisense acid invertase gene on reducing sugar and starch contents of potato (Solanum tuberosum L.) tuber stored at low temperature, Zhi Wu Sheng Li Yu Fen Zi Sheng Wu Xue Xue Bao. 31(5): Kontaktní adresa: Ing. Viera Šottníková, Ph.D. Mendelova univerzita v Brně Zemědělská 1, Brno 134

135 VYBRANÉ ZNAKY SEMEN ŘEPKY OZIMÉ OVLIVŇUJÍCÍ RŮST, VÝVOJ A VÝNOS V PODMÍNKÁCH SUCHA Selected seed traits of winter rape affecting growth, development and seed yield under drought conditions Bláha L. 1, Vyvadilová M. 1, Urban M. O. 2 1 Výzkumný ústav rostlinné výroby, Praha 6-Ruzyně 2 Přírodovědecká fakulta Univerzity Karlovy v Praze Abstrakt Geografický původ odrůdy, provenience osiva a odolnost semen vůči stresu vysoké teploty při klíčení ovlivňují nejen procesy klíčení, ale predikují i následný růst a vývoj, zejména v podmínkách sucha. Osivo použité k testování odolnosti k suchu musí však být z lokality vhodné pro produkci semen. Rozdíl v obsahu osmoticky aktivních látek v listech rostlin pěstovaných za sucha a standardních podmínek v nádobových pokusech významně koreluje s testovanými vlastnostmi semen a potvrzuje i shodu v pořadí odolnosti odrůd v laboratorních a nádobových pokusech. Klíčová slova: řepka ozimá, vlastnosti semen, sucho, osmotický potenciál, predikce odolnosti Abstract Geographic origin of cultivar, seed provenance and resistance to high temperature stress during germination processes affect not only germination, but also could predict the subsequent growth and development, especially in drought conditions. Seeds for drought resistence tests must originate from the locality suitable for seed production. The difference in the content of osmotically active substances from leaves of plants grown under drought and standard conditions in pot experiments correlates significantly with the seed traits and also confirms the compliance in the varieties hierarchy from the laboratory and pot experiments. Key words: winter oilseed rape, seed traits, drought, osmotic potential, resistance prediction Úvod Z našich předchozích prací a z literatury je známo, že vitální osivo dobré provenience zaručuje nejen lepší vzcházivost, růst a vývoj kořenové soustavy, ale má v konečném důsledku významný vliv i na výnos. Výkonnější genotypy mají efektivnější úroveň metabolismu po celou vegetaci. Provenience často ovlivňuje fyziologické vlastnosti semen více, než jejich hmotnost a klíčivost. Zjistili jsme, že původ semen, výběr odrůdy a také změny teplot, které se vyskytují na povrchu půdy po vysetí, mohou do značné míry ovlivnit klíčivost řepky v daných podmínkách. Byl též prokázán vliv hmotnosti kořenového systému na suchovzdornost a výši výnosu semene. Pro výnos je významný rychlý nástup růstu kořenového systému po ukončení zimního období. Odhaduje se, že abiotické stresory snižují celosvětově výnosový potenciál až o 70%. Podle analýzy posledních 60ti let, provedené vědeckým týmem z Goddarova střediska vesmírných letů NASA, jsou změny klimatu a zvyšující se variabilita průběhu počasí větší, než se předpokládalo. Jejich vliv na produkci rostlin bude značný (Morison et al. 2006, Viner et al. 2006). Cílem práce bylo prověřit, zda na základě fyziologických vlastností osiva, ovlivňujících následný růst a vývoj rostlin, lze předpovědět nejen výnos, jak tomu bylo v předchozích pracích, ale i reakci na stres sucha. Materiál a metody V tabulce 1 je uveden přehled původu čtyř modelových odrůd použitých v této práci. 135

136 Tab. 1: Použité rostlinné materiály a jejich původ Odrůda/ materiál Země původu Firma Californium Francie Monsanto SAS Viking Německo NPZ (Norddeutsche Pflanzenzucht) Navajo Velká Británie CPB Twyford Ltd Cadeli Francie Monsanto SAS Pro skleníkové nádobové pokusy, laboratorní testy odolnosti semen vůči teplotnímu stresu při klíčení a u standardní semenářské analýzy byly použity již dříve publikované postupy (např. Bláha 2009, Bláha et al. 2011). Hladiny kompatibilních solutů jsou většinou analyzovány z extraktu pletiva nebo buněk bez přihlédnutí k jejich kompartmentaci (Hare et al. 1998). Hodnocení osmotického potenciálu rostlin stresovaných suchem v nádobových pokusech bylo v této práci provedeno na druhém plně vyvinutém listu ve třech opakováních. Listy byly odstřiženy, vloženy do injekční stříkačky, uzavřeny a okamžitě zmraženy v tekutém dusíku. Před hodnocením byly vzorky rozmraženy a vylisovány. Buněčná šťáva byla přenesena na celulozní terčík, který byl vložen do komůrky osmometru (Wescor 5500, Wescor Inc., Utah, USA). Hodnota osmolality (mmol/kg) byla převedena na MPa pomocí van t Hoffovy rovnice. Výsledky a diskuse Jak vyplývá z našich dosavadních výsledků (Bláha et al. 2011), semena odrůd sklizená z lokality Slapy u Tábora jsou v průměru horší ve všech sledovaných parametrech než z lokality Chlumec nad Cidlinou a predikce dalšího vývoje a růstu jednotlivých odrůd je méně přesná. Z těchto důvodů je pozornost soustředěna převážně na výsledky z Chlumce nad Cidlinou, tedy lokality produkující kvalitnější osivo. Testování klíčivosti semen při vysokých teplotách, které se vyskytují na povrchu půdy po vysetí (den 42 ºC a noc 20 ºC) ukázalo rozdíly v odolnosti jednotlivých odrůd. Odrůdy Californium a Cadeli původem z Francie, tedy ze sušší a teplejší oblasti, jsou odolnější k vysokým teplotám (Graf 1). Jak dokumentuje tabulka 2, kde je uveden procentuální podíl vzešlých semen, stejné výsledky byly zjištěny také při hodnocení vzcházivosti semen v kontejnerech ve skleníkovém pokusu. Hodnota korelačního koeficientu vzcházivosti s klíčivostí je průkazná (r=0,93*). Případný rozdíl mezi vzcházivostí a klíčivostí vypovídá o odolnosti vůči biotickým a abiotickým půdním stresorům. Průkazné jsou obecně i další korelace vzcházivosti se všemi zde uvedenými údaji. Odrůdy, které lépe odolávají stresu vyšší teplotou při klíčení, lépe vzcházejí i ve standardních podmínkách (možný vliv větší aktivity enzymů). Klíčivost testovaná standardní metodou ISTA ve standardních podmínkách nemá takovéto predikční vlastnosti na rozdíl od klíčivosti ve stresu. Ale vitalita hodnocená jako klíčivost za 24 a 48 hod. naznačuje výsledky, které ukazují, že Californium a Cadeli jsou lepší než Navajo a Viking. Klíčení semen v chladném prostředí (den 20ºC a noc 0ºC), které se v půdě může vyskytnout po vysetí, nemá žádný vztah k uvedeným znakům, přestože existují odrůdové rozdíly. Tab. 2:Vzcházivost semen v půdě ve skleníkovém prostředí (%) Viking 79,34 Cadeli 88,68 Navajo 85,00 Californium 88,66 136

137 Rozdíl mezi kontrolou a stresovanou rostlinou (MPa) Úroda 12/2012, vědecká příloha časopisu Graf 1: Klíčivost v podmínkách vysoké teploty přes den a v noci (počet vyklíčených semen z 50) Klíčivost testovaných odrůd v podmínkách vysoké teploty Navajo Viking Cadeli Californium Snižování osmotického potenciálu (Ψπ) v buněčné šťávě je obecně spojováno se zvýšením tolerance k nedostatku vody v rostlině. Graf 2 dokumentuje, že byly zjištěny rozdíly mezi osmotickými potenciály u druhých zcela vyvinutých listů rostlin pěstovaných za celovegetačního sucha a ve standardních podmínkách, které jsou v korelaci s řadou dalších měřených parametrů - s rychlostí klíčení (r=0,91*), se vzcházivostí (r=0,89*), odolností vůči vysoké teplotě při klíčení (r=0,97**) a se suchovzdorností hodnocenou podle změny poměru sušin kořenů a nadzemní části (r=0,95**). Odrůdy z Francie, s nižším úbytkem nadzemní a podzemní hmoty rostlin v podmínkách sucha, měly i menší rozdíly mezi osmotickými potenciály listů rostlin pěstovaných v kontrastních podmínkách. Poměr sušin kořenů a nadzemní části byl zpracován pro sucho a standard. Suchovzdornější genotypy mají v podmínkách sucha menší redukci kořenů (Graf 3). Graf 2: Rozdíly mezi osmotickými potenciály u druhých zcela vyvinutých listů rostlin ze standardních podmínek a celovegetačního sucha Diference složky osmotického potenciálu - p r o v e n i e n c e C h l u m e c n / C ( k o n t r o l a - s t r e s ) 0,70 Viking Chlumec 0,60 0,50 Navajo Chlumec 0,40 0,30 0,20 Cadeli Chlumec 0,10 0,00 Californium Chlumec Graf 3: Procentuální poměr kořenů a nadzemní části rostlin za standardních podmínek a sucha Porovnání poměru sušin kořenů a nadzemní části 0,9 0,8 0,7 0,6 0,5 0,4 Standard Sucho 0,3 0,2 0,1 0 Californium Cadeli Navajo Viking 137

138 Tab. 3: Porovnání délky a objemu kořenů ze standardních podmínek a celovegetačního sucha (standard 100%) Odrůda Délka objem průměr Viking 13,53 28,72 21,13 Californium 60,60 34,18 47,39 Cadeli 78,60 24,71 51,66 Navajo 60,91 31,50 46,21 Vlastní parametry kořenů a nadzemní části mají jinou hierarchii absolutních hodnot, ale procento změny parametrů kořenů za sucha proti standardním podmínkám (100%) odpovídá zjištěné hierarchii odrůd u předchozích testů.odrůdy Viking a Navajo mají za sucha větší procento poklesu sušiny než Californium a Cadeli (Tab.3). Závěr Odrůda a její geografický původ, provenience semen, odolnost semen vůči stresu a zejména vůči vysoké teplotě mohou značně ovlivnit nejen procesy klíčení, ale i následný růst a vývoj. Odolnost semen vůči stresu může tedy být dobrým markérem pro další vybrané vlastnosti. Osivo pro predikce odolnosti k suchu musí být z pěstitelsky vhodné lokality. Výkonnější odrůdy jsou nejvitálnější již v juvenilní fázi růstu. Množství osmoticky aktivních látek významně koreluje s velkou řadou námi naměřených parametrů. Výsledky potvrdily shodu v hierarchii odrůd z nádobových pokusů a laboratorních testů. Dedikace Práce vznikla za podpory projektů MZe ČR QH82285 a Použitá literatura Bláha L.,Vyvadilová M., Klíma.M. (2011): Vliv genotypových rozdílů v parametrech kořenového systému na suchovzdornost a výnos řepky ozimé. In:Aktuální poznatky v pěstování, šlechtění, ochraně rostlin a zpracování produktů, konference, Brno. VÚPP Troubsko, Vědecká příloha časopisu Úroda, Brno listopad 2011, s Bláha L.,Vyvadilová M., Klíma M. (2011): Vliv vlastností semen na výnos vybraných genotypů řepky ozimé. Nové poznatky z genetiky a šlachtenia polnohospodárskych rastlín. Zborník z 18. vedeckej konferencie, Piešťany: VÚRV, 2011: Bláha L. (2009): Význam vlastností semen trav pro hodnocení suchovzdornosti. Úroda 10, s Hare P.D., Cress W.A., Van Staden J. (1998): Dissectingthe roles of osmolyte accumulation during stress. Plant Cell and Environment, 21, s Morison I.L, Morecroft M.E. (2006). Plant Growth and climate change, Blackwell publishing Ltd. Viner D, Jamesi L,Walalce M.,Walalce C. (2006): Recent and future climate change and thein implications for plant growth.in.: Plant Growth and climate change, Blackwell publishing Ltd, s Kontaktní adresa: Ing. Ladislav Bláha CSc,Výzkumný ústav rostlinné výroby v.v.i Praha 6, Ruzyně, Drnovská

139 GENOTYPOVÁ VARIABILITA LIPIDACYLHYDROLASOVÉ AKTIVITY U PATATINOVÝCH BÍLKOVIN PURIFIKOVANÝCH Z HLÍZ VYBRANÝCH DRUHŮ BRAMBOR Genetic variability of the lipid acyl hydrolase activity of patatin proteins purified from tubers of potato species Brabcová A. 1, Bárta J. 1, Bártová V. 1, Horáčková V. 2 1 Jihočeská univerzita v Českých Budějovicích, Zemědělská fakulta 2 Výzkumný ústav bramborářský Havlíčkův Brod, s.r.o. Abstrakt V příspěvku byla hodnocena aktivita lipidacylhydrolasy (LAH) u patatinových bílkovin purifikovaných z hlíz vybraných genotypů kulturních a planých druhů brambor diploidní S. bulbocastanum, S. chacoense, S. leptophyes, S. phureja, S. stenotomum; tetraploidní S. andigenum, S. goniocalyx, S. sucrense, S. tuberosum (cv. Desireé a cv. Kuras) a hexaploidní S. demissum. LAH byla stanovena kvalitativně (na gelu po provedené PAGE) i kvantitativně (spektrofotometricky). Detekcí LAH na gelu byly u jednotlivých druhů nalezeny 1 (S. bulbocastanum, S. chacoense) až 3 (S. phureja, S. stenotomum) bílkovinné pruhy s relativní elektroforetickou mobilitou 0,77-0,89. Kvantifikace specifické aktivity LAH se pohybovala v intervalu od 3,46 (S. phureja) 13,80 (S. sucrense) μmol/[min mg]. Klíčová slova: brambory, plané a kulturní druhy, patatin, lipidacylhydrolasová aktivita Abstract The presented contribution is focused on lipid acyl hydrolase activities (LAH) of the major potato tuber protein patatin of selected cultivated and wild potato species - diploid S. bulbocastanum, S. chacoense, S. leptophyes, S. phureja, S. stenotomum; tetraploid S. andigenum, S. goniocalyx, S. sucrense, S. tuberosum (cv. Desireé a cv. Kuras) a hexaploid S. demissum. LAH was determined qualitatively (on the gel) and quantitatively (by spectrophotometry). Detection of LAH on the polyacrylamide gel showed from 1 (S. bulbocastanum, S.chacoense) to 3 (S. phureja, S. stenotomum) protein bands with the relative mobility Quantification of LAH specific activitiy resulted in the interval from 3.46 (S. phureja) (S. sucrense) μmol/[min mg]. Key words: potatoes, wild and cultivated species, patatin, lipid acyl hydrolase activity Úvod Bílkoviny patatinového komplexu jsou glykoproteiny s molekulovou hmotností kda. V hlízách kulturního druhu brambor představují % z celkových bílkovin a jejich funkce je především zásobní. U těchto bílkovin bylo také potvrzeno, že vykazují několik enzymových aktivit, z nichž nejvýznamnější je aktivita lipidacylhydrolasy (LAH) (Shewry 2003). Obecně jsou patatiny jako LAH aktivní s fosfolipidy, monoacylglyceroly a p- nitrofenylovými estery karboxylových kyselin, středně aktivní s galaktolipidy, ale zřejmě neaktivní s di- a tri- acylglyceroly (Jiménez-Atiénzar et al. 2003). Ačkoli přesná fyziologická funkce patatinu není známa, díky svým enzymovým aktivitám může hrát roli v obranných mechanismech bramborové rostliny (Jiménez et al. 2001, Sakaki et al. 2007). Jak ve své práci naznačují Pots et al. (1999), intenzita (nízká/vysoká) LAH aktivity patatinu v hlízách může souviset s odolností odrůdy (genotypu) vůči biotickým a abiotickým činitelům. Pokud by se potvrdila hypotéza, naznačující, že vyšší LAH aktivitu vykazují genotypy s vyšší odolností vůči původcům chorob hlíz, tak by tato enzymová aktivita patatinů mohla sloužit jako biochemický marker pro šlechtění rostlin. Další význam LAH aktivity patatinu spočívá v tom, že purifikovaný patatin z hlíz resp. patatin připravený pomocí expresních systémů je schopný 139

140 syntetizovat estery monokarboxylových kyselin, jenž mohou být využívány pro další průmyslové výroby a samotný patatin je také schopný vytvářet hodnotné potravinářské pěny (Pots et al. 1999, Davis and Macrae 2001). Z tohoto pohledu je vysoké zastoupení patatinových bílkovin v hlízách velice zajímavé, protože při zpracování brambor na škrob přechází do hlízové vody, ze které může být v nativní podobě (mj. se zachovanou aktivitou LAH) izolován a následně používán pro výše uvedené syntetické účely. Plané a netradiční kulturní druhy jsou obecně zdrojem genetické variability a mohly by tak poskytnout patatinové bílkoviny s vyšší aktivitou LAH. Cílem příspěvku bylo hodnotit úroveň LAH aktivity u patatinových proteinů purifikovaných z hlíz vybraných druhů brambor. Materiál a metody Rostlinný materiál byl získán z Genové banky bramboru udržované ve Výzkumném ústavu bramborářském Havlíčkův Brod s.r.o. Vstupním materiálem pro analýzu byla lyofilizovaná sušina hlíz vybraných druhů brambor Solanum stenotomum (EVIGEZ 07S ), Solanum phureja (EVIGEZ 07S ), Solanum goniocalyx (EVIGEZ 07S ), Solanum andigenum (EVIGEZ 07S ), Solanum tuberosum odrůdy Desireé (EVIGEZ 07S ) a Kuras (EVIGEZ 07S ), Solanum bulbocastanum (EVIGEZ 07S ), Solanum chacoense (EVIGEZ 07S ), Solanum demissum (EVIGEZ 07S ), Solanum sucrense (EVIGEZ 07S ). Extrakce bílkovin byla provedena pomocí 25 mm pufru Tris-HCl ph 7,4, kdy poměr sušina:pufr byl 1:10. Purifikace bílkovin patatinového komplexu byla provedena dvoustupňově pomocí iontovýměnné (DEAE-52 Cellulose Servacel; SERVA, Německo) a afinitní chromatografie (Concanavalin A Sepharose 4B; GE Healthcare, USA). Purifikované bílkoviny patatinového komplexu byly dále odsoleny a zakoncentrovány pomocí centrifugačních filtrů s MWCO 3 kda (Millipore, USA). U purifikovaných patatinů byla stanovena koncentrace pomocí bicinchoninové kyseliny (BCA Protein Assay Kit; Pierce, USA) a k analýzám byly použity roztoky patatinů o koncentraci 100 µg/ml. LAH aktivita patatinu byla stanovena jak na gelu tak spektrofotometricky. Při detekci LAH aktivity na gelu byla nejprve provedena PAGE s diskontinuálním uspořádáním matrice (7,5% separační a 3,75% zaostřovací gel) v prostření Na-borátového pufru (ph 7,2). Poté byla LAH vyzualizována inkubací gelu (tma, 37 C) se substrátem α-naphthyl butyrate (Sigma-Aldrich, USA) (modifikováno dle práce Bárta et al. 2003). U tohoto typu stanovení byla určena relativní elektroforetická mobilita (Rm) patatinů a počet detekovaných pruhů na gelu představující isoformy patatinů. Kvantifikace LAH byla stanovena na základě měření na spektrofotometru (BioMate 5, ThermoElectron, UK) při λ= 410 nm dle Pots (1999) s použitým substrátem p-nitrophenyl butyrate (Sigma-Aldrich, USA). Podle sestrojené kalibrační řady pomocí p-nitrophenolu jako standardu (Fluka, Švýcarsko) byl proveden přepočet a stanovena specifická aktivita patatinů. Statistické vyhodnocení bylo provedeno v programu STATISTICA 10 (StatSoft, USA). Výsledky a diskuze LAH aktivita byla na gelu detekována u všech vybraných druhů (resp. genotypů) brambor v podobě 1 3 pruhů, což potvrzuje existenci nábojových isoforem bílkovin patatinového komplexu (viz tab. 1). Relativní mobilita těchto pruhů (0,77-0,89) byla stejná s majoritními proteinovými pruhy v celkovém bílkovinném spektru hlíz bramboru (data neukázána). Intenzita LAH aktivity na gelu se u jednotlivých druhů liší, jak je patrné na obr. 1, což potvrzuje komplikovanost genetického založení patatinů při rozdílné úrovni ploidity. Specifická aktivita patatinů, která byla kvantifikována spektrofotometricky, se mezi studovanými druhy lišila poměrně výrazně a pohybovala se v intervalu od 2,68 (S. tuberosum cv. Kuras) do 13,80 (S. sucrense) μmol/[min mg]. Výsledky ukazují, že netradiční kulturní a plané (resp. primitivní) druhy mohou být zdrojem vyšším LAH aktivity. Kromě patatinu 140

141 izolovaného z hlíz S. sucrence byla zjištěna vyšší aktivita LAH i u dalších druhů S. stenotomum, S. chacoense, S. leptohyes. Na druhé straně z pohledu druhu S. tuberosum byly hodnoceny jen dvě odrůdy, takže se skutečný potenciál toho druhu nemohl dostatečně projevit. LAH aktivita patatinu, ale i jiné enzymové aktivity, byly v minulosti studovány hlavně u odrůd kulturního druhu Solanum tuberosum (Racusen 1986, Pots et al. 1999, Jiménez et al. 2001). Např. z nedávných výsledků získaných na našem pracovišti (Bárta et al. 2012), kdy bylo hodnoceno 20 odrůd bramboru (S. tuberosum) určených pro konzumní a zpracovatelské účely, bylo nalezeno rozpětí LAH aktivity patatinu v rozpětí 0,92 5,46 μmol/[min mg]. Tento výsledek je v souladu s představou, že plané či netradiční kulturní druhy by mohly být genovým zdrojem patatinu s vyšší aktivitou LAH pro šlechtění nových odrůd brambor. U netradičních kulturních druhů a druhů planých či primitivních jsou literární informace o bílkovinách hlíz nedostatečné či neúplné a navíc staršího data (Racusen 1987, Racusen 1992). Z nedávno publikovaných výsledků (Dobson et al. 2010) metabolomických studií hlíz genotypů ze skupin Andigena, Phureja, Stenotomum a Tuberosum ve Skotsku Tab. 1: Souhrnné výsledky LAH aktivity purifikovaných patatinových bílkovinu vybraných genotypů brambor Druh Ploidita (EBN)* (2x=24) Počet pruhů/ Relativní mobilita Specifická aktivita (μmol/[min mg]) Kulturní S. tuberosum, odrůda Desireé 4x (4 EBN) 2 (0,80; 0,83) 8,60 cd S. tuberosum, odrůda Kuras 4x (4 EBN) 3 (0,85; 0,86; 0,88) 2,68 e Netradiční kulturní S. andigenum 4x (4 EBN) 2 (0,83; 0,85) 7,67 d S. goniocalyx 2 (0,84; 0,86) 9,58 c S. phureja 2x (2 EBN) 3 (0,77; 0,78; 0,84) 3,46 e S. stenotomum 2x (2 EBN) 3 (0,84; 0,85; 0,87) 13,07 a Plané (primitivní) S. bulbocastanum 2x (1 EBN) 1 (0,86) 9,52 c S. demissum 6x (4 EBN) 2 (0,85; 0,87) 6,87 d S. chacoense 2x (2 EBN) 1 (0,86) 11,20 b S. leptophyes 2x (2 EBN) 2 (0,85; 0,87) 10,73 bc S. sucrense 4x (4 EBN) 2 (0,86; 0,89) 13,80 a Neshodná písmena indikují průkazný rozdíl na hladině významnosti P < 0,05 (Tukey HSD) *převzato a upraveno dle práce Hawkes (1990) Obr. 1: Detekce LAH aktivity purifikovaných patatinových bílkovin na gelu po předchozí nativní PAGE (trojice vzorků jednotlivých genotypů) Rm 0,7 0,8 0,9 zřetelně vyplývá význam těchto druhů pro zlepšování nutriční hodnoty a organoleptických vlastností komerčně využívaných genotypů bramboru (S. tuberosum) prostřednictvím moderního šlechtění bramboru. 141

142 Závěr V rámci souboru 10 druhů brambor (Solanum spp.) byla potvrzena výrazná variabilita LAH aktivity patatinových bílkovin jak na kvalitativní úrovni (v rámci hodnoceného souboru druhů byly pomocí PAGE detekovány 1 3 pruhy), tak i na úrovni kvantitativní (specifická aktivita LAH byla v intervalu 2,68 13,80 μmol/[min mg]). Výsledky ukázaly, že v rámci praktického využití LAH aktivity patatinu mohou být plané a netradiční kulturní druhy brambor zdrojem těchto bílkovin s vyšší úrovní aktivity. Ve studiu rozsahu LAH aktivity hlízových patatinů je třeba i nadále pokračovat a soubor studovaných genotypů u jednotlivých druhů více rozšířit. Dedikace Výsledky byly získány v rámci řešení projektů NAZV QI91A069, GAJU 029/2012/Z, GAJU 064/2010/Z. Použitá literatura Bárta, J., Čurn, V., Diviš, J. (2003): Study of biochemical variability of potato cultivars by soluble proteins, isoesterase, and isoperoxidase electrophoretic patterns. Plant Soil and Environment 49: Bárta J., Bártová V., Zdráhal Z., Šedo O. (2012): Cultivar variability of patatin biochemical characteristics: table versus processing potatoes (Solanum tuberosum L.). Journal of Agricultural and Food Chemistry 60: Davis C., Macrae A.R. (2001): Způsob výroby esterů alifatických monokarboxylových kyselin. Patentový spis. Úřad průmyslového vlastnictví, CZ B6 (uděleno dne ), 10 p. Dobson, G., Shepherd, T., Verrall, S. R., Griffiths, W. D., Ramsay, G., McNicol, J. W., Davies, H. V., Stewart, D. (2010): A metabolomics study of cultivated potato (Solanum tuberosum) groups Andigena, Phureja, Stenotomum, and Tuberosum using gass-chromatography mass spectrometry. Journal of Agricultural and Food Chemistry 58: Jiménez-Atiénzar, M., Cabanes, J., Gandía-Herrero, F., Escribano, J., García-Carmona, F., Pérez- Gilabert, M. (2003): Determination of the phospholipase activity of patatin by a continuous spectrophotometric assay. Journal of Lipid 38(6): Jiménez, M., Escribano, J., Pérez-Gilabert, M., Chazarra, S., Cabanes, J., García-Carmona, F. (2001): An octaethylene glycol monododecyl ether-based mixed micellar assay for determining the lipid acyl hydrolase activity of patatin. Lipids 36: Pots, A. M., Gruppen, H., Diepenbeek, Van R., Lee, Van Der J. J., Boekel, Van M.A.J.S., Wijngaards, G., Voragen, A.G.J. (1999): The effect of storage of whole protein of three cultivars on the patatin and protease inhibitor content, a study using capillary electrophoresis and MALDI-TOF mass spectrometry. Journal of the Science of Food Agriculture 79: Racusen D. (1987): Patatin in wild species of Solanum. Canadian Journal of Botany 66: Racusen D. (1986): Esterase specifity of patatin from two potato cultivars. Canadian Journal of Botany 64: Racusen D. (1992): Esterase activity and structural heterogeneity from a wild potato species. Canadian Journal of Botany 70: Sakaki, T., Kato, T., Saji, H. (2007): Lipid acyl-hydrolase in leaves of different kidney bean (Phaseolus vulgaris L.) cultivars: Purification and characterization of a kidney bean lipid acylhydrolase, and foliar lipid changes in the cultivars with ozone exposure. Plant Science 172: Shewry, P. R. (2003): Tuber Storage Proteins. Annals of Botany 91: Kontaktní adresa: Ing. Adéla Brabcová Jihočeská univerzita v Českých Budějovicích, Zemědělská fakulta Studentská 13, České Budějovice, 142

143 VZTAH MEZI PODJEDNOTKAMI GLUTENINŮ A REOLOGICKOU KVALITOU GENETICKÝCH ZDROJŮ PŠENICE Relationships between glutenin subunits and rheological quality of wheat genetic resources Bradová J. 1, Papoušková L. 1, Faměra O. 2, Dvořáček V. 1, Dotlačil L. 1 1 Výzkumný ústav rostlinné výroby,v.v.i.,, Praha - Ruzyně 2 Česká zemědělská univerzita Praha Abstrakt U souboru 28 genotypů ozimé pšenice se známým složením gluteninových podjednotek byly stanoveny reologické parametry pomocí farinografu, Mixolabu a Solvent Retention Capacity testu. Bylo provedeno pokusné pečení. Statistickou analýzou hlavních komponent byl prokázán pozitivní vztah HMW-GS alel Glu-A1b, Glu-B3i a Glu-D3d k parametru stability těsta měřeném na Mixolabu i farinografu. Pozitivní korelaci s objemem pečiva vykazovaly ve větší míře alely nízkomolekulárních gluteninů oproti alelám vysokomolekulárních gluteninů. Klíčová slova: genetické zdroje pšenice, reologická kvalita, podjednotky gluteninů Abstract Rheological parameters were determined by farinograph, Mixolab and Solvent Retention Capacity Test in a set of 28 winter wheat genotypes with known glutenin subunits composition. Baking test was performed as well. Subsequent statistical analysis of the main components showed a positive relationship of HMW-GS alleles Glu-A1b, Glu-B3i and Glu-D3d for stability dough parameter measured by Mixolab and farinograph. Positive correlation with bread volume was found mainly for low molecular weight glutenin alleles compared to high molecular glutenin alleles. Key words: wheat genetic resources, rheological quality, glutenin subunits Úvod V současné době dochází k rozšiřování sbírek genetických zdrojů, které je zaměřeno na shromáždění a záchranu genetických zdrojů domácího původu, na rozšíření kolekcí o novou genetickou diversitu a na získání donorů hospodářsky a biologicky cenných znaků (Dotlačil et al., 2010). Jako velmi cenné se jeví zejména krajové odrůdy, které si zachovaly lepší hodnoty některých znaků, které v důsledku selekce jen zřídka nalézáme u moderních odrůd, např.vysoký obsah proteinů, odolnost proti stresům, ranost (Kato & Yokoyama, 1992). Kvalita a využitelnost pšenice závisí na složení jednotlivých proteinů, které je podmíněné specifickými bílkovinnými geny (Shewry, 2001) a je charakteristické pro každou odrůdu (Bushuk, 1998). Jako nejvýznamnější markery pro hodnocení pekařské jakosti pšenice se uvádí vysoko- (HMW-GS) i nízko- (LMW-GS) molekulární podjednotky gluteninů (Gianibelli et al., 2002). Cílem práce bylo vyhodnotit vliv jednotlivých gluteninových podjednotek na vybrané reologické parametry pomocí relativně nových metod (Mixolab, SRC test), u kterých nejsou zatím z dostupných zdrojů k dispozici žádné informace o působení jednotlivých gluteninových alel na parametry těchto testů. Materiál a metody Soubor 28 genotypů ozimé pšenice zahrnující perspektivní krajové a moderní registrované odrůdy se známým složením gluteninových podjednotek (Tab.1) byl v roce 2009 pěstován v opakovaných pokusech na lokalitě v Praze-Ruzyni a v roce 2010 na 3 lokalitách Praha- Ruzyně, Kroměříž a Humpolec. Vedení a hodnocení pokusů probíhalo dle standardních pokusnických zásad a interních postupů vedení genetických zdrojů oddělení Genové banky. K identifikaci LMW-, HMW- GS byla použita metoda SDS-PAGE (Bradová et al., 2011). 143

144 Reologické hodnocení bylo provedeno pomocí: i) Mixolabu fy Chopin, Tripette et Renaud (Mixolab application handbook, 2008); ii) Solvent Retention Capacity testu (AACC 56-11); iii) farinografu (ČSN ISO ); iiii) pokusného pečení (dle protokolu Výzkumného ústavu mlýnsko-pekárenského průmyslu). Tab.1 Seznam hodnocených genotypů a složení jejich gluteninových podjednotek Genotyp/linie HMW-GS LMW-GS 1A 1B 1D 3A 3B 1D Bílá od Dukovan/5B a (1) c (7+9) a (2+12) a b a Viglašská červenoklasá/12b a (1) c (7+9) a (2+12) a b a Vouska z Třemošnice/13B c (0) c (7+9) a (2+12) a g b Bergland/18B c (0) c (7+9) a (2+12) f d c Tschermak weisser Marchfelder/20B a (1) c (7+9) a (2+12) a g b Szekacz 19/37B a (1) c (7+9) b (3+12) a d c Mindeszentpusztai/44B a (1) c (7+9) a (2+12) e/f b d Szekacz 1242/47B b (2*) c (7+9) d (5+10) a d b Szekacz 1242/47E b (2*) c (7+9) d (5+10) a d a Hatvani 5612/48A a (1) c (7+9) d (5+10) e/f c b Ukrajinka/52A a (1) c (7+9) d (5+10) a b a Stepowa/53D b (2*) c (7+9) d (5+10) e/f b b Slovenská 2/63A c (0) k (22) a (2+12) a c b Altsteirer linie a (Feldbach)/64C c (0) b (7+8) a (2+12) a i b Verrosaz 1229 BA/74C a (1) c (7+9) a (2+12) a c c Ostka Czerwona Lopusta/111B c (0) k (22) a (2+12) a b a Ostka Czerwona Lopusta/111C c (0) k (22) a (2+12) a c a Szekacz/116A a (1) c (7+9) d (5+10) e/f b a Eszterhazi Mindenes/117C a (1) b (7+8) d (5+10) e/f g a Fleischman 481/119A b (2*) k (22) a (2+12) d b a Hassan-Orif b (2*) c (7+9) d (5+10) a c c Bohemia c (0) i (17+18) d (5+10) a g c Akteur a (1) c (7+9) d (5+10) d g c Biscay c (0) d (6+8) a (2+12) e/f g c Florett b (2*) b (7+8) d (5+10) a g c RU a (1) e (20) d (5+10) e/f g c Šárka c (0) b (7+8) d (5+10) d g c Rheia a (1) d (6+8) d (5+10) a g c Výsledky a diskuze V uvedené práci vzhledem ke genetické heterogenitě sledovaných genotypů, velkému počtu kombinací gluteninových alel i jejich nepravidelné distribuci v jednotlivých genotypech byla použita analýza PCA pro vyhodnocení přímých vazeb jednotlivých HMW- a LMW-GS k vybraným parametrům (Obr.1, 2). Z grafu pro HMW-GS (Obr.1) je zřejmý výrazný pozitivní vztah alelických podjednotek Glu- 1Ab (2*), Glu-1Dd (5+10) i Glu-1Bi (17+18) k parametru stability těsta měřeném na Mixolabu i farinografu, ke tvarové charakteristice pečiva (výška/šířka) i k parametru SRC testu pro kyselinu mléčnou, který koreluje k Zelenyho sedimentaci (Dvořáček et al., 2012). Oproti tomu alela Glu-1Da (2+12), pro kterou jsou udávány horší pekařské vlastnosti (Radovanovič et al., 2002), silně pozitivně korelovala s poklesem konzistence těsta stanoveným na farinografu i s odpovídajícím parametrem Mixolabu (C1-C2). Kombinace 144

145 gluteninových podjednotek Glu-1Aa (1) a Glu-1Bc (7+9) vykazovaly významný pozitivní vliv na objem pečiva i na vaznost vody moukou stanovenou na Mixolabu. Obr.1 PCA analýza pro HMW-GS a vybrané reologické parametry 1,2 1,0 0,8 PCA graf (p1 vs. p2) 0,6 1B {7+8} 1D {5+10} p2 = 17 % 0,4 0,2 0,0-0,2-0,4-0,6-0,8 1A {0} 1B {6+8} 1B {17+18} 1B {20} 1B {22} pokles konzistence C1-C2 1D {3+12} 1D {2+12} 1A {1} 1B {7+9} objem pečiva vaznost f. vaznost m. 1A {2*} SRC kys.ml. v-š stabilita těsta m. stabilita těsta f. vývin těsta C1-1,0-1,2-1,2-1,0-0,8-0,6-0,4-0,2 0,0 0,2 0,4 0,6 0,8 1,0 1,2 p1 = 27 % Nezanedbatelným faktorem na výslednou pekařskou kvalitu je i efekt nízkomolekulárních gluteninů (Izadi-Darbandi, 2010). To bylo potvrzeno i v této práci, kdy LMW-GS se výrazně podílely na variabilitě některých technologických i reologických parametrů. Z grafu pro analýzu LMW-GS (Obr.2) je patrné, že pozitivní korelaci s objemem pečiva, který je významným technologickým znakem, vykazovala řada alel (například Glu-3Da, Glu-3Bb). Obr.2. PCA analýza pro LMW-GS a vybrané reologické parametry p2 = 18 % 1,0 0,8 0,6 0,4 0,2 0,0-0,2-0,4-0,6 PCA graf (p1 v s. p2) v aznost v f aznost. m. objem pečiv a pokles konz. C1-C2 3A {a} 3D {a} 3B {g } 3B {b} 3B {d} 3D {d} 3D {b} 3A {f } v ýv in C1 těsta 3B {c} 3B {i} 3A {e/f } v -š stabilita těsta f. stabilita těsta m. SRC ky s.ml. 3D {c} 3B {g} 3A {d} -0,8-1,0-1,0-0,8-0,6-0,4-0,2 0,0 0,2 0,4 0,6 0,8 1,0 p1 = 21 % Z výsledků vyplynulo (Tab.1), že hodnocené genotypy, které vykázaly dobré pekařské vlastnosti, obsahovaly gluteninové alely s pozitivním vlivem na tyto vlastnosti. Například pro linie 47/B a 47/E odvozené z maďarské krajové odrůdy Szekacz 1242 byla charakteristická skladba gluteninových alel Glu-1Ab (2*), Glu-1Bc (7+9) a Glu-1Dd (5+10). Naopak linie 145

146 Bergland 18/B s alelickou kombinací Glu-1Ac (0), Glu-1Bc (7+9) a Glu-1Da (2+12) patřila při hodnocení technologických i reologických charakteristik spíše k průměrným materiálům. Závěr Nalezené výsledky potvrzují možnost využití LMW- a HMW- gluteninových alel jako markerů pekařské kvality pro účely šlechtění moderních perspektivních odrůd pšenice. Dedikace Výsledky byly získány při řešení projektu MZe ČR č. QH a Použitá literatura AACC (2000): Solvent Retention Capacity. 10th Edition Approved Methods of the AACC, St.Paul, MN. Bradová J., Dvořáček V., Štočková L. (2011): Využití gelové a čipové elektroforézy pro identifikaci podjednotek gluteninů s vysokou a nízkou molekulovou hmotností u pšenice. Praha, VÚRV,v.v.i. Bushuk W. (1998): Wheat breeding for end-product use. Euphytica, 100, ČSN ISO (1995): Pšeničná mouka. Fyzikální charakteristiky těst. Část 1: Stanovení vaznosti vody a reologických vlastností na farinografu. Český normalizační institut, Praha. Dotlačil L., Hermuth J., Stehno Z., Dvořáček V., Bradová J., Leišová L. (2010): How can wheat landraces contribute to present breeding? Czech J.Genet.Plant Breed., 46, Dvořáček V., Papoušková L., Hermuth J., Dotlačil L., Faměra O., Sedláček T., Hálová I., Riljáková B. (2012): Využití metody retenční kapacity mouky pro predikci technologické kvality pšenice v České republice. Metodika pro praxi. Výzkumný ústav rostlinné výroby, v.v.i., xprint s.r.o. Gianibelli M. C., Masci S., Larroque O. R., Lafiandra D., MacRitchie F. (2002): Biochemical characterisation of a novel polymeric protein subunit from bread wheat. Journal of Cereal Science, 35, Izadi-Darbandi A., Yazdi-Samadi B., Shanejat-Boushehri A.-A., Mohammadi M. (2010): Allelic variations in Glu-1 and Glu-3 loci of historical and modern Iranian bread wheat (Triticum aestivum L.) cultivars. Journal of Genetics, 89, 2, Kato K., Yokoyama H. (1992): Geographical variation in heading characters among wheat landraces, Triticum aestivum L., and its implication for their adaptability. Theoretical and Applied Genetics, 84, 3-4, Mixolab applications handbook (2008): Rheological and Enzymatic Analysis. Chopin Applications Laboratory. Radovanovic N., Cloutier S., Brown D., Humphreys D.G., Lukow O.M. (2002): Genetic variance for gluten strength contributed by high molecular weight glutenin proteins. Cereal Chemistry, 79(6), Kontaktní adresa: Ing. Jana Bradová Výzkumný ústav rostlinné výroby,v.v.i. Drnovská 507, Praha 6 Ruzyně 146

147 NETRADIČNÍ OBILNINY A MOŽNOSTI JEJICH VYUŽITÍ Non-traditional cereals and possibilities for their use Ehrenbergerová J. 1, Jirsa O. 2, Martinek P. 2, Balounová M. 2, Stehno Z. 3, Pluháčková H. 1, Laknerová I. 4, Macháň, P. 1 1 Mendelova univerzita v Brně 2 Agrotest fyto, s.r.o., Kroměříž 3 Výzkumný ústav rostlinné výroby, v.v.i., Praha 4 Výzkumný ústav potravinářský Praha, v.v.i. Abstrakt Cílem práce bylo zjistit, zda se ve studovaném souboru cereálií vyskytnou genotypy s vyššími hodnotami nutričně a zdravotně prospěšných látek, pro které by mohly být využity v pekárenských či pečivárenských technologiích. Soubor tvořily netradiční odrůdy pšenice jarní a ozimé s odlišným zbarvením zrna, pšenice dvouzrnky a genotypy ječmene jarního bezpluchého typu se světlým i černým zrnem. Byly zjištěny mezidruhové i meziodrůdové rozdíly v obsahu dusíkatých látek, škrobu, betaglukanů, minerálních látek i objemové hmotnosti. Výsledky potvrdily možnost využití těchto netradičních genotypů jako zdrojů pro nové receptury výroby cereálních výrobků, které svojí přidanou hodnotou mohou obohatit současný sortiment. Klíčová slova: odrůdy minoritních druhů pšenice, dvouzrnka, bezpluchý ječmen, nutriční látky Abstract The aim of this study was to determine whether the set of cereals under study contained genotypes with higher values of nutritiously and for health beneficial substances for which they could be used in bakery technologies. The set comprised non-traditional varieties of spring and winter wheat with different grain color, emmer and spring barley genotypes of a hulless type with pale and dark grains. Interspecies and intervarietal differences in the content of nitrogenous substances, starch, volume weight, beta-glucans and mineral substances were determined. Results confirmed the possibility of using these non-traditional genotypes as sources for new formulas of cereal products which with their added value could enrich the current assortment. Some of the genotypes bring with their properties the possibility for the use in production of so-called functional foodstuffs Key words: minority wheat varieties, emmer, hulless barley, nutritional substances Úvod Současné obohacování cereálních výrobků látkami zdraví prospěšnými či jinými, je často omezeno jejich nežádoucími technologickými účinky (Jirsa a Vaculová, 2011). Proto jsou hledány možnosti obohacení základní výrobní suroviny přírodními látkami, či surovinami, které dodají novou užitnou hodnotu (Laknerová et. al., 2011). Ta může spočívat ve změně senzorických vlastností, např. barvě mouky, obohacení minerály, či v přínosnějším nutričním složení. Také se může jednat o základní surovinu, která bude mít větší výtěžnost mouky, což má i ekonomický dopad. Využití netradičních zdrojů cereálií ve výrobě výrobků z nich může přispět pestřejší k nabídce spotřebitelům. Současně se takto využije nabídka široké diverzity genetických zdrojů obilnin. Materiál a metody Pro studium byly vybrány následující odrůdy a linie: Pšenice ozimá: RU (pro modré zbarvení aleuronové vrstvy), Citrus a Bona Dea (pro žluté zrno), Indigo (pro purpurové zbarvení perikarpu) a 48M (pro modré zbarvení 147

148 aleuronové vrstvy). Pšenice jarní: UC (pro modré zbarvení aleuronové vrstvy), ANK 28B, Abyssinskaja arrasajta a Konini (pro purpurové zbarvení perikarpu). Pšenice dvouzrnka: Rudico (pro vyšší obsah polyfenolů a vit. skup. B), May Emmer (pro vyšší obsah kyseliny ferulové), Weisser Sommer (pro vyšší obsah cukrů, kys. ferulové a vit. B1) a Tapioszele (pro vyšší obsah vitamínu E a B). Ječmen jarní - bezpluché formy: AF Lucius (pro vyšší obsah polyfenolických látek), KM 1057 (pro vyšší obsah tuku, aminokyselin, vitamínu E a nízký obsah beta-glukanů), KM 2084 (pro vyšší obsah beta-glukanů), KM 2283 (pro vyšší obsah beta-glukanů) a Nudimelanocrithon (pro černé zrno a vyšší obsah anthokyanogenů).vybrané genotypy byly pěstovány ve sklizňových letech 2010 a 2011 na lokalitách Kroměříž a Praha standardní pěstební technologií. Získané výsledky vyjádřené v sušině zrna byly statisticky vyhodnoceny. Metody: Stanovení N-látek: metodou podle Dumase (ICC Standard No. 167), přístroj FP-528 (LECO) ICC STANDARD No Stanovení sušiny - gravimetricky (sušením), ČSN EN ISO 712. Minerální látky: Metodiky stanovení jsou součástí akreditovaných postupů (Jiří Zbíral a kol., 2005). Obsah beta-glukanů enzymatickou kolorimetrickou metodou - kit Megazyme (návod K-BGLU 04/06) (zapracováno v normách AACC 32-23, ICC 166, AOAC ) Objemová hmotnost u obilovin byla stanovena dle ČSN ISO (2003). Výsledky a diskuse Z grafů č. 1 až 3 je patrný významný vliv odrůd/linií i lokalit na výši a variabilitu hodnot objemové hmotnosti a dusíkatých látek (NL). Obsah škrobu a beta glukanů (BG) byl významně ovlivňován pouze genetickou složkou odrůdami/liniemi. V obsahu NL (graf č.1) se průměru za oba roky hodnoty NL pohybovaly od 10,78 % (odrůda Indigo) do 16,79 % (odrůda Tapioszele) na lokalitě Kroměříž a od 12,57 % (odrůda Citrus) po 20,37 % (odrůda Tapioszele) na lokalitě Praha. Odrůda Tapioszele tedy dosahovala nejvyšších hodnot na obou lokalitách. Spolu s odrůdami May Emmer (19,32 %), Rudico (19,04 %) a Weisser Sommer (18,40 %) se na lokalitě Praha lišily svými nejvyššími obsahy NL od ostatních v souboru, vyšších hodnot dosáhl také černý genotyp Nudimelanocrithon (16,97 %) a UC (16,80 %). K odrůdám s nejnižšími hodnotami NL patřily: Citrus (12,57 %), Bona Dea (12,80 %) a Indigo (12,86 %). Na kroměřížské lokalitě byly nejvyšší hodnoty (avšak nižší než v Praze) rovněž zjištěny u odrůdy Tapioszele a Weisser Sommer (16,03 %) a odrůdy May Emmer (15,34 %), další nejvyšší hodnota patřila černému genotypu Nudimelanocrithon (14,96 %). Vyšší obsah NL měly v obou lokalitách pšenice dvouzrnky (až statisticky významně vyšší v Praze), z ozimých genotypů pšenice pak UC a z bezpluchých genotypů ječmene genotyp Nudimelanocrithon. Odrůdy ozimé pšenice byly tedy většinou překonány pšenicí dvouzrnkou. O odrůdách Rudico a Tapioszele uvádí Lachman et al. (2012), že se rovněž vyznačují vysokým obsahem celkových polyfenolů a vitamínu E. Avšak genotypy s nejvyššími hodnotami NL právě na lokalitě v Praze poskytly z této lokality nejnižší objemovou hmotnost (graf č.2). Je možné hovořit o záporném vztahu zmiňovaných dvou znaků, neboť bezpluchá linie jarního ječmene KM 2283 s nejnižším průměrným obsahem NL (12,21 %) dosáhla nejvyšší objemové hmotnosti (OH) v souboru (79,90 kg.hl -1 ), patrnější byl negativní vztah na lokalitě Praha zejména u genotypů Tapioszele a Nudimelanocrithon. Odrůdy Tapioszele a May Emmer s vysokými obsahy NL poskytly i poměrně vysoké hodnoty OH. Záporný vztah mezi obsahem NL a škrobu uvádí např. Hřivna et. al. (2009), neboť mezi těmito látkami stanovili středně silný záporný korelační koeficient. (r = -0,56*). V naší práci potvrdil tento záporný vztah zejména jarní ječmen Nudimelanocrithon (průměrný obsah škrobu 54,30 %), odrůdy pšenice dvouzrnky Tapioszele, May Emmer, Weisser Sommer a 148

149 ozimá pšenice UC 66049, neboť na rozdíl od vysokých hodnot NL (graf č. 1) měly nejnižší obsah škrobu (od 59,74 % do 61,63 % - graf č. 2). Naopak nejvyšší (v mnoha srovnáních statisticky významně vyšší) průměrný obsah škrobu jsme zaznamenali u ozimých odrůd Citrus a Bona Dea (67,94 a 67,54 %), které v obsahu NL patřily k nehorším. Nejvyšší obsah škrobu u o odrůdy Citrus uvádí také Jirsa a Vaculová (2011). Pokud se podíváme na graf č.3, je z něj patrný velmi malý počet statisticky významných rozdílů v obsahu BG mezi studovanými genotypy. Zejména se to týká ozimých odrůd pšenice i pšenic dvouzrnek. Od těchto se z obou stanovišť liší zjištěné hodnoty u bezpluchých genotypů ječmene včetně černě zbarveného zrna u genotypu Nudimelanocrithon. Ten spolu s liniemi se žlutým zrnem KM 2284, KM 2283, KM 1057 a bezpluchou odrůdou AF Lucius měly statisticky významně vyšší množství BG od 2,55 % (KM 1057) do 5,53 % (KM 2084) než ostatními genotypy. Z minerálních látek byl zaznamenán vyšší obsah K (více jak 0,4 %) a P (více jak 0,5 %) oproti ostatním genotypům, dále u všech odrůd pšenice dvouzrnky, linie KM 2283 a jarního ječmene Nudimelanocrithon. 24 Graf č.1 Průměrný obsah NL (%) za roky 2010 a NL RU Citrus Lokalita Kroměříž Loklaita Praha Bona Dea Indigo 48M UC ANK-28B Abyss. arr. Konini KM 1057 Odrůda AF Lucius KM 2084 KM 2283 Nudimelano. Rudico May-Emmer Weiss. Somm. Tapioszele Graf č.2 Průměrné hodnoty objemové hmotnosti (kg/hl) a škrobu (%) za roky 2010 a RU Citrus Bona Dea Indigo 48M UC ANK-28B Abyssi. arr. Konini KM 1057 AF Lucius KM 2084 KM 2283 Nudimelano. Rudico May-Emmer Weiss. Somm. Tapioszele OH Škrob Lokalita: Kroměříž RU Citrus Bona Dea Indigo 48M UC ANK-28B Abyssi. arr. Konini KM 1057 AF Lucius KM 2084 KM 2283 Nudimelano. Rudico May-Emmer Weiss. Somm. Tapioszele Lokalita: Praha 149

150 7 Graf č.3 Průměrný obsah Beta-glukanů (%) za roky 2010 a Beta-glukany RU Citrus Bona Dea Indigo 48M Lokalita Kroměříž Lokalita Praha Odrůda Vysv.: intervaly spolehlivosti jsou konstruovány při P=0,05 UC ANK-28B Abyss. arr. Konini KM 1057 AF Lucius KM 2084 KM 2283 Nudimelano. Rudico May-Emmer Weiss. Somm. Tapioszele Závěr Výsledky studia potvrdily, že genotypy bezpluchého ječmene mohou být využity pro přípravu potravin s přidanou hodnotou, tzv. funkčních potravin, zejména pro vysoký obsah betaglukanů ale i dalších nutričně důležitých látek. Odrůdy ozimé a jarní pšenice s netradičním zbarvením zrna skýtají možnost aplikace v pekárenských technologiích, v přípravě výrobků barevně pestřejších. Studované pšenice dvouzrnky i černě zbarveného genotypu jarního ječmene by mohly být použity jako komponenty v nových recepturách cereálních výrobků jako donory vyššího obsahu dusíkatých a minerálních látek. Dedikace: Tento projekt byl podporován projektem NAZV MZe č. QI91B095 a QI111B044. Použitá literatura Hřivna L., Vavroušová P., Somerlíková K.: Hodnocení vztahů mezi vybranými technologickými parametry zrna ječmene a sladu. [CD-ROM]. In Jakost a efektivnost produkce regionálních a malých pivovarů, 2009:1-6. ISBN Jirsa, O., Vaculová K.: Možnosti potravinářského využití netradičních genotypů pšenice a ječmene. Úroda 12, 2011, vědecká příloha, s ISSN Lachman J., Orsák M., Pivec V., Jírů K.: Antioxidant activity of grain of einkorn (Triticum mono-coccum L.), emmer (Triticum dicoccum Schuebl [Schrank]) and spring wheat (Triticum aestivum L.) varieties. Plant Soil Environ., 58, 2012 (1): ISSN Laknerová, I., Mašková E., Ouhrabková J., Erban V., Balounová, M.: Vliv složení suroviny na senzorickou a nutriční jakost chleba. Úroda 12, 2011, vědecká příloha, s ISSN Kontaktní adresa: Prof. Ing. Jaroslava Ehrenbergerová, CSc. Mendelova univerzita v Brně, Zemědělská 1, Brno 150

151 VYUŽITÍ MOLEKULARNÍCH MARKERŮ VE ŠLECHTENÍ F1 HYBRIDNÍCH ODRŮD ŘEPKY (B. NAPUS L.) The utilization of molecular markers in breeding of F1 hybrid oil seed rape Havlíčková L., Jozová, E., Hejna O., Čurn V. Biotechnologické centrum, ZF JU v Českých Budějovicích Abstrakt Molekulární markery jsou moderní a progresivní technologií využívanou při šlechtění nových odrůd. Pro účely genotypizace existuje poměrně velké množství různých molekulárních přístupů a technik, které mají ve srovnání s dosud používanými morfologickými přístupy mnoho výhod. V porovnání k ostatním plodinám jsou programy zaměřené na šlechtění hybridních odrůd řepky olejky velmi úspěšné zejména proto, že využívají efektivních a ekonomicky výhodných systémů zabraňujících samosprášení při produkci F 1 hybridního osiva. V současné době je snahou českých šlechtitelů využít stabilní AI dihaploidní (DH) linie s unikátními recesivními S alelami v hybridním šlechtění. Na základě analýzy genu S lokusu SLG třídy I, byl v této studii vyvinut selektivní marker vhodný pro časnou detekci AI/AK rostlin. Molekulární markery tak mohou být použity k marker asistované selekci požadovaných rostlin v hybridním šlechtění řepky olejky. Klíčová slova: autoinkompatibilita (AI), Brassica napus, PCR, S lokus, MAS Abstract Molecular markers in general can be used as modern and progressive tool in breeding of new varieties. In comparison with morphological characteristics/traits, molecular markers have many advantages and relatively high number of different molecular techniques and approaches are available for plant genotyping purposes. Rapeseed hybrid breeding programmes are more successful in comparison with other plants, because of utilization of effective and economic pollination control system for the production of F 1 hybrid seeds. Czech breeders currently utilize SI doublehaploid lines with stable recessive S alleles in programmes of oil seed rape hybrid breeding. We developed molecular selectable marker based on analysis of S-locus class I SLG gene for early detection of SI/SC plants. Molecular markers thus should be used for marker-assisted selection in hybrid oilseed rape breeding. Key words: self-incompatibility (SI), Brassica napus, PCR, S locus, MAS Úvod V hybridních šlechtitelských programech je nezbytné zajistit efektivní systém kontroly při opylování, který zabrání samosprášení v rámci jedné rostliny, nebo na úrovni mateřské rodičovské linie. Při použití samosprašných rostlin v hybridním šlechtění jsou využívány různé přístupy a systémy zabraňující samosprášení na úrovni mateřských rostlin. Autoinkompatibilita (AI) je u řepky olejky úspěšně využívána k produkci F 1 hybridů. Princip AI je založen na odmítnutí pylového zrna pocházejícího z rostliny se stejným genotypem. U řepky je specificita interakce mezi pylem a bliznou kontrolována na sporofytické úrovni a to působením (minimálně) dvou genů a jejich alelických forem (S haplotypů) přítomných v jednom Mendelistickém lokusu, nazývaném též S lokus [1], [2]. Studium genů S lokusu vedlo k identifikaci samčího a samičího determinantu, kteří se podílejí na AI reakci; konkrétně jde o peptidový ligand (S locus protein 11;SP11, nebo také S locus cistein-rich protein; SCR) [3], [4] a odpovídající receptor (S-locus receptor kinase; SRK) [5]. Specificita rozpoznávací reakce je zajištěna vzájemnou interakcí mezi samčím determinantem SRK a jeho ligandem; samičím determinantem SP11. Interakce mezi SP11 a SRK spouští signalizační kaskádu s ohledem na přítomné S haplotypy, která plyne v odmítnutí vlastního pylu. Přesná signalizační dráha včetně přítomnosti její regulace je stále nejasná [6]. S haplotypy jsou členěny do dvou tříd: třída I je obecně dominantní nad třídou II v pylu a kodominantní v blizně a způsobuje silný AI 151

152 fenotyp [7]. Řepka (Brassica napus; 2n = 38, AACC) je autokompatibilní tetraploid, vzniklý spontánní mezidruhovou hybridizací dvou autoinkompatibilních druhů; B. rapa (2n = 20, AA) a B. oleracea (2n = 18, CC). Teoreticky jsou linie řepky olejky považovány za homozygotní v obou S lokusech; jeden S haplotyp tak pochází z B. rapa a druhý z B. oleracea. Vzhledem k inkompatibilitě vyskytující se u obou předků (B. rapa a B. oleracea) by bylo reálné předpokládat, že i potomek (B. napus) bude mít AI projev ve svém fenotypu, jak je tomu například u resyntetizovaných linií. Většina kultivovaných odrůd je však autokompatibilních [6] a vlastní ve svém A genomu S haplotyp třídy I (podobný haplotypu S 47 z B. rapa) a ve svém C genomu S haplotyp třídy II (podobný haplotypu S 15 z B. oleracea) [8], [9]. AK je u řepky olejky způsobena přítomností nezávislé mutace v dominantním S haplotypu, která způsobuje potlačení funkčního recesivního S haplotypu [8]. Na molekulární úrovni byly dosud identifikovány čtyři a tři odlišné S haplotypy třídy II u Brassica rapa (S 29, S 40, S 44, S 60 ) a B. oleracea (S 2, S 5, S 15 ) [10]. U homozygotních rostlin se dvěma recesivními S haplotypy tedy dochází k projevu autoinkompatibility i na úrovni jejich fenotypu. Dosud nebyla vyšlechtěna česká odrůda řepky olejky pomocí systému AI, avšak v současné době je AI intenzivně používána v programech českého hybridního šlechtění. Použití technik molekulárních markerů za účelem genotypizace šlechtitelských populací řepky olejky může pobídnout k investicím, které mohou urychlit proces hybridního šlechtění. Cílem této práce bylo praktické využití molekulárních markerů založených na detekci AI pro hybridní šlechtění. Materiál a metody AI linie AI20 se stabilním recesivním S haplotypem byla odvozena po křížení mezi AI donorem (WRG15) a AK donory 00-kvality (2051; Viking). Dihaploidní AI20 byla následně křížena jako mateřská rostlina se čtyřmi AK odrůdami Da Vinci Cabernet Chagall a Wisent (Obr. 1) s cílem získat F 1 hybridy, ze kterých bylo odvozeno 159 dihaploidních (DH) rostlin F 2 populace pomocí mikrosporové embryogeneze. Veškerý materiál byl získán z VÚRV, Praha-Ruzyně. Semenný test Hlavní a dvě postranní nakvítající větve byly zabaleny do plátěných izolátorů, zabraňujících cizosprášení. Po třech týdnech byly izolátory odstraněny pro zajištění přirozeného vývinu semen. Po dosažení zralosti byl počítán počet vyvinutých semen na šešuli rostliny byly označeny jako AI, když se počet semen na šešuli pohyboval v rozmezí 0 až 3. DNA extrakce a PCR amplifikace Genomická DNA byla izolována z mladých listů řepky olejky pomocí metody CTAB [11]. PCR reakce byla připravena s použitím primerů SLGa [12], vyvinutých ze sekvence SLG- A10 (úsek s bodovou mutací v S I haplotypu), kde tyto primery amplifikují region u AK rostlin, zatímco u AI rostlin nedochází k amplifikaci. Pro PCR reakci bylo použito 10 ng genomické DNA, 1,25 μl (10 μm) každého primeru, 12,5 μl PPP MM (TopBio), vše doplněno destilovanou vodou do finálního objemu 25 µl. PCR kondice byla připravena, jak uvádí Zhang et al. [12]. Produkty PCR byly separovány na 1,5% agarozovém gelu v 1 TBE pufru a vizualizovány pomocí EtBr. Výsledky a diskuze Semenný test AI byla hodnocena na úrovni F 2 populace u 159 DH rostlin. Hodnocení AI rostlin vykazovalo tři trendy: i) přítomnost rostlin s méně, než třemi semeny na šešuli; ii) rostliny se 4 10 semeny na šešuli (značených jako AI/AK); iii) rostliny s více, než 10ti semeny na šešuli, které byly považovány za AK. Distribuce AI : AK rostlin v F 2 DH populaci korespondovala s 152

153 předpokládaným poměrem 1:1; 13 % rostlin bylo vyhodnoceno za indiferentní (AI/AK; Obr. 2). PCR reakce Primerový pár SLGa amplifikoval band o předpokládané velikosti ~1100 bp u AK rostlin s S haplotypem třídy I. Segregační poměr AI : AK rostlin na základě molekulární analýzy vykazoval poměr 1 : 1 (Obr. 2). Obr. 1 Přehled modelu křížení; produkce tříliniových hybridů a tříliniových DH linií B. napus Obr F 2 DH rostlin bylo podrobeno semennému testu a následně provedena molekulární analýza jejich genotypů. PCR reakce s primery (SLGaF/R) detekující S haplotyp třídy I vedla k amplifikaci přibližně 1,1 kb fragmentu, který byl specificky přítomen u AK rostlin. Přesná funkce genu SLG na AI reakci není stále jasná, ale předpokládá se, že má pozitivní vliv na AI odpověď a to ne zcela známým mechanismem [13]. Specifické primery použité v této studii detekují gen SLG třídy I a identifikují tak i nefunkční S haplotyp třídy I, který je přítomen pouze u AK rostlin. Přes veškeré dosavadní poznatky týkající se interakce mezi geny SP11 a SRK, má použití genu SLG nesporný význam, zejména při determinaci jednotlivých haplotypů. S použitím těchto primerů byla detekována haploidní rostlina s S haplotypem třídy I a dále AI rostliny, které byly vlivem nechtěného cizosprášení vyhodnoceny semenným testem jako AK. Na základě molekulární analýzy tak nedošlo ke ztrátě cenných AI genotypů. Závěr V této studii byla ověřena možnost aplikace specifických markerů do tradičního systému hybridního šlechtění řepky olejky. Porovnání výsledků semenného testu a výsledků molekulární analýzy ukázalo, že kromě časové a prostorové náročnosti při prováděném semenném testu může selekce založena pouze na tomto základě dále vést ke ztrátě cenných AI genotypů (v našem případě se jednalo o 5% AI rostlin vyloučených na základě nepřesné selekce semenným testem). Molekulární analýza potvrdila předpokládaný štěpný poměr 1 153

154 (AK) : 1 (AI) v F 2 DH odvozených liniích. Použití molekulárního markeru založeného na analýze genu SLG I bylo úspěšně validováno; tento marker může být úspěšně použit k selekci AI rostlin za účelem eliminace AK rostlin v raném stádiu jejich ontogenetického vývoje. S použitím tohoto markeru tak lze výrazně redukovat počet rostlin pro následující experiment. Dedikace Tato studie byla podpořena projekty Mze NAZV QI111A075 a GAJU/064/2010/Z. Použitá literatura [1] Bateman, A.J. (1955). Self-incompatibility Systems in Angiosperms: III, Cruciferae. Heredity 9, pp [2] Nasrallah, J.B., Nishio, T., Nasrallah, M.E. (1991). The self-incompatibility genes of Brassica: expression and use in genetic ablation of floral tissues. Ann Rev Plant Physiol Plant Mol Biol 42, pp [3] Schopfer, C.R., Nasrallah, M.E., Nasrallah, J.B. (1999). The male determinant of selfincompatibility in Brassica. Science 286, pp [4] Suzuki, G., Kai, N., Hirose, T., Fukai, K., Nishio, T., Takayama, S., Isogai, A., Watanabe, M., Hinata, K. (1999). Genomic organization of the S locus: identification and characterization of genes in SLG/SRK region of S(9) haplotype of Brassica campestris (syn. rapa). Genetics 153, pp [5] Stein, J.C., Howlett, B., Boyes, D.C., Nasrallah, M.E., Nasrallah, J.B. (1991). molecular cloning of a putative receptor protein kinase encoded at the self-incompatibility locus of Brassica oleracea. Proc Natl Acad Sci USA 88, pp [6] Zhang, X., Yin, D., Zhu, W, Ma, C., Fu, T. (2011). Progress on Characterization of Self-incompatibility in Brassica napus L. Euphytica [7] Nasrallah, J.B., Nasrallah, M.E (1993). Pollen-stigma signaling in the sporophytic selfincompatibility response. Plant Cell 5, pp [8] Okamoto, S., Odashima, M., Fujimoto, R., Sato, Y., Kitashiba, H., Nishio, T. (2007). Self-compatibility in Brassica napus is caused by indipendent mutations in S-locus genes. Plant J 50, pp [9] Zhang, X.G., Ma, C.Z., Tang, W., Tu, J.X., Shen, J.X., Fu, T.D. (2008). Distribution of S haplotypes and its relationship with restorer-maintainers of self-incompatibility in cultivated Brassica napus. Theor Appl Genet 117, pp [10] Sato, Y., Sato, K., Nishio, T. (2006). Interspecific pairs of class II S haplotypes having different recognition specificities between Brassica oleracea and Brassica rapa. Plant Cell Physiol 47, pp [11] Williams, J.G.K., Hanafey, M.K., Rafalski, J.A., Tingey, S.V. (1992). Genetics analysis using RAPD markers. Method Enzymol 260, pp [12] Zhang, X., Ma, C., Fu, T., Li, Y., Wang, T., Chen, O., Tu, J., Shen, J. (2008). Development of SCAR markers linked to self-incompatibility in Brassica napus L. Mol Breeding 21, pp [13] Shiba, H., Iwano, M., Entani, T., et al. (2002) The dominance of alleles controlling selfincompatibility in Brassica pollen is regulated at the RNA level. The Plant Cell 14, pp Kontaktní adresa: Ing. Lenka Havlíčková, Ph.D. Biotechnologické centrum, ZF JU v Českých Budějovicích Studentská 13, České Budějovice 154

155 VELIKOST KOŘENOVÉHO SYSTÉMU MOŽNÉ SELEKČNÍ KRITÉRIUM PRO SUCHOVZDORNOST PŠENICE Root system size possible selection criterion for drought wheat resistance Heřmanská A. 1, Bláha L. 2 1 SELGEN, a.s., Šlechtitelská stanice Úhřetice 2 VÚRV,v.v.i., Praha - Ruzyně Abstrakt Práce je zaměřena na hodnocení velikosti kořenového systému sedmi odrůd pšenice jarní, u kterých se porovnávala elektrická kapacita kořenů v polních podmínkách. Využití elektrické kapacity, jako sekundárního selekčního znaku pro šlechtění pšenice na velikost kořenové soustavy (odolnost vůči suchu), by nemělo být opomíjeno vzhledem k možnosti rychlého předběžného screeningu. Klíčová slova: pšenice jarní, sucho, velikost kořenového systému (VKS), elektrická kapacita, selekce Abstract In the presented work, the evaluation of the root system of seven spring wheat varieties measured by the their electrical capacity in the field conditions was provided. The utilisation of the electrical capacity as the secondary selection trait for the wheat breeding i. e. for the root system size (drought resistance) should not be neglected due to the possibility of quick preliminary screening. Key words: spring wheat, drought, root system size (RSS), electrical capacity, selection Úvod Globální změny klimatu způsobují v posledních letech častější výskyt sucha i v ČR. Letošní rok byl v době vegetace jedním z nejsušších za posledních 60 let. Sucho natolik poškodilo v některých regionech porosty polních plodin, že se plochy osetých obilnin musely dokonce zaorávat. Celovegetační sucho, střídavé sucho a sucho doprovázené vysokou teplotou je v přírodě a v zemědělství nejdůležitější faktor limitující výkon rostlin. U pšenice se stává pravděpodobně hlavním abiotickým stresorem. V současné době je ve světě více jak 40 % potravin produkováno pouze ze zavlažovaných ploch. V jižní Evropě, ale již i na řadě míst naší republiky, je patrný pokles hladiny spodní vody, ubývání srážek, které jsou navíc nerovnoměrně rozdělené, neustále se zvyšuje průměrná teplota v době vegetace. Jižní Morava a Polabí přestávají být hlavními obilnářskými oblastmi. Jejich místo zaujímají vyšší polohy například okraj Českomoravské Vysočiny atd. Podle britských modelů je ve střední Evropě 100 % pravděpodobnost výskytu sucha každým druhým rokem. Z hlediska fyziologického má celovegetační sucho většinou vliv na zvýšení hloubky pronikání kořenů do půdy. Kořeny po prodloužení přivádějí vodu i k výše položeným bočním větvím, což umožňuje příjem živin díky zvlhčování přilehlého prostoru. Také mají schopnost změnit svoji morfologii po nástupu sucha, kdy se mění poměr kořenů k nadzemní části rostliny ve prospěch kořenů, u některých odrůd se naopak zmenší objem, ale zvětší se hloubka pronikání. Je známo, zejména z Austrálie, že v suchém roce jsou odrůdy pšenice s větším, ale hlavně do hloubky pronikajícím kořenovým systémem výnosnější a s lepšími kvalitativnějšími parametry. Kořeny však patří dosud mezi nedostatečně prozkoumaný orgán rostliny. Význam vlastností kořenů pro odolnost vůči abiotickým stresorům je však velký. Kořeny jsou nejcitlivějším orgánem rostliny, který svými morfologickými a fyziologickými vlastnostmi reaguje podstatně citlivěji na vnější prostředí, nežli nadzemní části rostliny. Na základě vlastností kořenového systému lze vybírat rostliny odolnější suchu. Pomineme-li výrazně suchovzdorné plodiny, pak můžeme během vegetace u odrůd jednotlivých plodin vzdorujících suchu pozorovat při přechodném suchu obranu rostlin označovanou jako 155

156 dehydratation avoidance, tedy strategii vyhnutí se dehydrataci. Ta spočívá ve zvýšeném příjmu vody z hlubších vrstev půdy, a to zejména díky reakci spočívající v prodloužení kořenů, snížení výparu vody (např. rolování listů, částečná defoliace atd.) a vyšší citlivostí průduchů ke ztrátě vody. Velký význam pro rostliny má ta reakce, například u odrůd se sníženou hladinou etylénu, která při nástupu sucha částečně uzavírá průduchy, omezuje dýchání, nemění intenzitu fotosyntézy, zvyšuje mírně obsah ABA a současně dochází ke zvětšení kořenů. Takovýto typ je vždy odolnější vůči suchu a slouží i jako model pro šlechtění suchovzdornějších typů. Pro vyšlechtění nové odrůdy pšenice, která bude efektivněji hospodařit s vodou, je nutné vytipovat vhodné donory suchovzdornosti. Obilniny jsou svým původem stepní trávy a tak plané formy a krajové odrůdy mohou být cennými šlechtitelskými zdroji pro efektivní hospodaření s vodou. Vedle testování genotypů v podmínkách sucha se ukázaly být efektivní některé nepřímé metody hodnocení kořenů. Jednou z metod pro stanovení velikosti kořenového systému, kterou jsme hodnotili v našem pokusu, je měření elektrické kapacity kořenů v půdě. Materiál a metody V roce 2009 byl na lokalitě Úhřetice, na dvou honech vzdálených od sebe cca 500 m, vysetý sortiment 37 odrůd pšenice seté (Triticum aestivum L.) formy jarní. Pokus byl založen ve čtyřech opakováních, ruční výsev proveden ve sponu 10 x 15 cm v řádcích o délce 1 m, tj. 10 rostlin v řádku = 1 odrůda. V rámci víceúčelového, blokově založeného pokusu ve čtyřech opakováních bylo na základě získaných měření elektrické kapacity v BBCH a přihlédnutí k vegetačnímu hodnocení pro následné křížení (s cílem získat soubor kříženců pro výběr odolných genotypů vůči suchu dle velikosti kořenového systému) vybráno 7 odrůd z odlišných proveniencí a s rozdílnou velikostí elektrické kapacity kořenů, a to odrůda Amaretto (DEU), Bárbaro-B (CHL), Bhouth 4 (SYR), Frontana (MEX), Granny, Septima a Zuzana (všichni tři CZE). V letech bylo pro stanovení velikosti kořenového systému těchto 7 odrůd jarní pšenice včetně jejich 20 získaných potomstev vyseto na 3 lokalitách - Chlumec nad Cidlinou, Hustopeče u Brna a Úhřetice. Každá odrůda a potomstvo byly zastoupeny na dané lokalitě 40 rostlinami. Během vegetace probíhalo měření elektrické kapacity kořenů šesti středových rostlin ve všech řádcích ve dvou termínech, a to ve fázi sloupkování až naduření listové pochvy (BBCH 34-43) a v době metání až kvetení (BBCH 59-69). Větší rozpětí ve fázích BBCH bylo dáno odlišnou raností sledovaných odrůd. Měření elektrické kapacity kořenů probíhalo pomocí přístroje LCR Meter ELC-133A, který byl nastaven na paralelní kapacitu při měřící frekvenci 1 khz. Naměřené hodnoty se uvádí v jednotkách kapacity nanofaradech (nf). V obvodu, mezi kořenovým systémem a půdou, prochází střídavý proud o frekvenci 1 khz. Jedna deska kondenzátoru tak představuje povrch kořenového systému a druhá tvoří substrát, v němž kořeny rostou. Jedná se tedy o měření elektrického rozhraní mezi vnitřním a vnějším prostředím po připojení dvou elektrod jedné pomocí sondy do půdního (kultivačního) prostředí, kde rostlina roste (v polovině sponu) a druhé připevněné na kleště na bázi všech stébel rostliny, a to ve výšce cca 1-2 cm nad povrchem půdy, bez kontaktu s půdou. Zjišťuje se tak pouze živá část kořene, která vykazuje určitou elektrickou aktivitu na membránách (Chloupek, 1977; Středa et al., 2009). Výsledky a diskuze Z výsledků měření elektrické kapacity kořenů byly zjištěny odrůdové rozdíly ve velikosti kořenového systému na všech třech lokalitách. Vypočítaná průměrná hodnocení elektrické kapacity na jednu rostlinu z měření ve vývojové fázi sloupkování a metání na třech lokalitách v letech jsou znázorněna v grafu

157 kapacita v nf kapacita v nf Úroda 12/2012, vědecká příloha časopisu Graf 1 Průměrná elektrická kapacita kořenového systému pšenice jarní měřená ve fázi sloupkování a metání na třech lokalitách v letech Průměrná elektrická kapacita kořenového systému pšenice jarní 4,8 4,4 AM BA BH FR GR SE ZU 4,0 3,6 3,2 2,8 2,4 2,0 1,6 1,2 0,8 0,4 0,0 Chlumec 2012 Chlumec 2011 Hustopeče 2011 Hustopeče 2010 Úhřetice 2011 Úhřetice 2010 Z výsledků je patrné, že ve sledovaných třech letech na třech lokalitách nejvyšší průměrnou velikost kořenového systému měla odrůda Amaretto a Bárbaro-B, jen na lokalitě Chlumec 2011 odrůda Amaretto dosahovala nepatrně slabší elektrickou kapacitu kořenů (graf 2). Dle Dostála et al. (2008) se však jedná jen o odhad, protože použitá metoda měření velikosti kořenového systému neumožňuje porovnání velikosti kořenového systému různých druhů a měření v rozdílné půdě. Růst kořenového systému je ovlivňován meteorologickými podmínkami daného ročníku, ale také půdními podmínkami, jako je půdní druh, typ, úrodnost půdy atd. Z našich měření však vyplývá, že jsou některé odrůdy s velkým kořenovým systémem schopny reagovat na více lokalitách a v různých ročnících poměrně stejně. Graf 2 Průměrná elektrická kapacita kořenového systému pšenice jarní měřená ve fázi sloupkování a metání na lokalitě Chlumec nad Cidlinou v roce 2011 Elektrická kapacita kořenového systému pšenice jarní na lokalitě Chlumec nad Cidlinou, ,4 4,0 sloupkování metání průměr 3,6 3,2 2,8 2,4 2,0 1,6 2,43 2,87 2,50 2,46 2,39 2,29 2,15 1,2 0,8 0,4 0,0 AMARETTO BÁRBARO-B BHOUTH 4 FRONTANA GRANNY SEPTIMA ZUZANA Tabulka 1 Průměrná elektrická kapacita kořenového systému pšenice jarní na lokalitě Úhřetice v roce 2010 Odrůda Průměrná elektrická kapacita kořenů (nf) sloupkování metání průměr Amaretto 4,57 1,00 2,79 Bárbaro-B 4,41 0,92 2,66 Bhouth 4 3,04 0,70 1,87 Frontana 3,19 0,52 1,86 Granny 3,87 0,93 2,40 Septima 3,98 1,08 2,53 Zuzana 4,35 0,83 2,59 Tyto dvě odrůdy potvrdily velký kořenový systém i v jednotlivých vývojových fázích (sloupkování a metání) po celou dobu sledování, kromě roku 2010, kdy na lokalitě Úhřetice 157

158 větší naměřenou průměrnou kapacitu v době metání měla odrůda Septima (1,08 nf), jak je uvedeno v tabulce 1. Jsou-li tyto dvě odrůdy případným donorem pro velký kořenový systém, ukáže až selekce potomstev v rané generaci F2 a F3, kdy se provádí selekce rostlin na velký a malý kořenový systém. Selekce je v těchto počátečních generacích po křížení zaměřena především na znaky geneticky kvalitativní, a tak lze rostliny poměrně lehce identifikovat. Průměrnou velikost kořenového systému odrůdy Frontana můžeme považovat v různých prostředích a ročnících za stabilní. Do hodnocení VKS nebyly zahrnuty rostliny nevyrovnané (malé) a napadené patogenem (virózní), jak jsme zjistili, dovedou ovlivnit elektrickou kapacitu. Odrůdy pšenice tolerantní k suchu by podle výpočtu autorů mohly zvýšit výnos o 14,5 % v suchých letech; každý další milimetr extrahované vody z půdy by se v Austrálii projevil vyšším výnosem o 55 kg.haˉ¹ (Manschadi et al., 2006). Závěr Existuje mnoho vhodných metod pro hodnocení kořenové soustavy. V našem pokusu jsme použili metodu vhodnou přímo pro selekci v polních podmínkách, a to využití elektrické kapacity kořenového systému, která dokáže vyselektovat genotypy s větším kořenovým systémem. Pokus byl založen na třech lokalitách - Chlumec nad Cidlinou, Hustopeče a Úhřetice. Hodnocení velikosti kořenového systému probíhalo v letech převážně ve fázi sloupkování a metání. Nejlepších výsledků, tedy většího kořenového systému, dosahovaly dvě odrůdy Amaretto a Bárbaro-B. Naproti tomu odrůda Frontana prokázala ve všech zkoušeních stabilní velikost kořenového systému. Ze zjištěných výsledků vyplývá, že lze provádět pomocí měření elektrické kapacity kořenů selekci na velký kořenový systém, a to by mohlo být jedním ze sekundárních selekčních znaků pro šlechtění pšenice na odolnost vůči suchu. Odrůdy, které mají schopnost vyvinout větší kořenový systém, jsou nejen předpokladem tolerance k suchu, ale mohou zajistit i výnosovou stabilitu v suchých letech. Použitá literatura Bláha, L., Vyvadilová, M: Současné možnosti využití hodnocení kořenového systému při pěstování a šlechtění rostlin. In: Bláha L., Hnilička F., Martinková J. (ed.): Současné možnosti fyziologie a zemědělského výzkumu přispět k produkci rostlin. VÚRV, Praha, 2010, Dostál, V., Středa, T., Chloupek, O.: Výnos a kvalita zrna odrůd pšenice a ječmene v suchém roce 2007 v souvislosti s velikostí kořenového systému. Pšenice od genomu po rohlík. České Budějovice, 2008, Chloupek, O.: Evaluation of size of a plant s root system using its electrical capacitance. Plant Soil 48, 1977, Manschadi, A. M., Christopher, J., Devoil, P., Hammer, G. L.: The role of root architectural traits in adaptation of wheat to water limited environments. Functional Plant Biology, vol. 33, no. 9, 2006, Středa, T., Dostál, V., Chloupek, O.: Šlechtění a výběr odrůd obilnin s větší tolerancí k suchu. Úroda 57, č. 5, 2009, Kontaktní adresa: Ing. Anna Heřmanská, DiS., SELGEN, a.s. Šlechtitelská stanice Úhřetice, Úhřetice 158

159 VYUŽITÍ MOLEKULÁRNÍCH MARKERŮ PRO HODNOCENÍ DIVERZITY GENETICKÝCH ZDROJŮ ŘEPKY (BRASSICA NAPUS L.) Use of molecular markers for assessment of diversity of genetic resources oil seed rape (Brassica napus L.) Jozová E. 1, Havlíčková L. 1, Čurn V. 1, Kučera V. 2, Klíma M. 2, Vyvadilová M. 2 1 Zemědělská fakulta JČU, České Budějovice 2 Výzkumný ústav rostlinné výroby, v.v.i., Praha 6 Ruzyně Abstrakt Diverzita genetických zdrojů řepky (Brassica napus L.) byla sledována pomocí analýzy ISSR markerů. Pro analýzu bylo vybráno 94 genetických zdrojů světového sortimentu významných z pohledu českých šlechtitelských programů krajových odrůd, starších i moderních odrůd populačních liniových a hybridních, šlechtitelských materiálů se změněnými parametry kvality, obsahu oleje, žlutosemennosti, materiálů využívaných v hybridním šlechtění. Celkem byly pro hodnocení genetické diverzity použity tři ISSR markery (UBC 812, UBC 840 a UBC 845), díky nimž bylo možné odlišit jak jednotlivé genetické zdroje z pohledu geografického rozložení, tak i z hlediska historie šlechtění. Tato technika je díky své opakovatelnosti a poměrně vysokému polymorfismu vhodná jako marker pro určení geneticky nejvzdálenějších zdrojů a v kombinaci s jinými molekulárními metodami (SSR, AFLP atd.) se jeví jako velmi vhodná pro hodnocení genetické diverzity a charakterizování genetických zdrojů řepky. Klíčová slova: Brassica napus, ISSR, DNA markery, šlechtění Abstract Genetic diversity in a group of 94 genetic resources from world collection of - landraces, old and modern varieties, population, lines and hybrid varieties, breeding materials with changed parameters of quality, oil content, yellow-seeds, materials used in hybrid breeding was assessed using ISSR markers. Three ISSR markers (UBC 812, UBC 840 and UBC 845) were used to determine differences of genetic resources in terms of geographical distribution, as well as from the history of breeding. Due to its relatively high repeatability and high polymorphism level is this technique suitable as a marker for identification of genetic distances in breeding material. ISSR technique as well as SSR or AFLP seems to be very suitable tools for assessment of genetic diversity and genetic resources of oilseed rape. Key words: Brassica napus, ISSRs, DNA markers, breeding Úvod V České republice je řepka (brukev řepka olejka, Brassica napus L.) jednou z nejvýznamnějších plodin, v roce 2012 byla pěstovaná na ploše 401,2 tisíc ha o průměrném výnosu 2,79 t/ha. Řepka olejná sice patří do skupiny pozdně zkulturněných plodin, přesto v posledních desetiletích došlo k intenzivnímu šlechtění. Bohužel v důsledku zaměření selekčního procesu pouze na hospodářsky nejdůležitější parametry došlo k zúžení genetického základu odrůd řepky a tím pádem klesla míra genetické diverzity [8]. Díky vysokému a rychlému nárůstu počtu odrůd řepky, klesla i schopnost jejich identifikace pouze na základě morfologických znaků, proto jsou vyvíjeny vhodné molekulární markerovací systémy, které mají dostatečnou vypovídací schopnost. Molekulární markery mají celou řadu výhod a jsou úspěšně používány při určování pravosti odrůd, kontrole odrůdové čistoty hybridních odrůd, ale i detekci transgenů. Markerovací systémy se odlišují v obsahu informací, počtu výsledných polymorfismů, stupni automatizace, pracnosti a výší finančních nákladů [3]. V poslední době se k metodám vhodným pro indetifikaci odrůd zařadila technika ISSR neboli Inter Simple Sequence Repeats. Tato technika je modifikací techniky SSR markerů [5, 11]. Je 159

160 založena na použití PCR amplifikace s náhodně ukotveným mikrosatelitovým motivem. Na rozdíl od techniky SSR není při ISSR nutná žádná předchozí znalost sekvence či struktury studovaného genomu. ISSR se stala účinným nástrojem pro studium genetické rozmanitosti na úrovni rodičů a jejich potomstva u rodu Brassica [1, 6]. Tato metoda je vhodná díky vysokému polymorfismu, reprodukovatelnosti výsledků a finanční nenáročnosti [4]. Cílem této studie bylo zjistit variabilitu mezi odrůdami a dalšími genetickými zdroji, které prošly vývojem jak z hlediska šlechtitelského, tak i geografického a případně pomoci šlechtitelům při výběru nejvzdálenějších genotypů jako vhodných rodičů v novošlechtění. Materiál a metody Pro analýzu ISSR markerů byl vybrán soubor 94 genetických zdrojů světového sortimentu obsahující krajové, starší i moderní odrůdy, populační liniové a hybridní odrůdy, šlechtitelský materiál se změněnými parametry kvality, obsahu oleje, žlutosemennosti a materiál využívaný v hybridním šlechtění, tj. AI linie, sterilní komponenty typu Ogu-INRA, Pol/Shaan 2A a obnovitele fertility. Analyzované genetické zdroje byly na základě původu a charakteru rozděleny do patnácti skupin (Tab. 1). Veškerý semenný materiál byl získán z partnerských pracovišť VÚRV Praha, VÚO Opava, Sempra Slapy a Selgen Chlumec. Tab. 1 Rozdělení odrůd do jednotlivých skupin skupina O1 O2 O3 O4 O5 O6 O7 původ staré české krajové odrůdy a odrůdy přechodného typu staré 00 odrůdy české a západoevropské anglosaské odrůdy francouzské odrůdy německé odrůdy moderní české odrůdy Australské a americké odrůdy skupina O8 O9 O10 K SL CMSS AIK CMSO původ východoevropské odrůdy čínské odrůdy odrůdy z nejasným původem šlechtitelský materiál se změněnými parametry kvality šlechtitelský materiál materiál pro CMS typu Pol/Shaan 2A materiál pro AIK materiál pro CMS typu Ogu-INRA Pro analýzu ISSR markerů byly rostliny odebírány ve fázi děložních lístků, vždy 36 rostlin u každého z 94 analyzovaných genetických zdrojů, z kterých byl vytvořen směsný vzorek. DNA byla ze vzorků izolována pomocí komerčního kitu Invisorb Spin Plant Mini Kit (INVITEK). Na základním souboru vzorků bylo vyzkoušeno 18 UBC primerů z nichž byly použity 3 UBC primery s nejlepší vypovídací hodnotou a vysokou variabilitou. PCR reakce probíhala v objemu 10 µl, v 1x reakčním pufru (75 mm Tris HCl, ph=8,8, 20 mm (NH 4 ) 2 SO 4, 0,01% Tween 20, 2,5 mm MgCl 2, 200 µm dntps), 12,5 pmol primeru (IDT), 0,5 U Taq Purple DNA polymerázy (PPP Master Mix, Top-Bio, CZ), 2x BSA a 50 ng templátové DNA. Amplifikace proběhla při následujícím teplotním profilu: 2min při 95 C, 40 cyklů: 20s 93 C, 1min 52 C, 20s 72 C a 6min 72 C. Fragmenty byly vyzualizovány na 2% agarosovém gelu obarveném ethidium bromidem vždy ve dvou opakováních pro každý analyzovaný vzorek. Výsledky a diskuze Pro analýzu byly na základě provedené optimalizace vybrány 3 ISSR markery (viz. Tab 2). Výsledky z gelové elektroforézy byly zaznamenány, gely byly digitalizovány, provedena obrazová analýza a zaznamenány pozice ISSR markerů. Ze získaných dat byla sestavena matice znázorňující přítomnost či nepřítomnost jednotlivých fragmentů. Molekulární data byla statisticky vyhodnocena pomocí programu MVSP (Kovach Comp. Serv.) a byla provedena shluková (UPGMA) a PCO analýza. Výsledky PCO analýzy v podobě ordinačního diagramu jsou uvedeny na Obr

161 Axis 2 Úroda 12/2012, vědecká příloha časopisu Tab. 2 Charakteristika použitých primerů Primery teplota počet variabilních velikost označení sekvence* anealingu ( C) fragmentů fragmentů fragmentů (bp) UBC 845 (CT) 8 RG UBC 812 (GA) 8 A UBC 840 (GA) 8 YT * R=A/G, Y=C/T Obr. 1 Výsledky analýzy ISSR markeru založeného na přítomnosti a nepřítomnosti fragmentů po zpracování v programu MVSP. Použitý matematický model PCO analýza PCO case scores (Gower General Similarity Coefficient) o1 I_006 I_009 I_045 I_036 I_148 I_150 I_037 I_153 I_104 I_173 I_086 I_087 I_152 I_035 I_154 I_ I_089 I_061 I_158 I_069 I_155 I_067 I_172 I_090 I_072 I_167 I_147 I_163 I_049 I_071 I_ I_169 I_095 I_054 I_149 I_102 I_052 I_068 I_050 I_051 I_075 I_098 I_030I_076 I_165 I_077 I_160 I_070 I_004 I_161 I_066 I_214 I_157 I_046 I_003 I_ I_ I_156 I_039 I_033 I_056 I_ I_025 I_196 I_198 I_162 I_007 I_174 I_034 I_ I_065 I_005 I_059 I_048 I_062 I_055 I_073 I_058 I_182 I_212 I_215 I_057 I_032 I_031 I_038 I_029 I_ I_002 I_ I_010 o2 o3 o4 o5 o6 o10 o7 k CMSO AIK sl o8 I_064 I_008 I_ o9 CMSS I_ Axis 1 Z provededené analýzy je patrné, že u českých odrůd dochází k významnému zúžení genetické variability. Původní krajové odrůdy (O1) vykazují velkou šíři genetické diverzity, která je pravděpodobně zapříčiněna odlišným genetickým pozadím. Starší 00 a moderní 00 odrůdy mají výrazně užší rozsah genetické diverzity, velmi výrazné zúžení je patrné zejména u poslední zmiňované skupiny (O6). Patrné je odlišné umístění těchto skupin (O2 a O6) v ordinačním diagramu a lze konstatovat, že v průběhu poměrně krátké doby došlo u českých odrůd řepky k dosti zásadní změně v genetickém pozadí. Odrůdy západoevropského původu (O3 - O5) stále vykazují poměrně značnou variabilitu a u těchto skupin není zúžení genetické variability tak zřetelné. Tento fakt neznamená, že u těchto skupin odrůd došlo ke konzervaci jejich genetické struktury Odrůdy východoevropské a odrůry mimoevropského původu pak leží na okrajích diagramu genetické variability a představují materiály s výrazně odlišným genetickým pozadím. Genetické zdroje šlechtitelské materiály z aktuálních českých šlechtitelských programů pak představují velmi zajímavou skupinu. U těchto materiálů byla porušena uzavřenost a malá šíře genetiské varibility typická pro moderní české 161

162 odrůdy a aktuální šlechtitelské materiály v podstatě zaujímají rozsah genetické diverzity evropských odrůd. Šlechtitelské materiály zaměřené na změnu parametrů kvality naopak představují poměrně úzce vymezenou skupinu (vzorky I86-90). Analýza ISSR markerů se jeví jako vhodný nástroj pro hodnocení velkých souborů genetických zdrojů řepky. U řepky, obdobně jako u dalších zemědělských plodin je dostupný poměrně rozsáhlý soubor nejrůznějších molekulárních markerovacích technik [2, 11]. Markerovací systémy se liší v obsahu poskytovaných informací, hladině identifikovaného, stupni automatizace, nutnosti lidské práce a finančními náklady. Zpočátku pro fingerprinting odrůd často využívaná technika RAPD je nyní nahražována novými technikami, jako jsou mikrosatelity (SSR) a AFLP [7, 9]. Závěr U souboru 94 šlechtitelsky významných genetických zdrojů řepky (staré krajové odrůdy, starší i moderní odrůdy českého i světového sortimentu, aktuální šlechtitelské materiály) byla provedena analýza ISSR markerů a byla vyhodnocena úroveň genetické diverzity genetických zdrojů řepky. Celkem bylo testováno 18 ISSR primerů, na základě výsledků amplifikace, stability a reprodukovatelnosti získaného spektra markerů byly vybrány 3 nejvhodnější primery. Tyto primery generovaly celkem 52 fragmentů, z nichž bylo 47 polymorfních. Získaná molekulární data byla statisticky vyhodnocena a z analýz vyplývají významné změny v genetické diverzitě (šíři genetické variability a genetické struktuře) analyzovaných genetických zdrojů resp. skupin genetických zdrojů. Výsledky poukazují i na vhodnost techniky ISSR pro rychlé hodnocení genetické diverzity řepky. Poděkování Studie byla získána za podpory projektů MZe NAZV QI 111A075 a GAJU 064/2010/Z. Použitá literatura [1]Abdelmigid H.M., (2012). African Journal of Biotechnology, Vol. 11(24): [2]Caetano-Anolés, et al., (1997). DNA Markers: Protocols, Applications, and Overwies [3]Čurn V., et al., (2007). Elsevier Publ., 45: [4]Gupta K., et al., (2004). Proceeding of the 4th International Crop Science Congress, Brisbane, Australia, 26 September 1 October 2004 [5]Kantety R.V., et al., (1995). Mol. Breed. 1: [6]Liu A., et al., (2006). Genetic Resources and Crop Evolution, 53: [7]Lombard V., et al., (2000). Crop Science 40: [8]Sobotka R., et al., (2004). J. Appl. Genet. 45: [9]Soltis D.E., et al., (1998). Molecular Systematics of Plants II DNA Sequencing. Kluwer Academic Publishers, Novell, MA. [10]Weising K., et al., (2005). DNA Fingerprinting in Plants. Principles, Methods, and Apllications [11]Zietkiewics E., et al., (1994). Genomics 20: Kontaktní adresa: Ing. Eva Jozová Biotechnologické centrum ZF, JČU v ČB, Studentská 13, České Budějovice 162

163 STANOVENÍ PODOBNOSTÍ V ČESKÉ KOLEKCI ŠTÍROVNÍKU RŮŽKATÉHO (LOTUS CORNICULATUS L.) The determination of similarities in the Czech collection of birdsfoot trefoil (Lotus corniculatus L.) Knotová D. 1, Hutyrová H. 2 1 Zemědělský výzkum, spol. s r.o., Troubsko 2 Výzkumný ústav pícninářský, spol. s r.o. Troubsko Abstrakt V individuální výsadbě byla v letech 2008 a 2009 hodnocena česká kolekce zahrnující 25 původů štírovníku růžkatého (Lotus corniculatus L.). 14 původů představovalo odrůdy světového sortimentu a 11 původů plané formy získané sběrovými expedicemi v ČR a v zahraničí. Na 10 rostlinách každého původu byly zhodnoceny morfologické, výnosové a kvalitativní znaky. Celkem bylo zhodnoceno 34 znaků. Ze zjištěných hodnot byly pro jednotlivé původy odhadnuty bodové a intervalové střední hodnoty a variační koeficienty jako míry variability mezi a uvnitř původů v daném znaku. Bodové odhady středních hodnot původů vytvořily matici, která posloužila zpracování metodou shlukové analýzy. Na základě těchto výsledků byly určeny původy s největší podobností. Klíčová slova: štírovník růžkatý, shlukový analýza, popisné deskriptory, kolekce odrůd Abstract In 2008 and 2009 the Czech collection of 25 origins Lotus corniculatus L. were evaluated in individual out planting. The 14 origins represent the origins of the world range of varieties and the 11 origins were the wild form obtained by collecting expeditions in CZ and in abroad. On 10 plants of each origin the morphological, yield and quality characters were evaluated. In total the 34 characters were evaluated. From the obtained values the point and interval middle values and the coefficients of variations were estimated for each of the origin in concrete character. Point estimations of middle values created matrix were elaborated by the method of cluster analysis. Based on these result the origins were determined with the greatest similarities. Key words: Lotus corniculatus L., cluster analysis, descriptors, collection of varieties Úvod Štírovník růžkatý (Lotus corniculatus L.) je druh běžně vyskytující se v Evropě, západní Asii a severní Africe. V dalších oblastech je jeho výskyt druhotný (Rak, 2007). Roste na teplých a vlhkých stanovištích jako jsou louky, pastviny, břehy, meze (Chrtek, 2002). Pícninářsky je hodnotným druhem s vysokým obsahem bílkovin. Nejčastěji se uplatňuje ve směskách, vzácněji jako monokultura. Zvyšuje nutriční hodnotu píce a sena (Slavík a kol. 1995). Lotus corniculatus L. je tetraploidní druh, i když byl někdy charakterizován jako druh diploidní (Grant a Small, 1996). Průzkumy ukazují, že tento druh je jedním z nejrozšířenějších druhů celoročně přítomných na přírodních pastvinách v rozmezí nadmořských výšek, ph a množství srážek (Sardaro et all, 2008). Steiner a Santos (2001) uvádí, že geografická vzdálenost není spojena s genetickou vzdáleností. Podobnost genotypů je spojena s podobností stanoviště, i když geograficky velmi vzdálenými. Studium podobnosti původů v kolekcích genofondů je důležité z hlediska vyloučení duplicit v uložených materiálech genetických zdrojů v genových bankách. Kolekce významných zemědělských plodin bývají značně rozsáhlé a často se v nich objevují duplikace (Dotlačil 2005). Z tohoto důvodu je pro uživatele kolekcí velmi obtížná orientace v těchto materiálech. Mezi základní studie genofondů rostlin patří hodnocení variability znaků a vlastností mezi jednotlivými populacemi a genotypy (Brindza 1998). Popis a zhodnocení planých populací jetele lučního z hlediska morfologických a hospodářských 163

164 znaků a jejich porovnání s registrovanými odrůdami provedla Drobná (2005). Praktickým využitím statistických metod při studiu diverzity se na příkladu genetických zdrojů cizrny beraní zabývaly Žáková et Benková (2003). Materiál a metodika V průběhu roku 2008 a 2009 bylo v individuální výsadbě v polních podmínkách hodnoceno 25 původů druhu Lotus corniculatus, soustředěných v české kolekci tohoto druhu. 14 původů představovaly odrůdy světového sortimentu a 11 původů plané formy získané sběrovými expedicemi v ČR a v zahraničí. Na 10 rostlinách každého původu bylo hodnoceno 34 znaků: šířka řapíku, délka lodyh, tloušťka lodyh, počet internodií, výška rostliny, délka kořene, tloušťka kořenového krčku, počet lodyh, počet bočních větví, délka středního internodia, zelená hmota trsu, suchá hmota trsu, počet květenství na rostlině, počet květů v květenství, délka květu, šířka květu, délka květního kalicha, délka lusku, šířka lusku, počet semen v lusku, počet květenství na lodyze, šířka terminálního lístku, délka terminálního lístku, plocha listu, plocha terminálního lístku, výnos semen a jedna hodnota byla stanovena u znaků obsah dusíkatých látek, obsah tuku, obsah vlákniny, obsah popele, obsah SNL, obsah cukrů, stravitelnost sušiny a hmotnost tisíce semen. Z naměřených hodnot byly pro jednotlivé původy provedeny bodové a intervalové odhady středních hodnot jako míry proměnlivosti mezi původy a dále odhady variačních koeficientů jako míry vnitroodrůdové variability. Matice středních hodnot byla zpracována metodou shlukové analýzy. Výsledky a diskuse Některé morfologické parametry tohoto druhu studoval v porostu např. Sareen a Dev (2003). Shlukovou analýzu 28 světových genotypů provedenou na základě 18 morfologických charakteristik uvádí např. Steiner and Santos (2001). Matice středních hodnot posloužila ke zpracování shlukové analýzy, jejíž výsledek je uveden v gr. 1. Největší podobnost mezi zkoušenými původy byla zjištěna u dvojice planých forem TROU 164/95 a TROU 151/96, dále velkou podobnost vykázaly plané formy POD 1/98 a SVN 55/01. Ani v jednom z obou případů se však nejedná o duplicity, protože se jednalo o sběry z různých lokalit. Velkou podobnost také vykázaly odrůdy Táborák (CZE) a Grassland Goldie (NZL). Ani v tomto případě nejde o duplicity jak je zřejmé z jejich státu původu. Studovaný materiál vytvořil v podstatě 5 shluků. První je tvořen planými formami (TROU 164/95, TROU 151/96 a ZN 1/00) a k nim se dále přiřazují již zmíněné odrůdy Táborák a Grassland Goldie. Tyto původy zaznamenaly vysoké hodnoty ve znacích počet bočních větví, délka středního internodia a obsahu dusíkatých látek, tuku, popele a stravitelných dusíkatých látek. Druhý shluk je tvořen pouze planými formami (POD 1/98, SVN 55/01 a TROU 8/01). Původy v tomto shluku měly vysoké hodnoty znaků délka kořene a hmotnost tisíce semen. Třetí shluk tvoří odrůdy Bekeszi (HUN), Skrzeszowiecka (POL) a k nim se přiřazuje planá forma TROU 144/95. Původy tohoto shluku vynikaly ve stravitelnosti. Další shluk tvoří odrůdy Víglašský (SVK), Lotar (CZE), Puszta (HUN) a Malejovský (CZE). Tyto genotypy se od ostatních původů lišily vysokými hodnotami znaků plocha terminálního lístku, plocha listu a tloušťka lodyh. Poslední shluk tvoří zbývající odrůdy kolekce a planá forma SUM 382/94 z Rakouska. U odrůd se jedná o kanadské odrůdy Mirabel, Upstart, Bull a Leo a dále o odrůdy Szabolci (HUN) a Polom (SVK). V tomto shluku se soustředily původy, které vynikaly ve znacích zelená hmota trsu, počet květenství na rostlině, délka terminálního lístku a plocha listu. Samostatně stojí planá forma označená ROH 63/00. Tento původ zaznamenal nejvyšší hodnoty u znaků počet internodií, zelená hmota trsu, suchá hmota trsu počet květenství na rostlině a počet květenství na lodyze. 164

165 Závěr Planě rostoucí populace jsou velice často cenným zdrojem vlastností, které mohou být dále rozvíjeny ve šlechtitelském procesu. Rozsáhlá genetická variace byla popsána u štírovníku růžkatého Chrtkovou-Žertovou (1973). Steiner a Poklemba (1994) uvádí, že stávající odrůdy byly vyšlechtěny z úzkého genetického základu. Ukázalo se, že využití shlukové analýzy pro hodnocení genofondů rostlin na základě morfologických a výnosových charakteristik je vhodné. Soubor se rozdělí na několik shluků podle největší podobnosti. Tímto způsobem je možné vyhledat duplicity v souboru a uživatel si pak může vybrat nejvhodnější shluk, případně nejvíce podobné či odlišné genotypy. S těmito výsledky je možné dále pracovat ve šlechtitelských programech, neboť je možné vybírat z geneticky vzdálenějších populací. Graf 1: Dendrogram položek štírovníku růžkatého (Lotus corniculatus L.) TROU 164/95 TROU 151/96 ZN 1/00 Grassland Goldie CD-11 (Táborák) POD 1/98 SVN 55/01 TROU 8/01 Bekesi TROU 144/95 Skrzeszowiecka Malejovsk Víglašsk Lotar Puszta TROU 6/97 TROU 28/96 ROH 63/00 SUM 382/94 Polom Szabolci Leo Mirabel Upstart Bull Lotus corniculatus Com plete linkage Euclidean distances Distance of connection Dedikace Výsledek byl získán za částečné institucionální podpory na dlouhodobý koncepční rozvoj výzkumné organizace a částečně z prostředků Národního programu konzervace a využití genetických zdrojů kulturních rostlin a agrobiodiverzity, financovaného MZe ČR. 165

166 Použitá literatura Brindza J. (1998): Hodnotenie genofondu rastlín z pohl adu teorie chaosu. Zborník: Hodnotenie genetických zdrojov rastlín Chrtková-Zertová, A A monographic study of Lotus corniculatus L. I. Central and Northern Europe. Rozpravy Ceskoslovenske Akademie Ved 83:1 94. Dotlačil L. (2005) : Cíle a metody pro lepší management a využití kolekcí. In: Racionalizace managementu a využívání genetických zdrojů zemědělských plodin. Agritec Plant Research, s.r.o. Šumperk a VÚRV Praha Ruzyně. Genetické zdroje č. 93, Drobná J. (2005): Hodnotenie divorastúcich populácií ďateliny lúčnej (Trifolium pratense L.). In: Hodnotenie genetických zdrojov rastlín, VÚRV Piešťany: Grant, W. F., and E. Small The origin of Lotus corniculatus (Fabaceae): A synthesis of diverse evidence. Can. J. Bot. 74: Kubát, K., Hrouda, L., Chrtek, J. jun., Kaplan, Z., Kirschner, J. a Štěpánek J. (eds.): Klíč ke květeně České republiky, Academia, Praha, 2002, s Rak, L., 2007: Lotus corniculatus: Sareen, S., Dev, I.: A preliminary study to explore potential of Lotus corniculatus L (Birdsfoot trefoil) in Palampur ( Himachal Pradesh, India)., Lotus Newsletter, 2003, Volume 33: 3 5. Savo, M. L., Sardaro, Atallah, M., Tavakol, E., Russi, L. and Porceddu, E.: Diversity for AFLP and SSR in Natural Populations of Lotus corniculatus L. from Italy Crop Sci., May 1, 2008; 48(3): Slavík, B. a kol.: Květena České republiky 4, Academia, Praha, 1995, s Steiner, J.J., and Poklemba, C.J.: Lotus corniculatus classification by seed globulin polypeptides and relationship to accession pedigrees and geographic origin. Crop Sci., 1994; 34,: Steiner, J.J. and de los Santos, G.G.: Adaptive Ecology of Lotus corniculatus L. Genotypes: I. Plant Morphology and RAPD Marker Characterizations Crop Sci., March 1, 2001; 41(2): Žáková M., Benková M. (2003): Využitie štatistických metód v studiu diverzity kolekcie genetických zdrojov v príklade cícera baranino. In: Hodnotenie genetických zdrojov rastlín, VÚRV Piešťany: Kontaktní adresa: Ing. Daniela Knotová Zemědělský výzkum, spol. s r.o. Zahradní 1, Troubsko 166

167 VARIABILITA HMW GLUTENINŮ PŠENICE Variability of wheat HMW glutenins Leišová-Svobodová L. 1, Štočková L. 1, Bradová J. 1 1 Výzkumný ústav rostlinné výroby, v.v.i. Praha Ruzyně Abstrakt U 63 odrůd pšenice (Triticum aestivum) bylo nalezeno 21 alel HMW gluteninů. Největší alelickou variabilitu vykazují geny Glu B1x a Glu B1y (6 a 5 alel, resp.), nejmenší Glu D1y (2 alely). Celkový index diversity činil D G 0,953. Celkem 30 rozdílných genotypů bylo nalezeno analýzou alelické variability HMW gluteninů u studovaného souboru odrůd pšenice. Shoda detekce alel na úrovni proteinů (SDS PAGE) a na úrovni DNA (PCR) je poměrně nízká (64 %) a je dána zejména nedostatečnými znalostmi rozdílů DNA sekvencí mezi alelami HMW gluteninů. Klíčová slova: SDS PAGE, PCR, alelická variabilita Abstract Twenty-one alleles of HMW glutenins was found in 63 wheat (Triticum aestivum) varieties. Genes Glu B1x and Glu B1y showed the greatest variability (6 and 5 alleles, resp.), to the contrary Glu D1y was represented only by 2 alleles. Diversity index D G was found to be 0,953. Thirty different genotypes were found in the studied set of 63 wheat varieties. There was found a low level of congruence between the detection of HMW glutenin alleles on protein level (SDS PAGE) and on DNA level (PCR) (64 %). It is more likely caused by insufficient knowledge of differences of DNA sequences between HMW glutenin alleles Key words: SDS PAGE, PCR, allelic variability Úvod Pekařské vlastnosti pšenice (Triticum aestivum) jsou ovlivněné zejména obsahem a složením proteinové složky zrna. Zásobní proteiny jsou složeny z gluteninů, rozlišované dle molekulární hmotnosti na vysokomolekulární (HMW) a nízkomolekulární (LMW) gluteniny a z gliadinů, které mají obdobnou velikost jako nízkomolekulární gluteniny. Ačkoli HMW gluteniny tvoří jen 10 % obsahu zásobních proteinů v zrnu, mají značný vliv na pekařskou kvalitu pšenice, ovlivňují zejména viskoelastické vlastnosti těsta (Payne et al., 1984). Geny HMW gluteninů jsou lokalizovány na dlouhém rameni chromozomu 1 u všech tří genomů A, B a D. Na každém lokusu jsou přítomny 2 geny označované x a y (Kong et al., 2004). Ne všechny přítomné geny bývají exprimovány, odrůdy pšenice mívají obvykle 3-5 HMW gluteninových podjednotek detekovaných na úrovni proteinů, nejčastěji metodou SDS PAGE (Halford et al., 1987). U genu 1Ax byly dosud detekovány 2 alely, s tím, že u některých odrůd není tento gen exprimován a označuje se za nulovou alelu (Anderson et Greene, 1989). Gen 1Ay není exprimován u žádné odrůdy pšenice, ačkoli je na úrovni DNA přítomen. Geny 1Bx, 1Dx a 1Dy jsou exprimovány vždy a vykazují značnou alelickou variabilitu. Gen 1By rovněž vykazuje značnou alelickou variabilitu, ale u některých odrůd pšenice exprimován není a označuje se jako nulová alela (1By0) (Halford et al., 1987). Všechny geny HMW gluteninů se skládají z unikátních N a C terminálních domén a z velké centrální repetitivní domény bohaté na aminokyseliny glycin, prolin a glutamin (D Ovidio et al., 1995). Alelická variabilita je dána různou délkou repetitivní oblasti (Anderson et Greene, 1989; Liu et al., 2007). Hlavním cílem této práce bylo zjištění míry variability HMW gluteninů u vybraného souboru pšenice a porovnání dvou přístupů detekce na úrovni proteinů pomocí SDS PAGE a detekce ne úrovni DNA pomocí PCR. 167

168 Materiál a metody Celkem bylo analyzováno 63 odrůd pšenice. Pro charakterizaci HMW gluteninů na úrovni proteinů byla použita metoda vertikální elektroforézy v polyakrylamidovém gelu v prostředí dodecylsulfátu sodného (SDS PAGE) (Laemmli, 1970). Pro účely studia HMW gluteninů na úrovni DNA byla nejprve DNA extrahována z listových čepelí cca 30 rostlin ve stadiu 1. pravého listu pomocí detergentu CTAB dle optimalizovaného protokolu. Kvalita a koncentrace extrahované DNA byly ověřeny elektroforeticky v 0,8 % agarózovém gelu a vizualizaci pomocí ethidiumbromidu v UV světle srovnáním s velikostním a koncentračním standardem λhind III (Fermentas). PCR byly prováděny v reakčním objemu 15 μl obsahujícím 0,33 μm primerů specifických pro každou alelu každého ze studovaných genů (D Ovidio et al., 1995), 0,33 mm dntp, 1x pufr, 2mM MgCl 2, 1x Q roztok, 1U Taq polymerázy Qiagen a 200 ng DNA vzorku. Reakce byly prováděny v cykleru Gene Quant Pro za reakčních podmínek: počáteční denaturace 5 minut při 96 C, 35 cyklů: 30 sekund při 95 C, 30 sekund při 60 C a 1 minutu při 72 C, závěrečná fáze syntézy při teplotě 72 C po dobu 10 minut. Produkty PCR reakce byly separovány elektroforeticky v 1,6 % agarózovém gelu a vizualizovány pomocí ethidium-bromidu v UV světle srovnáním s velikostním standardem 100 bp+ (Fermentas). Statistické analýzy byly prováděny pomocí programů MS Excel, Multilocus 1.3 (Agapow et Burt, 2001) a Darwin (Perrier and Jacquemoud-Collet, 2006). Výsledky a diskuze U studovaného souboru 63 odrůd pšenice bylo celkem detekováno 21 alel HMW gluteninů, včetně nulových alel. U Glu A1x byly detekovány 3 alely, u Glu A1y 1 alela (nulová), u Glu B1x 6 alel, u Glu B1y 5 alel, u Glu D1x 4 alely a u Glu D1y 2 alely. Mezi detekcí pomocí SDS PAGE a pomocí PCR metody došlo ke značné neshodě. U Glu A1 se výsledky neshodovaly ve 27 % z celkového počtu studovaných odrůd pšenice, u GluB1 v 56 % odrůd a u Glu D1 v 25 % odrůd pšenice. Rozdíly jsou dány zejména tím, že dosud nejsou k dispozici primery specifické pro všechny alely detekované na úrovni proteinů a pravděpodobně rovněž tím, že na úrovni DNA dosud není k dispozici dostatek kvalitních sekvencí známých alel HMW gluteninů, komplikovaná DNA sekvence genů a ne příliš jasně definované rozdíly DNA sekvencí jednotlivých alel. Proto je velmi komplikované připravit alelově specifické PCR markery pro geny HMW gluteninů. Jednotlivé alely se ve studovaném souboru vyskytovaly v různých četnostech (Obrázek 1). U Glu A1x převládal výskyt alely Glu A1x0, tzn., že u většiny studovaných odrůd pšenice se Glu A1x podjednotka nevyskytovala vůbec. U Glu B1x se nejčastěji vyskytovala alela Glu B1x7, často v kombinaci s nulovou alelou Glu B1y0. U Glu B1y vykazovala nejčetnější výskyt alela Glu B1y8. U genu Glu D1x se nejčastěji vyskytovala alela Glu D1x2, většinou v kombinaci s alelou Glu D1y12. Statistickou analýzou bylo nalezeno 30 rozdílných genotypů v souboru 63 studovaných odrůd pšenice. Index diversity D G činil 0,953, což je hodnota, naznačující vysokou úroveň biodiversity sestavy HMW gluteninových alel studovaného souboru odrůd pšenice. Clusterová analýza potvrdila vysokou míru alelické variability HMW gluteninů u studovaného souboru odrůd a zároveň existenci týchž genotypů ve studovaných lokusech (Obrázek 2). Nejčastějším byl genotyp s kombinací alel Glu A1x0, Glu B1x6, Glu B1y8, Glu D1x2 a Glu D1y12 a vyskytoval se u 10 odrůd pšenice (Thesse, Magister, Clement, Beaver, Gawain, Brimstone, Damier, Champion, Riband a Joss). Naopak unikátní sestava alel byla detekována u 16 odrůd pšenice (Magdalena, Insignia, Ducat, Nectar, Campremy, Austerlitz, Salmone, Orca, Abbondanza, Hereward, Florin, Avalon, Viking, Brock, Resistente a Magnif27). 168

169 Četnost výskyt Četnost výskytu Četnost výskytu Četnost výskytu Četnost výskytu Úroda 12/2012, vědecká příloha časopisu Obrázek 1 Četnosti výskytu alel u 63 odrůd pšenice GluA1x GluB1x GluA1x0 GluA1x1 GluA1x2 GluB1x6 GluB1x7 GluB1x13 GluB1x17 GluB1x18 GluB1x20 35 GluB1y 40 GluD1x 50 GluD1y GluB1y0 GluB1y8 GluB1y9 GluB1y16 GluB1y18 0 GluD1x2 GluD1x3 GluD1x4 GluD1x5 0 GluD1y10 GluD1y12 Obrázek 2 Dendrogram vytvořený na základě genetických vzdáleností vypočtených z alelické variability HMW gluteninů 63 odrůd pšenice Hardi 37 Copain 10 Austerlitz 1 25 Salmone 16 Orca Abbondanza 66 Rivoli 34 Louvre Hereward 18 Florin 1 Viking 2 61 Iena 20 Champlein Brock Roazon Aquileja Darius Longbow 45 Galahad 26 Monitor Resistente Thesse Magister Clement Beaver Gawain Brimstone Damier Champion 73 Riband Joss Belaviso Axel Sabre Magali 46 Chinese_Spring Scipion Moulin 42 Kite Protinal 62 Fidel Lodi 85 Campremy Avalon Prinqual Gabo Proqual Magnif Magdalena Soissons Champtal 65 Pernel Gerbier Goya Carat Ducat Nectar Resceler Nisu Tarasque Rex Chopin Insignia

170 Závěr Odrůdy pšenice vykazují vysokou míru alelické variability Genů HMW gluteninů. Je třeba dále věnovat pozornost studiu těchto genů na úrovni DNA i proteinů pro pochopení vývoje této variability, vlivu jednotlivých alel na kvalitu pšenice a mechanismu, jak těchto znalostí využít v praxi. Dedikace Tento výzkum byl podpořen finančními prostředky projektů Mze ČR MZE a QH Použitá literatura Agapow P.M., Burt A. (2001): Indices of multilocus linkage disequilibrium. Mol Ecol Notes 1: Anderson O.D., Greene F.C. (1989): The characterization and comparative analysis of highmolecular-weight glutenin genes from genomes A and B of a hexaploid bread wheat. Theor Appl Genet 77: D Ovidio R., Masci S., Porceddu E. (1995): Development of a set of oligonucleotide primers specific for genes at the Glu-1 complex loci of wheat. Theor Appl Genet 91: Gale K.R. (2005): Diagnostic DNA markers for quality traits in wheat. J Cereal Sci 41: Halford N.G., Forde O.D., Anderson O.D., Greene F.C. Shewry P.R. (1987): The nucleotide and deduced amino acid sequences of an HMW glutenin subunit gene from chromosome 1B of bread wheat (Triticum aestivum L.) and comparison with those of genes from chromosomes 1A and 1D. Theor Appl Genet 75: Liu S., Zhao S., Chen F., Xia G. (2007): Generation of novel high quality HMW-GS genes in two introgression lines of Triticum aestivum/ Agropyron elongatum. BMC Evol Biol 7: 76 (doi: / ). Kong X.Y., Gu Y.Q., You F.M., Dubcovsky J., Anderson O.D. (2004): Dynamics of the evolution of orthologous and paralogous portions of a complex locus region in two genomes of allopolyploid wheat. Plant Mol Biol 54: Laemmli, V. K. (1970): Cleavage of Structural Proteins during Assembly of The Head Bacteriophag. Nature, 227, 1970: Payne P.I., Nightingale M.A., Krattiger A.F., Holt L.M. (1987): The relationship between HMW glutenin subunit composition and the bread-making quality of British grown wheat varieties. J Sci Food Agric 40: Perrier X, Jacquemoud-Collet JP. (2006) DARwin software Kontaktní adresa: RNDr. Leona Leišová-Svobodová Výzkumný ústav rostlinné výroby, v.v.i. Drnovská 507, Praha 6 Ruzyně 170

171 VLIV PODMÍNEK SKLADOVÁNÍ NA KLÍČIVOST A OBSAH ŽIVIN V ZRNINÁCH Influence of storage conditions on germination ability and content of nutrients in grain crops Vaculová K. 1, Kýhos K. 2, Balounová M. 1, Sedláčková I. 1 1 Agrotest fyto, s.r.o., Kroměříž 2 Výzkumný ústav potravinářský Praha, v.v.i. Abstrakt Byly hodnoceny změny v ukazatelích klíčivosti (klíčivost-ck, energie-ek a rychlost klíčení-rk) a obsahu vybraných živin (škrob, beta-glukany, tuk, dusík-n) v zrninách (ječmen, oves, pšenice, tritikale, kukuřice a hrách) v průběhu skladování celého zrna po dobu 24 měsíců v prostředí s modifikovanou atmosférou (vakuum, N 2 ). Sledované ukazatele se významně lišily u jednotlivých druhů i odrůd. Obecně nebyla zjištěna průkazná diference mezi variantou ošetření s vakuem nebo N 2 a interakcemi mezi modifikovanou atmosférou a délkou skladování. Délka skladování měla negativní vliv na CK (zejména u ječmene, ovsa, tritikale a hrachu) a RK (u hrachu). Byly nalezeny neprůkazné pozitivní trendy vlivu skladování na zvýšení obsahu tuku, EK (u ovsa, pšenice a kukuřice) a RK (u ovsa). Pozorovaný nárůst obsahu tuku může důsledkem metabolických změn v průběhu skladování. Klíčová slova: zrniny, skladování, modifikovaná atmosféra, klíčivost, složky zrna Abstract Changes in germination ability (G), germination energy (GE), speed (GS), content of selected nutrients (starch, beta-glucans, fat and nitrogen-n) in grain crops (barley, oats, wheat, triticale, maize and peas) were evaluated during storage for 24 months of the whole grain under modified atmosphere conditions (vacuum, presence of N 2 ). The parameters measured significantly differed for individual crops and cultivars. Generally there were no significant differences between vacuum and N 2 and interactions between atmosphere conditions and storage duration. The storage duration has negative impact on the G (especially in barley, oats, triticale and peas) and GS (in peas). No significant trends to increase during storage were found for fat, GE (in oats, wheat, and maize) and GS (in oats). The observed increase in the fat content can be attributed to metabolic changes during storage. Key words: grain crops, storage, modified atmosphere, germination ability, grain constituents Úvod Hlavním úkolem při skladování zrna je zachování jeho biologické, fyziologické a nutriční kvality. Kromě poškození obilek, přítomnosti plísní a mikroorganismů, nevhodných skladovacích podmínek (vysoká vlhkost a teplota, apod.) může kvalitu zrna významně snížit napadení skladovými škůdci (Kučerová et al. 2003). Jedním z nejnebezpečnějších skladových škůdců je pilous černý (Sitophilus granarius, L.) který se velmi obtížně likviduje zejména v ekologickém systému hospodaření, kde je použití chemických prostředků vyloučeno. Proto jsou hledány různé alternativní metody, které by nahradily běžně používané pesticidy (Finkelman et al. 2006, Trdan et al. 2006, aj.). V současně řešeném projektu se zabýváme způsoby inaktivace pilouse černého různými, ekonomicky dostupnými technologickými postupy, mezi které patří i využití skladování v prostředí kontrolovaně modifikované atmosféry. V předloženém příspěvku jsou uvedeny výsledky hodnocení biologických a kvalitativních ukazatelů vybraných zrnin, skladovaných při běžných teplotních podmínkách v modifikované atmosféře (vakuum, dusík). Materiál a metody Netříděné zrno různých druhů zrnin (ječmen jarní: odrůdy Bojos, Sebastian a AF Lucius; oves setý: Neklan a Pogon; pšenice jarní: Vánek; tritikale jarní: Kargo; kukuřice setá: hybrid 171

172 CE2607 a hrách polní: Concorde a Zekon), sklizené v roce 2009 bylo naváženo (0,5 kg x 20) do upravených sáčků z plastové folie (s bariérou proti propustnosti atmosférického kyslíku) a následně ošetřeno odsátím vzduchu (varianta s vakuem), resp. odsátím vzduchu a nahrazením plynným dusíkem (varianta s N 2 ). Všechny sáčky byly umístěny v uzavřeném kontejneru ve skladové hale (hala HARD) s neregulovanou teplotou prostředí. V průběhu 24 měsíců byly v celkem 9 intervalech (duben 2010-duben 2012) odebírány vždy 2 sáčky z obou variant ošetření a vzorky zrna byly hodnoceny z hlediska ukazatelů klíčivosti (klíčivost-ck, energie klíčení-ek, rychlost klíčení-rk-vše v %) a obsahu živin (škrob, beta-glukany-bg, tuk, dusík- N-vše v % suš.) dle platných metodik ČSN, EBC a ISO norem. Příprava sáčků a ošetření vzorků modifikovanou atmosférou (vakuum nebo N 2 ), provedené na laboratorním zařízení, je analogické postupu popsanému v přijatém užitném vzoru č. PUV (Kýhos et al. 2010). Experimentální data byla vyhodnocena použitím software STATISTICA, verze 8.0 (StatSoft, Inc., Tulsa, Oklahoma, USA). Výsledky a diskuse Kontrolovaně modifikovaná atmosféra v podobě vakua (zbytkový O 2 do cca 2%) a vakua s nahrazením plynným dusíkem (N 2 ) byla zvolena jako médium na základě dílčích experimentů s různými vývojovými stádii pilouse černého a dostupných výsledků zahraničních autorů (Bera et al. 2004, Žďárková a Voráček 1993, aj.). Předpokladem použití jakékoliv metody inaktivace škůdců v podmínkách ekologického systému hospodaření je možnost variabilního využití skladovaného zrna tedy jak pro účely setí v následujícím období, tak také pro další potravinářské zpracování. Zemědělci hospodařící v ekologickém zemědělství mají zřídka možnost skladovat větší objemy zrna v teplotně regulovaném prostředí. Proto byly vzorky zrna uskladněny v podmínkách, kde v důsledku konstrukce haly dochází k výrazným teplotním výkyvům v průběhu celého roku. Tab. 1 - Efekt vlivu faktorů na sledované ukazatele (GLM, ANOVA) MS Zdroj proměnlivosti df energie rychlost vlhkost klíčivost klíčení klíčení Druh *** *** *** *** Ošetření *** Datum *** ** *** ** Druh*Datum ** *** Ošetření*Datum ** Chyba Zdroj proměnlivosti df škrob beta-glukany tuk N 1) Druh *** 50.29*** 17.47*** Ošetření Datum *** *** 0.09** Druh*Datum *** Ošetření*Datum Chyba ) - viz. Materiál a metodika; * - P 0.05 ; ** - P 0.01, *** - P MS Hodnocení proměnlivosti pomocí analýzy variance (Tab.1) ukázalo, že nejvýznamnějším faktorem byl druh studované zrniny, a to jak pro ukazatele klíčivosti a vitality (měřené jako energie a rychlost klíčení Prokeš 2005, 2009), tak i změn v obsahu vlhkosti, BG, tuku i obsahu N. Vlhkost zrna hraje významnou roli při zachování biologické a fyziologické kvality 172

173 zrna při skladování v podmínkách s vysokými teplotami i teplotami pod bodem mrazu (Fleurat-Lessard et al. 1994, Domin a Kluza 2010). Počáteční vlhkost vzorků při zakládání pokusu ani v jednom případě nepřekročila limitní hranici 14,5%. Přesto byly diference mezi variantami ošetření zrna (varianta s N 2 =12,72% vs. vakuum=12,97%; P 0,05), datem odběru i jejich interakcemi statisticky významné. Vzhledem k tomu, že nejvyšší průměrné hodnoty vlhkosti (13,01-13,25%) byly naměřeny v prvních 4 odběrech, lze tyto rozdíly zřejmě přičíst na vrub postupné ztráty vody v důsledku probíhajících metabolických dějů v zrnu. V důsledku vysoké proměnlivosti mezi jednotlivými druhy zrnin nebyl způsob ošetření průkazný pro žádný další hodnocený ukazatel. Obr. 1 - Průměrné hodnoty a variabilita obsahu vybraných složek zrna jednotlivých druhů zrnin ve všech experimentálních termínech odběru tritikale kukuřice pšenice Y 1 Y 2 N (Y 1 ), tuk (Y 1 ), beta-glukany (Y 1 ), škrob (Y 2 ) - vše v % (suš.) oves ječmen hrách Délka skladování se naopak ukázala jako faktor proměnlivosti, který ovlivňoval jak obsah škrobu, tuku, N i všech ukazatelů klíčivosti. Obsah škrobu a tuku s dobou skladování mírně vzrůstal (Obr. 1). Zřetelnější trend nárůstu byl pozorován pro obsahu tuku, kde mezi průměrnou hodnotou prvního a posledního odběru byla zjištěna průkazná diference (2,44 vs. 3,41 %; P 0,05). Tyto změny jsou zřejmě důsledkem metabolických reakcí, při kterých dochází k uvolňování některých vazeb mezi tuky a proteiny a postupné inaktivaci některých enzymových systémů. Fleurat-Lessard et al (1994) zaznamenali u pšenice postupný úbytek počtu nukleotidů, silnější v důsledku vyšších teplot při skladování než vlivem modifikované atmosféry. Také Kaukovirta-Norja et al. (1998) pozorovali při skladování suchých intaktních vzorků sladovaného zrna redukční reakci vybraných masných kyselin působením enzymu lipoxygenázy, přičemž síla reakce závisela na stupni metabolických přeměn v zrnu. Chloupek (2009) uvádí, že ztráta vitality začíná degradací buněčných membrán vlivem oxidace membránových lipidů, snižuje se syntéza ATP a respirace. V průběhu námi hodnocené doby skladování zřejmě ještě nedošlo k významnějším změnám ve struktuře buněčných stěn, protože obsah BG, jako jedné ze stavebních složek buněčné stěny, se v průběhu hodnocení významně neměnil a byl jediným ukazatelem s proměnlivostí výhradně ovlivněnou zvoleným druhem plodiny. Kolísání obsahu N v průběhu skladování nevykazovalo žádný zřetelný trend. Nejvýznamnější změny, zapříčiněné jak délkou skladování, tak interakcemi s jednotlivými 173

174 druhy byly pozorovány pro ukazatele klíčivosti a vitality zrna (Obr. 2). Přesto, že odrůdy některých druhů (ječmen, oves a hrách) reagovaly rozdílně (u ječmene byly průkazně nejnižší hodnoty ukazatelů klíčivosti zjištěny u odrůdy Sebastian), zvolená délka skladování měla negativní vliv na celkovou klíčivost u většiny druhů a na RK u hrachu. Obr. 2 - Průměrné hodnoty a variabilita ukazatelů klíčivosti u jednotlivých druhů zrnin v průběhu všech experimentálních termínů odběru (I IX, data odběru viz. Obr. 1) % 100 klíčívost; EK, RK - vše v % I III V VII IX II IV VI VIII I III V VII IX II IV VI VIII I III V VII IX II IV VI VIII I III V VII IX II IV VI VIII I III V VII IX II IV VI VIII I III V VII IX II IV VI VIII ječmen pšenice oves hrách kukuřice tritikale Výjimku tvořila kukuřice kde, podobně jak uvádějí Domin a Kluza (2010), naopak vzrostl podíl klíčivých zrn. Na rozdíl od výsledků autorů Benková et al. (2011) měly odrůdy ovsa nejnižší klíčivost i celkovou vitalitu a obdobně se chovaly i odrůdy hrachu. Byly pozorovány pozitivní trendy vlivu délky skladování na zvýšení EK u ovsa, pšenice a kukuřice a RK u ovsa. Závěr Skladování různých druhů zrnin v podmínkách s modifikovanou atmosférou (vakuum, N 2 ) nemá statisticky průkazný vliv na ukazatele klíčivosti nebo obsah základních složek zrna. Významným faktorem ovlivňujícím zejména klíčivost a vitalitu zrna je délka skladování. Interakce délky skladování s variantou ošetření nebyly v našem pokusu nalezeny. Dedikace Příspěvek byl vypracován za finanční podpory projektu MZe ČR č. QI101B088. Použitá literatura: Citace použité literatury jsou k dispozici u autorů příspěvku. Kontaktní adresa: Ing. Kateřina Vaculová, CSc., Agrotest fyto, s.r.o., Havlíčkova 2787/121, Kroměříž 174

175 ŠLECHTĚNÍ HRACHU NA REZISTENCI KE KOMPLEXU VIRÓZ A ANTRAKNÓZ Resistance breeding of pea to complex of virosis and ascochyta Dostálová R., Ondřej M. a Ondráčková E. Agritec Plant Research s.r.o., Šumperk Abstrakt V letech byly některé pěstitelské oblasti hrachu napadány komplexem viróz a antraknóz. Výnos hrachu a stupeň napadení antraknózou byly v korelaci se stupněm napadení virózami. Silný přirozený infekční tlak viróz umožnil vybrat zdroje odolnosti proti původcům obou chorob současně a realizovat selekci odolných rostlin k získání perspektivních linií pro šlechtitelské využití. Klíčová slova: hrách, virózy, antraknóza, selekční metody Abstract In peas in some growing areas were attacked by viruses and ascochyta blight complex. Both yield of pea and damage degree of pea with ascochyta blight correlated with pea virus attack. Due to strong natural infection pressure of viruses, the resistant sources of pea to virus diseases and Ascochyta blight were selected. Resistant strains were used for breeding program of pea. Keywords: peas, virus diseases, ascochyta, selection methods Úvod Virová mozaika hrachu přenosná semenem (Pea seed-borne mosaic virus, PSbMV) se často vyskytuje spolu s původcem výrustkové mozaiky hrachu (Pea enation mosaic virus, PEMV). Typickými příznaky infekce hrachu virem PSbMV je svinutka listů, zkrácení internodií, různý stupeň zakrslosti infikovaných rostlin, dále potom deformace květů a vývoj malých deformovaných lusků. Příčinou snadného šíření je přenos semeny, který byl popsán u tak celosvětově významných plodin jako je hrách, čočka nebo bob. U náchylných odrůd hrachu se uvádí přenos semeny až do 30 %, ale byly zaznamenány případy, kdy 90 % komerčního osiva bylo infikováno. Virus je přirozeně přenosný vektory, a to mšicemi nepersistentním způsobem. Rezistence je založena recesivně geny sbm-1, sbm-2, sbm-3 a sbm-4, které odpovídají 4 patotypům PSbMV. Virus PEMV je celosvětově označován za nejnebezpečnější a ekonomicky nejzávažnější. Viróza je přenosná mšicemi a k přenosu dochází již po krátké době sání. Mezi typické a nezaměnitelné projevy na rostlinách hrachu, kromě výrůstků je i mozaika přecházející v typické dvůrky. Později vznikají deformace lusků, snižuje se HTS. Dědičnost rezistence proti viróze PEMV zajišťuje dominantní gen En. Obě virózy mohou způsobovat významné výnosové ztráty převyšující i %. Antraknóza hrachu, která je vyvolávána houbou Ascohyta pisi, způsobuje na produkci značné výnosové ztráty (Dostálová, 2010). Existence vzájemných interakcí mezi jednotlivými druhy antraknóz (Ascocyta pisi, Mycosphaerella pinodes a Phoma pinodella) a virózami je zatím málo známa. Selekcí odolných jedinců v podmínkách silného přirozeného infekčního tlaku lze získat cenný výchozí materiál. Cílem práce bylo nalezení zdrojů vysoké a kumulované odolnosti proti virózám (PSbMV a PEMV) a antraknóze (A. pisi). Dále pak zhodnocení přínosu zjištěné odolnosti na výnosové parametry v polních podmínkách. Materiál a metody Polní pokusy - byly hodnoceny registrované odrůdy hrachu ze seznamu doporučených odrůd (SDO), šlechtitelské linie Agritecu (označených AGT), zdroje rezistence s ověřenými vlastnostmi 12 linií B 99/98-118, odrůdy Franklin, Lifter. Napadení rostlin virózami a 175

176 antraknózou bylo hodnoceno bonitační stupnicí 1 9 (náchylné - odolné). Po sklizni byl zjištěn výnos semen a proveden rozbor zdravotního stavu napadení semen antraknózou (%). Kontrolní náchylná odrůda byla Terno. V letech bylo celkem hodnoceno 34 odrůd a 100 šlechtitelských linií hrachu. Laboratorní a skleníkové pokusy- hybridní populace odvozené od zdrojů rezistence k PEMV (gen En) a PSbMV (gen sbm-1) byly selektovány v laboratorních skleníkových podmínkách. Selekce bezpříznakových rostlin byla provedena pomocí umělé mechanické inokulace s virulentními izoláty k PEMV a PSbMV. Jako kontroly byly využity zdroje rezistence a diferenciační linie. K inokulačním screeningovým testům byl použit izolát 58 UP a nové izoláty získané v přirozených polních podmínkách. Molekulární analýzy Šlechtitelské perspektivní materiály polního hrachu byly otestovány pomocí certifikované metodiky: Molekulární detekce genu rezistence hrachu k viru mozaiky přenosné semenem - PSbMV (Smýkal, 2011). Tato metoda přímé detekce genu rezistence hrachu k nejrozšířenějšího patotypu P1 PSbMV viru (sbm-1 lokusu, eif4e genu), plně nahradila časově náročné a ne zcela spolehlivé symptomatické a biochemické ELISA testování. Postup je návodem přesné, alelicky specifické detekce eif4e genu pomocí polymerázové řetězcové reakce (PCR) s aplikací pro šlechtění hrachu a hodnocení genových zdrojů. Výsledky a diskuse Polní pokusy - selekce kmenů, na základě polního pozorování V polních podmínkách byla provedena selekce na základě pozorování v poli, s cílem vybrat kmeny bez příznaků enační mozaiky nebo semenem přenosné mozaiky hrachu. Zvýšená pozornost byla věnována těm kombinacím, ve kterých potomstva měla geny rezistence ke sledovaným virózám. Vizuální hodnocení zdravotního stavu bylo prováděno průběžně a vlastní výběry perspektivních kmenů byly prováděny ve dvou termínech: před květem a ve žluté zralosti. Hodnocením byl zjištěn velmi úzký vztah mezi intenzitou napadení rostlin virózou a původcem antraknózy (A. pisi). Ztráta odolnosti se prokázala i v inokulačních testech. Semena rezistentních genotypů hrachu k PEMV byla napadena antraknózou do 3,5 % ve srovnání s náchylnými genotypy, u kterých napadení dosáhlo 28,5 33,5 %, byla zjištěna imenší HTS a redukce výnosu oproti rezistentním genotypům. Postupný návrat druhu A. pisi do pěstitelských ploch hrachu v ČR byl pozorován i v jiných zemích (Mathew et al. 2010, Gossen et al. 2011, Morral et al. 2007). Ve všech skupinách kombinací byla nalezena, jak potomstva bez viditelných příznaků, tak i potomstva citlivá a výrazně napadená. Při sklizni byly vybírány ty kmeny, u kterých byly za vegetace pozorovány a následnými rozbory zjištěny vhodné hospodářské vlastnosti (ranost, délka lusku, počet semen v lusku). Z vybraných rostlin, pocházejících z perspektivních potomstev, bude založena kmenová školka v následujícím roce. Hodnocení registrovaných odrůd je uvedeno v tabulce č. 1. Z hodnocení odrůd je zřejmé, že žádná komerční odrůda není k virózám odolná, opakovaně bylo zjištěno, že odrůda Terno je vysoce náchylná jak k PEMV tak k antraknóze. Tab č. 1: Hodnocení výskytu viróz na registrovaných odrůdách (stupnice 9-1) Stupeň napadení Stupeň napadení Stupeň napadení Odrůda (9-1) Odrůda (9-1) (9-1) Sponsor 6,5 Terno 5 4 Hardy 6,5 Prophet 6 4 Terno 6 Slovan 6 6 Concorde 7 Sully 7 4 Prophet 6,5 Starter 7 5 Slovan 6,5 Velvet 6 6 Sully 7 Atlas 7 5 Starter 7 Audit 6 6 Velvet 7 Avantgarde 7 6 Atlas 7,5 Salamanca 7 6 Audit 7 Gambit

177 V Agritecu byly vyšlechtěny linie polního hrachu, které byly v průběhu minulých let testovány jak v polních, tak laboratorních podmínkách. V tabulce č. 2 je u vybraného souboru prezentováno zvýšení odolnosti k virózám a současně i k antraknóze. U napadených rostlin hrachu virózami lze očekávat ztrátu rezistence k antraknóze. Lze předpokládat potlačení nebo úplnou ztrátu schopnosti tvorby obraných imunitních látek pisatinu. (Lepoivre, 1979). Bylo potvrzeno, že v přírodních podmínkách se virózy i antraknozy vyskytují vždy v komplexu velkého množství rozdílných kmenů, patotypů a ras, lišících se ve virulenci a v řadě dalších vlastností (Nelson 1973, Kvíčala 1974,1977). Nejodolnější proti komplexu viróz a a antraknóz byly linie, kde byly ke křížení využity odrůdy s kumulovanými geny rezistence (Franklin, Lifter a linie B99/98-118). Nejvyšší odolnost byla zjištěna u linií AGT , AGT a AGT Bylo prokázáno i malé procentické napadení semen antraknózou. Tab. č. 2: Hodnocení napadení linií virózami, antraknózou, % napadení sklizených semen a vliv na výnos virózy (9-1) antraknózy (9-1) % napadení semen antraknózou výnos (g/10m 2 ) AGT AGT ,5 8 0, AGT AGT , AGT , AGT , AGT , AGT AGT , AGT ,5 8 0, AGT , AGT , Terno , Laboratorní a skleníkové pokusy V roce byly otestovány šlechtitelské perspektivní materiály polního hrachu a dřeňového hrachu, pomocí umělé mechanické inokulace s virulentními izoláty k PEMV a PSbM. Ve skleníku byly postupně vysety linie AGT (F6-F8) odvozené od ověřených zdrojů rezistence a kontrolní citlivá a rezistentní odrůda (Terno-S, Franklin-R). Na vyseté rostliny hrachu bylo aplikováno inokulum 58 UP.V tabulce č. 3 je uveden seznam a výsledky testování k PEMV a PSbMV z r S využitím metody PCR-eIF4E byl současně proveden screening kmenů a linií AGT na ověření rezistence k PSbMV. Na základě jeho výsledků bylo možno rozhodnout o tom, zda osivo bylo sklizeno z rostliny rezistentní k P1 PSbMV, zda původní rostlina byla recesivní homozygot (sbm-1/sbm-1) a zda je její potomstvo vhodné pro vytvoření čisté rezistentní linie. Kmeny a linie uvedené v tabulce č. 3 prokázaly spolehlivě rezistenci k P1 PSbMV. Tímto postupem bylo analyzováno přibližně 800 vzorků hrachu (semen, rostlin) F 2 až F 8 generací šlechtitelského materiálu. 177

178 Tab.č. 3 Screeningové laboratorní testy na odolnost k virovým patogenům (PEMV, PSbMV) Kmeny AGT a kontrola (S) PSbMV PEMV Kmeny PSbMV PEMV Kmeny PSbMV PEMV Terno S S Terno S S Terno S S 1 AGT RKY x Franklin R R/S 5004 x B R R/S LU 1977 x Franklin R R/S 2 Sponsor x B R R Faktor x B R R LU 1977 x Franklin R R/S 3 Sponsor x B R R Faktor x B R R LU 1977 x Franklin R R/S 4 AGT x B R R RKY x B R R LU 1977 x Franklin R R 5 RKY x B R R AGT210.8 R R LU 1977 x Franklin R R 6 RKY x B R R AGT R R LU 1977 x Franklin R R 7 Lu 1977 x Franklin R R/S AGT209.4 R R/S Kamelot x Franklin R R/S 8 Bilbo x Franklin R S 5004 x B R R/S AGT209.1 R R/S 9 Bilbo x Franklin R S RKY x B R R/S AGT R R/S 10 Panna x B R R/S LU 1977 x Franklin R R/S Bilbo x Franklin R R/S 11 Komet x B R S Franklin Luy x Lifter R R/S LU 1977 x Franklin R R 12 RKY x B R S AGT209.1 R R/S Catania x B R R 13 Sponsor x B R R/S LU 1977 x Franklin R R/S AGT209.4 R R/S 14 Lu 1977 x Franklin R R/S LU 1977 x Franklin R R/S LU 1977 x Franklin R R/S 15 RKY x B R R/S LU 1977 Lifter R R/S Franklin Luy x Lifter R R/S 16 RKY x B R R/S Kamelot x Franklin R R/S Sponzor x B R R/S 17 AGT R R/S Catania x B R R/S LU 1977 x Lifter R R/S 18 Sponsor x B R R/S AGT x B R R/S AGT211.6 R R/S 19 AGT R R LU 1977 x Franklin R R AGT211.7 R R 20 AGT R R Franklin Luy x Lifter R R AGT R R Terno S S Terno S S Terno R S Závěr Získání odolných kmenů a realizaci selekce odolných bezpříznakových jedinců proti viróze (PEMV a PSbMV) a antraknóze (A. pisi) umožnil silný infekční tlak viróz v letech Spolehlivé selekční metody umožnily vytvoření rezistentních linií, které budou využity pro šlechtění nových odrůd hrachu. Tato práce byla finančně podpořena projektem č. RO 0111 a projektem NAZV QI91A229. Použitá literatura Dostálová R., Ondřej M.: Hodnocení rezistence hrachu proti virózám a antraknóze. In Vliv abiotických a biotických stresorů_na vlastnosti rostlin ISBN: , p Gossen B. D., Hwang S. F., Conner R. L., and Chang K. F. (2011). Managing the Ascochyta blight complex on field pea in western Canada, Prairie Soils and Crop Journal, Vol. 4: Kvíčala B Poznatky o šlechtěné na rezistenci proti některým virům hrachu. Ochrana rostlin 10: Lepoivre P. 1979: Protection de Pisum sativum coutre l infection par Ascochyta pinodes par préinoculation avec A.pisi or A. pinodella. Parasitica35:73-78 Mathew F. M., Goswami R. S., and Markell S. G. (2010) First Report of Ascochyta Blight of Field Pea Caused by Ascochyta pisi in South Dakota. Plant Disease, Vol. 94, No. 6: 789 Morral R. A. A., Carriere B., Erns B., Pearse C., Schmeling D., Thomson I. (2007) Seedborne pathogens of pea in Sasktchewan in Can. Plant. Dis. Surv., No. 87: Nelson R. R. (1973): Breeding plants for disiase resistance. Concepts and aplications. The pennsylvania State Univ. Press. 401 pp. Smýkal P. (2011): Molekulární detekce genu rezistence hrachu k viru mozaiky přenosné semenem (PSbMV). Vydal Agritec Plant Research s.r.o. v nakladatelství AGRITEC, výzkum, šlechtění a služby, s.r.o. Šumperk. ISBN: Kontaktní adresa: Ing. Radmila Dostálová Agritec Plant Research, s.r.o., Zemědělská 16, Šumperk 178

179 VYUŽITÍ PCR METODY PŘI IDENTIFIKACI HOUBOVÝCH PATOGENŮ RODU FUSARIUM VYSKYTUJÍCÍCH SE NA TRVALÝCH TRAVNÍCH POROSTECH Use of PCR method for identification of fungal genus Fusarium occurring on permanent grassland Cholastová T. 1, Hujslová M. 2 1 Zemědělský výzkum, s.r.o. Troubsko 2 Výzkumný ústav rostlinné výroby, v.v.i. Abstrakt Rod Fusarium je celosvětově rozšířený rod vyskytující se ve všech klimatických pásmech a napadající nejrůznější druhy rostlin. Pro kontrolu zdravotního stavu rostlin, šlechtění na rezistenci a pro různé epidemiologické studie je rychlá a spolehlivá diagnostika takřka nepostradatelná. Zásadní průlom v diagnostice patogenních mikroorganismů nastal po zavedení moderních molekulárně genetických metod orientovaných na analýzu genomové DNA. Pro detekci hub rodu Fusarium izolovaných z rostlinného materiálu trvalých travních porostů byla použita specifická PCR amplifikace využívající primery, které pro druhy Fusarium avenaceum, F. culmorum, F. graminearum a F. poae navrhli autoři Lees (1995), Schilling et al. (1996), Nicholson et al. (nepublikováno) a Parry et Nicholson (1996). Klíčová slova: Fusarium spp., PCR, patogen-specifické primery, trvalé travní porosty Abstract The genus Fusarium is a worldwide genus occurring in all climate zones and affecting various plant species. To check the health of plants, breeding for resistance and for epidemiological studies is a rapid and reliable diagnosis almost indispensable. Major breakthrough in the diagnosis of pathogenic microorganisms occurred after the introduction of modern molecular genetic methods based on the analysis of genomic DNA. For Fusarium spp. detection, isolated from plant material of permanent grassland, the specific PCR with primers designed for Fusarium avenaceum, F. culmorum, F. graminearum and F. poae by Lees (1995), Schilling et al. (1996), Nicholson et al. (unpublished observations) and Parry et Nicholson (1996) was used. Key words: Fusarium spp., PCR, pathogen-specific primers, permanent grassland Úvod Trvalé travní porosty (TTP) zaujímají v České republice přes 23 % výměry zemědělské půdy. Je to zhruba 970tis. ha, z toho je asi 800tis. ha využívaných pro produkci píce. Už sama tato čísla napovídají, že jde o významnou součást agroekosystému. Kvetoucí luční porosty s převahou trav jsou nejen zdrojem pylu (z alergologického hlediska), ale mohou se stát také zdrojem fuzarióz s nekontrolovatelným únikem do okolního prostředí. Řada lučních trav je napadána tzv. parazitární běloklasostí, přenášenou hmyzem a roztoči. Předpokladá se však, že prvotní příčinou tohoto onemocnění je Fusarium poae (Soroka, 2005). V rámci sledování kvality a bezpečnosti krmiva je důležité monitorovat výskyt fuzarióz s toxinogenním účinkem. Určení druhu na základě morfologie je mnohdy neúspěšné, protože morfologické a fyziologické charakteristiky jednotlivých druhů jsou velmi podobné a druhy se příliš neliší ani svými projevy po napadení hostitele. Navíc situaci ztěžuje geografické rozšíření druhů, protože se často na jednom území vyskytuje současně více než jeden druh rodu Fusarium. Klasické mikrobiologické kultivační metody jsou navíc poměrně časově náročné a do jisté míry subjektivní. V současné době je však potřeba rychlá a jednoznačná detekce patogena. To všechno jsou důvody pro používání moderních molekulárně biologických metod pro identifikaci a detekci Fusarium spp. Jednou z nich je polymerázová řetězová reakce s 179

180 použitím specifických primerů. Genetické studie na základě PCR prováděl u rodu Fusarium spp. například Schilling et al. (1996), který odlišil F. culmorum a F. graminearum. Detekci rodu Fusarium spp. pomocí polymerázové řetězové reakce uvádí také Lees (1995), Turner et al. (1998), Doohan et al. (1998) a Arif et al. (2012). Cílem řešení byla molekulární identifikace patogenů Fusarium avenaceum, F. culmorum, F. graminearum a F. poae izolovaných z rostlinného materiálu trvalých travních porostů prostřednictvím polymerázové řetězové reakce s využitím patogen-specifických primerů. Materiál a metody Biologický materiál. Testovaný soubor byl tvořen rostlinným materiálem trvalých travních porostů. Vzorky houbových izolátů pro PCR analýzu byly získány ze směsných vzorků, které byly vytvořeny smícháním 4 směsí (A technická směs lipnice luční, kostřava červená, jílek vytrvalý, psineček tenký; B technická směs s jetelem lipnice luční, kostřava červená, jetel plazivý; C pícní směs kostřava luční, lipnice bahenní, srha laločnatá, bojínek luční; D pícní směs s jetelem festulolium, kostřava luční, jetel luční) Samotná izolace izolátů hub rodu Fusarium spp. probíhala standardními mykologickými postupy. Byly připraveny monosporické izoláty, které byly následně předány k izolacím DNA a PCR analýzám. Jako standardy byly použity izoláty Fusarium avenaceum CCM 8015, Fusarium culmorum CCM F-553, Fusarium graminearum CCM 8244 a Fusarium poae CCM F-169 získané z České sbírky mikroorganismů Masarykovy univerzity v Brně. Izolace DNA. Genomová DNA byla izolována z nárůstu mycélia z monosporických izolátů hub pomocí komerčně dostupného kitu DNeasy Plant Mini Kit (Qiagen, Německo). Kvalita DNA byla testována elektroforeticky. PCR amplifikace a agarózová gelová elektroforéza. Amplifikační reakce byly prováděny v objemu 25µl. Amplifikační reakce pro F. culmorum a F. avenaceum obsahovala 0,5U DyNAzyme II DNA polymerázy (Finnzymes, Finsko), 10mM Tris-HCl (ph 8.8), 1,5mM MgCl 2, 50mM KCl a 0,1% Triton X-100 (DyNAzyme II DNA polymerase 10x Buffer, Finnzymes, Finsko), 0,2mM dntp (TaKaRa, Japonsko), 1µM oba primery (Metabion, Německo) a přibližně mg houbové DNA. Amplifikační směs pro F. graminearum a F. poae byla podobná s výjimkou 0,4mM dntp (TaKaRa, Japonsko) a 0,4µM primerů (Metabion, Německo). Pro identifikaci patogenů byly použity následující dvojice primerů, které použili níže citovaní autoři: F. avenaceum (AF/AR: CAAGCATTGTCGCCACTCTC/GTTTGGCTCTACCGGGA CTG, Lees, 1995), F. culmorum (OPT18F 470 /OPT18R 470 : GATGCCAGACCAAGACGAAG/GATGCCAGACGCACTAAGAT, Schilling et al., 1996), F. graminearum (Fg11F/R: CTCCGGATATGTTGCGTCAA/GGTAGGTATCCGACATGG CAA, Nicholson et al., nepublikováno) a F. poae (Fp82F/R: CAAGCAAACAGGCTCTTCACC/TGTTCCACCTCAGTGACAGGTT, Parry et Nicholson, 1996). K amplifikaci houbové DNA byl použit teplotní a časový profil, který se měnil v závislosti na specificitě primerů. Použitím F. avenaceum specifických primerů byl termocykler naprogramován na 40 cyklů (95 C-30s, 60 C-30s a 72 C 40s). Program pro F. graminearum a F. poae specifické primery byl podobný s výjimkou annealingové teploty, která byla upravena na 62 C. Použitím F. culmorum specifických primerů byl termocykler naprogramován na 30 cyklů (94 C-1min., 55 C-1min. a 72 C 2min.). V závěrečném cyklu každého programu byl poslední krok prodloužen na 5min., aby byly dosyntetizovány chybějící úseky fragmentů. Produkty amplifikace byly separovány na horizontální elektroforéze HE 99X (Hoefer, USA) v 1,5% agarózovém gelu při konstantním napětí 120V po dobu 80 minut. 180

181 Výsledky a diskuze Z biologického materiálu byla vyizolována vysokomolekulární DNA s kvalitou vhodnou pro následnou amplifikaci. Pomocí F. avenaceum specifických primerů AF/AR byly amplifikovány produkty o délce 920bp (obr. 1), primer Fp82F/R specifický pro detekci F. poae amplifikoval fragment o velikosti 220bp (obr. 2), produkt amplifikovaný F. culmorum specifickým primerem OPT18F 470 /OPT18R 470 měl velikost 472bp (obr. 3) a s využitím primerové kombinace Fg11F/R byla velikost amplifikovaného produktu detekujícího F. graminearum 400bp (obr. 4). Tyto velikosti PCR markerů uvádí též Doohan et al. (1998) a Schilling et al. (1996). Yli- Mattila et al. (2004) uvádí pro F. graminearum 400bp velikost specifického fragmentu, která byla potvrzena i v této práci. Obrázek 1: Elektroforeogram PCR produktů při použití primerů AF/AR pro detekci Fusarium avenaceum M Obrázek 2: Elektroforeogram PCR produktů při použití primerů Fp82F/R pro detekci Fusarium poae M M M= 100bp-1,5kb DNA Ladder (Bio Basic Inc.) 1 pozitivní kontrola F. avenaceum 2 negativní kontrola 3, 4, 6, 7, 10, 13 a 14 pozitivní nález F. avenaceum (ZH1, P, ZH2) 5, 8, 9, 11 a 12 negativní nález F. avenaceum (SP1, M) M= 100bp-1,5kb DNA Ladder (Bio Basic Inc.) 1 pozitivní kontrola F. poae 2 negativní kontrola 3, 4, 5, 6, 8, 9, 12, 13 pozitivní nález F. poae (ZH2, M) 7, 10, 11 a 14 negativní nález F. poae (ZH1, P, SP1) Obrázek 4: Elektroforeogram PCR produktů při použití primerů Fg11F/R pro detekci Fusarium graminearum Obrázek 3: Elektroforeogram PCR produktů při použití primerů OPT18F 470 /OPT18R 470 pro detekci Fusarium culmorum M M M= 100bp-1,5kb DNA Ladder (Bio Basic Inc.) 1, 2 pozitivní kontrola F. culmorum 3 pozitivní nález F. culmorum (ZH2) 4 7 negativní nález F. culmorum (ZH1, P, SP1, M) 8 negativní kontrola Pro detekci napadení byly použity primery, které navrhli Lees (1995), Schilling et al. (1996) a Nicholson et al. (nepublikováno), Parry et Nicholson (1996). Přítomnost patogena v rostlinném vzorku je indikována amplifikací specifického DNA fragmentu typického pro daný patogen. Závěr 181 M= 100bp-1,5kb DNA Ladder (Bio Basic Inc.) 1 pozitivní kontrola F. graminearum 2 6 negativní nález F. graminearum (ZH1, ZH2, P, SP1, M) 7 negativní kontrola

182 Korektní identifikace patogenů je důležitá pro kontrolu zdravotního stavu rostlin, šlechtění na rezistenci a pro různé epidemiologické studie. Z těchto důvodů je proto přesná diagnostika takřka nepostradatelná. Taktéž následný výzkum chování patogenu musí být založen na správné identifikaci druhu. Variabilita druhů rodu Fusarium je velmi vysoká a identifikace těchto hub je mimořádně náročná na dodržování postupů dle zvoleného klíče. Je proto často výhodné používat molekulárně biologické metody (např. PCR a její modifikace, dot blot hybridizace, sekvenování, microarray aj.). V tomto příspěvku jsou prezentovány výsledky molekulárně genetické detekce izolátů F. avenaceum, F. culmorum, F. graminearum a F. poae získaných z rostlinného materiálu trvalých travních porostů v podmínkách Laboratoře molekulární biologie a genetiky VÚP s.r.o. v Troubsku. Dedikace Výsledky byly získány za finanční podpory Mze ČR NAZV při řešení výzkumného projektu č. QI111C016 a za částečné institucionální podpory na dlouhodobý koncepční rozvoj výzkumné organizace. Použitá literatura Arif M., Chawla S., Zaidi N. W., Rayar J. K., Variar M., Singh U. S. (2012): Development of specific primers for genus Fusarium and F. solani using rdna sub-unit and transcription elongation factor (TEF-1a) gene. African Journal of Biotechnology, 11 (2): Doohan F. M., Parry D. W., Jenkinson P., Nicholson P. (1998): The use of species-specific PCR-based assays to analyse Fusarium ear blight of wheat. Plant Pathology 47: Lees A. K. (1995): Diagnosis and Control of Foot Rot Pathogens of Wheat. Buckinghamshire, UK: Open University, Ph.D. thesis. Nicholson et al. (nepublikováno) - In.: Doohan F. M., Parry D. W., Jenkinson P., Nicholson P. (1998): The use of species-specific PCR-based assays to analyse Fusarium ear blight of wheat. Plant Pathology 47: Parry D. W., Nicholson P. (1996): Development of a PCR assay to detect Fusarium poae in wheat. Plant Pathology 45: Schilling A. G., Möller E. M., Geiger H. H. (1996): Polymerase chain reaction based assays for specific detection of Fusarium culmorum, F. graminearum and F. avenaceum. Phytophatology 86: Soroka J. J., Gossen B. D. (2005): Phytophagous arthropods and silvertrop levels associated with post harvest residue treatments in three turfgrass species grown for seed. Canadian Journal of Plant Science 56: Turner A. S., Lees A. K., Rezanoor H. N., Nicholson P. (1998): Refinement of PCR detection of Fusarium avenaceum and evidence from DNA marker studies for phenetic relatedness to Fusarium tricinctum. Plant Pathology 47: Yli-Mattila T., Paavanen-Huhtala S., Parikka P., Konstantinova P., Gagkaeva T. Y. (2004): Molecular and morphological diversity of Fusarium species in Finland and north-western Russia. European Journal of Plant Pathology 110: Kontaktní adresa: Cholastová Tereza, Mgr. Zemědělský výzkum, spol. s r.o., Zahradní 1, Troubsko 182

183 KLÍČIVOST KONIDIÍ COLLETOTRICHUM ACUTATUM PO APLIKACI ÚČINNÝCH LÁTEK VYBRANÝCH FUNGICIDŮ Conidial germination of Colletotrichum acutatum after application of active ingredients of selected fungicides Jílková B. 1, Víchová J. 1, Pokorný R. 1, Vejražka K. 2 1 Mendelova univerzita v Brně 2 Zemědělský výzkum, spol. s r.o., Troubsko Abstrakt V laboratorních in vitro testech byla zkoušena klíčivost konidií Colletotrichum acutatum po aplikaci účinných látek vybraných fungicidů. K testům bylo použito šest izolátů C. acutatum z různých plodin. Byla zjištěna rozdílná citlivost izolátů C. acutatum k fungicidním přípravkům obsahujícím různé účinné látky. Žádný z hodnocených izolátů nebyl k vybraným fungicidním přípravkům tolerantní. Výraznější rozdíly mezi jednotlivými izoláty byly zaznamenány po aplikaci fungicidních přípravků s ú. l. azoxystrobin a metiram. U fungicidního přípravku s ú. l. azoxystrobin bylo nejvyššího inhibičního účinku dosaženo u izolátu 1109 za světlice, zatímco nejnižší inhibice byla prokázána u izolátu PCF 437 z lupiny. Nejnižší klíčivost konidií u fungicidního přípravku s ú. l. metiram byla stanovena u izolátu 1209 ze světlice, naopak nejvyšší klíčivost měl izolát 710 z třezalky. Nejvyšší účinek na klíčivost konidií byl prokázán u ú. l. captan (98, %), folpet (99,2 100 %) a mancozeb (99,8 100 %). Klíčová slova: Colletotrichum acutatum, konidie, fungicidy, účinnost Abstract Conidial germination of Colletotrichum acutatum was tested after application of selected fungicides with different active ingredients in laboratory in vitro test. Six isolates of C. acutatum, which originated from various host plants, were used. Different sensitivity of the pathogen's isolates was found to effect of the fungicides. None of the evaluated isolates was tolerant to fungicides. Significant differences between the isolates were observed after application of fungicides with a. i. azoxystrobin and a. i. metiram. The highest inhibitory effect of fungicide with a. i. azoxystrobin was achieved in isolate 1109 from safflower, while the lowest inhibition was found in isolates PCF 437 from lupine. The lowest germination of conidia was established in isolate 1209 from safflower in fungicide with a. i. metiram, while the highest germination was found in isolate 710 from Hypericum perforatum. The highest inhibitory effect was observed in fungicides with a. i. captan ( %), folpet ( %) and mancozeb ( %). Keywords: Colletotrichum acutatum, conidium, fungicides, efficacy Úvod Patogen Colletotrichum acutatum, J. H. Simmonds 1968, patří mezi polyfágní houbové patogeny rozšířené v mnoha zemích na všech kontinentech. Způsobuje značné ekonomické škody na kulturních plodinách především však na rostlinách a plodech jahodníku. V České republice byl v roce 2005 laboratorně potvrzen výskyt tohoto patogena na jahodníku, třešni a lupině. Ve stejném roce byly v okrese Brno-venkov poprvé zaznamenány příznaky napadení patogenem C. acutatum na rostlinách světlice barvířské (Víchová et al., 2011). Patogen se zpočátku vyskytoval ohniskově, později se za vhodných podmínek rozšířil do celého porostu. V roce 2010 byly odebrány vzorky patogena C. acutatum z napadených plodů rajčete (okres Brno-venkov) a napadených plodů jabloně v okresech Brno-venkov a Znojmo (Víchová et al. 2012). Staňková et al. (2011) zjistili, že izoláty tohoto patogena z různých plodin jsou schopny infikovat různé hostitelské druhy rostlin. 183

184 Jednou z možností ochrany plodin vůči patogenu je použití fungicidních přípravků. V ČR je registrován pouze jediný fungicid proti C. acutatum Ortiva (ú.l. azoxystrobin) do jahodníku. Cílem práce bylo stanovit vliv vybraných účinných látek fungicidních přípravků na klíčení konidií C. acutatum. Materiál a metody Pro testování bylo použito sedm různých jednosložkových fungicidních přípravků (Tab. 1). Schopnost klíčení konidií byla testována v laboratorních podmínkách na šesti monosporických izolátech C. acutatum z různých rostlinných hostitelů: CBS (Malus domestica Borkh.), PCF 231 (Fragaria ananassa Duch.), PCF 437 (Lupinus alba L.), 710 (Hypericum perforatum L.), 1109 a 1209 (Carthamus tinctorius L). Metodika vycházela z postupu Kloutvorové a Kupkové (2009) a byla upravena dle aktuálních podmínek. Fungicidní přípravky byly rozpuštěny či smíchány s Potato Dextrose Broth (PDB), přičemž byla připravena o 100 % vyšší koncentrace než koncentrace základní. Z oranžových mas konidií jednotlivých izolátů bylo laboratorní kličkou odebráno takové množství, aby při zvětšení 400 mikroskopu Olympus CX41 bylo v zorném poli vidět konidií. V PDB byla připravena suspenze jednotlivých izolátů. Do každé jamky mikroskopického sklíčka se třemi jamkami bylo napipetováno 10 μl fungicidního přípravku a 10 μl suspenze s konidiemi, aby výsledná koncentrace fungicidního přípravku dosahovala koncentrace základní. Každá jamka byla hodnocena jako jedno opakování. Mikroskopické sklíčko s jednou jamkou bylo považováno za kontrolní a do jamky bylo napipetováno 10 μl PDB a 10 μl suspenze s konidiemi. Mikroskopická sklíčka byla umístěna jednotlivě do sterilních Petriho misek o průměru 10 cm, na jejichž dně byl položen filtrační papír dostatečně nasycený sterilní destilovanou vodou, aby se předešlo vyschnutí pokusného materiálu. Misky byly kultivovány při optimální teplotě pro růst a sporulaci 25 ± 2 C. Po 48 h od založení pokusu bylo při zvětšení 400 mikroskopu Olympus CX41 počítáno v náhodně vybraném zorném poli množství klíčících konidií v celkovém souboru 150 konidií. Výsledky byly statisticky zpracovány jednofaktorovou ANOVA (faktor izolát) programem UPAV. Hladina významnosti byla stanovena na α=0,05. Výsledky a diskuse Všechny hodnocené účinné látky fungicidních přípravků prokázaly inhibiční vliv na klíčení konidií patogena (Tab. 2). Rozdíly v klíčivosti konidií izolátů nebyly zjištěny u fungicidních přípravků s ú. l. dithianon, folpet a mancozeb. Výraznější rozdíly mezi jednotlivými izoláty byly zaznamenány u fungicidních přípravků s ú. l. azoxystrobin a metiram. U fungicidního přípravku s ú. l. azoxystrobin bylo nejvyššího inhibičního účinku dosaženo u izolátu 1109 (42,07% inhibice), zatímco nejnižší 22,97% inhibice byla prokázána u izolátu PCF 437. Nejnižší klíčivost konidií u fungicidního přípravku s ú. l. metiram byla stanovena u izolátu 1209 (76,73% inhibice), naopak nejvyšší klíčivost měl izolát 710 (16,9% inhibice). Celkově nejnižší inhibiční účinek byl zaznamenán u již zmiňovaných fungicidních přípravků s ú. l. azoxystrobin a metiram. Zjištění nízké inhibice ú. l. azoxystrobin bylo překvapivé a byl zde objeven rozpor se studovanou literaturou. Podle etikety totiž tento použitý fungicidní přípravek působí preventivně proti klíčení konidií a měl by být aplikován v časných fázích vývoje choroby (Anonym, 2012). Dobrý inhibiční účinek ú. l. azoxystrobin navíc potvrdily i Kloutvorová a Kupková (2009) ve svých testech klíčivosti konidií C. acutatum. U ostatních účinných látek fungicidních příravků použitých při našem testování se inhibice pohybovala v rozmezí 95,7 100 %. Nejvyšší fungicidní účinek byl prokázán u ú. l. captan (98, %), folpet (99,2 100 %) a mancozeb (99,8 100 %). Kloutvorová a Kupková (2009) rovněž zaznamenaly úplné potlačení klíčivosti konidií u ú. l. captan, ale i u ú. l. thiram. 184

185 Závěr V laboratorním testu zaměřeného na klíčení konidií byla zjištěna rozdílná citlivost izolátů houbového patogena C. acutatum k fungicidním přípravkům obsahujícím různé účinné látky. Žádný z hodnocených izolátů nebyl tolerantní k vybraným účinným látkám fungicidních přípravků. Laboratorní testy lze využít pouze pro předběžná zjištění, účinnost musí být vždy ověřena v polních testech. Při tomto testování je vhodné provádět umělé inokulace více izoláty příslušného patogena, aby se předešlo riziku snížené účinnosti fungicidního přípravku vlivem výskytu odolnější populace patogena. Dedikace Příspěvek byl zpracován s podporou NAZV MZe ČR č. QH81029 "Inovace ochrany světlice barvířské (Carthamus tinctorius L.) proti významným houbovým patogenům". Použitá literatura Anonym: Ortiva. Přípravek na ochranu rostlin. Etiketa, Syngenta. [cit ]. Dostupné na: Kloutvorová, J., Kupková, J Laboratorní testy citlivosti houby Colletotrichum acutatum k fungicidům. Vědecká práce ovocnářská. sv. 21 s Staňková, B., Víchová, J., Pokorný, R Virulence of Colletotrichum acutatum isolates to several host plants. Acta Universitatis Agriculturae et Silviculturae Mendelianae Brunensis. sv. LIX, č. 3, s ISSN Víchová, J., Staňková, B., Pokorný, R First Report of Colletotrichum acutatum on Tomato and Apple Fruits in Czech Republic. Plant Disease. sv. 96, č. 5, s ISSN Víchová, J., Vejražka, K., Cholastová, T., Pokorný, R., Hrudová, E Colletotrichum simmondsii Causing Anthracnose on Safflower in the Czech Republic. Plant Disease.. sv. 95, č. 1, s. 79. ISSN

186 Tab. 1 Účinné látky fungicidních přípravků použité při testování Účinná látka Základní koncentrace Mechanismus působení (%) azoxystrobin (25%) 0,40 systemické, translaminární vlastnosti, zastavuje transport elektronů při dýchání mitochondrií captan (50%) 1,50 kontaktní, multi-side inhibitor, inhibuje růst mycelia, sporulaci a respiraci dithianon (70%) 0,10 kontaktní, ovlivňuje širokou škálu enzymů, zasahuje do buněčného dýchání hub folpet (80%) 0,40 kontaktní, inhibuje respiraci a klíčení spor mancozeb (80%) 0,40 kontaktní, inhibuje klíčení spor metiram (70%) 0,45 kontaktní thiram (80%) 0,40 kontaktní s vícebodovým účinkem, zasahuje do procesu dýchání hub Tab. 2 Inhibice klíčivosti konidií izolátů u jednotlivých účinných látek fungicidních přípravků v % Účinná látka Izolát azoxystrobin captan dithianon folpet mancozeb metiram thiram CBS AB 28,37 100,00 A 100,00 A 100,00 A A 99, ,03 AB 96,40 PCF ,63 AB 100,00 A 100,00 A 100,00 A 99,83 A B 61,84 A 100,00 A PCF ,97 B 100,00 A 98,43 A 100,00 A 100,00 A 20,13 C 100,00 A ,10 AB 98,53 B 96,77 A 99,20 A 100,00 A 16,90 C 95,70 B ,07 A 100,00 A 97,87 A 100,00 A 99,87 A 29,37 BC 96,60 AB ,27 AB 100,00 A 96,50 A 100,00 A 100,00 A 76,73 A 100,00 A Statisticky průkazné rozdíly při hladině významnosti α = 0,05 jsou označeny rozdílnými velkými písmeny Kontaktní adresa: Ing. Jana Víchová, Ph.D. Mendelova univerzita v Brně Agronomická fakulta Zemědělská 1, Brno 186

187 DRUHOVÉ SPEKTRUM PLEVELŮ V MÁKU SETÉM Spectrum of weed species in Papaver somniferum Jonášová K., Horák O. Ústav agrosystémů a bioklimatologie, AF, Mendelova univerzita v Brně Abstrakt Cílem této práce bylo posoudit aktuální zaplevelení porostu máku setého v provozních podmínkách Zemědělského družstva Olbramkostel a společnosti PODYJÍ, a.s., v Horním Břečkově. Intenzita zaplevelení byla zkoumána s použitím metody počítání na ploše 1 m² v patnácti (Olbramkostel 27,74 ha) a padesáti (Horní Břečkov 100,96 ha) opakování. Hodnocení v máku setém bylo provedeno v dubnu, červnu a srpnu. Mák setý byl zaplevelen na obou lokalitách těmito plevely: Tripleurospermum inodorum, Fallopia convolvulus, Elytrigia repens, Polygonum aviculare, Viola arvensis. Výsledky vyhodnocení zaplevelení byly zpracovány analýzou DCA. Kanonickou korespondenční analýzou (CCA) bylo zjištěno, že na porost máku v Horním Břečkově jsou vázány tyto plevele: Sinapis alba, Papaver rhoeas, Cirsium arvense, Fumaria officinalis. Na porost máku v Olbramkostele jsou vázány tyto plevele: Avena fatua, Thlaspi arvense, Persicaria lapathifolia, Brassica napus var. napus, Descurainia sophia. Klíčová slova: plevele, mák setý, druhová diverzita Abstract The aim of this thesis to evaluace current weed infestation of Papaver somniferum in field conditions of agricultural enterprise in Olbramkostel (27,74 ha) and Horní Břečkov (100,96 ha). Observed fields are located in South Moravia region in dry and warm climatic region. Intensity of weed infestation was carried out in chosen fields using counting method on area of 1 m² in 15 and 50 replications. Evaluation in Papaver somniferum was done on April, June and August. The obtained results were analysed using Canonical Correspondence Analysis. Both these fields were weed infestation of species: Tripleurospermum inodorum, Fallopia convolvulus, Polygonum aviculare, Viola arvensis. The fields in the Horní Břečkov are bound by the following species: Sinapis alba, Papaver rhoeas, Cirsium arvense, Fumaria officinalis. The fields in the Olbramkostele are bound by the following species: Avena fatua, Thlaspi arvense, Persicaria lapathifolia, Brassica napus var. napus, Descurainia sophia. Key words: weeds, poppy, species diversity Úvod Mák setý má vůči plevelům jen malou konkurenční schopnost, proto je zaplevelení kritickým bodem velkovýrobní pěstitelské technologie (Baranyk et al., 2010). Hlavní ochrana proti plevelům by měla začít již v předplodinách, v nichž je ochrana snazší. Mák je totiž proti herbicidům méně odolný. O to pečlivější a přesnější musí být aplikace herbicidů v máku z hlediska jejich koncentrace a přesné aplikace (Bechyně, 1998). Materiál a metody Stanovení zaplevelení probíhalo na dvou lokalitách v Horním Břečkově a Olbramkostele. Obě tyto obce leží v Jihomoravském kraji v okrese Znojmo, od něhož jsou vzdáleny asi 11 km. Vzdálenost mezi sledovanými pozemky je 5 km. V Horním Břečkově hodnocení probíhalo na pozemku o výměře 100,96 ha, který patří společnosti PODYJÍ, a.s., a náleží do katastrálního území Horní Břečkov. Tato lokalita se nachází v bramborářské výrobní oblasti. Druhé hodnocení zaplevelení probíhalo na pozemku patřící Zemědělskému družstvu Olbramkostel, katastrální území Olbramkostel. Nachází se na pomezí kukuřičné a řepařské výrobní oblasti a jeho výměra je 27,74 ha. 187

188 V Horním Břečkově je mák setý řazen do osevního sledu jako zlepšující plodina mezi dvě obilniny, v hodnoceném období byl zařazen po pšenici seté. Pěstována byla odrůda Major. V Olbramkostele byla zaseta odrůda Bergam, shodně po obilnině, ale po ječmenu jarním. Zaplevelení bylo hodnoceno ve třech termínech. První termín byl na jaře po vzejití máku, tedy dubna, druhý termín byl v době květu máku setého, tedy června a třetí termín hodnocení byl před sklizní porostu máku, tedy srpna. Intenzita zaplevelení byla zkoumána s použitím metody počítání na ploše 1 m². V Horním Břečkově bylo provedeno padesát opakování na 100,96 ha a v Olbramkostele patnáct opakování na 27,74 ha. Výsledky zaplevelení byly zpracovány mnohorozměrnými analýzami ekologických dat. Výběr optimální analýzy se řídil délkou gradientu (Lengths of Gradient), zjištěného segmentovou analýzou DCA (Detrended Correspondence Analysis). Dále byla použita kanonická korespondenční analýza CCA (Canonical Correspondence Analysis). Při testování průkaznosti pomocí testu Monte-Carlo bylo propočítáno 499 permutací. Data byla zpracována pomocí počítačového programu Canoco 4.0. (Ter Braak, 1998). Tab. 1 Průměrné počty plevelů na lokalitách Horní Břečkov a Olbramkostel Sledovaná lokalita a termín pozorování Horní Břečkov Olbramkostel Druhy plevelů Anagallis arvensis 0,28 0,50 0,47 0,87 Atriplex patula 0,02 0,12 0,07 0,27 Atriplex sagittata 0,16 0,34 Avena fatua 0,10 0,20 0,80 0,67 Brassica napus var. napus 1,53 1,00 Capsella bursa-pastoris 0,02 0,06 3,73 Cirsium arvense 1,56 0,18 0,18 Chenopodium album 0,86 0,36 0,04 0,40 Descurainia sophia 1,20 0,67 0,87 Echinochloa crus-galli 0,24 0,64 1,20 0,33 Elytrigia repens 1,56 0,42 0,32 2,87 0,27 0,27 Euphorbia helioscopia 0,02 Fallopia convolvulus 19,14 0,58 1,16 10,40 0,27 0,93 Fumaria officinalis 0,36 0,18 0,16 Galium aparine 0,12 0,07 0,07 Papaver rhoeas 0,48 0,48 0,33 0,80 Persicaria lapathifolia 6,67 5,87 10,27 Plantago major 0,02 Polygonum aviculare 0,66 0,90 1,44 3,67 2,47 3,20 Sinapis alba 0,80 0,46 Sonchus arvensis 0,18 0,22 Taraxacum officinale 0,04 Thlaspi arvense 1,34 10,40 5,47 6,27 Tripleurospermum inodorum 0,06 0,38 1,50 5,00 4,20 4,47 Triticum aestivum 0,04 0,04 Veronica hederifolia 0,04 0,02 0,04 0,40 0,20 Viola arvensis 0,10 0,30 0,66 3,87 0,53 1,53 188

189 Zkratky vybraných druhů: Fum offi = Fumaria officinalis, Tri aest = Triticum aestivum, Sin alba = Sinapis alba, Ely repe = Elytrigia repens, Che albu = Chenopodium album, Fal conv = Fallopia convolvulus, Tar offi = Taraxacum officinale, Pla majo = Plantago major, Cir arve = Cirsium arvense, Bra napu = Brassica napus var. napus, Tri inod = Tripleurospermum inodorum, Vio arve = Viola arvensis, Des soph = Descurainia sophia, Ver hede = Veronica hederifolia, Per lapa = Persicaria lapathifolia, Thl arve = Thlaspi arvense, Cap burs = Capsella bursa pastoris, Gal apar = Galium aparine, Eup heli = Euphorbia helioscopia, Ech crus = Echinochloa crus galli, Atr sagi = Atriplex sagittata, Pap rhoe = Papaver rhoeas, Son arve = Sonchus arvensis, Ana arve = Anagallis arvensis, Ave fatu = Avena fatua, Atr patu = Atriplex patula, Pol avi = Polygonum aviculace. Vysvětlivky k ordinačnímu diagramu: Horní B. = Horní Břečkov, Olbramko = Olbramkostel Výsledky a diskuze Na obou sledovaných lokalitách bylo zjištěno celkem 27 druhů plevelných rostlin. Průměrné počty těchto jedinců jsou uvedeny v Tab. 1. Nejprve byla vypočtena délka gradientu (Lenghts of Gradient) pomocí analýzy DCA, která činila 4,385. Na základě tohoto výpočtu byla k dalšímu zpracování zvolena kanonická korespondenční analýza CCA. Analýza CCA vymezuje prostorové uspořádání jednotlivých druhů plevelů a variant faktorů, a to na základě dat, která byla o frekvenci výskytu plevelných druhů zjištěna. Toto je následně graficky vyjádřeno pomocí ordinačního diagramu. Výsledky analýzy CCA, která hodnotila vliv lokality na výskyt plevelů, jsou signifikantní na hladině významnosti α = 0,002, pro všechny kanonické osy. Na základě analýzy CCA (Obr. 1) je možné nalezené druhy plevelů rozdělit do tří skupin. První skupina plevelů se vyskytovala především na lokalitě Olbramkostel a jsou to tyto druhy: Veronica hederifolia, Viola arvensis, Tripleurospermum inodorum, Brassica napus var. napus, Persicaria lapathifolia, Descurainia sophia, Capsella bursa pastoris, Thlaspi arvense. Druhá skupina plevelů se vyskytovala především na lokalitě Horní Břečkov a jsou to tyto druhy: Fumaria officinalis, Triticum aestivum, Sinapis alba, Elytrigia repens, Chenopodium album, Fallopia convolvulus, Taraxacum officinale, Plantago major, Cirsium arvense. Třetí skupina plevelů není ovlivněna výběrem pozemku a jsou to tyto druhy: Galium aparine, Euphorbia helioscopia, Echinochloa crus galli, Papaver rhoeas, Atriplex patula, Atriplex sagittata, Sonchus arvensis, Avena fatua, Polygonum aviculace. Závěr Z výsledků je patrné, že byly zjištěny rozdíly zaplevelení mezi sledovanými pozemky. Některé plevelné druhy se vyskytovali pouze na jedné z vybraných lokalit, jako např. Persicaria lapathifolia, Descurainia sophia v Olbramkostele a Fumaria officinalis a Cirsium arvense v Horním Břečkově. Na obou lokalitách dochází k zaplevelování pozemků předchozí 189 Obr. 1 Ordinační diagram zobrazující vliv daného pozemku na zaplevelení

190 pěstovanou plodinou: v Horním Břečkově byl zjištěn výskyt Sinapis alba a v Olbramkostele pak Brassica napus var. napus. Dále se na obou pozemcích vyskytoval Papaver rhoeas, jehož další rozšíření by mohlo v budoucnosti ovlivnit možnost pěstování máku setého na těchto pozemcích. Z výsledků této práce je zřejmé, že provádět hodnocení aktuálního zaplevelení v porostech plodin je nezbytné. Na hodnocených lokalitách se vyskytovaly jak plevelné druhy, které byly nalezeny pouze na jednom z pozemků, tak i druhy rozšířeny na obou lokalitách ve všech termínech pozorování. Z tohoto důvodu se zjišťování aktuálního zaplevelení, jeho následné vyhodnocení a vhodná volba plevelohubného zásahu jeví jako nevyhnutelná agronomická povinnost. Dedikace Práce vznikla jako výstup projektu Interní grantové agentury AF MENDELU číslo: TP 9/2012 Inovace pěstitelských postupů v suchem ohrožených oblastech a projektu Excelence doktorského studia na AF MENDELU pro navazující vědecko-výzkumnou kariéru CZ.1.07/2.3.00/ Použitá literatura Baranyk, P., et al. (2010): Olejniny. 1. vyd. Praha: Profi Press, 206 s. Bechyně, M., (1998): Mák setý, s In: Hosnedl, V., Vašák, J., Mečiar, L., Rostlinná výroba II (luskoviny, olejniny). Praha: Agronomická fakulta ČZU v Praze, katedra rostlinné výroby, 180 s. Ter Braak, C., J., F.:Canoco, A Fortran (1998): program for canonical community ordination by [partial] [detrended] [canonical] correspondence analysis (version 4.0.). Report LWA Agricultural Mathematics Group. Wageningen, Kontaktní adresa: Ing. Kateřina Jonášová Ústav agrosystémů a bioklimatologie, Mendelova univerzita v Brně, Zemědělská 1, Brno, Česká republika, 190

191 VLIV ODRŮDY, OŠETŘENÍ, LOKALITY A ROČNÍKU NA NAPADENÍ OBILEK JARNÍHO JEČMENE PATOGENY RODU FUSARIUM Effect of variety, treatment, locality and year on spring barley grains infection by Fusarium spp. Kmoch M., Šafránková I., Pokorný R. Mendelova univerzita v Brně Abstrakt Cílem práce bylo zjistit vliv vybraných faktorů na úroveň přirozené infekce obilek jarního ječmene houbami r. Fusarium. Pro identifikaci těchto hub byla použita mikrobiologická metoda. V obilkách byly dominantní F. poae, F. avenaceum, F. tricinctum a F. graminearum. Na infekci obilek houbami r. Fusarium měla nejvyšší vliv lokalita a ročník. Vliv fungicidního ošetření byl nejednoznačný. Patogeny F. graminearum a F. sporotrichioides vyvolaly statisticky významně nižší infekci obilek na ošetřené variantě, oproti F. avenaceum a F. poae, které způsobily nižší infekci na neošetřené variantě. Odrůda/linie neměla statisticky průkazný vliv na infekci obilek pravděpodobně díky nízké infekci. Klíčová slova: Fusarium spp., jarní ječmen, odrůdy, mikrobiologická metoda Abstract The aim of the study was to determine the effect of selected factors on the natural infection level of spring barley grains by Fusarium fungi. Microbiological method was used to identify these fungi. Pathogens F. poae, F. avenaceum, F. graminearum and F. tricinctum were dominant in the barley grains. Locality and year had the highest effect on grains infection. Effect of fungicidal treatment was ambiguous. F. graminearum and F. sporotrichioides caused a statistically significantly lower grains infection on treated variant, compared to F. avenaceum and F. poae, which caused lower infection on untreated variant. Varieties/lines had no statistically significant effect on grains infection probably due to the low infection. Key words: Fusarium spp., spring barley, varieties, microbiological method Úvod Fytopatogenní houby rodu Fusarium způsobují několik chorob obilnin, včetně spály klíčních rostlin a hnilob pat stébel a klasů [běloklasost, spála klasů] (Parry et al, 1995). Nejčastějšími druhy na ječmeni (Hordeum vulgare L.) jsou F. graminerarum Schwabe (teleomorfa Gibberella zeae Schwein [Petch]), F. culmorum (W. G. Smith) Saccardo, F. poae (Peck) Wollenweber a F. avenaceum (Fries) Saccardo (t. G. avenacea Cook) (Tekauz et al., 2000; Brennan et al., 2003). Kromě snižování výnosů (Nicholson et al., 1998) produkují celou řadu sekundárních metabolitů mykotoxinů (Logrieco, 2003), které mohou být příčinou onemocnění člověka a hospodářských zvířat (D'Mello et al., 1999). V obilovinách převládají trichotheceny a zearalenon (Nicholson et al., 2003; Desjardins, 2006). Houby r. Fusarium na ječmeni lze omezovat aplikací fungicidů, jejichž účinnost závisí na účinné látce, způsobu, termínu a frekvenci aplikací (Parry et al., 1995; Homdork et al., 2000), meteorologických podmínkách (Mesterhazy et Bartok, 1996), virulenci patogenních kmenů a na přítomných druzích hub (Parry et al., 1995). Cílem práce bylo zjistit vliv odrůdy/linie, fungicidního ošetření, lokality a ročníku na úroveň přirozené infekce obilek jarního ječmene houbami r. Fusarium v podmínkách České republiky. Materiál a metody Pokus se třemi opakováními byl proveden v letech 2010 a 2011 na lokalitě Žabčice (179 m n. m.) a Kroměříž (220 m n. m.). Do pokusu bylo zařazeno 14 odrůd/linií jarního ječmene (pluchaté Aksamit, Blaník, Bojos, Jersey, Kangoo, Prestige, Radegast, Sebastian, Malz, Tolar a bezpluché KM 1057, AF Lucius, KM 2084 a KM 2283) ve dvou variantách, tj. 191

192 fungicidně ošetřená konvenční (osivo namořeno přípravkem Raxil TNT, během vegetace postřiky fungicidy Archer Top 400 EC a Fandango 200 EC) a bez ošetření (nemořené osivo). Fungicid Archer Top 400 EC (0,9 l ha -1 ) byl aplikován ve vývojové fázi ječmene DC 34 (čtvrté kolénko patrné) a Fandango 200 EC (1,2 l ha -1 ) ve fázi DC (celý klas vymetán). Raxil TNT účinná látka tebukonazol (20 g l -1 ) + triazoxid (20 g l -1 ) Archer Top 400 EC účinná látka fenpropidin (275 g l -1 ) + propikonazol (125 g l -1 ) Fandango 200 EC účinná látka fluoxastrobin (100 g l -1 ) + prothiokonazol (100 g l -1 ) K rozlišení jednotlivých druhů r. Fusarium byla použita mikrobiologická metoda. Obilky byly povrchově dezinfikovány (60 sec, 5% chlornan sodný), následně dvakrát opláchnuty sterilní destilovanou vodou a vyskládány do Petriho misek (PM) na bramboro-dextrózový agar (PDA), 10 ks/pm, v pěti opakováních. Inkubace probíhala při laboratorní teplotě (20 24 C). Izolace hub z obilek byla provedena čtvrtý až sedmý den. Pro identifikaci byly vypěstovány čisté kultury z monosporických izolátů (PDA, případně SNA [Spezieller Nährstoffarmer Agar]), dnů, t C, tma). K determinaci druhů byl použit optický mikroskop Olympus BX41 (zvětšení ) a stereomikroskop Olympus SZX12. Byly využity především morfologické znaky makro a mikrokonidií a charakteristiky kolonie houby. Determinace byla provedena podle určovacího klíče Leslie et Summerell (2006) a Samson et al. (1996). Statistické vyhodnocení rozdílů úrovně infekce obilek ječmene houbami bylo provedeno pomocí analýzy rozptylu a mnohonásobného porovnávání (Tukey-HSD; α = 0,05) za použití programu UNISTAT 5.1 (Unistat Ltd., London, UK). V tabulkách ve výsledcích představuje každé písmeno jinou hladinu statistické významnosti při p = 0,05. Úroveň infekce (počet infikovaných obilek v %) byla vypočítána podle vzorce: Úroveň infekce = [%] Výsledky a diskuze V letech 2010 a 2011 bylo na lokalitách Kroměříž a Žabčice identifikováno v obilkách jarního ječmene F. avenaceum (FA), F. poae (FP), F. graminearum (FG), F. tricinctum (FT), F. sporotrichioides (FSP), F. culmorum (FC) a F. verticillioides (FV). Dominantními druhy byly F. poae (40,53 %), F. avenaceum (23,16 %), F. tricinctum (19,74 %) a F. graminearum (10,26 %). Při porovnání úrovně infekce obilek druhy r. Fusarium nebyly zjištěny statisticky průkazné rozdíly mezi jednotlivými odrůdami/liniemi [Tab. 1]. Statisticky významné rozdíly v úrovni napadení obilek byly nalezeny mezi ošetřenou a neošetřenou variantou. U F. poae a F. avenaceum byla úroveň infekce nižší na neošetřené variantě, naopak u F. graminearum a F. sporotrichioides na ošetřené variantě [Tab. 2]. Podle Simpson et al. (2001) a Jones (2000) je F. graminearum citlivé na skupinu triazolů, do kterých patřily námi použité fungicidní účinné látky tebukonazol, propikonazol a prothiokonazol. Ošetření pšenice látkou tebukonazol provedené Ioos et al. (2005) rovněž výrazně snížilo infekci F. graminearum a F. culmorum. Mezi lokalitami byl zjištěn statisticky průkazný rozdíl v úrovni infekce obilek u F. avenaceum, F. poae, F. tricinctum a F. sporotrichioides (nižší napadení bylo zaznamenáno na lokalitě Žabčice) [Tab. 3]. Statisticky průkazný rozdíl mezi ročníky v napadení obilek byl zjištěn u F. poae, F. tricinctum a F. sporotrichioides (nižší napadení v roce 2010) [Tab. 4]. Rozdíly v napadení obilek ječmene houbami r. Fusarium mezi lokalitami Žabčice Kroměříž a mezi ročníky 2010 a 2011 byly s nejvyšší pravděpodobností způsobeny odlišnými meteorologickými podmínkami. Na lokalitě Kroměříž, kde byla v porovnání s lokalitou Žabčice zjištěna vyšší infekce obilek, byl zaznamenán i vyšší úhrn srážek. Podle Mesterhazy et Bartok (1996), Shaner (2003) a Logrieco et al. (2003) ovlivňuje výskyt a prevalenci druhů r. Fusarium ročník, daná oblast pěstování a genotyp houby a hostitelské rostliny. 192

193 Tab. 1 Vliv odrůdy/linie na napadení obilek ječmene (%) houbami r. Fusarium Odrůda/druh FA FP FG FT FSP FC FV Fusarium sp. AF Lucius 1,00 a 4,00 a 0,00 1,25 a 0,25 a 0,00 0,00 6,50 a Aksamit 1,00 a 2,00 a 0,00 2,25 a 0,00 0,00 0,03 5,50 a Blaník 2,00 a 2,00 a 1,25 a 1,25 a 0,25 a 0,00 0,00 7,00 a Bojos 1,00 a 2,75 a 1,00 a 1,25 a 0,25 a 0,00 0,00 6,50 a Jersey 3,00 a 3,50 a 1,00 a 2,25 a 0,25 a 0,00 0,00 10,00 a Kangoo 1,50 a 4,00 a 0,50 a 0,25 a 0,25 a 0,00 0,00 6,50 a KM ,75 a 3,75 a 0,75 a 1,25 a 0,25 a 0,00 0,00 8,00 a KM ,75 a 4,25 a 0,75 a 2,00 a 0,25 a 0,00 0,00 9,25 a KM ,50 a 2,00 a 1,50 a 1,25 a 0,25 a 0,00 0,00 6,50 a Malz 1,25 a 1,50 a 1,25 a 0,50 a 1,50 a 0,03 0,00 6,25 a Prestige 1,50 a 2,50 a 0,50 a 1,75 a 0,25 a 0,00 0,00 6,75 a Radegast 2,25 a 2,50 a 0,75 a 0,50 a 0,25 a 0,00 0,00 6,25 a Sebastian 1,25 a 3,00 a 0,00 1,00 a 0,25 a 0,00 0,00 5,50 a Tolar 1,25 a 0,75 a 0,50 a 2,00 a 0,00 0,00 0,00 4,50 a Tab. 2 Vliv fungicidního ošetření na napadení obilek ječmene (%) houbami r. Fusarium Varianta/druh FA FP FG FT FSP FC FV Fusarium sp. Neošetřená 1,04 a 1,79 a 1,00 b 1,43 a 0,61 b 0,04 a 0,04 a 5,93 a Ošetřená 2,11 b 3,71 b 0,39 a 1,25 a 0,14 a 0,04 a 0,00 7,64 a Tab. 3 Vliv lokality na napadení obilek ječmene (%) houbami r. Fusarium Lokalita/druh FA FP FG FT FSP FC FV Fusarium sp. Kroměříž 2,21 b 4,64 b 0,79 a 2,29 b 0,61 b 0,07 a 0,04 a 10,64 b Žabčice 0,93 a 0,86 a 0,61 a 0,39 a 0,14 a 0,00 0,00 2,93 a Tab. 4 Vliv ročníku na napadení obilek ječmene (%) houbami r. Fusarium Ročník/druh FA FP FG FT FSP FC FV Fusarium sp ,32 a 0,14 a 0,71 a 0,39 a 0,25 a 0,00 0,00 2,82 a ,82 a 5,36 b 0,68 a 2,29 b 0,50 b 0,07 a 0,04 a 10,75 b Závěr Dominantními druhy v obilkách jarního ječmene během let 2010 a 2011 na lokalitách Žabčice a Kroměříž byly F. poae, F. avenaceum, F. tricinctum a F. graminearum. Sporadicky izolovanými druhy byly F. culmorum a F. verticillioides. Na infekci obilek ječmene houbami r. Fusarium měla nejvyšší vliv lokalita (nižší napadení na lokalitě Žabčice), dále pak ročník (nižší infekce v roce 2010). Vliv fungicidního ošetření byl nejednoznačný. F. graminearum a F. sporotrichioides vyvolalo statisticky významně nižší infekci obilek na ošetřené variantě, oproti F. avenaceum a F. poae, které způsobily nižší infekci na neošetřené variantě. Odrůda/linie neměla statisticky průkazný vliv na infekci obilek pravděpodobně díky nízké infekci obilek druhy r. Fusarium. Kontrolou mykotoxigenních hub r. Fusarium lze kromě 193

194 příznivého ovlivňování výnosů minimalizovat průnik mykotoxinů do potravního řetězce a tím chránit zdraví lidí a hospodářských zvířat. Dedikace: Příspěvek byl zpracován s podporou projektu Výzkumného centra pro studium obsahových látek ječmene a chmele č. 1M0570 a projektu č. QI111B044 Komplexní strategie pro minimalizaci negativního dopadu infekce toxikogenními houbami r. Fusarium v obilovinách a odvozených produktech. Použitá literatura Brennan, J. M., Fagan, B., Van Maanen, A., Cooke, B. M., Doohan, F., M., 2003: Studies on in vitro growth and pathogenicity of Fusarium fungi. European Journal of Plant Pathology 109: Desjardins, A. E., 2006: Fusarium Mycotoxins: Chemistry, Genetics and Biology. APS Press. 260 s. D'Mello, J. P., F., Placinta, C. M., Macdonald, A. M. C., 1999: Fusarium mycotoxins: a reviewof global implications for animal health, welfare and productivity. Anim. Feed Sci. Technol 80, Homdork, S., Fehrmann, H., Beck, R., 2000: Effects of field application of tebuconazole on yield, yield components and the mycotoxin kontent of Fusarium infected wheat grain, J. Phytopathol. 148: 1 6. Leslie, J. F., Summerell, B. A., 2006: The Fusarium Laboratory Manual. Oxford: Blackwell Publishing. 388 s. Logrieco, A., Bottalico, A., Mulé, G., Moretti, A., Perrone, G., 2003: Epidemiology of toxigenic fungi and their associated mycotoxins for some Mediterranean crops. European Journal of Plant Pathology 109: Mesterhazy, A., Bartok, T., 1996: Control of Fusarium head blight of beat by fungicides and its effect on the toxin contamination of the. Pflanzenschutz-Nachrichten Bayer 49 (2): Nicholson, P., Chandler, E., Draeger, R. C., Gosman, N. E., Simpson, D. R., Thomsett, M., Wilson, A. H., 2003: Molecular tools to study epidemiology and toxicology of fusarium head blight of cereals. European Journal of Plant Pathology 109 (7): Nicholson, P., Simpson, D. R., Weston, G., Rezanoor, H. N., Lees, A. K., Parry, D. W., Joyce, D., 1998: Detection and quantification of Fusarium culmorum and Fusarium graminearum in cereals using PCR assay. Physiol. Mol. Plant Pathol. 53: Parry, D. W., Jenkinson, P., Mcleod, L., 1995: Fusarium ear blight (scab) in small grain cereals- a review. Plant Pathology 44: Samson, R. A., Hoekstra, E. S., Frisvad, J. C., Filtenborg, O., 1996: Introduction to foodborne fungi. 5th ed. Centraalbureau voor Schimmelcultures, Baarn and Delft, 322 s. Shaner, G., 2003: Epidemiology of Fusarium head blight of small grain cereals in North America. In: Leonard, K., J., Bushnell, W., R. (Eds.), Fusarium Head Blight of Wheat and Barley. APS Press, St. Paul, MN, pp Simpson, D. R., Weston, G. E., Turner, J. A., Jennings, P., Nicholson, P., 2001: Differential control of head blight pathogens of wheat by fungicides and consequences for mycotoxin contamination of grain. European Journal of Plant Pathology 107: Tekauz, A., McCallum, B., Gilbert, J., 2000: Review: Fusarium head blight of barley in western Canada. Canadian Journal of Plant Pathology 22: Kontaktní adresa: Ing. Martin Kmoch, Mendelova univerzita v Brně, Zemědělská 1/1665, Brno 194

195 RELATIVNÍ ČETNOST PŮVODCŮ ČERNÁNÍ STONKU BRAMBORU V ČESKÉ REPUBLICE V ROCE 2012 Relative incidence of potato blackleg pathogen in the Czech Republic in 2012 Krejzar V., Pánková I., Kůdela V. Výzkumný ústav rostlinné výroby, v.v.i., Praha-Ruzyně Abstrakt V letech 2012 jsme na šesti lokalitách v České republice (kraj Vysočina a Plzeňský kraj) uskutečnili průzkum výskytu původců bakteriálního černání stonku bramboru. Z příznakových rostlin jsme k mikrobiologickým analýzám odebrali celkem 75 vzorků. Identifikační testy jsme provedli u 95 bakteriálních izolátů. Relativní četnost výskytu jednotlivých původců černání stonku bramboru jsme stanovili v procentech z celkového počtu identifikovaných patogenů. Mezi získanými izoláty převládal druh Pectobacterium carotovorum subsp. carotovorum, který tvořil 65 % identifikovaných izolátů. Druh P. atrosepticum byl v roce 2012 zastoupen 17 % izolátů, druh Dickeya chrysanthemi nebyl v roce 2012 zaznamenán. Druhy rodu Pseudomonas byly mezi identifikovanými izoláty zastoupeny v rozmezí 1-7 %. Klíčová slova: bakteriální černání stonku bramboru; Dickeya chrysanthemi; Pectobacterium atrosepticum; P. carotovorum subsp. carotovorum; Pseudomonas cichorii; P. corrugata; P. fluorescens; P. marginalis; P. putida; P. viridiflava; brambory; Abstract In this study, we evaluate incidence of various soft rot bacteria in potato stems sampled from five localities in the Czech Republic in We analysed microbiologically altogether 75 samples of potato stems. Relative incidence of individual potato blackleg pathogen was expressed as percentage of the total number of identified pathogens. Of a total 95 isolates obtained from symptomatic blackleg stems, Pectobacterium carotovorum subsp. carotovorum was surprisingly prevailing as it was determined in 65% respectively, P. atrosepticum was determined in 17% respectively. Dickeya chrysanthemi was not determined in The bacterium of Pseudomonas genera were determined isolates in 1-7% respectively. Key words: blackleg; Dickeya chrysanthemi; Pectobacterium atrosepticum; P. carotovorum subsp. carotovorum; Pseudomonas cichorii; P. corrugata; P. fluorescens; P. marginalis; P. putida; P. viridiflava; potatoes; Úvod Publikace navazuje na vědecký článek: Relativní četnost původců černání stonku bramboru v České republice v roce , který byl uveřejněn v časopise Vědecké práce - Výzkumný stav bramborářský Havlíčkův Brod v roce 2011 a přináší informaci o spektru výskytu původců bakteriálního černání stonku bramboru v České republice v roce Černání stonku bramboru je choroba způsobovaná odlišnými bakteriálními patogeny, které jsou přenosné hlízami a jejich výskyt je závislý na převládajících klimatických podmínkách. Bakterie Pectobacterium atrosepticum se běžně projevuje typickou černou hnilobou na bázi stonku. Příznaky choroby mohou být rozdílné v závislosti na převládajících vnějších podmínkách (PÉROMBELON, KELMAN 1980). Patogen byl poprvé popsán jako původce černání báze stonku bramboru pod názvem Bacillus atrosepticus, později redukován na poddruh pod názvem Erwinia carotovora subsp. atroseptica. Status samostatného druhu opět nabyl pod názvem Pectobacterium atrosepticum (GARDAN et al. 2003). V oblastech mírného podnebního pásma je P. atrosepticum běžným patogenem, ke kterému se vztahuje název choroby. Obdobné příznaky černání stonku, které souvisejí s infekcí bakterií P. atrosepticum, mohou v polních podmínkách vyvolat další dvě pektinolytické bakterie, P. carotovorum 195

196 subsp. carotovorum a Dickeya chrysanthemi. Záleží na tom, který z těchto tří patogenů převládá na rozkládající se matečné hlíze, proniká do stonků a za příznivých povětrnostních podmínek se množí v xylémových cévách. Každý z těchto tří patogenů může také samostatně nebo v kterékoliv kombinaci způsobit měkkou hnilobu, a to jak u skladovaných hlíz, tak u sadbových hlíz na začátku vegetace, což má za následek nevzcházivost hlíz a mezerovitost porostu. Po proniknutí těchto odlišných pektinolytických bakterií dovnitř rostlinných pletiv je infekční proces obdobný a viditelné symptomy na rostlinách bramboru stěží rozlišitelné (PÉROMBELON, KELMAN 1987). Geografické rozšíření tří pektinolytických bakterií spjatých s rostlinami bramboru je odrazem klimatické distribuce jejich hostitelských rostlin a růstových charakteristik patogenů při různých teplotách (ELPHINSTONE 1987). Teplota je hlavní faktor ovlivňující patogenezi odlišnými pektinolytickými bakteriemi a určující, který patogenní organizmus bude převládat (LUMB et al. 1986). P. c. subsp. carotovorum a D. chrysanthemi jsou fenotypicky a geneticky heterogennější než P. atrosepticum (TOTH et al. 2003). P. atrosepticum je většinou omezeno na oblasti mírného podnebního pásma, P. c. subsp. carotovorum je celosvětově rozšířeno jak v mírném tak i tropickém podnebním pásmu. Je patogenní pro široké spektrum rostlin a je schopno přežívat v různém prostředí, např. v půdě, ve vodních tocích a jezerech. D. chrysanthemi je široce rozšířena v tropických a subtropických oblastech i v teplých oblastech mírného pásma, kde je patogenní pro mnohé plodiny, včetně těch, které se pěstují ve sklenících v mírných oblastech. Od konce 80. let minulého století byla zaznamenána na sadbových hlízách v některých mírných oblastech (ve Švýcarsku, Nizozemí, Francii a Japonsku), kde mimo jiné způsobila i černání stonku bramboru v polních podmínkách (DICKEY 1979; PÉROMBELON, KELMAN 1987). Pektinolytické enzymy produkují i některé pseudomonády způsobující měkké hniloby u bramboru, zeleninových a ovocných druhů. Patří k nim Pseudomonas viridiflava, P. marginalis a určité kmeny P. fluorescens a P. putida, které produkují enzym pektatlyázu. Některé kmeny nepektinolytických fluorescentních pseudomonád se mohou změnit za určitých podmínek na pektinolytické (LIAO 1991). Cílem tohoto příspěvku je zjistit spektrum výskytu původců bakteriálního černání stonku bramboru v České republice v roce Materiál a metody V roce 2012 bylo na 5 lokalitách z celkem 22 odrůd odebráno 75 vzorků stonků bramboru s příznaky bakteriálního černání. Ze zhnědlých částí cévních svazků na příčném a podélném řezu stonkem byly odebírány segmenty, které byly macerovány ve sterilní destilované vodě a roztírány na dva typy živných médií: (i) MPAg vhodné pro izolaci a kultivaci bakterií rodu Dickeya a Pectobacterium; (ii) King B vhodné pro kultivaci a izolaci bakterií rodu Pseudomonas. Živná média byla uchovávána v termostatu při teplotě 28 C po dobu 1-2 dnů. Petriho misky s živným médiem MPAg byly hodnoceny na přítomnost bakterií rodu Dickeya a Pectobacterium po 24 hodinách, Petriho misky s živným médiem King B byly hodnoceny na přítomnost bakterií rodu Pseudomonas po 48 hodinách. U získaných čistých kultur bakteriálních izolátů byly stanoveny jejich biochemické vlastnosti při využití identifikačního systému Biolog GEN III MicroPlate TM. Izoláty z rodu Pseudomonas byly podrobeny testům hypersenzitivity na rostlinách tabáku (Nicotiana tabacum L.). Pektinolytické vlastnosti vybraných bakteriálních izolátů byly ověřovány metodou inokulace plátků hlíz bramboru. Relativní četnost výskytu jednotlivých izolovaných původců černání stonku bramboru v roce 2012 byla stanovena v procentech z celkového počtu identifikovaných patogenů. Výsledky a diskuse V roce 2012 bylo na 5 lokalitách odebráno 75 vzorků stonků bramboru s příznaky bakteriálního černání, pocházejících celkem z 22 odrůd. Ze 75 vzorků bylo získáno celkem

197 bakteriálních izolátů. Z celkem 95 bakteriálních izolátů bylo 65 % identifikováno jako Pectobacterium carotovorum subsp. carotovorum, 17 % jako P. atrosepticum, 7 % jako Pseudomonas fluorescens, 4 % jako P. synxantha, 2 % jako P. marginalis, 2 % jako P. syringae, 1 % jako P. corrugata a 1 % jako P. cichorii. Druh Dickeya chrysanthemi nebyl mezi získanými izoláty identifikován (tab. 1, 2). Tab. 1: Výsledky identifikace 95 bakteriálních izolátů pocházejících z 5 lokalit v roce 2012 Lokalita Počet Počet Výsledky identifikace (%) Pcc Pa Pf Psyn Pm Ps Pcorr Pcich odrůd izolátů Celkem Pcc - Pectobacterium carotovorum subsp. carotovorum; Pa - P. atrosepticum; Pf - Pseudomonas fluorescens; Psyn - P. synxantha; Pm - P. marginalis; Ps - P. syringae; Pcorr - P. corrugata; Pcich - P. cichorii; Výsledky mikrobiologické analýzy stonků bramboru s příznaky bakteriálního černání získané v roce 2012 jsme porovnali s výsledky získanými v letech 2010 a 2011 (tab. 2). V roce 2010 z celkového počtu 120 testovaných bakteriálních izolátů pocházejících z 52 vzorků odebraných na celkem 3 lokalitách bylo 63 % identifikováno jako P. c. subsp. carotovorum, 13 % jako D. chrysanthemi, 6 % jako P. atrosepticum, 2 % jako P. viridiflava, 2 % jako P. putida a 2 % jako P. fluorescens. Celkem 12 % bakteriálních izolátů se nepodařilo identifikovat (KREJZAR et al. 2011) (tab. 2). V roce 2011 z celkového počtu 76 testovaných bakteriálních izolátů pocházejících z 29 vzorků odebraných na 3 lokalitách bylo 58 % identifikováno jako P. c. subsp. carotovorum, 16 % jako P. atrosepticum, 3 % jako P. putida a 20 % jako P. fluorescens. Celkem 4 % bakteriálních izolátů nebylo možno spolehlivě identifikovat (tab. 2). Bakterie D. chrysanthemi nebyla při průzkumu provedeném v roce 2011 detekována (KREJZAR et al. 2011). Tab. 2: Výsledky identifikace bakteriálních izolátů pocházejících z 5 lokalit v roce 2012 v porovnání s výsledky identifikace na 3 lokalitách v letech 2010 a 2011 Rok Počet Počet Výsledky identifikace (%) odrůd izolátů Pcc Pa Dch Pf Pv Ppu Pm Pcorr Pcich Pcc - Pectobacterium carotovorum subsp. carotovorum; Pa - P. atrosepticum; Dch - Dickeya chrysanthemi; Pf - Pseudomonas fluorescens; Pv - P. viridiflava; Ppu - P. putida; Pm - P. marginalis; Pcorr - P. corrugata; Pcich - P. cichorii; Převládajícím izolovaným patogenem v roce 2012, podobně jako v letech 2010 a 2011, byl druh P. c. subsp. carotovorum. Průměrná růstová teplota P. atrosepticum je okolo 27 C (při 36 C neroste), P. c. subsp. carotovorum okolo 29 C a D. chrysanthemi okolo 35 C (ELPHINSTONE 1987). Převládají-li v době výsadby brambor nízké teploty pod 15 C, převládá napadení druhem P. atrosepticum, a to jak stonků, tak i hlíz. Se stoupající teplotou se zvyšuje četnost a síla napadení stonků a hlíz bakteriemi P. c. subsp. carotovorum a D. chrysanthemi 197

198 (ELPHINSTONE 1987). Efektivní regulace původce černání stonku spočívá primárně na produkci a používání čisté sadby (PÉROMBELON 2000). Cílem je vypracování spolehlivých a ekonomicky přijatelných testů, kterými by bylo možno kvantifikovat kontaminaci hlíz patogeny, které představují pro porosty bramboru v určité oblasti hlavní riziko. Předpokládá se, že při použití tohoto přístupu se dosáhne lepších výsledků, než tomu bylo při aplikaci uznávání sadbových porostů založených na inspekci a odstraňování rostlin s příznaky černání báze stonku, které většinou nebývá důsledné. Kromě toho, vizuální hodnocení četnosti výskytu černání stonku v porostu je nespolehlivým indikátorem kontaminace dceřiných hlíz. Podle DE BOERA (2001) významně klesá škodlivost původce černání stonku bramboru v případech, kdy jsou sadbové brambory odvozeny z vegetativně množených mikrorostlin a počet polních generací se sníží. Dedikace Tato práce vznikla za finanční podpory Ministerstva zemědělství ČR, projekt č Použitá literatura De Boer S.H. (200l): Blagleg/soft rot of potato. In: Maloy O.C., Murry T.D.: Encyclopedia of plant pathology, Volume I., II. John Wiley & Sons, Inc., New York. Dickey R.S. (1979): Erwinia chrysanthemi: a comparative study of phenotypic properties of strains from several hosts and other Erwinia species. Phytopathology 69: Gardan L., Gouy C., Christen R., Samson R. (2003): Elevation of three subspecies of Pectobacterium carotovorum to species level: Pectobacterium atrosepticum sp. nov., Pectobacterium betavasculorum sp. nov. and Pectobacterium wasabiae sp. nov. International Journal of Systematic and Evolutionary Microbiology 53: Elphinstone, J.G. (1987): Soft rot and blackleg of potato. Erwinia spp. Technical Information Bulletin 21. International Potato Center, Lima, Peru. Krejzar V., Pánková I., Hausvater E., Doležal P., Kůdela V. (2011): Relativní četnost původců černání stonku bramboru v České republice v roce Vědecké práce - Výzkumný ústav bramborářský Havlíčkův Brod, 2011, 19: Liao G.H. (1991): Cloning of pectate lyase gene pel from Pseudomonas fluorescens and detection of sequences homology to pel in Pseudomonas viridiflava and Pseudomonas putida. Journal of Bacteriology 173: Lumb V.M., Pérombelon M.C.M., Zutra D. (1986): Studies of a wilt diseases of the potato plant in Israel caused by Erwinia chrysanthemi. Plant Pathol. 35: Pérombelon, M.C.M. - Kelman, A. (1980): Ecology of the soft rot erwinias. Ann. Rev. Phytopathol., 18: Pérombelon M.C.M., Kelman A. (1987): Blackleg and other potato diseases caused by soft rot erwinias: a proposal for a revision of the terminology. Plant Disease 71: Pérombelon M.C.M. (2000): Blackleg risk potential of seed potatoes determined by quantification of tuber contamination by the causal agent and Erwinia carotovora subsp. atroseptica: a critical review. OEPP/EPPO. Bulletin, 30: Toth J.K., Bell K.H., Holeva M.C., Birtch P.R.J. (2003): Soft rot erwiniae: from genes to genomes, Molecular Plant Patology 4: Kontaktní adresa : Ing. Václav Krejzar, Ph.D. Výzkumný ústav rostlinné výroby, v.v.i. Drnovská 507, Praha 6-Ruzyně, 198

199 VLIV PŘEDPLODINY A ZPRACOVÁNÍ PŮDY NA DIVERZITU A DRUHOVÉ SPEKTRUM PLEVELŮ Influence previous crop and soil tillage on species spectrum and weeds diversity Neischl A. 1, Winkler J. 2, Klepáčková V. 2, Zelená V. 1 1 Ústav biologie rostlin, 2 Ústav agrosystémů a bioklimatologie Mendelova univerzita v Brně Abstrakt Stanovení druhové rozmanitosti plevelných společenstev bylo provedeno u plodiny pšenice ozimé roce 2010 a Polní pokus byl založen v Žabčicích na polní pokusné stanici Mendlovy univerzity. Pšenice ozimá byla pěstována po předplodině vojtěšce seté a po předplodině kukuřici silážní. Při porovnání tří variant zpracování půdy (orba, minimalizace a přímé setí) bylo zjištěno největší zaplevelení, na variantě s minimalizačním zpracováním půdy a nejmenší na variantě, kde byla použita tradiční technologie zpracování půdy. Po tradiční technologii (orbě) bylo nalezeno 20 druhů plevelů, kde nejvíce dominoval Veronica polita, po minimalizační technologii druhů 17, kde měl opět největší zastoupení Veronica polita a po bezorebné technologii druhů 14, přičemž dominoval plevelný druh Capsella bursa-pastoris. Klíčová slova: plevele, zpracování půdy, předplodina, diverzita Abstract Determination of species diversity of weed communities was made in winter wheat stand in 2010 and The field experiment was established in Žabčice on the field experimental station of Mendel University in Brno. Winter wheat was raised by previous crop alfalfa as well as by previous crop silage maize. Comparison of three variants of soil tillage (ploughing, minimum tillage and direct sowing) shown that the highest weed infestation was on the variant with minimum tillage and the lowest was on the variant where the conventional way of tillage was used. After conventional technology (ploughing) was found 20 species of weeds, the most dominant was Veronica polita, on the minimum-tillage variant 17 species, the most common was Veronica polita again and after notillage was found 14 species and the most dominant was the weed specie Capsella bursa-pastoris. Key words: weeds, soil tillage, previous crop, diversity Úvod Zemědělství České republiky a jeho vliv na životní prostředí je poznamenán minulostí. Biologická rozmanitost na zemědělské půdě nedosahuje požadované úrovně, což se projevuje snížením populací původních druhů (MARADA et al., 2010). Dle MIKULKA et al. (1999) procházejí plevelná společenstva složitým vývojovým cyklem. V minulosti byla tato společenstva druhově bohatá a na polích bylo zastoupeno mnoho desítek plevelných druhů. Vývoj druhového spektra plevelných společenstev byl a stále bude ovlivňován celou řadu faktorů. Za základní příčinu snížení diverzity v agroekosystémech je považována ztráta funkce ekosystémů jejich narušením. Je to právě zemědělství, které má zájem na jednoduchých a uniformních ekosystémech řízených člověkem. Tím způsobuje vymizení mnoha původních druhů rostlin a živočichů, snížení druhové diverzity společenstev, ekosystémů a změny v početnosti druhů (MARADA et al., 2010; BOHÁČ et al., 2006). Vliv rozdílných technologií zpracování půdy a předplodiny na výskyt a druhovou rozmanitost společenstva plevelů v porostu pšenice ozimé byl hodnocen na polním pokusu. Materiál a metody Polní pokus byl založen na polní pokusné stanici v Žabčicích v roce Jednotlivé parcely mají velikost 1000 m2 (100 x 10 m). V polním pokusu byl použit sedmihonný osevní postup 199

200 (vojtěška setá - první užitkový rok; vojtěška setá druhý užitkový rok; ozimá pšenice; kukuřice na siláž; ozimá pšenice; cukrovka; jarní ječmen). V rámci sedmihonného osevního postupu byly k plodině pšenice ozimé použity tři varianty zpracování půdy. První varianta byla tradiční zpracování půdy, v textu označena jako orba. Druhá varianta byla minimalizace zpracování půdy s mělkým zpracováním, u které bylo použito označení minimalizace a třetí variantou bylo přímé setí, v textu označeno bez orby. Zaplevelení bylo vyhodnocováno před aplikaci herbicidů v porostech pšenice ozimé. Termíny vyhodnocení byly a Počty jedinců jednotlivých druhů plevelů byly zjišťovány na ploše 1 m2 a to ve 12 opakováních. České a latinské názvy jednotlivých druhů plevelů byly použity podle Kubáta (KUBÁT, 2002). Druhová diverzita byla vyjádřena pomocí Indexu diverzity (I div. ), který byl vypočten dle vzorce I div. = S.I -1, kde S je počet druhů a I je počet jedinců. Ke statistickému zpracování počtu druhů plevelů a Indexu diverzity byl použit počítačový program STATISTICA.Cz, dále byla aplikována analýza rozptylu a následně metoda minimální průkazné diference (LSD). K vyhodnocení výskytu jednotlivých druhů plevelů na variantách byla použita mnohorozměrná analýza ekologických dat kanonická korespondenční analýza CCA (Canonical Correspondence Analysis). Průkaznost byla testována pomocí testu Monte-Carlo a bylo propočítáno 499 permutací. Data zpracoval počítačový program Canoco 4.0. (TER BRAAK, 1998). Výsledky a diskuze V průběhu sledování bylo na pokusu nalezeno celkem 24 druhů plevelů. V Tab. 1 jsou uvedeny výsledky testování LSD počtu druhů a indexu diverzity. Rozdíly v hodnotách počtu druhů a byly indexu diverzity statisticky průkazné mezi osevními postupy a variantami zpracování půdy. Tab. 1 Výsledky testování LSD počtu druhů plevelů a Index diverzity Varianty Počet druhů Index diverzity Rok sledovaní Statistická průkaznost Průměrný I div. Průměrný počet druhů (druh.m -2 ) (α =0,05) 200 Statistická průkaznost (α =0,05) (α =0,01) ,45 a 0,53 a a ,33 a 0,59 b a Předplodina Statistická průkaznost (α =0,01) Statistická průkaznost (α =0,01) Kukuřice 3,17 a 0,62 a Vojtěška 3,62 b 0,49 b Zpracování Statistická půdy průkaznost Statistická průkaznost (α =0,01; α =0,05) Orba 3,17 (α =0,01; α =0,05) a 0,64 a Minimaliza 3,81 b 0,50 b ce Bez orby 3,20 a 0,53 b Výsledky analýzy CCA, která hodnotila vliv technologie zpracování půdy na výskyt plevelů je signifikantní na hladině významnosti α = 0,002, pro všechny kanonické osy. Na základě analýzy CCA (Obr. 1) je možné nalezené druhy plevelů rozdělit do 4 skupin: druhy v blízkosti značky CT ovlivněné orbou (rozrazil perský, ostrožka východní, úhorník

201 mnohodílný, rozrazil břečťanolistý, mák vlčí, opletka obecná, hořčice rolní, zemědým lékařský, merlík bílý, starček obecný), druhy v blízkosti značky MT ovlivněné minimalizační technologií (rozrazil lesklý, hluchavka nachová, penízek rolní, hluchavka objímavá, silenka noční), druhy v blízkosti značky NT ovlivněné bezorebnou technologií (svízel přítula, tolice vojtěška, heřmánkovec nevonný, violka rolní, rdesno ptačí, pcháč oset, locika kompasová), druhy ostatní ovlivněné jiným faktorem (ptačinec prostřední, kokoška pastuší tobolka). Vliv zpracování půdy a předplodiny na výskyt plevelů je také signifikantní na hladině významnosti α = 0,002 a je zobrazen na Obr. 2. Na základě analýzy CCA je možné nalezené druhy plevelů rozdělit do 3 skupin: druhy v blízkosti značky Vojteska (svízel přítula, ptačinec prostřední, hluchavka objímavá, heřmánkovec nevonný, tolice vojtěška, violka rolní, rdesno ptačí), druhy v blízkosti značky Kukurice (penízek rolní, hluchavka nachová, kokoška pastuší tobolka, silenka noční), druhy ostatní ovlivněné jiným faktorem (rozrazil lesklý, rozrazil perský, mák vlčí, ostrožka východní, úhorník mnohodílný, rozrazil břečťanolistý, starček obecný, zemědým lékařský, merlík bílý, hořčice rolní, locika kompasová, opletka obecná). Obr. 1 Ordinační diagram vyjadřující vliv technologie zpracování půdy na výskyt plevelů Obr. 2 Ordinační diagram vyjadřující vliv technologie zpracování půdy a předplodiny na výskyt plevelů Vysvětlivky ke zkratkám: technologie zpracování půdy CT orba, MT minimalizace, NT bezorebná technologie. předplodina Vojteska, Kukurice. Technologie zpracování půdy: NT bezorebná technologie, MT minimalizační technologie, CT orba. Druhy plevelů: Cap burs (Capsella bursa-pastoris), Cir arve (Cirsium arvense), Con orie (Consolida orientalis), Des soph (Descurainia sophia), Fall con (Fallopia convolvulus), Fum offi (Fumaria officinalis), Gal apar (Galium aparine), Che albu (Chenopodium album), Lac serr (Lactuca serriola), Lam ampl (Lamium amplexicaule),lam purp (Lamium purpureum), Med sati (Medicago sativa), Pap rhoe (Papaver rhoeas), Pol avic (Polygonum aviculare), Sen vulg (Senecio vulgaris), Sil noct (Silene noctiflora), Sin arve (Sinapis arvensis), Ste medi (Stellaria media), Thl arve (Thlaspi arvense),tri inod (Tripleurospermum inodorum), Ver hede (Veronica hederifolia), Ver pers (Veronica persica), Ver poli (Veronica polita), Vio arve (Viola arvensis). 201

202 Závěr Z výsledků testování minimální průkazné diference (LSD) vyplývá, že rozdíly v počtu druhů byly statisticky průkazné mezi předplodinami a variantami zpracování půdy. Dle výsledků testování LSD Indexu diverzity byla společenstva plevelů druhově pestřejší v roce 2010, po předplodině vojtěšce, u minimalizace a bezorebné technologie. Na variantě, kde byla provedena orba bylo nalezeno 20 druhů plevelů, na pozemcích s minimalizací se vyskytovalo 17 plevelných rostlin a v porostech s bezorebnou technologií bylo zjištěno 14 druhů plevelů. Na variantě s orbou dominoval rozrazil lesklý a rozrazil perský. Na minimalizační variantě vykazoval největší zastoupení rozrazil lesklý a hluchavka objímavá. Na pozemcích s bezorebnou technologií se v nejvíce vyskytovala kokoška pastuší tobolka a rozrazil lesklý. Obecně lze říci, že s vyšší diverzitou roste odolnost společenstva. Při masivním používání chemických prostředků však zůstává otázkou, zda je vůbec možné druhovou diverzitu plevelů nějak zachovat a současně podpořit, protože celý ekosystém je výrazně ovlivňován vůli člověka pěstitele. Průměrný počet druhů byl u minimalizace vyšší oproti orbě. Index diverzity vykazoval druhově pestřejší společenstva plevelů u minimalizace a bezorebné technologie, a také po předplodině vojtěšce. Celkově druhů však bylo málo. Z velké části se jednalo a jednoleté přezimující druhy plevelů. Dedikace Práce vznikla jako výstup projektu Interní grantové agentury AF MENDELU číslo: TP 9/2012 Inovace pěstitelských postupů v suchem ohrožených oblastech. Použitá literatura Boháč, J., Moudrý, J., Desetová, L. 2006: Biodiversity and Agriculture. Život. Prostr., Vol. 41, No. 1. Katedra agroekologie Zemědělské fakulty Jihočeské univerzity V Českých Budějovicích. Dostupné na: Kubát, K. 2002: Klíč ke květeně České republiky. Academia. Praha. 928 s. ISBN Marada, P., Havlíček, Z., Skládanka, J. 2010: Ochrana přírody a krajiny Ekosystémové služby, nový trend zemědělského podnikání, 1.vyd. Brno, Mendlova univerzita v Brně, 45 s. Mikulka, J. a kol. 1999: Plevelné rostliny polí, luk a zahrad. 1.vyd., Praha, 160 s. Ter Braak, C., J., F. 1998: CANOCO A FORTRAN program for canonical community ordination by [partial] [detrended] [canonical] correspondence analysis (version 4.0.). Report LWA Agricultural Mathematics Group. Wageningen,. Kontaktní adresa: Ing. Jan Winkler, Ph.D. Ústav agrosystémů a bioklimatologie, Mendelova univerzita v Brně Zemědělská Brno, Česká republika 202

203 POTVRZENÝ VÝSKYT PŮVODCE BLEEDING CANKER JÍROVCŮ V ČR The first report of causal agent of bleeding canker of horse chestnut in the Czech Republic Pánková I. 1, Krejzar V. 1, Mertelík J. 2, Kloudová K. 2 1 Výzkumný ústav rostlinné výroby, v.v.i. 2 Výzkumný ústav Silva Taroucy pro krajinu a okrasné zahradnictví, v.v.i. Abstrakt Choroba bleeding canker (BC) s českým názvem slizotoková nekróza na jírovci maďalu (Aesculus hippocastanum) vyvolaná bakterií Pseudomonas syringae pv. aesculi (Psa) byla v České republice poprvé prokázána v roce První výskyt choroby byl zjištěn na lokalitě Měděnec v Krušných horách, přítomnost Psa na této lokalitě byla potvrzena v roce Od roku 2011 byl výskyt bakterie Psa prokázán i na dalších dvou lokalitách. Přítomnost bakterií Psa byla prokázána v korových a floémových pletivech stromů různého stáří. Bakterie Psa byly úspěšně izolovány v průběhu celého vegetačního období. Bakterie byly identifikovány metodami Biolog, Sherlock a qpcr. Patogenita izolátů byla ověřena na semenáčcích jírovce maďalu. Klíčová slova: Aesculus hippocastanum L. jírovec maďal, bleeding canker, Pseudomonas syringae pv. aesculi, izolace Abstract Disease bleeding canker (BC) with the czech name slizotoková nekróza on horse chestnut (Aesculus hippocastanum) caused by the bacteria Pseudomonas syringae pv. aesculi (Psa) has been demonstrated for the first time in 2010 in the Czech Republic. The first occurrence of the disease was recorded on the locality Měděnec in the Ore mountains. The presence of the pathogen on this locality was confirmed in From 2011 the presence of this Pseudomonas subspecies on the other two localities was demonstrated. The presence of the bacteria was demonstrated in the bark and floem tissue of trees of different ages. The bacteria were successfully isolated and identified during the entire growing period. Bacteria have been identified by Biolog, Sherlock a qpcr methods. Pathogenicity of isolates was confirmed by inoculation of the horse chestnut seedlings. Keywords: Aesculus hippocastanum L. horse chestnut, bleeding canker, Pseudomonas syringae pv. aesculi, isolation Úvod Jírovec maďal (koňský kaštan) je převládajícím druhem jírovce v České republice. Porosty jírovců jsou v současnosti v ČR nejvíce ohrožovány klíněnkou jírovcovou (Cameraria ohridella), některými houbovými chorobami (Phytophthora sp.) a nově bakterií Pseudomonas syringae pv. aesculi (Psa), způsobující bleeding canker (BC), česky slizotokovou nekrózu jírovce maďalu. Choroba se projevuje praskáním korových pletiv, především na hlavním kmeni. Z různě velkých prasklin vytéká rezavý až tmavě hnědý klej, který postupně zasychá a vytváří na povrchu kmene tmavě hnědé shluky, připomínající krápníky. Na kmeni se mohou tvořit puchýřky vyplněné touto tekutinou. Při silné infekci je zasažena i koruna, dochází k celkovému chřadnutí stromu, které končí úhynem. Po roce 2000 došlo postupně k masivnímu odumírání jírovců v západní Evropě ve Velké Británii, Belgii, Holandsku a Německu. Příčiny vypuknutí této epidemie dosud nebyly objasněny. K rychlému šíření choroby v západní Evropě pravděpodobně přispívá celkové oteplování klimatu. Mírnější a vlhčí zimy umožňují přežívání patogena. Příznaky BC jsou velmi podobné příznakům vyvolaným houbami rodu Phytophthora spp. Vzhledem k postupu infekce v západní Evropě probíhal v České republice v letech orientační průzkum výskytu BC v rámci sledování jiných chorob jírovce maďalu. Sporadicky byly zaznamenávány výtoky kleje z prasklinek na 203

204 kmeni jírovců. Při mikrobiologických analýzách byla v jednom případě identifikována infekce houbou Phytophthora cactorum. Systematický průzkum výskytu BC jírovců v důsledku napadení gramnegativní fluorescentní bakterii Pseudomonas syringae pv. aesculi (Psa) byl zahájen v roce 2009 v rámci projektu NAZV QI92A246 (Mertelík et al., 2012). Izoláty mohou být identifikovány biochemickými, chemickými nebo molekulárně-biologickými systémy. Stávající databáze biochemických a chemických systémů umožňují spolehlivě identifikovat původce BC na úroveň druhu. Přestože rozlišení jednotlivých patovarů Pseudomonas syringae (Ps) je obtížné jakoukoliv metodou, jako nejperspektivnější metoda identifikace v současnosti se jeví qpcr (Green et al., 2009). Materiál a metody V letech byly v ČR během vegetačního období odebírány vzorky korových a floémových pletiv jírovce maďalu (Aesculus hippocastanum) z městských a krajinných výsadeb s podezřením na příznaky BC. Z každého příznakového stromu byly podle intenzity napadení odebírány 1-3 vzorky. Pro porovnání byly na jaře a na podzim odebírány stejné typy pletiv jírovce maďalu z lokalit v Holandsku (Keukenhof) a Německu (Meppen) s již dříve potvrzeným výskytem BC. Všechny odebrané vzorky pletiv byly podrobeny mikrobiologické analýze, bylo stanoveno spektrum přítomných bakterií, s důrazem na přítomnost Psa a hub, s důrazem na přítomnost rodu Phytophthora. Části korových pletiv s příznaky BC byly macerovány ve sterilní vodě, maceráty byly roztírány na bakteriologické médium King B (KING et al., 1954) a mykologické mrkvové médium (Stelfox and Herbut, 1979). Houby byly kultivovány 2 týdny při C. Bakterie byly kultivovány 2-4 dny při teplotě 21 C. Spektrum hub bylo hodnoceno zejména mikroskopicky. Spektrum bakterií bylo hodnoceno systémy Biolog GEN III system protokol A (Biolog, Inc., Hayward CA), MIDI gas chromatography system (MIDI, Microbial ID, Inc., Newark, DE), metodou qpcr (Green et al., 2009), testy hypersensitivity na tabáku a testy patogenity na 1-2letých semenáčcích jírovce maďalu, genotypu Sklenné. Při testech patogenity na jírovcích byla do vzrostných vrcholů a letorostů dvou semenáčků injikována suspenze izolátu o koncentraci 10 6 buněk/ml. Po 3 měsících byla zjišťována přítomnost lézí. Molekulárně biologická specifikace Psa byla provedena metodou qpcr (STEP One Plus, Fast SYBR Green PCR Mastermix, Applied Biosystems) a specifickými primery dle Green et al., (2009). Pro identifikaci byla použita buď přímo suspenze bakterií izolovaných ve VÚRV,v.v.i., nebo přímo DNA získaná z korových pletiv pomocí izolačního kitu Qiagen. Jako pozitivní kontrola byla využita korová pletiva odebraná ze stromů s prokázaným BC v Nizozemí a Německu a kmen Psa PD 2250 (Velká Británie). Výsledky a diskuze V letech byl proveden průzkum výskytu BC na více než 200 lokalitách, kontrolováno bylo více než 3000 stromů jírovců různého stáří. Příznaky podobné BC byly zjištěny na 18ti lokalitách. Analyzováno bylo celkem 39 vzorků s příznaky BC z 9 lokalit ČR. V žádném z analyzovaných vzorků nebyla prokázána přítomnost houby rodu Phytophthora. Fluorescentní bakterie byly izolovány ze všech typů pletiv a bez ohledu na roční období. Izolace byla úspěšná i u starších zaschlých vzorků. Izoláty, včetně pozitivní kontroly PD 2250 byly nejprve anylyzovány a identifikovány systémem Biolog GEN III a MIDI databází Sherlock TSBA6. Vzhledem k tomu, že ani v jedné z těchto databází není dosud uveden patovar aesculi, byla pozitivní kontrola identifikována jako Pseudomonas syr. pv. tabaci. Získané izoláty byly identifikovány jako patovary druhu syringae (antirrhini, aptata, maculicola, primulae, syringae). Do dalšího ověřování byly vzhledem k morfologické a biochemické podobnosti zařazeny i izoláty identifikované jako Pseudomonas fluorescens (Tabulka 1). V testech patogenity byly prověřovány jak identifikované izoláty Pseudomonas 204

205 syringae, tj. s koeficientem podobnosti nad 0,5 (SimIndex > 0,5), tak i neidentifikované izoláty Pseudomonas syringae (SimIndex < 0,5). U vybrané skupiny izolátů identifikovaných jako Pseudomonas syringae (přednostně s SimIndex > 0,75) byla provedena identifikace metodou qpcr se specifickými primery pro Psa (Tabulka 1). Jako první byl jako Psa jednoznačně identifikován izolát 6404/2A z lokality Měděnec. Tento kmen vykazoval prudkou hypersenzitivní reakci na tabáku. Po inokulaci semenáčků jírovce vyvolával tvorbu rozsáhlých lézí na letorostech a odumírání vzrostných vrcholů, na listech se tvořily charakteristické rezavě hnědě drobné skvrny kolem vodivých pletiv. Typ lézí vytvořených po inokulaci pozitivní kontrolou a izolátem z Měděnce byl shodný. Vzniklé léze jsou dobře rozlišitelné od dalších typů lézí vyvolaných jinými abiotickými a biotickými faktory. K naplnění Kochových postulátů byla provedena reizolace patogena z drobných listových lézí. Virulentní reizolát 6404/2A se v současnosti využívá pro testování hladiny rezistence jednotlivých genotypů jírovce maďalu vůči bakterii Psa. Přítomnost patogena Psa na lokalitě Měděnec byla opakovaně potvrzena v letech 2011 a Vzhledem k nárůstu počtu lokalit v posledním roce se nechá očekávat další šíření choroby v ČR. Doposud byl zaznamenán výskyt pouze mírnějších příznaků choroby ve formě výtoků z kmene. Chřadnutí koruny stromů a úhyn stromů byl v ČR dosud pozorován pouze ojediněle, přičemž bylo zřejmé, že se jedná o komplexní poškození dalších bionóz a abionóz vázaných na jírovce (Mertelík et al., 2012). Bohužel stav na lokalitě Měděnec, kde v roce 2010 příznaky BC vykazovalo více jak 70% z více než sta stromů jírovců rozdílného stáří, se již blíží obrázkům poškozených porostů jírovců v západní Evropě. Účinná ochrana proti bakterii Psa neexistuje. Všeobecně se doporučuje udržovat porosty jírovců v dobré kondici. Bylo zaznamenáno, že výraznější projev chřadnutí stromů s BC byl u jedinců se slabší vitalitou, přičemž např. eliminace minování klíněnky jírovcové měla na posílení vitality významný vliv (Percival a Noviss, 2010). Tabulka 1: Výsledky identifikace a testů patogenity izolátů rodu Pseudomonas získaných z pletiv jírovce maďalu odebraných v letech na lokalitách ČR s podezřením na výskyt původce bleeding canker, bakterie Pseudomonas syringae pv. aesculi rok odběru období lokalita vzorek číslo 205 identifikace t.patogenity BIOLOG MIDI qpcr tabák jírovec 2010 Havířov 6335/1 P. fluorescens Ps. pv. syringae N - + jaro 6335/3 Ps. pv. aceris* P. putida B N - N 6335/4 Ps. pv. syringae* neidentifikováno N - N Karviná 6336/1 P. fluorescens Ps. pv. syringae /2A P. marginalis Ps. pv. tabaci * - - N Praha 6338/2B Ps. pv. helianthi* Ps. pv. syringae Ostrov 6399/1A Ps. pv. helianthi* Ps. pv. syringae - - N pozdní 6399/1H Ps. pv. tomato* Ps. pv. tomato* léto 6399/1S Ps. pv. syringae Ps. pv. tabaci Měděnec 6404/2A Ps. pv. syringae Ps. pv. syringae pozdní 6404/2E Ps. pv. tabaci Ps. pv. syringae + + N léto 6404/2H Ps. pv. antirrhini Ps. pv. tomato + + N 2011 Měděnec 6523/1 Ps. pv. primulae Ps. pv. syringae N - N podzim 6523/2A Ps. pv. primulae Ps. pv. phaseolicola N + N 6523/2B Ps. pv. antirrhini Ps. pv. syringae N + N 6523/3C Ps. pv. aceris P. putida B N + N 6523/3D Ps. pv. syringae P. putida B N + -

206 6523/4 P. tolaasii Ps. pv. syringae N /10A Ps. pv. antirrhini Ps. pv. tagetes N + N 6523/10C Ps. pv. antirrhini Ps. pv. maculicola N /11 Ps. pv. pisi Ps. pv. tabaci N /13 Ps. pv. primulae Ps. pv. syringae N Olomouc 6637/2 Ps. pv. aptata Ps. pv. maculicola + + N jaro 6637/6 Ps. pv. pisi Ps. pv. tagetes - + N Měděnec 6649/1 Ps. pv. antirrhini Ps. pv. tabaci /2 P. fluorescens Ps. pv. tabaci /3 P. fluorescens Ps. pv. antirrhini Klatovy 6656/1 Ps. pv. aptata Ps. pv. tagetes PK Ps. pv. tabaci Ps. pv. tabaci * - izolát s indexem podobnosti SimIndex < 0,5; P. Pseudomonas; Ps. Pseudomonas syringae; N - netestován; intenzita reakce - negativní (-), pozitivní (+) Závěr Choroba BC na jírovci maďalu vyvolaná bakterií Psa byla v roce 2010 poprvé prokázána v ČR. Vzhledem k více jak desetiletým zkušenostem v některých státech západní Evropy lze předpokládat její postupné plošné šíření. K závažnosti situace přispívá jednak skutečnost, že původcem BC jsou napadány stromy všech věkových kategorií a bez ohledu na charakter lokality a jednak vysoké zastoupení jírovců v užitných výsadbách v ČR. Z hlediska úrovně chřadnutí jírovců s BC ukazují současné výsledky na zhoršování stavu stromů v důsledku komplexního působení s dalšími biotickými a abiotickými faktory. Dedikace Tato práce byla podpořena výzkumným projektem NAZV QI 92A246. Použitá literatura Green S., Laue B., Fossdal C. G., A hara S.W. and Cottrell J. E. (2009): Infection of horse chestnut (Aesculus hippocastanum) by Pseudomonas syringae pv. aesculi and its detection by quantitative real-time PCR. Plant Pathology 58, p: King E. O., Ward M. K. & Raney D. E. (1954): Two simple media for the demonstration of phycocyanin and fluorescin. J Lab Clin Med 44, p: Mertelík J., Kloudová K., Pánková I., Krejzar V. and Kůdela V. (2012): Vývoj slizotokové nekrózy jírovců způsobené infekcí Pseudomonas syringae pv. aesculi v období 2010 až 2012 na první lokalitě prokázaného výskytu choroby v ČR. Acta Pruhoniciana 101(v tisku). Percival C. G. and Noviss K. (2010): Managing Pseudomonas Bleeding Canker of Horse Cheastnut.Bartlet Tree Research Laboratories Technical Report. Chestnut.pdf Stelfox D. and Herbut M. (1979): Growth of a Phytophthora sp. on carrot agar. Can. Plant Dis. Surv. 59(3), p: Kontaktní adresa: Iveta Pánková, Ph.D., Výzkumný ústav rostlinné výroby, v.v.i., Drnovská 507, Praha 6 Ruzyně, 206

207 VLIV LOKALITY NA KONTAMINACI SEMEN ŘEPKY OLEJKY OZIMÉ PATOGENY ALTERNARIA BRASSICAE, ALTERNARIA BRASSICICOLA A LEPTOSPHAERIA MACULANS, LEPTOSPHAERIA BIGLOBOSA Location effect on contamination of winter oilseed rape seeds by pathogens Alternaria brassicae, Alternaria brassicicola and Leptosphaeria maculans, Leptosphaeria biglobosa Plachká E. 1, Macháčková I. 2 1 OSEVA vývoj a výzkum s.r.o., provozovna Opava 2 SELGEN, a.s., Šlechtitelská stanice Chlumec nad Cidlinou Abstrakt Cílem práce bylo kvantifikovat přenos patogenů Alternaria brassicae, A. brassicicola a Leptosphaeria maculans, L. biglobosa osivem. Pro tyto účely jsme modifikovali metodiku zkoušení pro stanovení kontaminace semen. Semena jsme umístili na filtrační papír do roztoku kyseliny 2,4- dichlorfenoxyoctové. Inkubace patogenů na semenech probíhala při střídání UVC záření a tmy. Pracovali jsme se 46 vzorky semen z lokalit Opava a Chlumec n. C. sklizených v letech 2010 a U Alternaria spp. byla zjištěna kontaminace od 20 % do 95 % semen z lokality Chlumec n. C. a 47 % až 100 % z lokality Opava. U Leptosphaeria spp. byla stanovena kontaminace 0 % až 4 % sklizně z Chlumce n. C. a 0 % až 5 % z Opavy. U Alternaria brassicae, A. brassicicola byla potvrzena korelace mezi lokalitou a kontaminací semen. Byla také zjištěna korelace mezi napadením rostlin patogeny Leptosphaeria spp. na poli a kontaminací sklizně z lokality Chlumec n. C. Klíčová slova: Ozimá řepka; kontaminace semen; Alternaria brassicae; Leptosphaeria maculans; Leptosphaeria biglobosa Abstract The aim of this work was to quantify Alternaria brassicae, A. brassicicola and Leptosphaeria maculans, L. biglobosa pathogens transport by seeds. The testing method for the detection of seed contamination was modified for this purpose. The seeds were placed on filter paper soaked with 2,4- dichlofenoxyacetic acid. Incubation of the pathogens was under alternation of the UVC radiation and dark periods. In 2010, 2011 forty six seeds samples from the harvest of the locations Opava and Chlumec n. C. were tested. Pathogen Alternaria spp. contaminated from 20 to 95 % of the harvest from the location Chlumec n. C. and 47 % to 100 % of the havest from Opava. Leptosphaeria spp. contaminated from 0 % to 4 % of the harvest from Chlumec n. C. and 0 % to 5 % from Opava. The correlation between location and seed contamination by Alternaria brassicae, A. brassicicola observed was confirmed. The correlation was also detected between plant infection by Leptosphaeria spp. in the field and the seed harvest contamination from location Chlumec n. C. Key words: Winter oilseed rape; seed contamination; Alternaria brassicae; Leptosphaeria maculans; Leptosphaeria biglobosa Úvod Řepka olejka je celosvětově druhou nejvýznamnější olejninou s přibližnou produkcí 55 milionů tun semen. Jejím největším producentem je Evropská unie a po té Čína (Baranyk a kol., 2010). V ČR se pěstuje převážně ozimá forma. Osevní plochy se od roku 2007 pohybují mezi tisíci hektary. V pěstování řepky mají velký význam choroby alternáriová skvrnitost brukvovitých a fomová hniloba brukvovitých. Ty způsobují padání klíčních rostlin, nouzové dozrávání a předčasné otevírání šešulí. Jako původce alternariové skvrnitosti brukvovitých jsou uváděny dva patogeny - Alternaria brassicae (Berk.) Sacc. a Alternaria brassicicola (Schwein.) Wiltsh. (Hoffmann, Schmutterer 1999). U fomové hniloby brukvovitých jsou také uváděny dva patogeny - Leptosphaeria maculans (Desm.) Ces. et de 207

208 Not. a Leptosphaera biglobosa sp. Nov. Shoemaker & Brun. Oba patogeny mají společné imperfektní stádium Phoma lingam (Tode ex Fr.) Desm. (Rimmer and Berg, 2007). L. biglobosa je obecně méně škodlivá, způsobuje povrchové léze na stonku, L. maculans je hodnocena jako více škodlivá, způsobuje hnilobu (rakovinu) báze stonku (West et al cit. podle Huang et al. 2005). Infekčním zdrojem jsou posklizňové zbytky rostlin řepky a semena. Přenos semeny byl prokázán. U A. brassicae a A. brassicicola se jedná o přenos sporami nebo myceliem v osemení. Infekce semen může být vyšší než 20 %. Po 3 měsících skladování může infekce poklesnout o 50 %. Vysoké ztráty byly zaznamenány na sazenicích zelí vypěstovaných z osiva s kontaminací 80 %. Kontaminace osiva patogeny L. maculans a L. biglobosa zůstala v mnoha polních pokusech i přes vysoké napadení stonku nižší než 1 %. Přenos patogenů L. maculans, L. biglobosa semeny má větší význam u brukvovitých zelenin při pěstování jejich sadby, protože sazenice jsou infikovány již během růstu (Hoffmann, Schmutterer 1999). V ČR chyběla pro potřebu šlechtitelů dostupná metodika pro hodnocení kvality zdravotního stavu osiva šlechtitelských materiálů a nebyly k dispozici informace o vlivu lokalit množení na zdravotní stav osiva. Pro tyto účely byla modifikována metodika pro hodnocení kontaminace semen patogeny Leptosphaeria maculans a Alternaria linicola (Chadová, 2006) pro patogeny Altermaria brassicae, A. brassicicola a Leptosphaeria maculans, L. biglobosa. Pomocí modifikované metodiky byla v letech 2010 a 2011 vyhodnocena kontaminace semen uvedenými patogeny a vliv lokality na zdravotní stav osiva. Materiál a metody V roce 2009/2010 a 2010/2011 jsme na sledovaných lokalitách Opava a Chlumec nad Cidlinou založili polní výkonové zkoušky se stejnými materiály řepky olejky ozimé s nízkým obsahem glukosinolátů a kyseliny erukové. Hodnocení zdravotního stavu rostlin jsme provedli ve fázi BBCH 85 (asi 50 % šešulí vyzrálých) stupněm 1 až 9. Pro fomovou hnilobu brukvovitých/fomové černání stonku je stupeň 9 bez výskytu choroby, stupeň 1 - více než 50 % rostlin má alespoň jednu skvrnku na hlavním stonku, část skvrn obepíná více než 80 % stonku. Pro alternárivou skvrnitost brukvovitých/čerň řepkovou je stupeň 9 bez výskytu choroby, stupeň 1 - je napadeno více než 75 % plochy větví nebo šešulí. V roce 2010 jsme ze sklizně testovaného souboru vybrali 11 materiálů, v roce 2011 byl testován celý soubor, to je 35 materiálů z každé lokality. U těchto vzorků jsme stanovili kontaminaci semen patogeny A. brassicae, A. brassicicola a L. maculans, L. biglobosa. Jako výchozí metodiku pro stanovení kontaminace semen sledovanými patogeny jsme použili filtrační metody pro Alternaria linicola a Leptosphaeria maculans (Chadová 2006). Pracovali jsme s modifikovanou metodou pro podmínky fytopatologické laboratoře v Opavě. Modifikaci metody jsme realizovali před založením uvedených testů. Velikost zkušebního vzorku byla 100 semen. Ošetření semen: propláchnutí destilovanou vodou a umístění po 25 semenech na 1 Petriho misku na médium. Médium: 3 vrstvy filtračního papíru s 6 ml 0,2% roztoku sodné soli kyseliny 2,4-dichlorfenoxyoctové. Po té probíhala inkubace patogenů 11 dní při laboratorní teplotě a střídání UVC záření (9 hodin) a tmy (15 hodin). Jako zdroj záření jsme použili germicidní lampu vysílající záření s vlnovou délkou 253,7 nm. Před diagnostikou kolonií černí A. brassicae, A. brassicicola jsme kolonie černí potvrdili vyhodnocením přítomnosti konidií patogenů u 20 namátkově vybraných kolonií. Z nich jsme připravili mikroskopický preparát a vyhodnotili přítomnost konidií pomocí mikroskopu Carl Zeiss Jena při 312,5 násobném zvětšení. Po té jsme kolonie černí diagnostikovali pomocí 25 násobného zvětšení pomocí binokulární lupy. Diagnostiku pyknid patogenů L. maculans, L. biglobosa jsme provedli přímo pomocí binokulární lupy při 25 násobném zvětšení. 208

209 Na závěr testu jsme v procentech vyhodnotili kontaminaci semen v 1 vzorku a průměrnou kontaminaci, provedli statistické posouzení vlivu napadení rostlin na kontaminaci semen a kontaminací semen a vlivu lokality. K vyhodnocení jsme použili program MS Office Excel. Výsledky a diskuze Kontaminace semen jednotlivých materiálů patogeny A. brassicae, A. brassicicola se ve sledovaných letech pohybovala od 20 % do 100 %. Průměrná kontaminace semen na lokalitu se v obou letech pohybovala od 37,89 % do 96,8 %. V literárních zdrojích je uvedeno, že infekce semen může být vyšší než 20 % (Hoffmann, Schmutterer 1999). Získané výsledky kontaminace semen byly v závislosti na materiálu, lokalitě a ročníku rovny a vyšší než 20 %. V roce 2010 byla zaznamenána vyšší kontaminace sklizně z lokality Chlumec nad Cidlinou 92,4 %. V roce 2011 byla zaznamenána vyšší kontaminace sklizně z lokality Opava 96,8 %. Kontaminace semen jednotlivých materiálů patogeny L. maculans, L. biglobosa se ve sledovaných letech pohybovala od 0 % do 5 %. Průměrná kontaminace semen na lokalitu se v obou letech pohybovala od 0,28 % do 1,46 %. Tato skutečnost odpovídá údajům citovaných v zahraniční literatuře, že kontaminace osiva patogeny L. maculans a L. biglobosa zůstávala v mnoha polních pokusech i přes vysoké napadení stonku nižší než 1 % (Hoffmann, Schmutterer 1999). V roce 2010 byla zaznamenána vyšší kontaminace sklizně z lokality Opava 1,46 %. V roce 2011 byla zaznamenána vyšší kontaminace sklizně z lokality Chlumec nad Cidlinou 0,83 %. Vedle kontaminace semen byl korelacemi posouzen vliv lokality na kontaminaci semen u obou patogenů a vliv napadení rostlin na kontaminaci semen u patogenů L. maculans, L. biglobosa. Byl potvrzen vliv lokality na kontaminaci semen patogeny A. brassicae, A. brassicicola v obou sledovaných letech a vliv napadení rostlin patogeny L. maculans, L. biglobosa na kontaminaci semen na lokalitě Chlumec nad Cidlinou v roce Vliv napadení rostlin u A. brassicae, A. brassicicola na kontaminaci semen nebyl posuzován, protože napadení před sklizní na poli bylo v obou letech a na obou lokalitách vyrovnané. Výsledky jsou uvedeny v tabulkách 1 až 3. Tabulka 1: Kontaminace semen patogeny A. brassicae, A. brassicicola a L. maculans, L. biglobosa v roce 2010, 11 materiálů/vzorků, [%] Opava Chlumec n. Cidlinou Materiál A. brassicae A. brassicicola L. maculans L. biglobosa A. brassicae A. brassicicola L. maculans L. biglobosa Minimální hodnota Maximální hodnota Průměr 65,5 1,45 92,4 0,36 Tabulka 2: Kontaminace semen patogeny A. brassicae, A. brassicicola a L. maculans, L. biglobosa v roce 2011, 35 materiálů/vzorků, [%] Opava Chlumec n. Cidlinou Materiál A. brassicae A. brassicicola L. maculans L. biglobosa A. brassicae A. brassicicola L. maculans L. biglobosa Minimální hodnota Maximální hodnota Průměr 96,8 0,28 37,89 0,83 209

210 Tabulka 3: Výpočet korelací, rok 2010/2011 Napadení Lokalita A. brassicae A. brassicicola 0, /-0, L. maculans L. biglobosa -0, /0, L. maculans L. biglobosa Na poli Opava Na poli Chlumec n. Cidlinou Na poli Opava, Chlumec n. C. Semen 0,062253/-0, ,16652/-0, ,16356/-0,04553 Závěr U Alternaria spp. byla vyšší kontaminace sklizně zjištěna v roce 2010 v Chlumci n. C. - 92,4 % a v roce 2011 v Opavě - 96,8 %. U Alternaria spp. byla v obou letech potvrzena korelace mezi lokalitou a kontaminací semen. Kontaminace závisela na průběhu počasí na lokalitě. U Leptosphaeria spp. byla v roce 2010 zjištěna vyšší kontaminace sklizně z Opavy - 1,45 % a v roce 2011 z Chlumce n. C - 0,83 %. Korelace mezi lokalitou a kontaminací semen nebyla v žádném roce potvrzena. V roce 2011 byla na lokalitě Chlumec nad Cidlinou potvrzena korelace mezi napadením rostlin patogeny Leptosphaeria spp. před sklizní a kontaminací sklizně. Použitou filtrační metodu je možné použít pro stanovení kontaminace osiva patogeny Alternaria brassicae, A. brassicicola a Leptosphaeria maculans, L. biglobosa. Dedikace Prezentované výsledky byly získány mimo jiné za finanční podpory projektu MZe ČR QH Použitá literatura Baranyk P., Soukup J., Balík J., Kazda J., Markytán P., Šaroun J., Zelený V., Volf M., 2010: Řepka olejka ozimá, s In: BARANYK P. a kol.: Olejniny. Profi Press s.r.o., Praha, 206 s. Hoffmann G. M., Schmutterer H., (1999): Parasitäre Krankheiten und Schädlinge an landwirtschaftlichen Kulturpflanzen. 2. erweiterte und ergänzte Auflage. Verlag Eugen Ulmer Stuttgart. s Huang Y.J., Fitt B.D.L., Jedryczka M., Dakowska S., West J.S., Gladders P., Steed J.M., Li Z.Q., 2005: Patterns af ascospore release in relation to phoma stem canker epidemiology in England (Leptosphaeria maculans) and Poland (Leptosphaeria biglobosa). European Journal of Plant Pathology, 111: Chadová J., 2006: Přehled chorob a skladištních škůdců na osivu vybraných druhů plodin : (metodika zkoušení zdravotního stavu osiva). České Budějovice, Kurent s. Rimmer S.R., van den Berg C.G.J., 2007: Black Leg (Phoma Stem Cnaker), s In: Rimmer S.R., Shattuck I.V. and Buchwald L. (ed.), Compendium of Brassica Disease. The American Phytopathological Society. West J.S., Balesdent M.H., Rouxel T., Narcy J.P., Huang Y.J., Roux J., Steed J.M., Fitt B.D.L., SCHMIT J., 2002: Colonisation of winter oilseed rape tissues by A/Tox + and B/Tox 0 Leptosphaeria maculans (phoma stem canker) in France and England. Plant Pathology 51: Kontaktní adresa: Ing. Eva Plachká, Ph.D. OSEVA vývoj a výzkum s.r.o., provozovna Opava, Purkyňova 10, Opava předměstí 210

211 ODOLNOST VYBRANÝCH GENOTYPŮ OZIMÉ ŘEPKY VŮČI HOUBOVÝM PATOGENŮM TESTOVANÝCH V MEZISTANIČNÍCH ZKOUŠKÁCH VÝKONU V LETECH Resistance of selected genotypes of winter oilseed rape to fungal pathogens tested in interstation tests of performance in Poslušná J. 1, Plachká E. 2 1 Agritec Plant Research s.r.o. 2 OSEVA PRO s.r.o., oz VÚO Opava Abstrakt Od roku 2000 probíhá v ČR testování nových genotypů ozimé řepky v mezistaničních předzkouškách výkonu na vybraných stanovištích. Byly posuzovány zejména hospodářské vlastnosti včetně vyhodnocení výnosu a odolnosti vůči významným houbovým patogenům, které představuje Leptosphaeria maculas / L. biglobosa (původce fomové hniloby brukvovitých) a Sclerotinia sclerotiorum (původce bílé hniloby řepky). Nové genotypy ozimé řepky pocházely ze šlechtitelských stanic v Opavě, Chlumci nad Cidlinou a ve Slapech a byly testovány na vybraných lokalitách v Šumperku, Chlumci nad Cidlinou a v Kujavách. V letech 2010 až 2012 bylo každoročně testováno na 50 nových materiálů. Získané výsledky potvrdily šlechtění odolnějších materiálů vůči sledovaným houbovým patogenům při dosažení stabilního výnosu. Původ genotypů průkazně neovlivnil získané výsledky jejich odolnosti, přesto nejvyšší průměrné hodnoty odolnosti vůči vybraným patogenům před sklizní byly pozorovány u genotypů ze šlechtitelské stanice Opava a Chlumec nad Cidlinou. Klíčová slova: ozimá řepka, genotypy, šlechtění na odolnost, fomová hniloba brukvovitých, bílá hniloba řepky Abstract Since 2000 new genotypes of winter oilseed rape have been tested in interstation tests of performance at selected sites in Czech Republic. There were assessed particularly economic evaluation of properties, including yield and resistance to major fungal pathogens as Leptosphaeria maculas / L. biglobosa (causing phoma stem canker) and Sclerotinia sclerotiorum (causing white rot). New genotypes of winter oilseed rape derived from breeding stations in Opava, Chlumec Cidlinou and Slapy and were tested at selected locations in Šumperk, Chlumec Cidlinou and Kujavy. In the years 2010 to 2012 there were tested annually about 50 new materials. The results confirmed the breeding of more resistant materials to fungal pathogens with achieving a stable yield. The origin of the genotypes did not significantly affect the results of their resistance to fungal pathogens. Nevertheless, the highest average values of resistance to fungal pathogens before harvest were observed in genotypes from breeding station Opava and Chlumec Cidlinou. Keywords: winter oilseed rape, genotypes, breeding for resistance, phoma stem canker, Sclerotinia white rot Úvod Mezi významné choroby řepky olejky patří zejména fomová hniloba brukvovitých, bílá hniloba řepky a šedá plísňovitost brukvovitých. Fomová hniloba brukvovitých, kterou způsobuje komplex patogenů Leptosphaeria maculans / L. biglobosa, může při zvýšené míře napadení porostů způsobit až 10% škody na výnosu, v letech se silným výskytem chorob až % dle míry napadení (Kazda et al., 2008). Stejně tak bílá hniloba řepky, kdy polyfágní patogen Sclerotinia sclerotiorum napadá celé rostliny řepky, zamořuje pozemek novými sklerocii, která dlouhodobě přežívají v půdě a mohou následně infikovat následné plodiny. Obě choroby způsobují nouzové dozrávání, což je nežádoucí faktor ovlivňující výnos i kvalitu produkce (Poslušná, Plachká, 2009b). 211

212 Testování hospodářských vlastností nových materiálů v předzkouškách výkonu na více lokalitách s rozdílnými klimatickými podmínkami značně přispívá k segregaci vhodných a slibných materiálů, které dále pokračují do Státních odrůdových zkoušek. (Poslušná, Plachká, 2009a). Nejen díky tomuto procesu byly letos přihlášeny nové odrůdy ozimé řepky Oceania a Orion, které zastupuje/vlastní firma OSEVA PRO, s.r.o. a odrůda Cortes zastoupená firmou SELGEN a.s. (OSEVA, Agro Brno, 2012). Materiál a metody Polní pokusy s novými genotypy ozimé řepky byly založeny na vybraných stanovištích v Šumperku, Chlumci nad Cidlinou a v Kujavách. Maloparcelkové pokusy s parcelami o velikosti 10 m 2 jsou plně randomizovány a pokus byl veden ve 3 opakováních. Jako kontrolní materiál k novým genotypům byly vybrány registrované odrůdy totožné s kontrolními odrůdami ve státních odrůdových zkouškách. Hodnocení zdravotního stavu a výskytu významných houbových chorob probíhalo dle Metodiky ÚKZÚZ v Brně pro zkoušky užitné hodnoty odrůd řepky olejky ozimé (2005). Zdravotní stav genotypů se hodnotil v růstové fázi BBCH 85. Dle míry poškození rostlin chorobami byly zařazeny do jednotlivých stupňů napadení. Napadení fomovou hnilobou se posuzuje dle 9 stupňů poškození: 9 bez výskytu, 8 ojedinělý výskyt tj. 1-2 rostliny se skvrnou na stonku na parcele; 7 do 10 % rostlin se skvrnou na hlavním stonku; 5 do 20 % rostlin má alespoň jednu skvrnu na hlavním stonku; 3 do 50 % rostlin má alespoň jednu skvrnu na hlavním stonku, část skvrn obepíná více než 80 % obvodu stonku; 1 více jak 50% rostlin má alespoň jednu skvrnu na hlavním stonku, většina skvrn obepíná více než 80 % stonku. Napadení bílou hnilobou řepky se posuzuje dle 6 stupňů napadení: 9 bez výskytu; 8 ojedinělý výskyt tj. 1-2 rostliny na parcelu; 7 do 5 % rostlin; 5 do 10 % rostlin; 3 do 50 % rostlin; 1 více než 50 % rostlin. Získaná data byla statisticky porovnána za pomocí vybraných statistických metod: srovnání dle Abbotta a Tukey test: P=0,10; P=0,05. Výsledky a diskuze Výskyt houbových chorob v porostu je značně závislý na zdroji infekce a na průběhu povětrnostních podmínek. Z grafu č. 1 je patrné, že výskyt sledovaných chorob a průměrný stupeň poškození řepkových porostů ve vybraných ročnících je rozdílný. Na lokalitě Šumperk byly získány výsledky poměru napadení fomovou hnilobou brukvovitých a bílé hniloby řepky v roce 2010 (7,30 : 6,26), v roce 2011 (7,09 : 5,74) a v roce 2012 (5,27 : 6,49), veskrze tedy nízké až střední napadení houbovými chorobami. Na lokalitě Chlumec nad Cidlinou se jednalo o poměry nízkého a středního stupně napadení chorobami v letech 2010 (7,30 : 6,65) a 2012 (5,79 : 7,94), v roce 2011 se jednalo o střední napadení oběma chorobami 5,70 : 5,63. Na lokalitě Kujavy byl zdravotní stav řepkových porostů hodnocen jako komplex houbových chorob jedním číslem. Výsledky nabývaly středních až vysokých stupňů napadení v roce 2010 (5,48), v roce 2011 (4,12) a v roce 2012 (7,27). V následujících grafech jsou znázorněny hodnoty napadení houbovými chorobami vzestupně, tedy od nejvíce napadeného genotypu ozimé řepky po nejméně napadený genotyp. Byl hodnocen vliv původu vybraných genotypů na odolnost vůči komplexu houbových patogenům, výsledky však nebyly statisticky průkazné. Mezi top ten testované genotypy v roce 2010 patřily materiály ze Slap a Chlumce nad Cidlinou, v roce 2011 materiály ze šlechtitelských stanic Opava a Slapy a v roce 2012 převažovaly materiály ze šlechtitelské stanice Opava a Chlumec nad Cidlinou. Avšak v průměru lze dle hodnocení pořadí v grafech 2-4 usuzovat, že odolnější genotypy pocházejí ze šlechtitelských stanic Opava a Chlumec nad Cidlinou. 212

213 Graf č. 1: Hodnocení odolnosti vybraných genotypů ozimé řepky vůči houbovým patogenům v MPZ na zkušebních stanicích Graf č. 2: Odolnost vybraných genotypů ozimé řepky vůči komplexu houbových patogenů v roce 2010 Graf č. 3: Odolnost vybraných genotypů ozimé řepky vůči komplexu houbových patogenů v roce

214 Graf č. 4: Odolnost vybraných genotypů ozimé řepky vůči komplexu houbových patogenů v roce 2012 Závěr 1) Při testování genotypů ozimé řepky na odolnost vůči komplexu houbových patogenů, měla více jak polovina materiálů výrazně lepší zdravotní stav než kontrolní registrované odrůdy. 2) Nejvyšší průměrné hodnoty odolnosti vůči komplexu houbových patogenů před sklizní byly pozorovány u genotypů ze šlechtitelské stanice Opava a Chlumec nad Cidlinou. 3) Testování v mezistaničních předzkouškách slouží k selekci slibných genotypů ozimé řepky, které mají zvýšenou šanci ve Státních odrůdových zkouškách. Dedikace Výsledky vycházejí z řešeného projektu MZe ČR NAZV QI111A075. Použitá literatura Kazda J., Škeřík J. a kol Metodika integrované ochrany řepky. SPZO s.r.o., Praha, 78 s. OSEVA, Agro Brno Nabídka osiva a sadby. Podzim [online]. [cit ]. Dostupné z: Poslušná J., Plachká E. 2009a. Monitoring výskytu významných chorob řepky olejky a odolnost vybraných řepkových genotypů vůči fomové hnilobě (L. maculans) a hlízence obecné (S. sclerotinia). S In: Šafránková I., Šefrová H. (eds): XVIII. Česká a slovenská konference o ochraně rostlin. Sborník abstraktů. MZLU v Brně, 2. 4.září 2009, 239 s. Poslušná J., Plachká E. 2009b. Odolnost vybraných genotypů ozimé řepky olejky vůči fomové hnilobě brukvovitých (Leptosphaeria maculans)a bílé hnilobě řepky (Sclerotinia sclerotiorum) hodnocených na zkušebních lokalitách v Šumperku a Opavě, Úroda 12/2009, vědecká příloha s Kontaktní adresa: Ing. Jana Poslušná Agritec Plant Research, s.r.o. Zemědělská 2520/16, Šumperk 214

215 VYUŽITÍ METODY MATENÍ SAMCŮ PROTI NESYTCE JABLOŇOVÉ (SYNANTHEDON MYOPAEFORMIS) Mating disruption method use against apple clearwing moth (Synanthedon myopaeformis) Psota V., Bagar, M BIOCONT LABORATORY Abstrakt V letech byl sledován vliv metody matení samců (Isomate P) na výskyt housenek nesytky jabloňové (Synanthedon myopaeformis Borkhausen, 1789). Sledování probíhalo v produkčních sadech na lokalitě Tuchoraz (36 ha) a ve dvou sousedících sadech (sad 9 6,5 ha, sad ha) na lokalitě Stošíkovice. Metoda matení samců byla aplikována v letech 2010, 2011 v dávce 300 odparníků na ha (pouze ve Stošíkovicích v roce 2011 bylo 220 dparníků/ha). Hodnocení průměrného výskytu housenek na jeden strom bylo provedeno každoročně v měsíci dubnu. Na lokalitě Tuchoraz byl zjištěn následující průměrný výskyt housenek na jeden strom: ,57; ,36 a ,17. Na lokalitě Stošíkovice průměrný výskyt housenek následující: Sad 9: ; ,13 a ,69; sad 10: ,63; ,5 a ,31. Klíčová slova: nesytka jabloňová, sady, metoda matení samců, feromony, jabloně Abstract The effect of mating disruption method Isomate P (Shin-Etsu, Japan) on apple clearwing moth (Synanthedon myopaeformis Borkhausen, 1789) larvae occurrence was evaluated during the years 2010, 2011 and 2012 in apple orchards in the Czech Republic on localities Tuchoraz (36 ha) and Stošíkovic. Location Stošíkovice was consisted of two adjacent orchards (sad ha and aad ha) Isomate P was applied in 2010 and Dosage of Isomate P was 300 dispensers per hectare in Tuchoraz. It Stošíkovice it was 300 dispensers per hectare in 2010 and 220 dispensers per hectare in Average occurrence of apple clearwing moth larvae was evaluated during April every year. We found 0.57 larvae per tree in 2010, 0.36 in 2011 and 0.17 in 2012 on the locality Tuchoraz. On the locality Stošíkovice we found on part sad 9 1 larvae per tree in 2010, 0.13 in 2011 and 0.69 in On part sad 10 it was 1.63 larvae per tree in 2010, 0.5 in 2011 and 1.31 in Key words: apple clearwing moth, orchards, mating disruption, pheromones, apple Úvod Metoda matení samců je založena na postupném uvolňování samičího sexuálního feromonu ze speciálních odparníků. Tyto odparníky se ve specifickém počtu dle druhu škůdce rozvěsí před začátkem jeho letu na vybrané ploše. Feromon se pak postupně uvolňuje a ulpívá také na listech a veškerý zelený porost pak funguje jako sekundární odparník. Tím je pak vůně samic překryta. Samci nejsou schopni nalézt samici a nedochází ke spáření (Psota, 2010). V České republice se metoda matení samců používá v sadech proti obaleči jablečnému (Falta a kol., 2008). Do budoucna se také uvažuje o využití proti obaleči východnímu a obaleči švestkovému (Psota, 2010). Ověřována byla také proti nesytce rybízové (Ouředníčková, 2011). Dalším potenciálním škůdcem, kde by měla metoda matení samců význam je nesytka jabloňová (Synanthedon myopaeformis Borkhausen, 1789). Její škodlivost v posledních letech stoupá a to především ve starších výsadbách. Přednostně jsou napadány pravidelně a hluboce řezané stromy (Laštůvka a Šefrová, 2012). Na škodlivost a četnost populace nesytky jabloňové může mít zásadní vliv také průběh počasí (Laštůvka, osobní sdělení), avšak tento faktor nebyl prozatím podrobně studován. Škodlivé výskyty jsou známé z celého území České republiky. Škodlivost spočívá především v postupném chřadnutí stromů a snižování jejich životnosti. Vzhledem k tomu, že housenka nesytky jabloňové žije v lýkové části pod kůrou 215

216 (Alford, 2007), je téměř nemožné zasáhnout ji insekticidem ve formě postřiku. Prozatím se využívá především regulace četnosti dospělců pomocí potravních atraktantů (Lánský a kol, 2005). Metoda matení samců by mohla ochránit především mladé výsadby před rozvojem napadení tímto škůdcem. Materiál a Metody V letech jsme ověřovali efekt metody matení samců na četnost housenek nesytky jabloňové. Pro účely tohoto sledování jsme využili produkt Isomate P japonské firmy Shin- Etsu. Jeden odparník obsahuje 180 mg sexuálního feromonu nesytky jabloňové. V dávce 300 odparníků na hektar byl feromon aplikován na dvou lokalitách v produkčních sadech vždy v poslední dekádě měsíce dubna. Na první lokalitě (Tuchoraz, střední Čechy) byly feromony aplikovány na ploše 36 hektarů. Sad byl vysázen v roce 2005 a pěstované odrůdy byly Gala, Golden delicious, a Idared. Druhá lokalita se nachází na jižní Moravě (Stošíkovice) a feromony byly aplikovány v roce 2010 a 2011 na ploše 18,5 ha ve dvou sousedících sadech (sad 9-6,5 ha a sad ha). V roce 2011 byla z důvodu meziročního poklesu četnosti nesytky jabloňové dávka na lokalitě Stošíkovice snížena na 220 odparníků na hektar. Sad byl vysázen v průběhu let Pěstované odrůdy byly Gala, Golden delicious, Idared a Breaburn. Na každé lokalitě jsme vždy v měsíci dubnu hodnotili průměrný výskyt housenek nesytky jabloňové. Na lokalitě Tuchoraz je sledovaná plocha rozdělena na tři části (sad 3, sad 4 a sad 5). Tyto části jsou rozděleny cestou pro mechanizační prostředky. V každé části byl výskyt hodnocen vždy na 25 stromech. Na lokalitě Stošíkovice jsme vždy hodnotili 16 stromů. Na této lokalitě jsme navíc v letech 2010 a 2012 provedli hodnocení v blízkém sadu, bez metody matení samců. Tento kontrolní sad byl dostatečně vzdálen od feromony ošetřené plochy, tak aby se tento vliv neprojevil. Četnost housenek byla stanovována při bázi kmene, kde se housenky nejčastěji vyskytuji. Na místech s podezřením na výskyt housenek nesytky jsme kůru stromu narušili pomocí kapesního nože a stanovili počet housenek. Získaná data byla statisticky vyhodnocena pomocí analýzy variance a Tukeyova testu (α 0,05) v programu Statistica CZ 10 (StatSoft, 2011). Výsledky a diskuse Na lokalitě Tuchoraz došlo na sledované ploše ke každoročnímu snižování průměrné četnosti housenek (obr. 1). Přičemž statisticky významný rozdíl byl prokázán mezi roky 2010 a 2012 (F 8,72; p 0,0002). Na lokalitě Stošíkovice byl v části Sad 9 v prvním roce pokusu dne zjištěn průměrný výskyt housenek v množství 1 kus na strom. V roce 2011 (hodnoceno ) došlo k výraznému snížení četnosti. V roce 2012 se pak četnost housenek opět zvýšila, avšak nedosáhla úrovně jako v roce 2010 (obr. 2). Dle Tukeyova testu (α 0,05) se četnost v roce 2011 prokazatelně liší od roku 2010 a také 2012 (F 5,27; p 0,01). V části sad 10 byl průměrný výskyt housenek 1,63, v roce ,5 a v roce ,31 (obr. 3). Stejně jako v sadu 9 se i v části sad 10 statisticky prokazatelně lišší výskyt housenek v roce 2011 od roku 2010 a 2012 (F 3,68; p 0,35). Na kontrolní ploše byl průměrný výskyt housenek na jeden strom v roce ,68 a v roce 2012 to bylo už 2,6. Z výsledků je patrný rozdíl mezi lokalitami, kdy na větší ploše v Tuchorazi (36 ha) dochází k postupnému snižování četnosti housenek. Naopak, na menší ploše na lokalitě Stošíkovice není toto snižovaní tolik výrazné. Je otázkou, jakou roli v nárůstu populační hustoty zahrálo meziroční snížení dávky a jakou jiné vlivy (např. počasí). Je však patrný rozdíl ošetřené plochy v porovnání s plochou kontrolní, kde došlo ke zvýšení napadení. 216

217 Je známo, a uvedené výsledky to potvrzují, že na větších plochách je účinnost metody dezorientace vyšší a je nižší riziko komplikací. Obecně se uvádí, že minimální plocha, kde matení samců proti nesytce jabloňové funguje, je zhruba 10 ha. Na druhou stranu tato plocha může být i výrazně menší, pokud půjde o izolovaný sad bez blízkých zdrojů nesytky jabloňové v okolí. Závěr Z výsledků je patrné, že metoda matení (Isomate P) může účinně ochránit výsadby jabloní před napadením nesytkou jabloňovou. Je zřejmé, že vyšší účinnosti bude dosahováno na větších plochách s rozlohou řádově desítek hektarů. Obrázek 1. Průměrný výskyt housenek na jeden strom na lokalitě Tuchoraz Obrázek 2. Průměrný výskyt housenek na jeden strom na lokalitě Stošíkovice (část 9) 217

218 Obrázek 3. Průměrný výskyt housenek na jeden strom na lokalitě Stošíkovice (část 10) Dedikace Za spolupráci na tomto sledování děkujeme podnikům AGRO Stošíkovice, s.r.o. a Sady Tuchoraz s.r.o. Výzkum byl podpořen z projektu NAZV QJ Použitá literatura Alford, D. V., 2007: Pest of fruit crops. Manson Publishing, London. 461 s. Falta, V, Stará, J., Kocourek, F., 2008: Metoda dezorientace v ochraně ovocných sadů proti škodlivým obalečům. VÚRV, 31 s. Laštůvka, Z., 2012: Osobní sdělení (e-mial). Laštůvka, Z, Šefrová, H., 2012: Škodlivost nesytek (Sesiidae) mírně narůstá. s In: Bokor, P., Tóthová, M. (Eds.)., Zborník abstraktov z XIX. Slovenskej a českej konferencie o ochrane rastlín. Slovak University of Agriculture in Nitra. 165 s. Lánský, M., Falta, V., Kloutvorová, J., Kocourek, F., Stará, J., Pultar, O., 2005: Integrovaná ochrana ovoce v systému integrované produkce. Výzkumný a šlechtitelský ústav ovocnářský, Holovousy. 159 s. Ouředníčková, J., 2011: Využití feromonů v ochraně rybízu I. díl. Zahradnictví, 10(11), Psota, V., 2010: Metoda matení samců obalečů: délka odparu feromonů v podmínkách České republiky. Zahradnictví, 9(9): StatSoft, Inc., STATISTICA (data analysis software system), version 10. Kontaktní adresa: Ing. Václav Psota, Ph.D. BIOCONT LABORATORY spol. s r.o. Šmahova 66, BRNO 218

219 INTENZITA NAPADENÍ RŮZNÝCH ODRŮD ČESNEKU VLNOVNÍKEM ACERIA TULIPAE (KEIFER) (ACARI: ERIOPHYIDAE) The intensity of infestation of different garlic varieties by dry bulb mite Aceria tulipae (Keifer) (Acari: Eriophyidae) Sapáková E. 1, Hasíková L. 1 Hřivna L. 1 Stavělíková H. 2 Šefrová H. 1 1 Mendelova univerzita v Brně 2 ýzkumný ústav rostlinné výroby, v.v.i., pracoviště Olomouc Abstrakt Bylo hodnoceno napadení jedenácti odrůd česneku kuchyňského vlnovníkem Aceria tulipae (Keifer, 1938). Výzkum byl prováděn v zimním období na skladovaném česneku, pocházejícím ze střední Moravy (210 m n. m.). Odrůdy vytvářející květní stvol (Bzenecky Mutant VF, Sochi 25, Tiraspol, Zailijskij) byly vlnovníkem A. tulipae silně napadené. Odrůdy nevytvářející květní stvol (Czerga, SIR 10 new breeding, Gjirokaster) byly slabě napadené a odrůda Kelcyre nebyla napadena vůbec. Nejvyšší početnost vlnovníka A. tulipae byla zjištěna u odrůdy Plovdiv Rogosh (polovybíhající do květu) s celkovým počtem až 1500 jedinců na stroužku. U čtyř z jedenácti hodnocených odrůd byl zaznamenán průkazný rozdíl mezi napadením vnější a vnitřní části stroužku. Průkazně nejvíce byla napadená spodní část stroužku u kořene. Klíčová slova: česnek, napadení, škodlivost, vlnovník Abstract Infestation rate of Aceria tulipae (Keifer, 1938) on eleven garlic (Allium sativum) varieties was evaluated. The research was done on storage garlic during winter period , coming from central Moravia (210 m). Bolting garlic varieties (Bzenecky Mutant VF, Sochi 25, Tiraspol, Zailijskij) were highly infested by mite A. tulipae. Non-bolting garlic varieties (Czerga, SIR 10new breeding, Gjirokaster) were mite infested weakly or not at all (Kelcyre). The highest abundance of mite was found in semi-bolting garlic variety (Plovdiv Rogosh) with total number up to 1500 individuals in clove. Significant differences in infestation between external and internal part of the clove were observed in 4 of 11 evaluated varieties. Significantly root segment was the most infested part of the clove. Key words: garlic, infestation, harmfulness, eriophyid Úvod Vlnovník Aceria tulipae byl popsán v Sacramentu v Kalifornii z cibulí tulipánu dovezených z Nizozemska (Keifer, 1938). Šíří se především pasivně s napadenými rostlinami, případně vzdušným prouděním. Vlnovník A. tulipae je celosvětově rozšířený, v Evropě je znám v Bulharsku, Dánsku, Velké Británii, Finsku, Francii, Německu, Maďarsku, Itálii, Nizozemsku, Polsku, Španělsku a bývalé Jugoslávii. Jeho areál je pravděpodobně ještě širší. Z České republiky jej jako škůdce tulipánů uvádí Dušek (1985), jako škůdce česneku Rod (1997). Symptomy a škody na hostitelských rostlinách hodnotili např. Lesna et al. (2004). Několik autorů studovalo možný přenos rostlinných virů tímto druhem (Van Dijk et al., 1991; Ostoja- Strazewski & Mattews, 2009). Lesna et al. (2004) a Aratchige et al. (2007) se zabývali možnostmi ochrany před vlnovníkem A. tulipae pomocí dravých roztočů. Předmětem našeho studia bylo hodnocení abundance vlnovníka Aceria tulipae na jedenácti odrůdách česneku během skladování. 219

220 Materiál a metody Hodnocené odrůdy česneku byly dodány VÚRV, v.v.i., Centrum regionu Haná pro zemědělský a biotechnologický výzkum v Olomouci (210 m n. m.), po 150 dnech skladování při teplotě 15 C a 80% relativní vlhkosti během zimního období Byly hodnoceny následující odrůdy česneku: šest odrůd vytvářející květní stvol (Bzenecky Mutant VF, Sochi 24\1, Sochi 25, Tiraspol, Dushanbijskij 125 a Zailijskij), čtyři odrůdy nevytvářející květní stvol (Czerga, SIR 10 new breeding, Gjirokaster a Kelcyre) a jediná odrůda polovybíhající do květu (Plovdiv Rogosh). Cibule byly po celou dobu pokusu uchovávány v lednici při teplotě 4 C, aby se zabránilo dalšímu vývoji vlnovníka. Od každé odrůdy česneku bylo hodnoceno pět cibulí, z každé sedm stroužků. Před hodnocením byl vždy stroužek podélně rozříznut. Pro hodnocení výskytu vlnovníka A. tulipae byl stroužek rozdělen do tří segmentů (kořen, střed a vrchol) a na vnější a vnitřní část. Odečet roztočů byl proveden okamžitě po vytažení z lednice pod mikroskopem Olympus SZX9. Abundance byla hodnocena pomocí čtyřbodové stupnice (tab. 1). Výsledky byly zpracovány metodou analýzy variance s následným testováním dle Tukey, Statistica 8 (obr. 1, 2). Tab. 1: Stupnice napadení česneku podle hustoty vlnovníka Aceria tulipae na jednom stroužku Hustota Stupeň výskytu Intenzita napadení 0 1 bez napadení slabá střední > silná Výsledky a diskuze Vlnovník Aceria tulipae byl zjištěn na deseti z jedenácti hodnocených odrůd (obr. 1). Odrůdy vytvářející květní stvol (Bzenecky Mutant VF, Sochi 25, Tiraspol, Zailijskij) byly silně napadené. Odrůdy nevytvářející květní stvol (Czerga, SIR 10 new breeding, Gjirokaster) byly slabě napadené a odrůda Kelcyre nebyla napadena vůbec (tab. 2). Nejvyšší početnost vlnovníka A. tulipae byla zjištěna u odrůdy Plovdiv Rogosh (polovybíhající do květu), až 1500 jedinců na jednom stroužku. U všech odrůd s výjimkou odrůdy Kelcyre bylo vyšší napadení na vnější než na vnitřní části (obr. 2). U čtyř odrůd byl zaznamenán průkazný rozdíl, u ostatních odrůd byly rozdíly neprůkazné. Největší rozdíl mezi vnitřní a vnější částí byl pozorován u odrůdy Sochi 25, Zailiskij a Tyraspol. Nejvyšší napadení ve vnitřní části stroužků bylo zaregistrováno na odrůdách Zailiskij, Sochi 25 a Tiraspol. Tyto odrůdy pocházejí z Moldávie, Ruska a Tadžikistánu. Průměrné až vyšší hodnoty abundance byly zjištěny u české odrůdy Bzenecky Mutant VF. Disperze jedinců vlnovníka A. tulipae na stroužku nebyla homogenní (obr. 2). Tab. 2: Stupeň napadení jednotlivých odrůd česneku vlnovníkem Aceria tulipae Class Variety 1 Kelcyre 2 Sir 10 new breeding, Gjirokaster 3 Bzenecky Mutant VF, Tiraspol, Sochi24/1, Dushanbijskij 125, Czerga 4 Sochi 25, Zailijskij, Plovdiv-Rogosh 220

221 Obr. 1: Celkový počet vlnovníka A. tulipae na stroužku z každé odrůdy četnost výskytu (ks) B B 1200 B B N 600 B 400 B 200 N N N Bzenecký mutant VF Sochi 24/1 Sochi 25 Tiraspol Dushanbijskij 125 Zailijskij Czerga SIR 10 new breeding Gjirokaster Kelcyre Plovdiv-Rogosh S Odrůdy (B-s květním stvolem, N-bez kv ětního stvolu, S-polovybíhající do ětu) kv Obr. 2: Výskyt vlnovníka A. tulipae na jednotlivých segmentech stroužku četnost výskytu (ks) Bzenecký mutant VF Sochi 24/1 Sochi 25 Tiraspol Dushanbijskij 125 Zailijskij Odrůdy Czerga SIR 10 new breeding Gjirokaster Kelcyre Plovdiv-Rogosh kořenový segment středový segment vrcholový segment Průkazně nejvíce byla napadena spodní část stroužku u kořene, nejnižší výskyt byl uprostřed stroužku. Nebyly zaregistrovány výrazné rozdíly výskytu vlnovníka A. tulipae ve spodní, střední a vrcholové části. Průkazné rozdíly na jednotlivých segmentech stroužku byly pozorovány pouze u odrůd Zailiskij a Plovdiv Rogosov. Scalopi et al. (1971) hodnotili napadení vlnovníkem A. tulipae u pěti odrůd česneku a na rozdíl od našich výsledků nezjistili významné rozdíly v jeho početnosti. Naše experimenty prokázaly, že volba vhodných odrůd česneku může významně ovlivnit jejich napadení a výskyt vlnovníka A. tulipae. Početnost vlnovníka Aceria tulipae se může v jednotlivých letech měnit v závislosti na abiotických a biotických faktorech. Rezistence 221

222 odrůdy Kelcyre je pravděpodobně způsobena kompaktností cibule a těsně přiléhajícími slupkami, které brání vniknutí vlnovníka A. tulipae mezi jednotlivé stroužky a do vnitřního prostoru. Odrůdy Zailiskij a Plovdiv Rogosh, které byly nejvíce napadeny, jsou méně vhodné pro skladování. Závěr Při hodnocení napadení jedenácti odrůd česneku vlnovníkem Aceria tulipae jsme dospěli k následujícím závěrům Byl prokázán rozdíl v intenzitě napadení různých odrůd česneku Odrůda Kelcyre nebyla vůbec napadena Nejvyšší početnost vlnovníků byla zjištěna u odrůdy Plovdiv Rogosh (polovybíhající do květu) s celkovým počtem až 1500 jedinců na stroužku Odrůdy Sir 10 new breeding, a Gjirokaster byly napadeny slabě Odrůdy Bzenecky Mutant VF, Tiraspol, Sochi24/1, Dushanbijskij 125 a Czerga varieties byly napadeny středně Odrůdy Sochi 25, Zailijskij a Plovdiv-Rogosh byly napadeny silně Příspěvek byl zpracován v rámci řešení výzkumného záměru MSM a projektu IP 7/2012 IGA/. Použitá literatura Aratchige, N. S., Sabelis, M. W. & Lesna, I., 2007: Plant structural changes due to herbivory: do changes in Aceria-infested coconut fruits allow predatory mites to move under the perianth? Exp. Appl. Acarol., 43: Dušek, J., 1985: Ochrana rostlin. Škůdci okrasných rostlin. Vysoká škola zemědělská, Brno, 164 pp. Keifer, H. H., 1938: Eriophyid studies. Bull. Calif. Dept. Agric., 27: Lesna, I., Conijn, C. G. M. & Sabelis, M. W., 2004: From biological control to biological insight: rust-mite induced change in bulb morphology, a new mode of indirect plant defense? Phytophaga, 14: Ostoja-Starzewski, J. C. & Matthews, L., 2009: Aceria tulipae (Keifer) (Acari: Eriophyidae) on imported onion sets, and present status in Britain. Ent. Month. Mag., 145: Rod, J., 1997: Nejčastější choroby a škůdci česneku. Agro, 2(9): Kontaktní adresa: Ing. Eva Sapáková Ústav pěstování, šlechtění rostlin a rostlinolékařství Mendelova univerzita v Brně, Zemědělská 1, Brno, Česká republika 222

223 IDENTIFIKACE PŮVODCŮ FUZARIÓZ KLASU POMOCÍ MULTIPLEX PCR Identification of pathogens associated with Fusarium head blight by multiplex PCR Sumíková T., Žabka M. Výzkumný ústav rostlinné výroby v.v.i., Praha Abstrakt Fuzariózy klasu patří mezi nejzávažnější choroby obilnin. Identifikace původců, tj. hub rodu Fusarium, morfologickými metodami je časově náročná a nemusí být jednoznačná. Proto jsou vyvíjeny molekulární markery, které umožňují přesnou a jednoduchou detekci daného druhu pomocí PCR. Zde je popsána metoda multiplex PCR, která umožňuje identifikaci šesti původců fuzarióz klasu (F. avenaceum, F. culmorum, F. poae, F. graminearum, F. pseudograminearum, F. sporotrichioides) současně v jedné reakci. Klíčová slova: Fusarium, multiplex PCR, fuzariózy klasu Abstract Fusarium head blight (FHB) is one of the most important diseases of cereals. Identification of the pathogens associated with FHB fungi from genus Fusarium, by morphological methods is time consuming and not always unambiguous. Nowadays molecular markers enabling precise and rapid identification of the pathogens by PCR are developed. Here we describe a multiplex PCR enabling the identification of six Fusarium pathogens (F. avenaceum, F. culmorum, F. poae, F. graminearum, F. pseudograminearum, F. sporotrichioides) simultaneously in one reaction. Key words: Fusarium, multiplex PCR, head blight Úvod Fuzarióza klasu (Fusarium head blight) se projevuje předčasným odumřením klasů nebo jejich zbělením. Hlavními hostiteli jsou pšenice, ječmen a kukuřice. Toto onemocnění se vyskytuje ve všech oblastech pěstování pšenice, zvláště významné je ve vlhkých oblastech. Mezi nejčastější a nejvýznamnější původce fuzariź klasu patří následující druhy: F. graminearum, F. culmorum, F. avenaceum, F. poae a Microdochium nivale var. nivale a var. majus. V menší míře se vyskytují např. F. tricinctum, F. equiseti, F. acuminatum, F. sambucinum, F. pseudograminearum a F. oxysporum (Ioos et al., 2004). Na území České republiky začíná převažovat F. graminearum oproti minulým letům, kdy bylo dominantním druhem F. culmorum (Chrpová et al. 2004, Ostrý et al. 2004). Poslední studie ukazují zvyšující se zastoupení druhu F. poae (Remešová et al. 2006). Jedná se o fakultativní nespecifické parazity, kteří také mohou infikovat další části rostlin (Parry et al., 1995,, Lemmmens et al., 2004). Poškození klasů tedy může být doprovázeno infekcí kořenů, listů nebo následným napadením klíčních rostlin. Škodlivost fuzarióz spočívá jednak v redukci výnosu, ale zejména ve schopnosti mnoha původců fuzarióz produkovat mykotoxiny. Je známo, že fuzáriové mykotoxiny mohou způsobovat vážné zdravotní potíže jak u člověka, tak u hospodářských zvířat. Nejvýznamnější fuzáriové mykotoxiny jsou trichoteceny, zejména deoxynivalenol a nivalenol a zearalenony. Ke tvorbě zdraví škodlivých toxinů v zrnu dochází zejména při infekci druhy F. graminearum a F. culmorum. Přesná detekce jednotlivých původců fuzarióz klasu a zejména stanovení toxinogenních kmenů je nezbytná jak pro pochopení faktorů podílejících se na rozvoji onemocnění a akumulaci toxinů, tak z hlediska ochrany rostlin i zdraví konzumentů. 223

224 Mykologické určení jednotlivých druhů je dosti obtížné a relativně časově náročné, proto došlo v poslední době k rozvoji metod založených na PCR. V současnosti jsou známy druhově specifické primery pro mnoho druhů rodu Fusarium např. pro F. avenaceum (Doohan et al., 1998, Turner et al., 1998), F. culmorum a F. graminearum (Nicholson et al.,1998), F. poae (Parry et Nicholson, 1996), F. pseudograminearum (Aoki et O Donnell, 1999) a F. sporotrichioides (Demeke et al., 2004). Efektivnější metodou je použití tzv. multiplex PCR tj. PCR, která díky přítomnosti několika primerových párů umožňuje detekci více druhů současně. Rutinně je možné detekovat současně 2 14 lokusů. Nutností ovšem je zajistit, aby se amplifikované produkty dostatečně lišily ve svých délkách a bylo je tak možno bez problémů rozlišit na agarózovém gelu. Neméně důležitým předpokladem k úspěšnému použití multiplex PCR je pečlivá optimalizace reakčních podmínek, zejména zajištění vhodné annealingové teploty a koncentrace jednotlivých primerů. Problémem mohou být také nespecifické produkty, které se amplifikují společně s požadovanými fragmenty a mohou zkreslovat výsledek reakce. Nicméně při vhodné optimalizaci dochází ke znatelné úspoře času i materiálu. Cílem práce bylo vyvinout multiplex PCR, s využitím publikovaných primerů, k detekci šesti nejběžnějším původců fuzarióz klasu současně. Materiál a metody Monosporické izoláty hub F. avenaceum, F. culmorum, F. poae, F. graminearum, F. pseudograminearum a F. sporotrichioides byly získány z přirozeně napadených pšeničných klasů. Identifikace byla provedena klasickými morfologickými metodami a potvrzena molekulárními markery. Izolace DNA byla provedena z narostlého houbového mycelia izolační soupravou Mobio (MoBio Ultra Clean TM Microbial DNA Isolation kit) podle instrukcí výrobce. K dosažení nejlepší výtěžnosti reakce byla testována nejvhodnější annealingová teplota, koncentrace hořčíkových iontů a vzájemná koncentrace primerů. Výsledné optimální podmínky reakce jsou uvedeny v tabulkách 1 a 2. Reakce probíhaly v termocyklerech Veriti (Appied Biosystems) a UNO II (Biometra). PCR produkty byly naneseny na 2% agarózový gel (s ethidiumbromidem) spolu s 6µl délkového standardu 100bp DNA Ladder (Fermentas). Separace elektroforézou probíhala cca 1-1,5 hodiny při 60-50V. Produkty na gelech byly poté vizualizovány a detekovány pod UV lampou. Přítomnost produktu amplifikace požadované délky (v párech bází) značí příslušnost k testovanému druhu (obrázek 1). Tabulka 1: Reakční směs Primer mix forward a revers primer (5µM) pro každý detekovaný druh dntp (2,5mM) pufr Qiagen (10 ) MgCl 2 (15mM) Taq polymeráza Qiagen (5U/1µl) 1,5µl * / 1µl ** 2µl 2,5µl 1,5µl 0,2µl doplnit do 24µl H 2 O Templátová DNA 1µl Celkový reakční objem 25µl * množství primerů pro druhy: F. avenaceum, F. culmorum, F. pseudograminearum, F. sporotrichioides ** množství primerů pro druhy: F. poae, F. graminearum Tabulka 2: Reakční podmínky 1 cyklus: 95 C 5 min. 35 cyklů: 95 C 30 s. 60 C 30 s. 72 C 40 s. Konečná extense: 72 C 5 min. 224

225 Výsledky a diskuse Obrázek 1: Druhově specifické produkty multiplex PCR pro níže uvedené druhy r. Fusarium 100bp DNA ladder, 1 F. avenaceum, 2 F. culmorum, 3 F. graminearum, 4 F. poae, 5 F. pseudograminearum, 6 F. sporotrichioides, 7 voda Primerové páry byly voleny tak, aby se výsledné PCR produkty dostatečně lišily ve velikosti a bylo možné je rozlišit horizontální elektroforézou na běžném agarózovém gelu. Jednotlivé primerové páry je možné libovolně kombinovat což umožňuje detekci jednoho nebo až všech šesti výše uvedených druhů v jedné PCR reakci. Výsledná determinace izolátů pomocí multiplex PCR se buď shodovala s morfologickým určením nebo napomohla k definitivní determinaci v případě, že se jednalo o izoláty, které nebylo možné jednoznačně určit pomocí morfologických znaků. Multiplex PCR bývá využívána k rozlišení jednotlivých chemotypů, zejména u druhu F. graminearum (Wang et al. 2012, Quarta et al. 2006). Identifikaci některých druhů r. Fusarium z kukuřice pomocí multiplex PCR popisují Faria et al. (2012). Závěr Multiplex PCR představuje spolehlivou metodu detekce až šesti patogenů r. Fusarium (F. avenaceum, F. culmorum, F. poae, F. graminearum, F. pseudograminearum, F. sporotrichioides.) v jedné reakci. Vzhledem k tomu dochází k úspoře času a chemikálií oproti využití standardní jednotlivé (single) PCR pro každý uvedený druh. Dedikace Práce byla financovaná z projektu ministerstva školství ČR ME a výzkumného záměru MZe České republiky Použitá literatura Aoki T, O Donnell K. (1999) Morphological and molecular characterization of Fusarium pseudograminearum sp nov., formerly recognized as the Group 1 population of F. graminearum. Mycologia 91:

226 Demeke T, Clear RM, Patrick SK, Gaba D. (2005) Species-specific PCR-based assays for the detection of Fusarium species and comparison with whole seed agar plate method and trichothecene analysis. Inter J Food Microbiol 103: Doohan FM, Parry DW, Jenkinson P, Nicholson P. (1998) The use of species-specific PCRbased assays to analyze Fusarium ear blight of wheat. Plant Pathol 47: Chrpová J, Šíp V, Sýkorová S, Sychrová E, Matějová E. (2004) Beitrag zur Problematic der Ährenfusariosen bei Getreide. J Appl Bot Food Qual 78: Faria CB, Abe CAL, da Silva CN,Tessmann DJ,Barbosa-Tessmann IP. (2012) New PCR Assays for the Identification of Fusarium verticillioides, Fusarium subglutinans, and Other Species of the Gibberella fujikuroi Complex. Ioos R, Belhadj A, Menez M. (2004) Occurrence and distribution of Microdochium nivale and Fusarium species isolated from barley, durum and soft wheat grains in France from 2000 to Mycopathologia 158: Int J Mol Sci 13: Lemmens M, Buerstmayr H, Krska R, Schuhmacher R, Grausgruber H, Ruckenbauer P. (2004): The effect of inoculation treatment and long-term application of moisture on Fusarium head blight symptoms and deoxynivalenol contamination in wheat grains. Eur J Plant Pathol 110: Nicholson P, Simpson DR, Weston G, Rezanoor HN, Lees AK, Parry DW, Joyce D. (1998) Detection and quantification of Fusarium culmorum and Fusarium graminearum in cereals using PCR assay. Physiol Mol Plant Pathol 53: Ostrý V, Škarková J, Malíř F, Sýkorová S. (2004) Advances on the Occurence of Toxigenic Fungi and Mycotoxins in the Czech Republic, In: An Overview on Toxigenic Fungi and Mycotoxins in Europe, Logrieco, Antonie, Visconti, Angelo (Eds.) Kluwer 2004, ISBN: Parry DW, Jenkinson P, Mc. Leod L. (1995) Fusarium ear blight (scab) in small-grain cereals - a review. Plant Pathol 44: Parry DW, Nicholson P. (1996) Development of a PCR assay to detect Fusarium poae in wheat. Plant Pathol 45: Quarta A, Mita G, Haidukowski M, Logrieco A, Mule G, Visconti A (2006) Multiplex PCR assay for the identification of nivalenol, 3- and 15-acetyl-deoxynivalenol chemotypes in Fusarium. FEMS Microbiol Lett 259:7-13. Remešová J, Sumíková T, Sychrová E, Matějová E, Chrpová J, Šíp V. (2006) Toxigenic micromycetes of genus Fusarium on wheat isolated in the Czech Republic. In: Sborník abstraktů "XVII. česká a slovenská konference o ochraně rostlin", září 2006, ČZU Praha Turner AS, Lees AK, Rezanoor HN, Nicholson P. (1998) Refinement of PCR-based detection of Fusarium avenaceum and evidence for phenetic relatedness to Fusarium tricinctum. Plant Pathol 47: Wang JH, Zhang JB, Chen FF, Li HP, Ndoye M, Liao YC. (2012) A multiplex PCR assay for genetic chemotyping of toxigenic Fusarium graminearum and wheat grains for 3- acetyldeoxynivalenol, 15-acetyldeoxynivalenol and nivalenol mycotoxin. J Food Agri Environ 10: Kontaktní adresa: Mgr. Taťána Sumíková, Ph.D. Výzkumný ústav rostlinné výroby, v.v.i. Drnovská 507, , Praha 6 226

227 HODNOCENÍ ODOLNOSTI VYBRANÝCH NOVOŠLECHTĚNÍ OKUREK NAKLÁDAČEK K VIRU ŽLUTÉ MOZAIKY CUKETY (ZYMV) Evaluation of resistance selected new crossing pickling cucumbers to Zucchini yellow mosaic virus (ZYMV) Svoboda J. Výzkumný ústav rostlinné výroby, v.v.i., Praha Ruzyně Abstrakt Virus žluté mozaiky cukety (ZYMV) způsobuje značné ztráty produkce pěstovaných tykvovitých zelenin v České republice, zejména na jižní Moravě. Běžně pěstované odrůdy okurek jsou k ZYMV vysoce náchylné. Největší ztráty působí boulovité deformace na plodech. Nejúčinnějším způsobem ochrany před ZYMV je pěstování rezistentních odrůd. Šlechtění na rezistenci k ZYMV je v České republice teprve v začátcích. Byla získána semena novošlechtění okurek nakládaček a metodou porovnání relativních koncentrací viru žluté mozaiky cukety v rostlinách po mechanické inokulaci českým silně virulentním kmenem viru byla hodnocena jejich odolnost k ZYMV. Klíčová slova: relativní koncentrace viru, titr viru Abstract Zucchini yellow mosaic virus (ZYMV) causes considerable losses of cucurbitaceous vegetables grown in the Czech Republic, especially in Southern Moravia. Commonly grown cucumber cultivars are highly susceptible to ZYMV. The highest losses cause lumpy deformations on fruits. The most effective way of protection is the use of resistant plants. The breeding programme of cucumbers for the resistance to ZYMV has just started in the Czech Republic. There were obtained seeds of newly bred pickling cucumbers and their level of resistance to ZYMV was evaluated by comparison the relative concentration of the virus in plants after mechanical inoculation by a highly virulent Czech ZYMV strain. Key words: virus relative concentration, virus titer Úvod Virus žluté mozaiky cukety, Zucchini yellow mosaic virus (ZYMV) je hospodářsky významným virem, který byl objeven poměrně nedávno zároveň v Itálii (Lisa et al., 1981) a ve Francii (Lecoq et al., 1981). Je to vláknitý virus z čeledi Potyviridae, rod Potyvirus obsahující +ssrna nukleovou kyselinu. V České republice (ČR) byl ZYMV poprvé zjištěn v r (Chod a Jokeš, 1991). Od r Státní rostlinolékařské správa eviduje jeho epidemický výskyt na jižní Moravě. Virus vyvolává na infikovaných rostlinách žloutnutí a deformace listů, boulovitost plodů, zakrslost a výrazné snížení výnosů; v případě náchylných odrůd a infekce silně virulentním kmenem ZYMV rostliny neplodí vůbec nebo mají deformované neprodejné plody (obr.1). Tento virus je rozšířen v teplých oblastech po celém světě a napadá téměř všechny rostliny čeledi Cucurbitaceae (Al-Saleh a Al-Shahwan, 1997). Snadno se šíří neperzistentně mšicemi a mechanicky (Lisa a Lecoq, 1984). Virus v podmínkách ČR přezimuje na různých druzích plevelných rostlin, jako jsou ptačinec žabinec (Stellaria media (L.) Vill.), heřmánkovec přímořský, (Tripleurospermum maritimum (L.) Sch. Bip.) a jetel plazivý (Trifolium repens L.; Svoboda a Polák, 2002). Výzkumem rezistence okurek k viru žluté mozaiky cukety se zabývala především francouzská, italská a americká pracoviště. Provvidenti (1987) nalezl gen rezistence zym v čínské okurce (Cucumis sativus L.) Taichung Mou Gua ( TMG-1 ) na Tajwanu. Ansanelli et al. (1997) referují o vyšlechtění okurek nakládaček CLX 2935, CLX 2946, Afrodite a Roberta rezistentních k ZYMV. Také v ČR se v posledních letech šlechtí na rezistenci k ZYMV. 227

228 Úkolem provedené práce bylo vyhodnotit úroveň rezistence novošlechtění českých okurek nakládaček k ZYMV po mechanické inokulaci českým silně virulentním kmenem viru. Materiál a metody Rostlinný materiál Bylo získáno osivo novošlechtění kandidátských rezistentních okurek nakládaček (Cucumis sativus L.) 1/05, 9/05, 12/05, 2/08, 3/08, 4/08, 5/08, 6/08, 8/08, 9/08, 10/08, 11/08, 12/08, 13/08, 14/08 a 15/08 (Ing. Bohuslav Holman s.r.o., Bzenec, ČR). Jako k ZYMV náchylná kontrola byla použita okurka nakládačka Melody F1 (Rijk Zwaan, Holandsko) a jako okurka se známou polní rezistencí Lili F1 (SEMO, Smržice, ČR; Petříková et al., 2005). Semena okurek byla vysévána ve skupinách po deseti od každého novošlechtění a odrůdy. Rostliny byly pěstovány v izolované skleníkové kóji při světelné periodě den/noc 14/10 hodin a teplotě 25/20 C. K pomnožení viru pro potřebu mechanické inokulace byla použita tykev cuketa (Cucurbita pepo L. convar. giromontiina Grebenščikov) Zelená (Seva Flora, Valtice, ČR). Mechanický přenos ZYMV Při inokulaci ZYMV byl použit silně virulentní kmen ZYMV-H, který byl vybrán z různých izolátů viru pocházejících z jižní Moravy (Svoboda and Polák, 2002). Molekulární diverzita ve vztahu k patogenitě českých a slovenských izolátů ZYMV byla studována Glasou et al. (2007); kmen ZYMV-H patřil k nejvirulentnějším, jeho sekvence byly uloženy do databáze GenBank pod č. DQ a je součástí Sbírky patogenních virů (2012) ve VÚRV, v.v.i., Praha. Pro mechanický přenos bylo v třecí misce homogenizováno 10 g listů tykve cukety Zelená infikované kmenem ZYMV-H se 30 ml fosfátového pufru (0,03 M Na 2 HPO 4 s přídavkem 0,2 % DIECA, ph 9,3) podle Mahgouba et al. (1997). K homogenátu bylo přidáno aktivní uhlí a karborundum mesh 200 a byla provedena mechanická inokulace třením děložních listů okurek. Veškeré chemikálie a nádoby byly předem vychlazeny v chladničce a připravený homogenát byl uchováván až do skončení inokulace v misce s drceným ledem pro zajištění dlouhodobé infekčnosti inokula. Náchylná okurka nakládačka Melody F1 byla zařazena jako poslední inokulovaná odrůda sloužila jako kontrola účinnosti inokula. Stanovení relativní koncentrace ZYMV Čtyři týdny po provedené inokulaci, tj. ve stadiu pravého listu, kdy již byly na rostlinách náchylných odrůd zřetelně viditelné příznaky systémové infekce ZYMV, byly odebrány vzorky mladých listů. Vzorky ze všech deseti rostlin jedné odrůdy byly smíšeny z alikvotních dílů a vzniklý směsný vzorek byl použit k analýze. Pro určení koncentrace ZYMV ve vzorku byl v něm stanoven titr viru jako nejvyšší ředění vzorku rozetřeného v extrakčním pufru, které ještě dávalo v ELISA pozitivní reakci. Koncentrace virového proteinu (c) je nepřímo závislá na titru (t), tj. čím větší ředění ještě dává pozitivní reakci, tím vyšší je koncentrace virového proteinu v listu. Závislost lze vyjádřit jako podíl specifické konstanty (k) a stanoveného titru c = k / t. Pro porovnání koncentrací téhož virového proteinu v listech různých rostlin není nutné znát přesnou hodnotu konstanty (k) protože je pro všechny rostliny při použití stejné metody a antisera totožná. Poměr koncentrací viru v hodnocených rostlinách potom bude c 1 : c 2 = 1 / t 1 : 1 / t 2 228

229 Relativní koncentrace ZYMV proteinu Úroda 12/2012, vědecká příloha časopisu a převrácenou hodnotu (1/t) lze považovat za relativní koncentraci virového proteinu, která nemá přesně hodnotu koncentrace ZYMV ve vzorku, ale je ve správném poměru k vypočteným relativním koncentracím ZYMV ostatních hodnocených vzorků. Pro stanovení titru byla použita imunoenzymatická metoda DAS-ELISA popsaná Clarkem a Adamsem (1977), komerční protilátky k ZYMV a pracovní postup podle návodu firmy Loewe Biochemica, Německo. Obrázek 1: Plod náchylné okurky Melody F1 infikované silně virulentním kmenem ZYMV-H Výsledky a diskuse Zjištěné relativní koncentrace ZYMV v listech okurek nakládaček ukazuje obr.2. Jako nejperspektivnější se jeví novošlechtění 14/08 a 15/08. Tyto rostliny prokázaly vysokou odolnost k silně virulentnímu kmenu ZYMV-H, množení viru v nich bylo potlačeno na poloviční úroveň oproti známé rezistentní Lili F1. Tomu odpovídaly i pozorované příznaky na rostlinách: mírná mozaika na listech bez deformací plodů. Jako další slibná se jeví novošlechtění 1/05, 8/08 a BH-502, v jejichž listech byla zjištěna dvojnásobně vyšší relativní koncentrace virového proteinu. Oproti tomu všechna ostatní testovaná novošlechtění měla 4-8 násobně vyšší koncentraci ZYMV v listech a dosáhly tak úrovně náchylné kontroly okurky Melody F1 (obr.1). Také tyto rostliny vykazovaly silné příznaky virové infekce s víceméně deformovanými plody. Experimenty byly dvakrát opakovány se stejným výsledkem. Obrázek 2: Relativní koncentrace virového proteinu ZYMV-H v listech okurek nakládaček /05 9/05 12/05 2/08 3/08 4/08 5/08 6/08 8/08 9/08 11/08 12/08 13/08 14/08 15/08 BH-502 Melody F1 Lili F1 229

230 Závěr V testovaném novošlechtění okurek nakládaček vynikly svou odolností k ZYMV novošlechtění 14/08 a 15/08. Přesto je ale ještě potřeba udělat spoustu šlechtitelské práce, než bude k dispozici širší sortiment rezistentních okurek na stejné úrovni, jako je okurka TMG1. Dedikace Provedený výzkum byl financován z výzkumného záměru MZE ČR Autor děkuje Ing. B. Holmanovi za poskytnuté osivo novošlechtění okurek nakládaček. Použitá literatura Al-Saleh M. A., Al-Shahwan I. M. (1997). Viruses infecting cucurbits in Riyadh, Gassim and Hail regions of Saudi Arabia. Arab Gulf Journal of Scientific Research 15 (1): Ansanelli C., Giovannantonio C., Tomassoli L., Di-Giovannantonio C. (1997). Tolerant varieties and reflective soil coverings to control viruses of courgette. Informatore Agrario 53 (11): Clark M. F., Adams A. N. (1977). Characteristic of the microplate method of enzyme-linked immunosorbent assay for the detection of plant virus. Journal of General Virology 34: Glasa M, Svoboda J, Nováková S (2007). Analysis of the Molecular and Biological Variability of Zucchini yellow mosaic virus isolates from Slovakia and Czech Republic, Virus Genes 35(2): Chod J., Jokeš M. (1991). Nález viru žluté mozaiky cukety v Československu. Ochrana Rostlin 27: Mahgoub HA, Desbiez C, Wipf-Scheibel C, Dafalla G, Lecoq H (1997). Characterization and occurrence of zucchini yellow mosaic virus in Sudan. Plant Pathology 46: Lecoq H., Pitrat M., Clément M. (1981). Identification et caractérisation d un potyvirus provoquant la maladie du rabougrissement jaune du melon. Agronomie 1: Lisa V., Boccardo G., D'Agostino G., Dellavalle G. and d'aquilio M. (1981). Characterisation of a potyvirus that causes zucchini yellow mosaic. Phytopathology 71: Lisa V., Lecoq H. (1984). Zucchini yellow mosaic virus. CMI/AAB Descriptions of Plant Viruses No. 282, Unvin Brothers Press, Surrey (GB). Mahgoub H. A., Desbiez C., Wipf-Scheibel C., Dafalla G., Lecoq H. (1997). Characterization and occurrence of zucchini yellow mosaic virus in Sudan. Plant Pathology 46: Petříková K., Nakvasil V., Pokluda R. (2005). Zhodnocení sortimentu okurek nakládaček na rezistenci k ZYMV. In: Sborník přednášek ze semináře "Metodika pro integrovaný systém ochrany polní zeleniny vůči škodlivým organismům", 30. listopadu 2005, VÚRV Praha 6, p Provvidenti R (1987). Inheritance of resistance to a strain of zucchini yellow mosaic virus in cucumber. Hort. Science, 22: Sbírka fytopatogenních virů [www dokument]. [cit ]. Dostupné na: Svoboda J, Polák J (2002). Distribution, Variability and Overvintering of Zucchini yellow mosaic virus in the Czech Republic. Plant Protection Science, 38 (4): Kontaktní adresa: Ing. Jiří Svoboda, Ph.D., Výzkumný ústav rostlinné výroby, v.v.i., Drnovská 507, Praha 6-Ruzyně, 230

231 VÝSKYT FYTOPATOGENNÍCH VIRŮ NA TYKVOVITÉ ZELENINĚ PĚSTOVANÉ V ČESKÉ REPUBLICE Occurrence of phytopathological viruses on cucurbitaceous vegetables in the Czech Republic Svoboda J., Leišová-Svobodová L. Výzkumný ústav rostlinné výroby, v.v.i., Drnovská 507, Praha 6 Abstrakt V minulých pěti letech byl proveden průzkum výskytu fytopatogenních virů na rostlinách čeledi Cucurbitaceae v hlavních i okrajových oblastech pěstování plodových zelenin Čech a Moravy. Celkem bylo odebráno a pomocí ELISA otestováno 610 vzorků listů tykvovitých zelenin na přítomnost běžných a možných nových invazivních virů Cucurbit aphid-borne yellows virus (CABYV), Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV), Melon necrotic spot virus (MNSV), Papaya ring spot virus (PRSV), Squash mosaic virus (SqMV), Watermelon mosaic 2 virus (WMV-2), Zucchini yellow fleck virus (ZYFV) a Zucchini yellow mosaic virus (ZYMV). Ve vzorcích byla zjištěna přítomnost CABYV, CMV, SqMV, WMV-2 a ZYMV s převládajícím výskytem ZYMV na jižní a střední Moravě. Klíčová slova: CABYV, CMV, SqMV, WMV-2, ZYMV Abstract The survey of the presence of phytopathological viruses on plants of the family Cucurbitaceae was carried out in both main and marginal fruit vegetables producing areas in the Czech Republic during the last five years. Altogether 610 leaf samples of cucurbitaceous vegetables were collected and examined by ELISA for the presence of common and new possible invasive viruses Cucurbit aphidborne yellows virus (CABYV), Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV), Melon necrotic spot virus (MNSV), Papaya ring spot virus (PRSV), Squash mosaic virus (SqMV), Watermelon mosaic 2 virus (WMV-2), Zucchini yellow fleck virus (ZYFV) and Zucchini yellow mosaic virus (ZYMV). In the samples, there was detected the presence of CABYV, CMV, SqMV, WMV-2 a ZYMV with the predominating occurrence ZYMV in southern and middle Moravia. Key words: CABYV, CMV, SqMV, WMV-2, ZYMV Úvod Velké množství fytopatogenních virů napadá rostliny čeledi tykvovitých (Cucurbitaceae) po celém světě a způsobuje nemalé ztráty na jejich výnosu. V Evropě, zejména ve Středozemí, jsou běžně rozšířeny virus mozaiky okurky (Cucumber mosaic virus, CMV), virus zelené skvrnité mozaiky okurky (Cucumber green mottle mosaic virus, CGMMV), virus nekrotické skvrnitosti melounu (Melon necrotic spot virus, MNSV), virus kroužkovitosti papáji (Papaya ring spot virus, PRSV), virus mozaiky tykve (Squash mosaic virus, SqMV), virus mozaiky vodního melounu (Watermelon mosaic 2 virus, WMV-2), virus žluté skvrnitosti cukety (Zucchini yellow fleck virus, ZYFV) a virus žluté mozaiky cukety (Zucchini yellow mosaic virus, ZYMV; Descriptions of Plant Viruses, 2012). Ve Francii byl na tykvovitých zeleninách v r popsán nový Cucurbit aphid-borne yellows virus (CABYV; Lecoq et al., 1992). Dál na sever Evropy není výskyt virových chorob tykvovitých zelenin tak široký; např. v sousedním Polsku byly zjištěny jen CMV (Korbin a Kaminska, 1998), WMV-2 (Borodynko et al., 2009) a ZYMV (Pospieszny et al., 2003). Virové infekce často vyvolávají na nemocných rostlinách žloutnutí nebo mozaiku listů, deformují plody, způsobují zakrslost rostlin a snižují celkový výnos. V přírodních podmínkách jsou běžné směsné infekce několika viry současně, což působí silným synergickým efektem na hostitelské rostliny, které pak vykazují výrazné příznaky virové infekce a často neplodí vůbec. 231

232 Úkolem provedené práce bylo zjistit rozšíření a výskyt virových patogenů tykvovitých zelenin v České republice (ČR). Materiál a metody Rostlinný materiál Ve spolupráci se Státní rostlinolékařskou správou byly vytipovány pozemky na Moravě a v Čechách, kde se pěstují tykvovité zeleniny. Z těchto lokalit byly opakovaně odebírány vzorky listů okurek, tykví a melounů s možnými příznaky virové infekce. Pomocí ELISA v nich byla zjišťována přítomnost jednotlivých virů. ELISA Pro identifikaci virových patogenů rostlin ve vzorcích listů byla použita imunoenzymatická metoda DAS-ELISA popsaná Clarkem a Adamsem (1977), komerční protilátky a pracovní postup podle návodů firmy Loewe Biochemica, Německo. Do každého testu byla zařazena pozitivní a negativní kontrola pro zvýšení spolehlivosti testu. Výsledná barevná reakce byla vyhodnocována na fotometru Dynatech MR 5000, Německo při vlnové délce 405 nm. Vzorky s absorbancemi A 405 > 0,150 byly brány jako pozitivní a vzorky s absorbancemi A 405 < 0,030 byly brány jako negativní. Dosahované absorbance pozitivních kontrol byly přes 1,0 a negativních kontrol do 0,025. Elektronová mikroskopie Vzorky listů zkoumaných rostlin byly homogenizovány v třecí misce s HEPES pufrem v poměru 1 : 2. Homogenát byl filtrován přes silonové síto a negativně barven přídavkem kyseliny fosfowolframové, ph 6,9 v poměru 1 : 1. Vzniklá směs byla adsorbována na elektronmikroskopickou síťku a prohlížena transmisním elektronovým mikroskopem Philips 208 S, Holandsko. Nalezené virové částice byly měřeny a fotografovány. Extrakce RNA Celková RNA byla extrahována z listů rostlin pomocí RNeasy Plant Mini Kit (Qiagen). RT PCR je prováděna podle optimalizovaného protokolu s primery specifickými pro každý detekovaný druh viru. Produkty PCR byly separovány elektroforeticky v 1,6% agarózovém gelu. Výsledky a diskuse Průzkum výskytu virů V průběhu posledních pěti let byly každý rok ve spolupráci s okresními pracovišti SRS a Zelinářskou unií Čech a Moravy vytipovány lokality, kde se ve větší míře pěstují tykvovité zeleniny nebo kde je podezření na výskyt virových chorob na nich. Jednalo se o pozemky ležící jak v hlavních, tak i v okrajových pěstitelských oblastech. Na těchto lokalitách byly hledány rostliny s příznaky možné virové infekce, ze kterých byly odebírány vzorky listů. Celkem bylo otestováno 610 vzorků listů okurek, tykví a melounů z polních i skleníkových porostů na přítomnost CGMMV, CMV, MNSV, PRSV, SqMV, WMV-2, ZYFV a ZYMV. Každoročně byl ve vzorcích nejčastěji detekován ZYMV následovaný WMV-2 a CMV. V roce 2009 bylo na jižní Moravě pozorováno žloutnutí listů tykví olejných (Cucurbita pepo L. var. oleifera Pietsch). Na základě informací získaných od Dr. Lecoqua, INRA, Avignon, Francie bylo pojato podezření na přítomnost v ČR nového CABYV. Pomocí specifického antisera připraveného v INRA byly provedeny ELISA testy na detekci viru. Ve vzorcích listů tykví olejných odebraných v blízkosti obcí Josefov, Prušánky a Rakvice (okr. Břeclav) byla zjištěna jeho přítomnost. Nález byl potvrzen pozorováním odpovídajících virových částic pod elektronovým mikroskopem a pomocí RT-PCR. Amplikony byly sekvencovány a na základě 232

233 sekvencí byla zjištěna blízká příbuznost českých izolátů viru se slovenskými izoláty. Jednalo se o první nález CABYV v ČR (Svoboda at al., 2011). V roce 2010 byla ve vzorcích listů tykví ozdobných (Cucurbita pepo L. convar. microcarpina Grebenščikov) pěstovaných v blízkosti obce Tasovice (okr. Znojmo) zjištěna přítomnost SqMV. Nález byl detekován metodou ELISA a potvrzen pomocí elektronového mikroskopu a PCR. Amplikony PCR byly sekvenovány a byla určena jejich příbuznost s publikovanými sekvencemi SqMV z USA a Číny. Zjištění SqMV představuje první nález v ČR (Svoboda a Leisova-Svobodova, 2011). Nalezený český izolát viru je bezpříznakový, jeho přítomnost lze však snadno odhalit pomocí ELISA nebo PCR. Tabulka 1: Souhrnný přehled zjištěného výskytu virových chorob na tykvovitých zeleninách v ČR Virové choroby tykvovitých zelenin - ČR, virus počet pozitivních vz. % z 610 odebraných vz. ZYMV ,0 WMV ,2 CMV 72 11,8 CABYV 15 2,5 SqMV 2 0,3 Přehled nalezených virů na tykvovitých zeleninách s jejich četnostmi je uveden v tabulce 1. Z tabulky je patrné, že na tykvovité zelenině se nejčastěji vyskytuje ZYMV následovaný WMV-2 a CMV. Geografické rozložení výskytu virových chorob tykvovitých zelenin na území ČR je znázorněno na obr.1. Negativní nálezy nejsou na obrázku vyznačeny, protože by se obrázek stal nepřehledným. Analýzou výsledků bylo zjištěno, že fytopatogenní viry se na tykvovitých zeleninách vyskytují v hlavních produkčních oblastech pěstování tykvovité zeleniny jižní a střední Moravy (okresy Břeclav, Znojmo, Hodonín, Olomouc a Prostějov) a Polabí (okresy Praha-východ a Mělník) každoročně od svého prvního nálezu. V okrajových oblastech, jako jsou okresy Moravy (Blansko, Bruntál, N. Jičín, Ostrava, Opava) a Čech (Beroun, Č. Budějovice, Písek, Tábor, Benešov, Jičín) byly fytopatogenní viry nalezeny ojediněle, především v záhumencích na okrajích vesnic. Izoláty jednotlivých virů byly uloženy do sbírky fytopatogenních virů VÚRV, v.v.i, Praha (Sbírka fytopatogenních virů, 2012). Závěr Byl zjištěn výskyt fytopatogenních virů jak v hlavních oblastech pěstování tykvovitých zelenin v Čechách a na Moravě, tak také v okrajových oblastech. Přítomnost sledovaných virů představuje nebezpečí znehodnocení a snížení produkce tykvovitých zelenin v zamořených oblastech a je nezbytné soustředit se na ochranu proti jejich šíření pomocí mšic a pěstovat rezistentní odrůdy zelenin. Metodika ochrany před ZYMV je na vyžádání u autora příspěvku. Dedikace Provedený výzkum byl financován z výzkumného záměru MZE ČR

234 Obrázek 1: Výskyt virových chorob zjištěných na tykvovitých zeleninách v ČR, CABYV: CMV: SqMV: WMV-2: ZYMV: zelená značka žlutá značka fialová značka modrá značka červená značka Použitá literatura Borodynko, N., Hasiow-Jaroszewska, B., Rymelska, N. and Pospieszny, H Watermelon mosaic virus reported for the first time in Poland. Plant Pathology 58:783. Descriptions of Plant Viruses [www document]. [cit ]. Available in: Korbin, M. and Kaminska, M Characterization of cucumber mosaic cucumovirus isolates. Phytopathologia Polonica. 16: Lecoq, H., Bourdin, D., Wipf-Scheibel, C., Bon, M., Lot, H., Lemaire, O. and Herrbach, E A new yellowing disease of cucurbits caused by a luteovirus, cucurbit aphidborne yellows virus. Plant Pathology 41: Pospieszny, H., Cajza, M. and Plewa R First report of zucchini yellow mosaic virus in cucumber in Poland. Plant Disease 87:1399. Sbírka fytopatogenních virů [www dokument]. [cit ]. Dostupné na: Svoboda J., Leisova-Svobodova L First Report of Squash Mosaic Virus in Ornamental Pumpkin in the Czech Republic. Plant Disease 95:10, Svoboda J., Leisova-Svobodova L., Lecoq H First Report of Cucurbit aphid-borne yellows virus in squash in the Czech Republic. Plant Disease 95:2, Kontaktní adresa: Ing. Jiří Svoboda, Ph.D., Výzkumný ústav rostlinné výroby, v.v.i., Drnovská 507, Praha 6-Ruzyně, 234

235 REGULACE PLEVELŮ U CIZRNY BERANÍ A HRACHORU SETÉHO Weed control in chickpea (Cicer arietinum) and vetchling (Lathyrus sativus) Šmahel P., Kolaříková E. Zemědělský výzkum, s.r.o.,troubsko Abstrakt V letech byly v Troubsku v polních pokusech zkoumány chemické i mechanické metody regulace plevelů u vybraných netradičních luskovin. Jako lépe konkurenceschopná proti plevelům a výnosnější plodina se projevil hrachor setý (odrůda Radim, výnosy cca 2-2,7 t/ha) oproti cizrně beraní (Irenka, cca 0,2-0,9t/ha). Vláčení plecími branami nemělo dostatečný účinek na plevele s hlubšími kořeny. Z použitých herbicidů se jako uspokojivě účinné a selektivní ukázaly jednak premergentní aplikace linuronu cca g/ha aktivní substance, u hrachoru v tankmixu s clomazonem cca g/ha. Cizrna snášela naopak dobře oproti hrachoru S-metolachlor. Výrazně fytotoxické byly pendimethalin, metribuzin a prosulfocarb, slabě účinný diflufenican a ethofumesate. V nových pokusech se jeví jako poměrně nadějné hlavně využití S- dimethenamidu a dále aclonifenu. Z postemergentních herbicidů, které snášel zpravidla výrazně lépe hrachor než cizrna, se kromě graminicidů jevily jako vhodné jednak samotný bentazone, lépe selektivní bez aktivátoru, než s aktivátorem. Na řadu plevelů účinnější, ale v doporučovaných dávkách někdy méně selektivní byl imazamox, většinou doplněný pendimethalinem nebo bentazonem. Klíčová slova: cizrna, hrachor, regulace plevelů, herbicidy, selektivita, účinnost Abstract The chemical and mechanical methods of weed control in pulse crops chickpea (variety Irenka) and vetchling (Radim) were observed in field trials in Troubsko in The vetchling was better competitive to the weeds and herbicides and more profitable crop in the trials. The harrowing with rod harrows had not sufficiant efficacy mainly to the weeds with a deep roots. Herbicide treatment with linuron ca g/ha active ingredience was good selective and effective to the brodleaf weeds by the vetchling with clomazone too in the rate ca g/ha a.i. The preemergence aclonifen and dimethenamid provided a bit better effectivity in the last trials. Vetchling tolerated good quite better than chickpea the postemergence herbicides bentazone, imazamox with tween and imazamox with pendimethalin or bentazone. Key words: Chickpea, vetchling, weed control, herbicides, selectivity, efficacy Úvod Cizrna beraní a hrachor setý jsou staré kulturní rostliny, pěstované jako potraviny hlavně ve středomoří. V souvislosti se současnými klimatickými tendencemi oteplování a suchých period se dostávají znovu do oblasti zájmu pěstitelů, snažících se nabídnout pestřejší možnosti stravy v rámci zdravé výživy. Pěstitelská doporučení, týkající se využití preemergentních nebo postemergentních herbicidů, jsou v literatuře spíše z oblastí jiných podmínek, většinou středomoří nebo Indie pro cizrnu (Kachhadiya SP, et al, 2009) nebo Severní Ameriky pro příbuzný fazol (Hekmat, S., et al, 2008), (Sikkema, PH, et al, 2008). Indický pramen uvádí možnost využití oxyfluorfenu preemergentně (u nás např. přípravek Goal 2E) a postemergentně imazethapyru (Pivot), který u nás po jeho restrinkci nahrazuje imazamox, dostupný zatím ve směsné formulaci s pendimethalinem (přípravek Escort Nový). Při nevýznamných rozdílech mezi variantami dosáhli výnosů cizrny až cca 3t/ha. Severoamerické resp. kanadské prameny u fazolu hodnotí jako potenciálně použitelné preemergentně dimethenamid (u nás přípravek Outlook) nebo S-metolachlor (Dual Gold 960EC), již s větší fytotoxicitou linuron (např. Afalon 45SC). I v Troubsku byly kolegou Tesařem prováděny v 90. letech pokusy s těmito plodinami (pro registraci byl z nich doporučen do cizrny např. metribuzin (Sencor) či postemergentně pyridate (Lentagran), které v souvislosti s novými 235

236 přípravky nebo dalšími možnostmi z jiných luskovin byly částečně využity při nových pokusech. V Troubsku byly v minulých letech vyšlechtěny odrůdy cizrny a hrachoru a je řešena i technologie jak v podmínkách ekologického, tak konvenčního hospodaření. Příspěvek je zaměřen na pokusně zkoumané způsoby regulace plevelů. Materiál a metody Pro ověření způsobů regulace plevelů u cizrny a hrachoru byly v Troubsku prováděny polní maloparcelové pokusy s přirozeným zaplevelením, jejichž součástí byly v některých ročnících i plochy pro mechanickou kultivaci, zejména vláčení prutovými branami. Pokusy byly prováděny v randomizovaném uspořádání podle mezinárodních metodik EPPO pro ověřování biologické účinnosti herbicidů. Pokusy probíhaly v podmínkách řepařské výrobní oblasti a jejich výsledky byly dosti závislé na průběhu počasí na jaře. Výsevy byly prováděny vždy cca od začátku do poloviny dubna po výraznějším jarním oteplení, preemergentní aplikace do 3 dnů po zasetí a postemergentní podle růstu porostu začátkem nebo do poloviny května, po vývinu min. 2-3 pravých listů plodin, na plevele v růstovém stádiu od děložních do cca 6 - max. 8 pravých listů. V letech 2007, 2009 a 2012 bylo jaro s výrazným přísuškem, což ovlivňovalo negativně zejména preemergentní tzv. půdní herbicidy a také vzcházení a počáteční růst porostu. Naopak normální příznivější podmínky s dostatkem srážek byly v letech 2008 a Z jednotlivých variant ošetření, které byly aplikovány během let ve velmi širokém souboru, byly do tohoto příspěvku a výsledků vybrány spíše potenciálně vyhovující varianty s uspokojivou selektivitou a účinností. Pro informaci uvádíme alespoň výčet zkoušených látek a přípravků, aplikovaných samostatně i v některých kombinacích. Preemergentní ošetření: linuron (Afalon 45 SC), clomazone (Command 36CS), pendimethalin (Stomp 400SC), imazamox +pendimethalin (Escort), S-metolachlor (Dual Gold 960EC), diflufenican (Brodal), metribuzin (Sencor 70WG), S-dimethenamid (Outlook), aclonifen (Chalenge). Postemergentní ošetření: bentazone (Basagran), bentazone+ aktivátor wettol (Basagran Super), imazamox +adjuvant tween (Pulsar 40), imazamox +pendimethalin (Escort, Pulsar 40+Stomp 400SC, Escort Nový), imazamox + bentazone (Pulsar 40+Basagran nebo Basagran Super, BAS Corum), ethofumesate (Stemat super), pyridate (Lentagran WP). Dávky jsou uvedeny ve výsledkové části. V pokusech byla hodnocena vizuálně selektivitu a účinnost na plevele u jednotlivých variant ošetření v % ve vztahu k neošetřené kontrole (0%). Výsledky a diskuze Výsledky pokusů jsou uvedeny v následujících tabulkách, které obsahují účinnost použitých variant ošetření na několik hlavních vyskytujících se druhů plevelů, fytotoxicitu (selektivitu) v % oproti neošetřené kontrole a kde bylo možné výnosové údaje v t/ha. Pro snadnější přehlednost a porovnatelnost jsou uvedeny pouze průměrné hodnoty všech údajů v jednotlivých ročnících. Tab. 1: Cizrna beraní (Irenka) Účinnost a fytotoxicita herbicidů, výnos semen Účinnost průměr v % Laskavec Merlík Rdesno Ježatka Fytotoxicita % Výnos Přípravek l/ha AMARE CHEAL POLLA ECHCG t/ha 2007 Kontrola (počet plevelů na 1m 2) , ,29 Průměr 14,0 16,2 5,0 31,6 0,0 0,0 0, Afalon 1,

237 Afalon1,18+Command 36 CS 0, Afalon 1,2 + Command 0,12 87, ,5 33, ,5 62,5 87,5 57, ,5 0, Stomp 400 3, Escort 2,9 preem Outlook 1l * 87, , ,5 37, , , Basagran , Basagran 1, Basagran ,5 0,18 Průměr 77,2 65,9 93,7 18,3 25,0 22,8 0, Basagran Super 1, , Basagran Super 1, Průměr 58,8 80,9 86,0 23,3 19,6 17,1 0, Pulsar 40 0, , Pulsar 40 0, Pulsar 0, Pulsar 0, Průměr 98,1 52,1 73,3 54,0 29,6 24,1 0, Escort 1, , Escort 1, Průměr 91,3 84,0 87,5 73,0 30,8 28,9 0, Pulsar 0,59+Stomp 400 0, , Pulsar 0,7+Stomp 400 1, , Pulsar 0,47+ Stomp 400 0, Průměr , Escort Nový 1, Escort Nový 1, Escort Nový 1, , ,5 36,25 27,5 0,31 Průměr Pulsar 0,58+ Basagran 1, , Pulsar 0,7 + Basagran 1, , Pulsar 0,53+Basagran 1, Pulsar 0,55+Basagran Průměr 96,5 86,0 92,2 62,9 24,7 19,1 0, Pulsar 0,55+Basagran Super 0, BAS Corum 1 + Dash HC 0, , ,35 Průměr 100,0 77,5 100,0 50,0 40,0 30,0 237

238 Tab. 2: Hrachor setý (Radim) 238 Účinnost a fytotoxicita herbicidů, výnos semen Účinnost v %, průměr ročníku Laskavec Merlík Rdesno Ježatka Fytotoxicita % Výnos Přípravek l/ha AMARE CHEAL POLLA ECHCG t/ha 2007 Kontrola (počet plevelů na 1m 2) , , Průměr 3,0 15,8 5,3 5,0 0,0 0,0 1, Afalon 1, * * , Afalon 1,25+Command 36 CS 0, * 2008 Afalon1,17+Command 36 CS 0, * , Afalon 1,2l + Command 0,12l * ,5 * 2007 Stomp 400 3, * * , Escort 2,9 preem * * , Outlook 1l * 77, ,5 16,25 * 2007 Basagran 1, , * , * * Průměr 74,9 73,9 95,0 41,5 21,8 14,7 2, Basagran Super 1, , Basagran Super 1, * , * * Průměr 80,3 89,6 100,0 49,0 22,6 17,5 2, Pulsar 40 0, , Pulsar 40 0, * , Pulsar 0, * , * * Pulsar 0,5l * * Průměr , Escort 1, , Escort 1, * ,11 Průměr Pulsar 0,6+ Stomp 400 0, , Pulsar 0,7+ Stomp 400 1, , Pulsar 0,6+ Stomp 400 0, * ,31 Průměr 98,3 90,0 96,3 80,3 19,6 14,2 2, Escort Nový1, * * Escort Nový 1, * * Escort Nový 1,25 * 90 97,5 87,5 7,5 7,5 Průměr 61,5 74,7 97,5 87,5 24,2 21,4

239 2007 Pulsar 0,58 + Basagran 1, , Pulsar 0,7 + Basagran 1, , Pulsar 0,58+ Basagran 1, * , Pulsar 0,55+Basagran * * Průměr , Pulsar 0,55+Basagran Super 0, * * BAS Corum 0,9l * 72,5 100 * 12,5 10 Vysvětlivky k tabulkám: hranice u fytotoxicity do 20% zeleně vcelku dobrá selektivita, do 29% žlutě uspokojivá, % oranžově zvýšená fytotoxicita, nad 45% červeně silná Hranice u účinnosti od 80% uspokojivá až dobrá zeleně, 66-79% nedostatečná žlutě, slabá oranžově, do 49% velmi slabá červeně *nebo prázdné políčko-nehodnoceno z důvodu slabého výskytu plevelů, u výnosů porost nebyl způsobilý ke sklizni U pokusů s herbicidy jsou zejména u těchto citlivějších plodin vlivy konkurence plevelů a přímého působení herbicidů na plodinu (fytotoxicity) i dalších, zejména např. klimatických vlivů často spojeny, proto jsou v tabulkách uvedeny společně. Snažili jsme se alespoň o hrubší grafické rozlišení tabulek parametrů účinnosti a fytotoxicity podle barev (zelená pro příznivější údaje, červená nepříznivé, žlutá a oranžová přechodné). Vhodné varianty pro využití by měly mít v první řadě uspokojivou selektivitu a také účinnost alespoň na některé významné druhy plevelů. Po dozrání porostu bylo u pokusů s nižším zaplevelením provedeno sklizňové hodnocení. To se často nedařilo. Bylo to jednak vlivem slabé účinnosti řady ošetření při vysokém tlaku plevelů, ale naopak aplikaci často redukovaných dávek herbicidů, potřebných z hlediska dobré selektivity (zejm. u citlivější cizrny). U premergentních variant pak docházelo ke značnému zaplevelení za sucha. Porosty trpěly i poškozením po zasetí holuby a hlavně u cizrny i částečným spásáním zajícem polním. Dosažené výsledky v jednotlivých ročnících jsou poměrně různorodé vlivem klimatických a stanovišťnich podmínek, zejm. značných rozdílů v zaplevelení, postupných dílčích úprav dávkování nebo i změn použitých přípravků kvůli jejich nevyhovující selektivitě nebo účinnosti, případně kvůli změnám formulace výrobcem. Výsledky nejsou proto příliš vhodné k podrobnějšímu detailnímu srovnávání a statistickému zpracování. U cizrny i hrachoru v pokusech docházelo ke značným rozdílům z hlediska účinnosti na plevele i selektivity zejména u preemergentních variant ošetření kvůli značné závislosti na půdní vlhkosti. V suchých letech 2007, 2009 a 2012 byla účinnost preemergentních variant vesměs slabá a hodnocení selektivity naopak příznivé, obě málo vypovídající. Při vlhčím průběhu jara v letech 2008 a pak v roce 2011, oproti zahraničním poznatků z fazolu (Sikkema, et al.,2008), které konstatují dobrou selektivitu spíše u dimethenamidu a horší u linuronu, byla zjištěna u cizrny i hrachoru u variant linuronu (Afalon 45SC cca 1,1-1,5l/ha) poměrně uspokojivá selektivita, s fytotoxicitou krátkodobě cca 20-30% (mírně opožděné vzcházení a snížený růst). U hrachoru byla i přes možnost přechodné fytotoxicity až 40% hodnocena pro významně lepší účinnost jako akceptovatelná i tankmix směs s clomazonem (Command 36CS 0,125-0,15l/ha), u cizrny zde docházelo již k poněkud výraznější zbrždění růstu 40-50%, akceptovatelnému snad ve snížené dávce. V pozdějších pokusech v roce 2011, 2012 se jako poměrně účinný na ježatku i dvouděložné a uspokojivě selektivní u obou plodin jevil dimethenamid (Outlook cca 1-1,2l/ha) a dále aclonifen (Chalenge) cca 2-2,5l/ha (2012) jako určitá alternativa linuronu na dvouděložné. Naopak silnou fytotoxicitu, projevující se opožděným vzcházením a slabým růstem, působily u obou plodin pendimethalin (Stomp 400SC cca 3l, Escort preemergentně 2,9l/ha), a prosulfocarb (Boxer 800EC) a zejm. u cizrny r metribuzin (Sencor). 239

240 Postemergentní varianty sice měly poněkud stabilnější působení na plevele než premergentní, ale spíše užší spektrum účinku a někdy výrazné, i když obvykle dočasné fytotoxické působení, hlavně u citlivější cizrny. Z postemergentních herbicidů byl u obou plodin většinou uspokojivě selektivní bentazone, lépe ve formulaci bez aktivátoru (Basagran). Fytotoxicita byla u něj obvykle cca 10-25% u cizrny i hrachoru. Ve dvou pokusech však činila maximální hodnota krátkodobě cca 35% a v roce 2012 u cizrny až 50%, a to dlouhodoběji. U samotného imazamoxu (Pulsar 40) byla selektivita u cizrny s určitými výkyvy poměrně uspokojivá - fytotoxicita krátkodobě cca (maximální dílčí hodnota cca 50%). U hrachoru byla jeho selektivita zřetelně lepší. Přípravek Pulsar 40 však v této formulaci zatím nebude výrobcem u nás registrován a zřejmě dojde ke změně formulace kvůli slabšímu působení, zejména na merlíky. Ze směsných přípravků byly zkoumány hlavně směsi imazamoxu s pendimethalinem (nejprve byl použit původní, nyní restringovaný přípravek Escort, později tankmix Pulsar 40+Stomp 400 s větším podílem imazamoxu oproti pendimethalinu a nakonec tomuto poměru odpovídající nová originální formulace Escort Nový). U těchto směsí byla u cizrny fytotoxicita v pokusech poněkud vyšší a dlouhodobější (cca 25-40%, maximální hodnota u vyšší dávky až 60%). U hrachoru byla selektivita těchto přípravků opět zřetelně lepší. Z jednotlivých formulací se lépe selektivní nakonec jevila nejnovější originální formulace. U tohoto přípravku Escort Nový vzhledem k dobré účinnosti na většinu dvouděložných a jednoděložných plevelů (zejména laskavce, ale i merlíky, svízel, rdesna a řadu dalších, z jednoděložných na ježatku a oves hluchý) a jeho dostupnosti (proběhla registrace výrobcem od sezóny 2012 v hrachu) je připravováno rozšíření jeho použití se sníženými dávkami. Směsi imazamoxu s bentazonem (Pulsar 40+ Basagran nebo B. Super, nověji pak směsný přípravek - experimentální ready mix BAS Corum) bývají na některé plevele účinnější (oproti Escortu hlavně na heřmánkovité a oproti samotnému bentazonu na laskavce a další). Byly u cizrny v některých ročnících hůře selektivní (fytotoxicita i přes 30%). U hrachoru byla jejich selektivita vcelku dobrá, podobně jako v literatuře (Hekmat, et al, 2009) u fazolu a dle našich poznatcích u některých jetelovin. U tankmixů imazamoxu a bentazonu bez aktivátoru i připravovaného ready mixu však docházelo ke slabšímu působení na některé plevele, zejména na merlíky. Proto se u readymixu (BAS Corum) navrhuje doplnění smáčedlem nebo případně k bentazonu využít jako partnera spíš směsného Escortu, což vyžaduje další testování, vzhledem ke přepokládané vyšší fytotoxicitě. Závěr Cizrna beraní Irenka se v pokusech projevila jako celkově méně konkurenceschopná plodina z hlediska potlačování plevely, byla také spásána zajícem a mělce zasetá semena holuby. Z hlediska integrované ochrany se jeví jako určitá možnost zlepšení konkurenceschopnosti porostu zvýšení výsevku této odrůdy z doporučovaných kg/ha na min. 150kg/ha a oplocení. Je u ní zřejmě vhodnější mechanická regulace plevelů, na menší ploše se osvědčilo pěstování v širších řádcích a plečkování, při hlubším setí a dobrém zakořenění vláčení plecími branami. Projevovala se u ní i obecně relativně vyšší citlivost na ošetření herbicidy. Hrachor setý Radim se naopak ukázal jako dobře konkurenceschopná plodina vůči plevelům, která při včasném, kvalitním zasetí a dobrém vzejití výrazně plevele potlačuje, hlubší setí je důležité i proti vyzobávání holuby, kteří mohou vyzobávat i polehlý porost před sklizní. Je zde možnost mechanické regulace plevelů, v širších řádcích plečkování, vláčení plecími branami, v pozdější době poléhavá lodyha možnosti mechanické regulace omezuje a ztěžuje sklizeň. Možnosti herbicidních ošetření: - z preemergentních herbicidů je u obou plodin uspokojivě selektivní i ve vlhčích ročnících linuron (Afalon 45SC), spíše jen u hrachoru včetně směsi se sníženou dávkou clomazone 240

241 (Command 36CS), u cizrny je zase možno využít S- metolachlor ( Dual Gold 960EC), u uvedených herbicidů bylo rozšířené použití již schváleno SRS - nově se jeví jako použitelný u obou plodin dimethenamid (Outlook) a u cizrny aclonifen (Chalenge), který u hrachoru zatím nebyl zkoušen - naopak u metribuzinu (Sencor), již dříve zaregistrovaného u cizrny, se projevila za vlhka silná fytotoxicita, podobně jako u pendimethalinu (Stomp), prosulfocarbu (Boxer) a směsného Escortu, takže je k ošetření nelze doporučit - z postemergentních přípravků byl pro ošetření vybrán jako dostatečně selektivní u obou plodin bentazone bez aktivátoru (Basagran), u hrachoru i s aktivátorem - Basagran Super zde bylo schváleno rozšíření použití - jako potenciálně možné se jeví použití imazamoxu, u samotného (Pulsar 40) však byla v pokusech prokázána na některé významné plevele slabší účinnost a je avizována změna jeho formulace - z účinnějších směsí imazamoxu s pendimethalinem se uvažuje o vyžití Escortu Nového, který se vyznačoval poněkud zlepšenou selektivitou oproti starším formulacím a vcelku dobrým působením na jednoleté plevele včetně jednoděložných, takže zde je zřejmě vhodné navrhnout rozšíření použití - směsi imazamoxu s bentazonem mohou být někdy hůře selektivní u cizrny, uspokojivě u hrachoru, mají slabší účinnost na některé plevele, zejm. na merlíky, ale jsou naopak účinné na důležité heřmánkovité a další druhy, takže se s nimi počítá do dalšího zkoumání, potřebnému i kvůli výrobcem avizované úpravě formulací přípravků a směsi Dedikace Projekt NAZV QG60130: Minoritní plodiny pro specifické využití v potravinářství Použitá literatura Hekmat, S., Soltani, N., Shropshire, C., Sikkema, PH.: Effect of imazamox plus bentazon on dry bean (Phaseolus vulgaris L.). CROP PROTECTION, 2008, Vol. 27, No. 12, s. ISSN Sikkema, PH., Robinson, DE., Nurse, RE., Soltani, N.: Pre-emergence herbicides for potential use in pinto and small red mexican bean (Phaseolus vulgaris) production. CROP PROTECTION, 2008, Vol. 27, No. 1, s. ISSN Kachhadiya, SP., Savaliya, JJ., Bhalu, VB., Pansuriya, AG., Savaliya, SG.: Evaluation of new herbicides for weed managment in chickpea (Cicer arietinum L.). LEGUME RESEARCH, 2009, Vol. 32, No. 4, s. ISSN Kontaktní adresa: Ing. Petr Šmahel Zemědělský výzkum, s.r.o., Zahradní 1, Troubsko 241

242 Cicer arietinum L. Lathyrus sativus L. 242

243 OBSAH GLUKOSINOLÁTŮ V ZELENÝCH ČÁSTECH ŘEPKY A JEJICH VLIV NA VYBRANÉ ŠKŮDCE Glucosinolate content (GSL) in green matter of rapeseed and their influence on selected pests Vrbovský V. 1, Rychlá A 1., Endlová L. 1 1 OSEVA PRO s.r.o., odštěpný závod Výzkumný ústav olejnin Opava Abstrakt V listech a mladých šešulích řepky olejky ozimé (Brassica napus; Brassicaceae) byl analyzován obsah glukosinolátů (GSL) metodou vysokoúčinné kapalinové chromatografie (HPLC). Celkový obsah GSL v listech dosahoval v průměru 5,08 µmol/g, v šešulích 8,93 µmol/g sušiny. V listech dominovala alifatická skupina GSL (66 % z celkových GSL), následovala aromatická (17 %) a indolová (17 %) skupina. V mladých šešulích dominovaly alifatické (49 %) a indolové (47 %) GSL, aromatická skupina tvořila 4 %. Současně byla stanovena velikost napadení analyzovaných genotypů řepky pilatkou řepkovou (Athalia rosae, Hymenoptera) a bejlomorkou kapustovou (Dasineura brassicae, Diptera). Byly stanoveny korelace mezi obsahem zjištěných GSL a napadením těmito škůdci. Negativní vliv na napadení pilatkou byl zjištěn u gluconapoleiferinu (P>0,05). Pozitivní vliv na napadení bejlomorkou vykazoval obsah glucoalyssinu (P>0,05). Klíčová slova: řepka olejka, glukosinoláty, pilatka řepková, bejlomorka kapustová Abstract In leaves and young siliques of rapeseed (Brassica napus; Brassicaceae) was analyzed content of glucosinolates (GSL). The used method was high performance liquid chromatography (HPLC). The total content GSL in the leaves was 5,08 µmol/g d.m., in siliques was 8,93 µmol/g d.m.. In the leaves dominated group of alifatic GSL (66 %), groups of aromatic and indolyl GSL were represented from 17%. In the young siliques dominated groups of alifatic (49 %) and indolyl (47 %) GSL, group of aromatic GSL was represented by 4%. Simultaneously was determined damage of leaves of Athalia rosae (Hymenoptera) and damage of siliques of Dasineura brassicae (Diptera). Correlations have been established between the attack and GSL content. Gluconapoleiferin exhibited the significant negative influence to the damages of A. rosae (P>0,05). Glucoalyssin exhibited the significant positive influence to the damages of D. brassicae (P>0,05). Key words: rapeseed, glucosinolates, Athalia rosae, Dasineura brassicae Úvod Glukosinoláty a jejich rozkladné produkty (isothiokyanáty, thiokyanáty, nitrily) se mimo jiné podílejí na obranyschopnosti rostlin proti živočišným škůdcům. Účinnost této obrany je prokázána u celé řady fytofágů. Někteří však dokáží přítomnost těchto látek využít pro rozpoznání hostitelské rostliny a z GSL se tak stávají atraktanty. Obecně platí, že polyfágní, méně specializovaní škůdci, jsou GSL odpuzováni, zatímco u některých škůdců specializovaných na brukvovité tomu bývá naopak. V rámci představovaného výzkumu bylo provedeno stanovení obsahu GSL v rostlinných pletivech řepky olejky ozimé v různých vývojových fázích a částech rostliny u více linií vzniklých šlechtitelskou činností organizace OSEVA PRO s.r.o., Výzkumný ústav olejnin Opava. Pro hodnocení vlivu obsahu GSL na napadení byla zvolena pilatka řepková a bejlomorka kapustová. Housenice pilatek poškozují žírem listy a lodyhy, při vyšším tlaku dochází až k holožíru. Bejlomorka kapustová je typický šešulový škůdce, kterého je často nutné regulovat chemicky. Dospělci kladou vajíčka do mladých 1-2 cm velkých šešulí. Ty se následně deformují, praskají a semena vypadávají. 243

244 glucoiberin progoitrin epi-progoitrin glucoraphanin gluconapoleifein gluconapin glucobrassicanapin glucoalyssin gluconasturtiin glucotropaeolin 4- hydroxyglucobrassicin glucobrassicin 4- methoxoglucobrassicin neoglucobrassicin Úroda 12/2012, vědecká příloha časopisu Materiál a metody S vybranými genotypy řepky byl založen maloparcelkový pokus s těmito parametry: výměra parcel 10 m 2, délka 9 m, šířka 1,125 m, počet řádků 9, meziřádková vzdálenost 12,5 cm, zásev v agrotechnickém termínu maloparcelním secím strojem při výsevku 700 klíčivých semen na 10 m 2. Agrotechnické zásahy byly v souladu s běžnou pokusnickou praxí bez insekticidního ošetření. Vzorky listů pro analýzu GSL byly odebrány ve fázi řepky BBCH 19 (6 a více listů vyvinuto) z 16-ti pilatkou kontrastně napadených genotypů. Při polním hodnocení ( ) byla stanovena míra napadení pilatkou jako procento housenicemi poškozené listové plochy. Odběr vzorků mladých šešulí o velikosti do 2 cm pro analýzu GSL byl proveden ve fázi BBCH 69 (dokvétání). Každá rostlina, ze které byl proveden odběr, byla označena a po dozrání samostatně sklizena ( ) za účelem stanovení velikosti procentického napadení šešulí bejlomorkou. Hodnoceno bylo 52 rostlin 9 genotypů. Vzorky zelené hmoty byly bezprostředně po odběru analyzovány na obsah GSL. Metodika jejich stanovení v zelené hmotě metodou vysokoúčinné kapalinové chromatografie (HPLC) vychází z mezinárodní normy ISO : 1992 (E). Pracovní postup zahrnuje úpravu vzorků, extrakci GSL methanolem, jejich enzymatickou desulfataci na iontoměniči, končí stanovením desulfoglukosinolátů metodou HPLC na koloně s reverzní fází za použití gradientové eluce a detekce v UV oblasti. Ke kvantitativnímu stanovení GSL v zelené hmotě byla použita metoda vnitřního standardu (KOLOVRAT 2005). Výsledky a diskuze Obsah GSL v různých částech rostlin V listech řepky bylo identifikováno 12 GSL, v šešulích 13 GSL. Identifikované GSL, jejich procentické zastoupení a celkové množství udává tabulka 1. V listech dominovala alifatická skupina GSL (66 % z celkových GSL), následovala aromatická (17 %) a indolová (17 %). V mladých šešulích dominovaly alifatické (49 %) a indolové (47 %) GSL, aromatická skupina tvořila 4 %. Pro porovnání uvádíme průměrné obsahy GSL v semenech zjištěných po sklizni. V semenech výrazně dominovala alifatická skupina (77 %), následována indolovou (20,5 %). Aromatická skupina byla zastoupena jen ze 2,5 %. Tab. 1: Zastoupení jednotlivých GSL v listech, šešulích a semenech řepky (průměrné hodnoty z jednotlivých stanovení) Alifatická skupina (% z celkových GSL) Aromatická skupina (%) Indolová skupina (%) Rostlinná část GSL celkem (µmol/g sušiny) Listy 5,075 0,1 11,7 0,7 5,5 3,7 11,4 33,6 5,3 11,9 0,0 1,2 15,2 0,0 1,3 Šešule 8,926 0,3 22,8 0,1 3,8 4,2 13,1 5,2 1,4 2,3 0,0 7,4 38,5 0,1 0,6 Semeno 19,138 0,4 51,3 1,1 0,0 2,3 17,0 4,5 2,0 0,6 is 19,0 1,2 0,1 0,4 Vliv GSL na napadení Statistická analýza byla provedena pomocí programu STATISTICA Cz 10. Signifikantně negativní vliv (P>0,05) na napadení rostlin pilatkou byl zjištěn v případě gluconapoleiferinu. 244

245 Rostliny, u nichž bylo v listech zjištěno vyšší procentické zastoupení tohoto GSL na celkovém obsahu GSL, vykazovaly nižší míru poškození housenicemi pilatek (graf 1). Pozitivní vliv (P>0,05) na napadení bejlomorkou kapustovou byl zjištěn u glucoallysinu. Rostliny s vyšším zastoupením tohoto GSL v šešulích vykazovaly větší míru poškození bejlomorkou (graf 2). Graf 1: Napadení rostlin pilatkou řepkovou vs. obsah gluconapoleiferinu v listech: 50 Bodový graf: Gluconapoleiferin (%) vs. napadení (%) (Celé příp. vynech. u ChD) napadení (%) = 36,643-3,235 * Gluconapoleiferin (%) Korelace : r = -, napadení (%) Gluconapoleiferin (%) 0,95 Int.spol. Graf 2: Napadení rostlin bejlomorkou kapustovou vs. obsah glucoalyssinu v šešulích: napadení bejlomorkou (%) Bodový graf: Glucoalyssin (%) vs. napadení bejlomorkou (%) (Celé příp. vynech. u ChD) napadení bejlomorkou (%) = 9, ,4761 * Glucoalyssin (%) Korelace : r =, ,4 0,6 0,8 1,0 1,2 1,4 1,6 1,8 2,0 2,2 Glucoalyssin (%) 0,95 Int.spol. 245

246 Závěr Nejvyšší obsah celkových GSL byl identifikován v semeni, dále v mladých šešulích a nejnižší v listech. Tento závěr koresponduje s údaji v literatuře. Pokles obsahu GSL během vývoje rostliny je vysvětlován expanzí pletiv, kdy akumulace GSL výrazně zaostává za nárůstem rostlinné hmoty (BROWN et al. 2003; PORTER et al. 1991). Vyšší obsah GSL v mladých šešulích zřejmě souvisí s akumulací a transportem GSL do vyvíjejících se semen (BILSBORROW et al. 1993). Zjištěná korelace obsahu GSL a napadení pilatkou řepkovou odpovídá literárním údajům, kdy byla prokázána citlivost tohoto hmyzu ke GSL a jejím rozkladným produktům (BARKER et al. 2006). V rámci výzkumu představovaného v tomto příspěvku byl v předešlých letech zjištěn signifikantní negativní vliv na velikost napadení řepky pilatkou u GSL glucobrassicinu a gluconasturtinu (VRBOVSKÝ et. al. 2011). Také v případě vlivu GSL na napadení bejlomorkou kapustovou odpovídají námi získané závěry publikovaným údajům. MURCHIE et al. (1997) prokázal preferenci lapačů obsahujících rozkladné produkty GSL (isothiokyanáty) bejlomorkou před lapači bez těchto látek. Je tedy možné, že se při rozpoznávání hostitelské rostliny bejlomorky řídí obsahem GSL a jejich rozkladných produktů. Dedikace Výsledky byly získány na základě řešení projektu č. QI111A075 Využití biotechnologických metod, nových výchozích materiálů a efektivních postupů ve šlechtění ozimé řepky ( ), financovaného MZe prostřednictvím Národní agentury pro zemědělský výzkum. Použitá literatura Barker A. M. et al., 2006: Chemosensory and behavioural responses of the turnip sawfly, Athalia rosae, to glucosinolates and isothiocyanates. Chemoecology, 16(4): Bilsborrow E., Murray F., Zhao F., 1993: Glucosinolate changes in developing pods of single and double low varieties of autumn-sown oilseed rape Brassica napus. Annals of Applied Biology, 122(1): Brown P., Tokuhisa J., Reichelt M., Gershenzon J., 2003: Variation of glucosinolate accumulation among different organs and developmental stages of Arabidopsis thaliana. Phytochemistry, 62(3): Kolovrat O., 2005: GSL HPLC (zelená hmota řepky). Metodický návod. Oddělení chemické laboratoře VÚOl Opava, nepublikováno. Murchie A. K., Smart L. E., Williams I. H., 1997: Responses of Dasineura brassicae and its parasitoids Platygaster subuliformis and Omphale clypealis to field traps baited with organic isothiocyanates. Journal of Chemical Ecology, 23(4): Porter A., Morton A., Kiddle G., Doughty K., Wallsgrove R., 1991: Variation in the glucosinolate content of oilseed rape Brassica napus L. leaves I. Effect of leaf age and position. Annals of Applied Biology, 118(2): Vrbovský V., Rychlá A., Endlová L., 2011: Variabilita obsahu glukosinolátů obsažených v zelené hmotě a jejich vliv na vybrané škůdce řepky. Úroda 12/2011, vědecká příloha s Kontaktní adresa: Mgr. Viktor Vrbovský OSEVA PRO s.r.o., o. z. Výzkumný ústav olejnin Opava Purkyňova 10, Opava

247 DRUHOVÉ SPEKTRUM PLEVELŮ OZIMÝCH PLODIN V PROVOZNÍCH PODMÍNKÁCH Species spectrum of weeds in the winter crops of chosen agricultural enterprise Winkler J., Blažková H. Ústav agrosystémů a bioklimatologie,mendelova univerzita v Brně Abstrakt Cílem této práce bylo vyhodnocení druhového spektra plevelů na pozemcích zemědělského podniku ZEAS Lysice ve vybraných plodinách. Pozemky se nacházejí v nadmořské výšce od 350 do 650 m.n.m. a jedná se o obilnářskou výrobní oblast. Druhové zaplevelení bylo pozorováno v ozimé řepce, ozimé pšenici a ozimém žitu, které jsou v tomto zemědělském podniku každoročně pěstovány. Výsledky zaplevelení byly zpracovány mnohorozměrnou analýzou ekologických dat. Z výsledků vyplývá, že se v porostu ozimé řepky nejvíce vyskytoval Stellaria media, Capsella bursa-pastoris, Galeopsis tetrahit, Viola arvensis, Thlaspi arvense. V ozimém žitu se nejvíce vyskytovaly Veronica persica, Viola arvensis, Taraxacum officinale, Sinapis arvense, Achillea millefolium, Poa annua. V ozimé pšenici se nejčastěji nacházely Thlaspi arvense, Chenopodium hybridum, Anthemis arvensis, Tripleurospermum maritimum. Klíčová slova: plevele, plodina, druhová diverzita Abstract The aim of this work was to evaluate the spectrum of weed species on lands agricultural company ZEAS Lysice in selected crops. These grounds are situated from 350 to 650 meters above sea level and they are parts of a grain production area. Species weed infestation was observed on a perennial rape, a perennial wheat and a perennial rye, which are grown in this agricultural company every year. The results of weed infestation were processed by a multivariate analysis of ecological data. The results showed that in the growth of a perennial rape mostly occurred Stelaria media, Capsella bursapastoris, Galeopsis tetrahit, Viola arvensis, Thlaspi arvense. In a perennial rye mostly occurred Veronica persica, Viola arvensis, Taraxacum officinale, Sinapis arvense, Achillea millefolium, Poa annua. In a perennial wheat were mostly found Thlaspi arvense, Chenopodium hybridum, Anthemis arvensis, Tripleurospermum maritimum. Key words: weeds, crops, species diversity Úvod V současné době je v ČR dle Křena a Valtýniové (2008) ekonomicky nejvíce ziskové pěstování sladovnického ječmene, pšenice, řepky a máku; v případě dobrých prodejních kontraktů ještě i brambor a cukrovky. Procento pěstovaných obilnin na orné půdě se pohybuje v rozmezí přibližně % a to zejména díky úbytku stavů skotu a omezení pěstování víceletých pícnin. Výskyt plevelů v porostech kulturních rostlin je závislý na specifických biologických vlastnostech všech složek agrofytocenózy. V ní se může vyskytovat určitý rostlinný druh pouze tehdy, jestliže jednotlivé podmínky stanoviště vyhovují jeho nárokům, nebo jestliže se dokáže měnícím se podmínkám přizpůsobit, jak uvádějí Hron, Kohout, (1986). Monitoring zaplevelení pozemků je důležitý pro navržení vhodné regulace plevelů na konkrétní lokalitě. Materiál a metody Sledování zaplevelení bylo provedeno na pozemcích zemědělského podniku ZEAS Lysice. Vybrané pozemky se nachází v Jihomoravském kraji okresu Blansko. Lokalita se rozkládá v nadmořské výšce od 350 do 650 m n. m., jedná se o obilnářskou výrobní oblast. Z hlediska klimatických poměrů se vyhodnocená oblast nachází v mírně teplém, vlhkém (MT 4) 247

248 klimatickém regionu. Hodnocení druhového spektra plevelů bylo provedeno početní metodou, odpočtová plocha měla velikost 1 m 2. Nejprve bylo provedeno určení daných druhů plevelů a pak jejich počet. Jednotlivá sledování byla vybrána rovnoměrně na celé ploše pozemku a v typickém porostu pro dané místo. Termíny pozorování byly v letech 2010 a 2011 a to vždy v podzimním a jarním období. Ve sledovaných plodinách byly aplikovány herbicidy po založení porostu nebo v průběhu podzimního období. V porostech řepky byly použity přípravky Butisan 400 EC + Command 36 CS; Fusilade Forte 150 EC, v porostech pšenice a žita Maraton 4 + Glean 75 WG. Celková sledovaná plocha byla 109 ha. V ozimé pšenici bylo celkem provedeno 24 sledování, v řepce ozimé 60 sledování a žitu 30 sledování. Ke zjištění vlivu sledovaných faktorů na jednotlivé druhy plevelů, které se vyskytovaly v polním pokusu, byly použity mnohorozměrné analýzy ekologických dat. Byla použita kanonická korespondenční analýza CCA (Canonical Correspondence Analysis). Při testování průkaznosti pomocí testu Monte-Carlo bylo propočítáno 499 permutací. Data byla zpracována pomocí počítačového programu Canoco 4.0. (Ter Braak, 1998). Výsledky a diskuze Celkem bylo zaznamenáno 62 druhů plevelů. Intenzita zaplevelení jednotlivými druhy plevelů je uvedena v Tab.1. Tab. 1 Průměrný počet jedinců plevelných druhů v letech ve sledovaných plodinách Podzim Jaro Ozimá Ozimá Druhy pšenice Ozimá řepka Ozimé žito pšenice Ozimá řepka Ozimé žito Viola arvensis 0,00 92,14 55,65 6,58 24,43 18,20 Brassica napus 75,40 8,65 5,55 0,00 0,00 0,00 Chenopodium hybridum 84,40 0,02 0,00 0,00 2,57 0,00 Apera spica-venti 12,40 45,54 0,00 0,08 0,43 0,00 Thlaspi arvense 0,00 1,98 35,15 10,83 3,73 2,30 Anthemis arvensis 0,00 2,98 0,05 19,00 0,23 0,00 Capsela bursa pastoris 0,00 5,81 1,50 0,00 11,87 0,90 Polygonum aviculare 0,00 0,03 0,00 13,00 0,73 0,00 Triticum/Hordeum 0,00 4,59 8,65 0,00 0,00 0,00 Veronica persica 6,00 4,71 0,95 0,25 0,00 0,00 Chenopodium album 0,00 0,52 0,85 0,00 6,03 3,60 Stelaria media 0,00 6,60 0,30 2,67 1,20 0,00 Galium aparine 3,60 0,43 0,20 4,75 0,40 0,00 Polygonum maculata 0,00 0,00 0,00 9,25 0,00 0,00 Galeopsis tetrahit 0,70 3,71 0,00 0,42 3,73 0,00 Tripleurospermum maritimum 0,00 0,11 0,70 5,17 0,00 0,10 Atriplex patula 4,40 0,62 0,00 0,00 0,10 0,00 Papaver rhoes 0,00 0,56 0,00 0,00 3,77 0,00 Raphanus raphanistrum 0,60 0,06 0,05 0,17 1,97 0,50 Fumaria officinalis 0,00 1,00 1,10 0,08 1,13 0,00 Geranium pusillum 0,00 3,22 0,00 0,00 0,00 0,00 Fallopia convolvulus 0,00 0,86 0,35 0,25 1,37 0,00 Avena fatua 0,00 0,05 0,00 0,00 2,67 0,00 Lamium alpexicaule 0,00 0,10 0,00 0,00 0,00 2,60 Myosotis arvensis 0,00 0,44 0,25 0,00 0,90 1,10 Veronica agrestis 0,00 0,00 0,00 0,17 2,13 0,00 Galinsoga parviflora 0,00 1,16 0,00 0,00 0,77 0,20 Sinapsis arvensis 0,00 0,38 0,00 0,17 0,07 1,20 Cirsium arvense 0,10 0,35 0,00 0,58 0,57 0, Období sledování

249 Veronica hederifolia 0,90 0,25 0,00 0,00 0,53 0,00 Euphorbia helioscopia 0,00 0,22 1,30 0,00 0,00 0,00 Taraxacum officinale 0,00 0,00 1,35 0,00 0,00 0,10 Malva neglecta 0,00 1,08 0,00 0,00 0,00 0,00 Poa annua 0,00 0,02 0,20 0,00 0,33 0,50 Atriplex sagitatta 0,00 0,00 0,00 0,00 0,00 0,90 Sisymbrium officinale 0,00 0,71 0,00 0,00 0,00 0,00 Cardaria draba 0,00 0,68 0,00 0,00 0,00 0,00 Convolvulus arvensis 0,00 0,24 0,00 0,00 0,40 0,00 Anagyllis arvensis 0,00 0,03 0,00 0,58 0,00 0,00 Agrostis capillaris 0,00 0,54 0,00 0,00 0,00 0,00 Matricaria recutita 0,00 0,27 0,00 0,00 0,00 0,20 Sonchus arvensis 0,00 0,44 0,00 0,00 0,00 0,00 Lamium purpureum 0,00 0,38 0,00 0,00 0,00 0,00 Arabidopsis thaliana 0,00 0,00 0,00 0,33 0,00 0,00 Achillea millefolium 0,00 0,03 0,00 0,00 0,00 0,30 Carduus acanthoides 0,00 0,10 0,10 0,00 0,07 0,00 Plantago major 0,00 0,00 0,25 0,00 0,00 0,00 Equisetum arvense 0,00 0,00 0,20 0,00 0,00 0,00 Silene latifolia 0,00 0,00 0,00 0,17 0,00 0,00 Trifolium dubium 0,00 0,00 0,00 0,00 0,17 0,00 Elytrigia repens 0,00 0,08 0,00 0,00 0,07 0,00 Cirsium arvense 0,00 0,14 0,00 0,00 0,00 0,00 Senecio vulgaris 0,10 0,00 0,00 0,00 0,00 0,00 Aphanes arvensis 0,00 0,00 0,00 0,08 0,00 0,00 Plantago lanceolata 0,00 0,06 0,00 0,00 0,00 0,00 Bromus arvensis 0,00 0,05 0,00 0,00 0,00 0,00 Echinochloa crus-galli 0,00 0,00 0,00 0,00 0,03 0,00 Bunias orientalis 0,00 0,03 0,00 0,00 0,00 0,00 Glechoma hederacea 0,00 0,02 0,00 0,00 0,00 0,00 Lapsana communis 0,00 0,02 0,00 0,00 0,00 0,00 Centarea cyanus 0,00 0,02 0,00 0,00 0,00 0,00 Alopecurus myosuroides 0,00 0,02 0,00 0,00 0,00 0,00 Výsledky zaplevelení byly zpracovány pomocí analýzy DCA, kdy byla pomocí této metody nejprve vypočtena délka gradientu (Lengths of Gradient), která činila 3,739. Na základě tohoto výpočtu byla k dalšímu zpracování zvolena i kanonická korespondenční analýza CCA. Analýza CCA vymezuje prostorové uspořádání jednotlivých druhů plevelů a plodin na základě dat o frekvenci výskytu plevelných druhů. Toto je následně graficky vyjádřeno pomocí ordinačního diagramu Obr. 1. Druhy plevelů a plodin jsou zobrazeny body odlišného tvaru a barvy. Výsledky analýzy CCA jsou signifikantní na hladině významnosti α = 0,002. Na základě analýzy CCA je možné nalezené druhy plevelů rozdělit do 3 skupin. První skupina plevelů se vyskytovala především v řepce a jsou to tyto druhy: Fumaria officinalis, Chenopodium album, Myosotis arvensis, Capsella bursa-pastoris, Stelaria media atd. Druhá skupina plevelů se vyskytovala v porostu pšenice ozimé, jedná se o následující druhy: Galium aparine, Tripleurospermum maritimum, Brassica napus, Anthemis arvensis atd. Do třetí skupiny patří druhy plevelů, které se vyskytovaly s porostem ozimého žita: Sinapis arvensis, výdrol pšenice, Poa annua aj. Závěr Z výsledků vyplývá, že v druhovém spektru plevelů hodnocených plodin je výrazný rozdíl. Nejvíce plevelných druhů se vyskytovalo v porostech řepky naopak nejméně druhů bylo v žitu. Nejhojněji zastoupeným plevelem byla violka rolní (Viola arvensis). Do budoucna můžeme předpokládat její další rozšiřování, pokud budou pěstitelské plochy sledovaných plodin i nadále vysoké. 249

250 Pěstovaná plodina výrazně spoluutváří podmínky pro život jednotlivých druhů plevelů a tím výrazně působí na druhové spektrum a může také přispět k rozšiřování některých druhů plevelů. Monitoring zaplevelení je velmi důležitý pro navržení vhodné regulace plevelů na konkrétní lokalitě. Tam, kde dochází k nadměrnému výskytu určitého druhu, je třeba volit vhodný způsob regulace a také je potřeba klást větší důraz na preventivní opatření, např. střídání plodin, kvalitní zpracování půdy a jiné dostupné opatření. Dalším výrazným faktorem, který působí na zaplevelení je také průběh počasí v jednotlivých letech. Ovšem k vyhodnocení tohoto složitého faktoru by bylo potřeba výsledků z dalších let sledování. Obr. 1 Zastoupení jednotlivých plevelných druhů v pozorovaných plodinách Vysvětlivky zkratek použitých v ordinačním diagramu: Plodiny: Zito oz - žito ozimé, Repka oz - řepka ozimá, Psenice oz - pšenice ozimá Plevele: Agr capi Agrostis capillaris, Ach mill Achillea millefolium, Alo myos Alopecurus myosuroides, Ana arve Anagyllis arvensis, Ant arve Anthemis arvensis, Ape spic Apera spica venti, Aph arve Aphanes arvensis, Ara tha Arabidopsis thaliana, Arr sagi Atriplex sagitatta, Atr patu Atriplex patula, Ave fatu Avena fatua, Bra napus Brassica napus, Bro arve Bromus arvensis, Bun orie Bunias orientalis, Cap bun Capsella bursa-pastoris, Car acan Carduus acanthoides, Car drab Cardaria draba, Cen cyan Centaurea cyanus, Cir arve - Cirsium arvense, Con arve Convolvulus arvensis, Ech crus Echinochloa crus-galli, Ely repe Elytrigia repens, Equ arve Equisetum arvense, Eup heli Euphorbia helioscopia, Fal conv Fallopia convolvulus, Fum offi Fumaria officinalis, Gal apar Galium sarine, Gal parv Galinsoga parviflora, Gal tetr Galeopsis tetrahit, Ger pusi Geranium pusillum, Gle hede Glechoma hederacea, Che hybr Chenopodium hybridum, Lam ampl Lamium amplexicaule, Lam purp Lamium purpureum, Lap comm Lapsana communis, Mal negl Malva neglecta, Mat recu Matricaria recutita, Myo arve Myosotis arvensis, Pap rhoe Papaver rhoes, Pla lanc Plantago lanceolata, Pla majo Plantago major, Poa annu Poa annua, Pol avic Polygonum aviculare, Rap raph Raphanus raphanistrum, Sen vug Senecio vulgaris, Sin arve Sinapis arvensis, Sis offo Sisymbrium officinale, Son arve Sonchus arvensis, Ste medi Stelaria media,tar offi Taraxacum officinale, Thl arve Thlaspi arvense, Tri dubi Trifolium dubium, Tri mari Tripleurospermum maritimum, Ver hede Veronica hederifolia, Ver pers Veronica persica Práce vznikla jako výstup projektu Interní grantové agentury AF MENDELU číslo: TP 9/2012 Inovace pěstitelských postupů v suchem ohrožených oblastech. Použitá literatura Hron., F., Kohout, V. 1986: Polní plevele obecná část. 1. vyd. Praha. Skriptum VŠZ Praha, 168 s. Křen, J., Valtýniová, S. 2008: Czech Agriculture In The Period Of Transformation. Acta Agrophysica, 11(1), p ISSN Ter Braak, C., J., F. Canoco A Fortran program for canonical community ordination by [partial] [detrended] [canonical] correspondence analysis (version 4.0.). Report LWA Agricultural Mathematics Group. Wageningen, Kontaktní adresa: Ing. Jan Winkler, Ph.D., Mendelova univerzita v Brně, Zemědělská 1, Brno, 250

251 SKRINING ANTIFUNGÁLNÍCH VLASTNOSTÍ VYBRANÝCH ROSTLINNÝCH EXTRAKTŮ Screening of antifungal properties of selected plant extracts Žabka M., Pavela R., Sumíková T. Výzkumný ústav rostlinné výroby, v.v.i. Praha-Ruzyně Abstrakt Methanolové extrakty celkem 27 léčivých rostlin byly užity při skríningové studii se zaměřením na testování antifungálních vlastností. Inhibiční efekt byl testován na modelu čtyř vybraných patogenních a toxinogenních houbových druhů: Aspergillus flavus, Aspergillus fumigatus, Fusarium oxysporum a Fusarium verticillioides, v souladu s jejich ekonomickým významem. Možnost užít některé testované rostlinné extrakty jako složku pesticidů na přírodní bázi byla indikována v případě pěti rostlinných druhů. Nejvíce efektivními byly Asarum europaeum, Angostura trifoliata a především Alpinia purpurata. Klíčová slova: Rostlinný extrakt, antifungální aktivita, Patogenní houby, Toxinogenní houby, Botanické fungicidy. Abstract Methanol extracts of twenty seven medicinal plants were used in screening assay for antifungal activity. Growth inhibitory effect was tested against four very important pathogenic and toxinogenic fungal species: Aspergillus flavus, Aspergillus fumigatus, Fusarium oxysporum and Fusarium verticillioides in accordance with their health and economic significance. Possibility to use some of plant extracts as a component of natural pesticide in a future was indicated in the case of five plant species. The most effective were Asarum europaeum, Angostura trifoliata and especially Alpinia purpurata extracts. Keywords: Plant extract, Antifungal activity, Pathogenic fungi, Toxinogenic fungi, Botanical fungicides. Úvod V oblasti produkce hygienicky nezávadných zemědělských komodit jsou mikromycety z rodu Fusarium a Aspergillus největším problémem díky schopnosti produkovat většinu nebezpečných mykotoxinů (Edwards et al. 2002; Niessen 2007; Palumbo et al. 2008). Obecně jsou patogenní houby kontrolovány aplikací syntetických fungicidů. Syntetické fungicidy a jejich rezidua však představují velké riziko díky své vysoké přímé či nepřímé toxicitě (Costa et al. 2008; Nakanishi 2007; Scordino et al. 2008). Posklizňové ošetření produktu při skladování může tak představovat riziko ještě vyšší. (Singh et al. 2009; Dalvie et al. 2006). Krom otázek toxicity a reziduální aktivity pesticidů, lze zmínit i stále častější výskyt méně citlivých či úplně rezistentních populací patogenních hub a to díky mnohdy v historii jednostranné a necitlivé chemizaci. Na rozdíl od jiných škodlivých biogenních vlivů vyvstává u houbových patogenů další rozměr škodlivosti, kterým je produkce toxických a extrémně nebezpečných sekundárních metabolitů (aflatoxiny, trichotheceny, fumonisiny atd.). Tyto nebezpečné metabolity, jejichž toxicita se může porovnávat s toxicitou moderních bojových látek a jejichž biologická aktivita je stále předmětem výzkumu, jsou předmětem dnes již samostatně profilované problematiky (Žabka et al., 2002; 2008). Pokrok v oblasti environmentálně bezpečných fungicidů na bázi rostlinných extraktů nabývá v současnosti na významu. Biologická aktivita těchto extraktů je způsobena a ovlivněna přirozeným obsahem biologicky aktivních látek, zahrnujících např. přirozené terpenoidy, fenoly a alkaloidy, které bývají obecně v rostlinách přítomny (Žabka et al., 2009). Jejich význam stoupá společně s rostoucím uvědomováním si rizik spojených s plošným používáním syntetických pesticidů. 251

252 Materiál a metody Inhibiční vlastnosti testovaných rostlinných extraktů na myceliární růst hub byly testovány pomocí diluční metody. Rostlinné extrakty byly získány z vlastních zdrojů methanolickou extrakcí nasbíraného materiálu. Každý extrakt byl důkladně rozpuštěn v bramboro dextrózovém agaru (PDA) v přesně dané koncentraci 2 mg.ml -1, při teplotě pod 50 C. Kontrolní sada byla připravena přidáním ekvivalentního množství methanolu. Připravené Petriho misky (9 cm) byly sterilně naočkovány pomocí myceliárních disků (0,4 cm) odebraných ze 7 denních povrchových kultur cílových hub. Kultivace probíhala po dobu 7 dní, při teplotě 21 C. Následné srovnání průměru kolonií v porovnání s kontrolními sety bylo převedeno na procentuální vyjádření inhibičního potenciálu. Seznam vybraných rostlinných druhů pro základní skríning je uveden v Tab. 1 včetně původu a výtěžku. Pro extrakci byla použita nadzemní část rostlin. Testované cílové druhy hub spolu s původem izolace jsou uvedeny v Tab. 2. Tab. 1: Rostlinné druhy použité při základním skriningu antifungálních vlastností Druh Sbíraná část výtěžek Původ a místo sběru (%) Acer campestre L. Leaves 9,8 Prague, Czech Republic Acer capillipes Maxim. Leaves 12,5 Prague, Czech Republic Acer platanoides L. Leaves 9,3 Prague, Czech Republic Acinos arvensis (Lam.) Dandy Stem 8,4 Vranov nad Dyjí, Czech Ajuga chamaepitys (L.) Schreber Stem 14,8 Republic Prague, Czech Republic Alpinia purpurata Roots 7,0 Číčenice, Czech Republic Angostura trifoliata Bark 11,7 Číčenice, Czech Republic Asarum europaeum Stem 7,2 Vranov nad Dyjí, Czech Astragalus glycyphyllos L. Roots 5,1 Republic Hodonín, Czech Republic Campanula rotundifolia L. Stem 9,8 Vranov nad Dyjí, Czech Citrus aurantium L. Pericarp 5,6 Republic Číčenice, Czech Republic Citrus bergamia (Risso) Wright & Arn Pericarp 9,1 Číčenice, Czech Republic Filipendula ulmaria (L.) Maxim. Stem 7,8 Prague, Czech Republic Guaiacum officinale Xylem 5,3 Číčenice, Czech Republic Hypericum montanum L. Stem 16,1 Blatnica, Slovak Republic Lavandula angustifolia Mill. Stem 9,4 Prague, Czech Republic Leuzea carthamoides Roots 2,3 Číčenice, Czech Republic Levisticum officinale W. D. J. Koch Roots 5,8 Hodonín, Czech Republic Orlaya grandiflora (L.) Hoffm. Stem 11,4 Prague, Czech Republic Panax ginseng C. A. Mey Roots 8,1 Hodonín, Czech Republic Petasites hybridus L. Rhizome 6,2 Hodonín, Czech Republic Potentilla anserina L. Stem 7,3 Prague, Czech Republic Potentilla fruticosa L. Stem 21,6 Prague, Czech Republic Rumex acetosella L. Stem 4,6 Blatnica, Slovak Republic Salix alba L. Bark 3,5 Číčenice, Czech Republic Stachys sylvatica L. Stem 5,6 Vranov nad Dyjí, Czech Withania somnifera L. Roots 5,2 Republic Hodonín, Czech Republic Tab. 2: Cílové patogenní a toxinogenní druhy hub Houbový druh Status a významnost houby zdroj izolace Aspergillus flavus toxinogenní, kontaminant potravin skladovaná kukuřice Aspergillus fumigatus toxinogenní, lidský patogen, kontaminant skladovaná kukuřice Fusarium oxysporum rostlinný patogen, toxinogen, kontaminant napadená kukuřice Fusarium verticillioides rostlinný patogen, toxinogen, kontaminant napadená kukuřice 252

253 Výsledky a diskuse Výsledky potvrzují, že v rámci testovaných rostlinných extraktů (Tab. 1.) většina prokázala určitý stupeň inhibice radiálního růstu alespoň jednoho houbového patogenního druhu, která však nepřesahovala efektivních 50%. Pro účely studie však bylo finálně označeno jako efektivní a potenciálně využitelných 5 z celkového souboru 27 testovaných rostlinných extraktů, jejichž inhibiční efekt vykazoval hladinu inhibice nad úroveň 50% (Tab. 3). Tyto extrakty byly vybrány pro další výzkum, jehož výsledky budou uplatněny v dalších experimentech. Jako nejvíce zajímavé považujeme extrakty prokazující efektivitu (nad 50%) více než u poloviny cílových houbových patogenních druhů. Takovýto antifungální efekt byl patrný u třech extraktů. Prvním byl extrakt z kůry Angostura trifoliata (angostura trojlistá). Biologická aktivita této původem jihoamerické dřeviny, používané v lidové medicíně, bývá v literatuře spojována nejvíce s obsahem chinolinových alkaloidů jako je např. galipin. Kromě antimikrobiálních účinků bývá též využívána jako antimalarikum. (O'Byrne and Evans, 2008; Rakotoson et al., 1998). Výzkum účinku na vláknité patogenní houby není zatím v literatuře příliš popsán. Zatímco inhibiční aktivita v rámci modelových druhů rodu Fusarium zde byla poměrně vyrovnaná, z obou druhů rodu Aspergillus došlo k účinné inhibici pouze v případě A. fumigatus. Zde se nejspíše jedná o projev rozdílné mezidruhové citlivosti založené na různých morfologických a metabolických vlastnostech. Toto zůstává otázkou pro další experimenty. A flavus se v celém experimentu jevil jako nejméně citlivý patogen. Asarum europeum (kopytník evropský) vykazoval efektivní inhibici na všechny testované patogeny kromě A. flavus. U tohoto rostlinného druhu byl popsán obsah biologicky aktivních fenolických látek jako je asaron, tedy látek strukturálně podobných antifungálnímu eugenolu (Zabka et al., 2009). Z výsledků dále vyplývá, že nejvíce účinným byl extrakt Alpinia purpurata (galgán nachový) a to nejen po stránce hladiny inhibičního efektu na jednotlivé druhy, ale i po stránce šíře spektra inhibovaných patogenních hub, kdy byla efektivní inhibice nad 50% pozorována u všech cílových patogenů. V případě F. oxysporum a A. fumigatus byla u tohoto extraktu pozorována inhibice nad 72 %. Ve spojitosti s výraznými antifungálními vlastnostmi A. purpurata bývají v literatuře nejčastěji uváděny polyfenolické látky jako je flavonoid kumatakenin, který kromě antifungální aktivity vykazuje protizánětlivé účinky a stejně tak například zajímavou aktivitu proti mycobacterium tuberculosis (původce tuberculozy) (Afifi et al., 1991; Villaflores et al., 2010). Tab. 3: Nejefektivnější rostlinné extrakty s inhibicí nad 50% růstu patogena Inhibiční efekt nejúčinnějších rostlinných extraktů na růst patogenů Testovaná rostlina v dávce 2 mg.ml -1 (v %) Aspergillus Aspergillus Fusarium Fusarium flavus fumigatus oxysporum verticillioides Alpinia purpurata 50.86± ± ± ±0.17 Angostura trifoliata 16.67± ± ± ±0.00 Asarum europaeum 42.86± ± ± ±0.00 Guaiacum officinale 5.13± ± ± ±0.05 Leuzea carthamoides 18.75± ± ± ±0.14 Závěr V této práci se z dvaceti sedmi testovaných druhů rostlin podařilo nalézt celkem pět efektivních rostlinných extraktů schopných dostatečně inhibovat růst významných patogenních hub. Z tohoto počtu efektivních extraktů tři prokázaly účinnost na většinu testovaných patogenních druhů. V dalších experimentech se nyní zabýváme hlouběji sledovanou antifungální aktivitou zkoumanou napříč daleko širším spektrem hub. Následné práce by měly směřovat k přímé identifikaci a výzkumu samotných efektivních substancí obsažených v těchto rostlinných extraktech a potenciálnímu vývoji složek komerčních 253

254 ekologicky přijatelných antifungálních preparátů s vysokou účinností na cílové patogeny a vysokou bezpečností pro člověka a ekosystém. Dedikace Tato práce byla financována z následujících zdrojů MZE a ME Seznam použité literatury Afifi, F.U., S. Alkhalil, B.K. Abdulhaq, A. Mahasneh, D.M. Aleisawi, M. Sharaf, L.K. Wong, and P.L. Schiff Antifungal Flavonoids from Varthemia-Iphionoides. Phytotherapy Research 5: Costa LG, Giordano G, Guizzetti M, Vitalone A (2008) Neurotoxicity of pesticides: a brief review. Front Biosci 13: Dalvie D, Smith E, Deese A, Bowlin S (2006) In vitro metabolic activation of thiabendazole via 5-hydroxythiabendazole: Identification of a glutathione conjugate of 5- hydroxythiabendazole. Drug Metab Disposition 34: Edwards SG, O'Callaghan J, Dobson ADW (2002) PCR-based detection and quantification of mycotoxigenic fungi. Mycol Res 106: Nakanishi T (2007) Potential toxicity of organotin compounds via nuclear receptor signaling in mammals. J Health Sci 53:1-9. Niessen L (2007) PCR-based diagnosis and quantification of mycotoxin producing fungi. Int J Food Microbiol 119: O'Byrne, A., and P. Evans Rapid synthesis of the tetrahydroquinoline alkaloids: angustureine, cuspareine and galipinine. Tetrahedron 64: Palumbo JD, O'Keeffe T L, Abbas, HK (2008) Microbial interactions with mycotoxigenic fungi and mycotoxins. Toxin Rev 27: Rakotoson, J.H., N. Fabre, I. Jacquemond-Collet, S. Hannedouche, I. Fouraste, and C. Moulis Alkaloids from Galipea officinalis. Planta Medica 64: Scordino M, Sabatino L, Traulo P, Gagliano G, Gargano M, Panto V, Gambino GL (2008) LC/MS/MS detection of fungicide guazatine residues for quality assessment of commercial citrus fruit. Eur Food Res Technol 227: Singh P, Kumar A, Dubey NK, Gupta R (2009) Essential Oil of Aegle marmelos as a Safe Plant-Based Antimicrobial Against Postharvest Microbial Infestations and Aflatoxin Contamination of Food Commodities. J Food Sci 74: Villaflores, O.B., A.P.G. Macabeo, D. Gehle, K. Krohn, S.G. Franzblau, and A.M. Aguinaldo Phytoconstituents from Alpinia purpurata and their in vitro inhibitory activity against Mycobacterium tuberculosis. Pharmacognosy Magazine 6: Žabka M., Jegorov A. (2002): Návrat houby, jež dala vzniknout jménu trichotheceny, Chemické listy 96: Žabka M. (2008): Less known secondary metabolites of pathogenic fungi: Vědecká příloha časopisu Úroda Aktuální poznatky v pěstování, šlechtění, ochraně rostlin a zpracování produktů, Žabka M., Pavela R., Slezakova L. (2009): Antifungal effect of Pimenta dioica essential oil against dangerous pathogenic and toxinogenic fungi, Industrial Crops and Products 30: Kontaktní adresa: Ing. Martin Žabka, Ph.D. Výzkumný ústav rostlinné výroby, v.v.i. Drnovská 507, Praha6-Ruzyně 254

255 ZAMEZENÍ VODNÍ EROZE PŮDY PŘI VYUŽITÍ MEZIPLODIN Prevention of soil water erosin by utilization of intercrops Badalíková B., Bartlová J. Zemědělský výzkum, spol. s r.o., Troubsko Abstrakt V poloprovozních pokusech v bramborářské výrobní oblasti byla sledována půdoochranná funkce meziplodin současně s různým zpracováním půdy. V průběhu tříletého sledování bylo zjištěno, že půdoochrannou funkci proti vodní erozi nejlépe splnila nevymrzající meziplodina žito svatojánské, která dosahovala nejvyšší pokryvnosti povrchu půdy v jarním období, a to z %. U variant s meziplodinou žito nedocházelo k eroznímu smyvu půdy. Ke smyvu půdy došlo pouze u varianty bez meziplodiny. Byl potvrzen význam meziplodin v protierozní ochraně půdy. Klíčová slova: ochrana půdy, vodní eroze, meziplodiny, smyv půdy Abstract In a pilot experiment established in a potato growing region soil protection function with different soil tillage was studied. During years it was found that soil protection function against water erosion best complied a winter-hardy intercrop ray - Secale cereale L. var. multicaule, METZG. ex ALEF. This intercrop best covered the soil surface in the spring time namely %. In the variants using ray wasn't found the erosive washing away of soil. To soil washing - off got only in variant without intercrops. It was confirmed meaning of intercrops in soil protection from erosion. Key words: soil protection, water erosion, intercrops, soil washing-off Úvod Významnou úlohu v protierozní ochraně hrají meziplodiny především v tom, že se do půdy dodává jejich prostřednictvím snadno rozložitelná organická hmota, ať už kořenovými zbytky či nadzemními částmi rostlin, která stimuluje biologické pochody v půdě (Vach a kol., 2005). Dále plní funkci ochrany půdy před vodní i větrnou erozí svou rozvinutou listovou plochou. Pramanik a kol. (1998) zjistili, že vlivem meziplodin se nejen snížila eroze půdy, ale také tyto plodiny přispěly ke zvýšení obsahu živin v půdě zejména N, P a K. Kořeny meziplodin přispívají k zlepšování fyzikálního stavu půdy a příznivě působí na její strukturní stav. Významnou roli sehrává pěstování meziplodin v ochranných pásech vodních zdrojů, zejména v období, kdy dochází k významným ztrátám živin vyplavováním. Své místo zastávají meziplodiny i jako přerušovače v osevních postupech, zejména s vyšším zastoupením zrnin. Shrneme-li tyto poznatky, tak meziplodiny v rostlinné produkci mají funkci: pokryvnou, zkypřující, výživnou, ozdravující. Cílem řešení ochrany půdy je využití různých meziplodin pro snížení erozního smyvu půdy. Materiál a metody Pro zjištění ochrany půdy proti vodní erozi byl sledován v letech smyv půdy na poloprovozním polním pokusu v bramborářské výrobní oblasti, kde se pohybovala svažitost terénu mezi Ke zhodnocení půdních vlastností pokusné lokality byly sledovány fyzikální i chemické vlastnosti, tzv. index pokryvnosti půdy, který vyjadřuje procento pokryvu půdního povrchu meziplodinami nebo jejich zbytky. Pokryvnost půdy byla zjištěna procenticky po vzejití meziplodiny na podzim spolu s počtem rostlin na m 2 a na jaře, kdy byla posuzována pokryvnost povrchu půdy rostlinnými zbytky vymrzlých rostlin a pokryv půdy nevymrzlou meziplodinou. Pokryvnost půdy byla hodnocena z 10 měření v každém opakování dílce varianty. Ke sledování smyvu půdy byly instalovány speciální záchytné kapsy v šířce 1 m v dolní části svahu a ohraničeny bočnicemi. Délka sledovaného svahu byla 255

256 cca 100 m. Ze smyté půdy byly prováděny analýzy na obsah základních živin dle Melicha III, výměnná půdní reakce ph byla stanovena z výluhu KCl potenciometricky, celkový obsah humusu resp. oxidometrické stanovení půdní organické hmoty bylo provedeno metodou Walkley-Black, modifikací Novák-Pelíšek. Pokusné pozemky se nacházely v bramborářské výrobní oblasti, kde nadmořská výška je 513 m, dlouhodobý úhrn srážek 500 mm, z toho úhrn srážek za vegetační období 395 mm, průměrná roční teplota dosahuje 6,8 0 C. Průběh dešťových srážek během vegetace za sledované období znázorňuje graf 1. Graf 1: Množství srážek během vegetace Půdy na této lokalitě řadíme do hnědých půd lehkých, hlinitopísčitých, s hloubkou ornice 0,20 0,25 m, středně zásobené živinami a půdní reakcí slabě kyselou. Na vybraném stanovišti byly založeny na podzim 3 varianty s meziplodinami a 1 varianta kontrolní bez meziplodiny s klasickým zpracováním půdy: Varianta 1 podmítka, předseťová příprava, setí nevymrzající meziplodiny žito svatojánskétrsnaté (Secale cereale L. var. multicaule METZG. ex ALEF.) na jaře desikace, předseťová příprava, setí kukuřice Varianta 2 podmítka, předseťová příprava, setí nevymrzající meziplodiny žito svatojánskétrsnaté, na jaře desikace, přímé setí kukuřice do zaschlého mulče Varianta 3 podmítka po sklizené předplodině, předseťová příprava, setí vymrzající meziplodiny sléz krmný (Malva verticillata L.) nebo katrán etiopský (Crambe abyssinica Hochst.), na jaře přímé setí kukuřice do vymrzlé předplodiny Varianta 4 kontrola - tradiční zpracování půdy, podmítka, střední orba nebo kypření, na jaře předseťová příprava, setí kukuřice Výsledky a diskuze Ke smyvu půdy došlo opakovaně během vegetačního období v roce 2010 u varianty 4 (kontrolní, bez meziplodiny), jak ukazuje tabulka 2, tedy u varianty, kde bylo procentické hodnocení pokryvnosti půdy nejhorší (tab. 1). Smyv půdy v roce 2010 probíhal opakovaně v důsledku vytvoření erozní rýhy (tab. 2), takže při každých větších dešťových srážkách docházelo k soustředěnému odtoku v této dráze. Začátkem června došlo dokonce k překroční přípustné ztráty půdy, která má limit na těchto půdách 4 t.ha -1, a sice o 5,73 t.ha -1. Celkem v roce 2010 došlo ke smyvu půdy během vegetace v množství 11,54 t.ha -1. V roce 2011 nedošlo ke smyvu půdy u žádné varianty a v roce 2012 došlo ke smyvu opět u varianty 4 kontrolní, v množství 0,25 t.ha -1. Současně se smytou půdou došlo ke ztrátám živin a půdního humusu, což způsobuje degradaci půdy a snížení její produkční schopnosti (tab. 3, 4). 256

257 Statistické hodnocení v tomto případě je zbytečné, neboť ke smyvu půdy došlo pouze u jedné varianty, tudíž průkazně oproti ostatním variantám. Tab. 1: Procentické hodnocení pokryvnosti půdy meziplodinami Nárameč varianta Rok Tab. 2: Smyv půdy v suš. (t.ha -1 ) Nárameč varianta ,54 0 0,25 Tab. 3: Obsah živin ve smyté půdě Nárameč 2010 datum smyvu ph/ KCl P (mg/kg) K (mg/kg) Měřené prvky Mg (mg/kg) Nc (%) C OX (%) Humus (%) , ,180 1,71 2, , ,090 1,02 1, , ,200 1,77 3, , ,180 1,32 2, , ,150 1,66 2,86 Tab. 4: Obsah živin ve smyté půdě Nárameč 2012 datum smyvu ph/ KCl P (mg/kg) K (mg/kg) Měřené prvky Mg (mg/kg) Nc (%) C OX (%) Humus (%) , ,350 2,83 4,88 Jak bylo zjištěno i jinými autory vlivem eroze dochází jak ke kvantitativním změnám, tak i ke změnám vzájemných vztahů mezi jednotlivými fyzikálními vlastnostmi (Dumbrovský, 1992). Z hlediska zpracování půdy je nejdůležitější při pěstování kukuřice udržení dobré půdní struktury, která nám zaručuje ochranu před vodní erozí (Marko, 1996). V grafu 2 jsou znázorněny hodnoty objemové hmotnosti redukované (OHr), což je jedna z nejdůležitějších fyzikálních vlastností půdy ovlivňujících však vody (měřeno v dvouletém intervalu). U varianty s meziplodinou byl zjištěn půdní profil méně utužený oproti variantě bez meziplodiny. S nižší OHr se zvyšovaly hodnoty pórovitosti, což zlepšovalo vsakovací schopnost půdy a vyšší provzdušněnost. Při dlouhodobějším využívání meziplodin v osevních postupech lze očekávat příznivý vliv na výnosy hlavních plodin a na půdní strukturu (Javůrek, Vach, 2009). Mnoha autory byla zjištěna přímá spojitost mezi erozí a hospodařením na půdě (Zhang a kol., 2009). Autoři zjistili, že půdoochranné technologie zpracování půdy snižují riziko eroze až o 63% oproti konvenčnímu zpracování půdy. Je tedy podstatné, aby se v rámci pěstování kukuřice na svahu dodržovaly zásady půdoochranných, protierozních technologií. 257

258 Graf 2: Objemová hmotnost redukovaná v různých hloubkách a u různých variant Nárameč, 2010 a ,70 1,60 1,50 1,40 g.cm -3 1,30 1,20 1, ,00 0,90 0-0,1 0,1-0,2 0,2-0,3 0-0,1 0,1-0,2 0,2-0,3 s meziplodinou bez meziplodiny Závěr Pokryv půdy meziplodinou se projevil pozitivně z hlediska ochrany půdy proti vodní erozi. Výsledky ukázaly, že k největšímu smyvu půdy došlo u varianty orané bez vysetých meziplodin vzhledem k nechráněnému povrchu půdy rostlinnými zbytky meziplodin. Meziplodiny také zaručily nižší utuženost půdy díky lepšímu prokypření kořenovým systémem, což následně vedlo k lepší infiltrační schopnosti půdy. Dedikace Výsledek byl získán za (částečné) institucionální podpory na dlouhodobý koncepční rozvoj výzkumné organizace. Použitá literatura Dumbrovský, M.: Vliv eroze na produkční schopnost půd. Kandidátská disertační práce, VÚMOP Praha-Zbraslav, 1992, 238 s. Javůrek M., Vach M.: Význam meziplodin v pěstebních systémech rostlinné produkce. In CD: Aktuální poznatky v pěstování, šlechtění, ochraně rostlin a zpracování produktů, vědecká příloha časopisu Úroda, 12/2009, s ISSN Marko, F. a kol.: Pestovanie kukurice. VÚRV Piešťany, 1996, 104 s. Pramanik, SC, Sharma, TVRS, Raj, SM, Bandyopadhyay, AK: Studies on soil loss, nutrient recycling and economics of plantation based intercropping systems in Bay Islands. In Journal of the Andaman Science Association. 1998, 14: 1, 1-6, 5 ref. Vach, M., Haberle, J., Javůrek, M., Procházka, J., Procházková, B., Suškevič, M., Neudert, L.: Pěstování meziplodin v různých půdně- klimatických podmínkách České republiky. Praha, ÚZPI, Zeměd. Inform., 2005, 36 s ISBN Zhang J.H., Su Z.A, Nie X.J.: An investigation of soil translocation and erosion by conservation hoeing tillage on steep lands using a magnetic tracer. In: Soil & Tillage research 105, 2009, ISSN Kontaktní adresa: Ing. Barbora Badalíková Zemědělský výzkum, spol. s r.o., Zahradní 1, Troubsko 258

259 VLIV ÚHOROVÉHO HOSPODAŘENÍ NA VODOSTÁLOST PŮDNÍCH AGREGÁTŮ The influence of fallow on water stability of soil aggregate Bartlová J. Zemědělský výzkum, spol. s r. o. Abstrakt V letech byl sledován vliv různého agrotechnického hospodaření na změnu kvality ornice černozemě. Kvalita půdy byla posuzována podle schopnosti půdních agregátů odolávat rozplavení. Byly založeny dvě varianty zpracování půdy - diskování a úhorové hospodaření. Lokalita se nachází poblíž obce Mikulov v kukuřičné výrobní oblasti. Na obhospodařovaném pozemku byl pěstován ječmen ozimý a řepka ozimá. Během dvouletého sledování nebyl prokázán statisticky průkazný rozdíl vodostálosti půdních agregátů mezi úhorovým hospodařením a diskováním. Klíčová slova: černozem, úhor, diskování, vodostálost půdních agregátů Abstract In the years the effect of different agronomy practices on quality changes in topsoil of Chernozem was studied. Soil quality refers to the ability of soil aggregates to resist dispersion. Two soil tillage treatments were established disk tillage and three-field system. The locality is situated in the territory of Mikulov in a maize-growing region. The crops growned on cultivate plot were winter barley and rape. The results obtained over two years of studies of water stability of soil aggregates showed that there were no statistically significant difference between disk tillage and fallow. Key words: chernozem, fallow, disk tillage, water stability of soil aggregate Úvod Soudržnost půdních agregátů ovlivňuje půdní stabilitu a její schopnost vést plyny a kapaliny, což jsou důležité funkce pro pěstování plodin a zdraví celého ekosystému. Protože je stabilita agregátů indikátorem vitálních funkcí půdy, může být využívána k posuzování kvality půd (Seybold a Herrick, 2001). Stabilita půdních agregátů je závislá na půdním typu a druhu, na obsahu organických látek (Javůrek and Vach, 2009), biologické aktivitě půdy (Oades, 2005), hnojení (Anabi et al., 2007) a také na zpracování půdy a vegetačním pokryvu. Při různém zpracování půdy odpovídají rozdíly ve stabilitě agregátů intenzitě lidské činnosti a kultivace půd. Nevhodné využívání půd může vést k rozpadu nestabilních agregátů produkující jemnější a snadněji odnositelné částice a mikroagregáty (Zhang a kol., 2008). Panayiotopulus a Kostopoulou (1989) konstatují, že přírodní půdy mají průkazně vyšší agregátovou stabilitu než půdy kultivované. Kandeler a Murer (1993) sledovali effect dočasného zatravnění ve srovnání s konvenčním zpracováním půdy. Zjistili, že po zatravnění došlo díky vlivu zvýšeného množství mikrobiální biomasy ke zlepšení stability agregátů. Po zornění tohoto zatravnění došlo k rychlému poklesu agregátové stability. Také Kogut a kol. (2012) uvádějí, že vodostálost černozemní struktury závisí na jejím využívání a zhoršuje se v následujícím pořadí: neposečený úhor > pšenice ozimá > permanentní úhor. Jedním z cílů výzkumu bylo zjistit změnu kvality ornice při úhorovém systému hospodaření. Materiál a metodika V roce probíhalo sledování poloprovozního pokusu v katastru obce Mikulov. Lokalita se nachází v kukuřičné výrobní oblasti v nadmořské výšce 350 m na středně těžké černozemi na spraši. Průměrná roční teplota je zde 9,6 C a průměrný roční úhrn srážek je 524 mm. Na lokalitě byly pěstovány plodiny v rámci osevního postupu: v roce 2011 ječmen ozimý (Hordeum vulgare), v roce 2012 řepka ozimá (Brassica napus L.). 259

260 Na sledovaném pozemku byl spolu s obhospodařovanou částí založen úhor, který byl zcela ponechán sukcesi, pouze se 1x ročně provedlo posečení narostlých plevelů. Varianty pokusu: 1. půda bez zpracování (úhor) 2. diskování Vzorky půdy pro stanovení vodostálosti půdních agregátů byly odebírány každý rok vždy na jaře na začátku vegetačního období a na podzim na konci vegetačního období. Odběr byl proveden vždy ze tří hloubek ornice (0-0,10 m, 0,10-0,20 m a 0,20-0,30 m) ze tří odběrných míst. Vodostálost půdních agregátů byla zjišťována metodou mokrého prosévání (Kandeler 1996). Při této metodě se z půdního vzorku vyschlého při laboratorní teplotě oddělí pomocí sít frakce 1-2 mm. Vzorek o hmotnosti 4 g byl promýván na sítech po dobu 5 min. Poté byly vzorky vysušeny při 105 C do konstantní hmotnosti a po vychladnutí v exsikátoru zváženy. Po zvážení je přidán roztok pyrofosforečnanu sodného a vzorky jsou opět promývány, tak aby byly vyplaveny všechny jílovité částice (zůstanou jen písčité částice nad 0,25 mm), vysušeny a zváženy. Navážka půdních agregátů byla provedena ze směsného vzorku ve třech opakováních. Vodostálost půdních agregátů je vyjádřena jako procento stabilních agregátů z celkového množství agregátů po odečtení obsaženého písku podle vzorce: % SAS = ((M2 M3) / W (M3 M1)). 100 % SAS procento stabilních půdních agregátů M1 hmotnost misky (g) M2 hmotnost misky, stabilních agregátů a písku (g) M3 hmotnost misky a písku (g) (M2 M3) hmotnost stabilních agregátů (M3 M1) hmotnost písku W navážka vzorku (g) Data byla statisticky hodnocena více faktorovou analýzou variance a následné testováním jednoduchých kontrastů metodou dle Tukeye (tab.2, 3). Ke statistické analýze byl využit program Statistica 7.1. Výsledky a diskuze V prvním roce sledování byla v obou obdobích zjištěna nejvyšší hodnota vodostálosti půdních agregátů u varianty s diskováním, kromě povrchové vrstvy (0 0,10 m) u varianty s úhorem. Zde došlo v podzimním období ke značnému snížení vodostálosti u varianty s diskováním (tab. 1). Hodnoty vodostálosti dosažené u varianty s úhorovým hospodařením byly celkově nižší (23,36 %), než u varianty s diskováním (26,79 %). V jarním období byly hodnoty vodostálosti celkově vyšší (28,62 %) než v podzimním období (21,52 %). V druhém roce sledování došlo v jarním období v povrchové vrstvě u varianty se zpracováním k poklesu vodostálosti oproti úhorovému hospodaření. Také v podzimním období došlo ve všech hloubkách u varianty bez zpracování ke značnému zvýšení hodnot vodostálosti. Hodnoty vodostálosti dosažené u varianty s úhorovým hospodařením byly celkově vyšší (o 2,41 %), než u varianty s diskováním. V jarním období byly hodnoty vodostálosti celkově nižší (o %) než v podzimním období. 260

261 % Úroda 12/2012, vědecká příloha časopisu Tab. 1: Průměrné hodnoty vodostálosti půdních agregátů (%) v jednotlivých letech rok varianta jaro podzim 0-0,10 m 0,10-0,20 m 0,20-0,30 m 0-0,10 m 0,10-0,20 m 0,20-0,30 m úhor 27,78 25,55 23,81 27,88 19,95 15,17 diskování 36,34 29,23 29,03 18,48 24,88 22,75 úhor 27,26 27,64 25,09 48,69 46,01 43,33 diskování 26,04 35,01 25,58 41,80 38,98 36,17 Výsledky z hodnocení za dvouleté sledování ukázaly, že nejvyšší hodnoty vodostálosti byly dosaženy v podzimním období u varianty s úhorovým hospodařením (graf 1). V jarním období byly zjištěny vyšší hodnoty vodostálostí u varianty s diskováním, v podzimním období u varianty s úhorem. Graf 1: Průměrné hodnoty vodostálosti půdních agregátů (%) v letech Mikulov 45,00 40,00 35,00 30,00 25,00 20,00 15,00 úhor diskování 10,00 5,00 0,00 0-0,10 m 0,10-0,20 m 0,20-0,30 m 0-0,10 m 0,10-0,20 m 0,20-0,30 m jaro podzim Ačkoliv různí autoři (Badalíková a Procházková, 2002; Caravaka a kol., 2004) konstatují, že při vyšší intenzitě zpracování půdy dochází ke snižování množství vodostálých agregátů, v našem pokusu nebyl při celkovém hodnocení zjištěn statisticky průkazný rozdíl mezi variantami (tab. 2, 3). Také Eynard.a kol. (2004) srovnávali stabilitu půdních agregátů na travních porostech a při různých zpracováních půdy, ale nezjistili významné rozdíly. V podzimním období bylo dosaženo statisticky průkazně vyšších hodnot vodostálosti než v jarním období (tab. 2, 3). Podle Hlušičkové a Lhotského (1994) je stabilita půdní struktury ovlivňována mnoha faktory, které se neustále během roku mění. Většinou je stabilita vyšší v pozdním létě a na podzim (díky stimulované činnosti mikroorganismů) a nejnižší bývá v předjaří (nízká teplota, málo lehce rozložitelné hmoty, přesycení půdy vodou, negativní vliv odtékajícího sněhu). Tab. 2: Analýza variance pro stabilitu půdních agregátů (v letech ) Efekt Stupně volnosti PČ Abs. Člen ,49*** Rok ,52*** Období 1 174,33*** Hloubka 2 77,2*** Varianta 1 3,12 n.s. Chyba 33 8,78 *** P = 0,001; **P = 0,01; *P = 0,05; n.s. neprůkazné Tab. 3: Tukeyův HSD test prům. období jaro 28,2 a podzim 32,01 b varianta úhor 29,08 abcd diskování 30,36 abcd Průměrné hodnoty indikované různými písmeny jsou statisticky rozdílné (P = 0,05) 261

262 Závěr Během dvouletého sledování nebyl prokázán statisticky průkazný rozdíl vodostálosti půdních agregátů mezi úhorovým hospodařením a diskováním. V podzimním období bylo u obou variant dosaženo statisticky průkazně vyšších hodnot vodostálosti než v jarním období. Dosažené výsledky naznačují možnost změny kvality ornice při úhorovém systému hospodaření, avšak k projevení významnějších rozdílů je zapotřebí delšího sledování. Dedikace Výsledek byl získán za (částečné) institucionální podpory na dlouhodobý koncepční rozvoj výzkumné organizace. Použitá literatura; Annabi M., Houot S., Francou C., Poitrenaud M., Le Bissonnais Y., 2007 : Soil aggregate stability improvement with urban composts of different maturities. Soil Sci. Soc. Am. J., 71 (2): Badalíková, B., Procházková, B., 2002: Desagregace půdní hmoty vlivem různého hospodaření se slámou. Pedologické dny 2002, Praha, s Cavaraca F., Lax A., Albaladejo J., 2004: Aggregate stability and carbon characteristics of particle-size fractions in cultivated and forested soils of semiarid Spain. Soil and Tillage Research, 78 (1): Eynard A., Schumacher T. E., Lindstrom, M. J., Malo D. D., 2004: Aggregate sizes and stability in cultivated South Dakota prairie ustolls and usterts. Soil Sci. Soc. Am. J. 68: Hlušičková, J., Lhotský, J., 1994: Metodika: Ochrana půdní struktury před technogenní degradací. Ústav zemědělských a potravinářských informací, Praha, 40 str. Javůrek M., Vach M., 2009: Vliv dlouhodobého uplatňování půdoochranné technologie na sekvestraci uhlíku a dusíku a související charakteristiky ve středně těžké půdě typu luvisol. Úroda, scientific attachment of the journal, 12: Kandeler, E., Murer, E., 1993: Aggregate stability and soil microbial processes in a soil with different cultivation. International workshop on methods of research on soil structure/soil biota interrelationships, 56 (1-4): Kogut, B. M., Sysuev, S. A., Kholodov, V. A., 2012: Water stability and labile humic substances of typical chernozems under different land uses. Eurasian soil science, 45 (5): Oades J. M., 2005: Soil organic matter and structural stability: mechanisms and implications for management. Plant and Soil, 76 (1-3): Panayiotopoulos K. P., Kostopoulou S., 1989: Aggregate stability dependence on size, cultivation and various soil constituents in Red Mediterranean soils (Alfisols). Soil Technology, 2 (1): Seybold, C. A., Herrick, J. E., 2001: Aggregate stability kit for soil quality assessments. Catena, 44: Zhang, Z., Wei, C. F., Xie, D. T., Gao, M., Zeng, X. B., 2008: Effects of land use patterns on soil aggregate stability in Sichuan Basin, China. Particuology, 6 (3): Kontaktní adresa: Ing. Bartlová Jaroslava Zemědělský výzkum, spol. s r. o. Zahradní 1, Troubsko 262

263 MONITORING PŮDNÍ RESPIRACE V CHKO ŽĎÁRSKÉ VRCHY V LETECH Monitoring soil respiration The Zdarske Vrchy protected area from 2008 to 2010 Brtnický M. 1, Kučerová J. 1, Kynický J. 2, Janzová A. 2, Pokorný E. 1 1 Mendelova univerzita v Brně, Agronomická fakulta 2 Mendelova univerzita v Brně, Lesnická a dřevařská fakulta Abstrakt V této práci byla sledována půdní respirace v CHKO Žďárské vrchy. Půdní respiraci zde charakterizují bazální respirace a potenciální respirace (fyziologická využitelnost půdního dusíku N:B a poměr G:N, který nám popisuje vzájemný poměr využitelného uhlíku a dusíku v půdě). Sledování probíhalo v letech 2008 až 2010 a týkalo se tří různých porostů (lesní porost, orná půda a trvalý travní porost). Ze zjištěného vyplývá, že bazální respirace dosahovala nejvyšších hodnot na lesních lokalitách a nejnižších na trvalém travním porostu. Fyziologická využitelnost půdního dusíku (N:B) byla u všech lokalit vyrovnaná a pohybovala se okolo hodnoty 1, což značí jeho dostatek. Vyrovnaný vzájemný poměr uhlíku a dusíku (G:N) je roven hodnotě 5 většina sledovaných lokalit vyrovnaný poměr těchto dvou prvků nevykazovala. Klíčová slova: půdní respirace, CHKO Žďárské vrchy Abstract In this work was studied soil respiration in the Zdarske Vrchy protected area. Soil respiration are characterized by basal respiration and potential respiration (Physiological availability of soil nitrogen N:B ratio and G:N, which we describe the ratio of available carbon and nitrogen in the soil). Monitoring was carried out in the years 2008 to 2010 and covered the three different stands (forest vegetation, arable land and permanent grassland). From established that the basal respiration is longest on forest sites and lowest in the meadow. Physiological availability of soil nitrogen (N:B) was balanced in all locations and moved around a value of 1, which indicates its enough. Ratio of available carbon and nitrogen in soil (G:N) is equal to 5 - most of the monitoring sites balanced ratio of these two elements did not show. Key words: Soil respiration, The Zdarske Vrchy protected area Úvod V této práci jsou sledovány vybrané biologické vlastnosti na lokalitách v chráněné krajinné oblasti Žďárské vrchy. Lokality se nacházejí v okrese Žďár nad Sázavou. Vybranými variantami jsou lesní porost, trvalý travní porost (dále jen TTP) a orná půda. Přes polovinu rozlohy CHKO pokrývají kambizemě. Na zvoleném území se vyskytují vedle kambizemí také gleje, pseudogleje a stagnogleje. Půdní biologii reprezentují podzemní části rostlin a edafon, jež se podílejí na vzniku a vývoji kvality/zdraví půdy. Tesařová (1992) řadí k hlavním funkcím živé mikrobní složky půd rozklad širokého spektra organických látek, syntézu humusu, tvorbu půdní struktury, zpřístupnění živin rostlinám, detoxikaci cizorodých látek a produkci biologicky aktivních látek. Společenstvo půdních mikroorganismů pak charakterizuje jako nejreaktivnější složku biotické části ekosystému reagující na mnohé faktory vnějšího prostředí. Respirace půdy je uvolňování CO 2 živými, metabolizujícími komponenty půdy kořeny, půdními živočichy a mikroorganismy. Pokud je však měřena v laboratorních podmínkách u homogenizovaného vzorku, reprezentuje především respiraci půdních mikroorganismů a zahrnuje v sobě jejich 263

264 množství i aktivitu (Úlehlová, 1989). Vybranými vlastnostmi biologických charakteristik je bazální a potenciální respirace. Materiál a metody Oblast CHKO Žďárské vrchy zaujímá severovýchodní kulminační část Českomoravské vrchoviny s centrálním masivem Žďárských vrchů a navazujícími částmi sousedních pahorkatin. Přes polovinu rozlohy CHKO pokrývají kambizemě. Námi vybrané lokality se nacházejí severně od obce Lhotka v horní části povodí potoka Staviště zejména ve třetí zóně CHKO. Malá část zkoumané plochy se nachází v zóně první. Na zvoleném území se vyskytují kambizemě, gleje, pseudogleje a stagnogleje. Sledování probíhalo v letech 2008 až 2010 a týkalo se tří různých porostů (lesní porost, orná půda a trvalý travní porost). Přístroj Vaisala GMT220, který jsme na laboratorní podmínky respirometrického testu (Novák, Apfelthaler, 1964) přizpůsobili (Foukalová, Pokorný 2006; Foukalová, 2011) měřil oxid uhličitý ve čtyřech variantách přidaných látek (destilovaná voda, dusík v podobě síranu amonného, glukóza a dusík s glukózou v poměru 1:1). Byla zde sledována bazální respirace a potenciální respirace (fyziologická využitelnost půdního dusíku N:B je-li v půdě využitelného dusíku dostatek, přídavek dalšího dusíku již respiraci nezvyšuje a hodnota N:B je blízká 1; a poměr G:N dává představu o vzájemném poměru využitelného uhlíku a dusíku v půdě. Při vyrovnaném fyziologickém poměru obou těchto elementů poměr G:N roven přibližně 5. Při nižších hodnotách tohoto koeficientu jsou půdní mikroorganismy z půdního vzorku relativně lépe vyživovány organickými látkami než dusíkem. Při vyšších hodnotách daného koeficientu je tomu naopak. Výsledky a diskuze Vybrané biologické vlastnosti (bazální a potenciální respirace) byly sledovány na lokalitách CHKO Žďárské vrchy. Monitorování probíhalo v letech 2008 až 2010 a týkalo se tří různých porostů (lesní porost, orná půda a trvalý travní porost). Byla zde sledována bazální respirace a potenciální respirace (fyziologická využitelnost půdního dusíku N:B a poměr G:N vzájemný poměr využitelného uhlíku a dusíku v půdě). Obr. 1: Bazální respirace [mg CO g 1.h 1 ] v letech 2008 až 2010 u tří porostů (lesní porost, orná půda a trvalý travní porost) 0,700 0,600 0,500 0,400 0,300 0,200 0,100 Bazální respirace [mg CO g 1.h 1 ] LESNÍ POROST ORNÁ PŮDA TRVALÝ TRAVNÍ POROST 0,000 B jaro08 B léto08 B podzim08 B jaro09 B léto09 B podzim09 B jaro10 B léto10 B podzim10 Bazální respirace měla nejvyšší hodnoty na lokalitách lesního porostu (Obr. 1) Nejnižší hodnoty byly naměřeny na trvalém travním porostu. Společenstvo půdních mikroorganismů 264

265 podílejících se na přeměnách a mineralizaci organické hmoty je závislé především na teplotě, vlhkosti, obsahu snadno rozložitelných látek v půdě a rostlinném pokryvu (Rychnovská, 1993). Petrášová et al. (2009) potvrzuje nižší hodnoty u TTP oproti orné půdě. Ke snížení respirace může dojít i v případě, kdy významná část daného mikrobiálního společenstva není schopna adaptace na stresové podmínky. Mikrobiální aktivita je ve většině půd limitována nedostatkem snadno dostupného uhlíkatého substrátu (Fallih and Wainwright, 1996). Obr. 2: Fyziologická využitelnost půdního dusíku (N:B) v letech 2008 až 2010 u tří porostů (lesní porost, orná půda a trvalý travní porost) 1,600 1,400 1,200 1,000 0,800 0,600 0,400 0,200 N:B LESNÍ POROST ORNÁ PŮDA TRVALÝ TRAVNÍ POROST 0,000 N:B jaro08 N:B léto08 N:B N:B jaro09 N:B léto09 N:B N:B jaro10 N:B léto10 N:B podzim08 podzim09 podzim10 Z Obr. 2 je zřejmá vyrovnanost hodnot využitelného dusíku v půdě, kdy dostatek dusíku vyjadřuje hodnota poměru kolem 1. Tuto hodnotu výrazněji přesahuje pouze lokalita lesního porostu na podzim 2009 a lokality orné půdy z letního termínu 2008 to ukazuje na nedostatek fyziologicky využitelného dusíku u těchto dvou lokalit. Obr. 3: Vzájemný poměr využitelného uhlíku a dusíku v půdě (G:N) v letech 2008 až 2010 u tří porostů (lesní porost, orná půda a trvalý travní porost) 9,000 8,000 7,000 6,000 5,000 4,000 3,000 2,000 1,000 0,000 G:N LESNÍ POROST ORNÁ PŮDA TRVALÝ TRAVNÍ POROST G:N jaro08 G:N léto08 G:N G:N jaro09 G:N léto09 G:N G:N jaro10 G:N léto10 G:N podzim08 podzim09 podzim10 Poměr G:N (Obr. 3) udává představu o vzájemném poměru využitelného uhlíku a dusíku v půdě. Při vyrovnaném fyziologickém poměru obou těchto elementů je poměr G:N roven přibližně 5. Při nižších hodnotách tohoto koeficientu jsou půdní mikroorganismy z půdního vzorku relativně lépe vyživovány organickými látkami než dusíkem a to se týká většiny 265

266 lokalit, kdy nejvýznamněji je tomu u lesního porostu. Při vyšších hodnotách daného koeficientu je tomu naopak půdní mikroorganismy jsou lépe vyživovány dusíkem než organickými látkami a tato situace nastala u lokalit orné půdy. Závěr Na lokalitách CHKO Žďárské vrchy byla sledována bazální respirace a potenciální respirace Sledování probíhalo v letech 2008 až 2010 a týkalo se tří různých porostů (lesní porost, orná půda a trvalý travní porost). Bazální respirace měla nejvyšší hodnoty na lokalitách lesního porostu. Nejnižší hodnoty byly naměřeny na trvalém travním porostu. Ke snížení respirace může dojít v případě, kdy významná část daného mikrobiálního společenstva není schopna adaptace na stresové podmínky. U poměru N:B je zřejmá vyrovnanost hodnot využitelného dusíku v půdě, kdy dostatek dusíku vyjadřuje hodnota poměru kolem 1. Tuto hodnotu výrazněji přesahuje, a tím značí nedostatek dusíku, pouze lokality lesního porostu na podzim 2009 a lokality orné půdy z letního termínu Poměr G:N udává představu o vzájemném poměru využitelného uhlíku a dusíku v půdě. Při vyrovnaném fyziologickém poměru je poměr G:N roven přibližně 5. Při nižších hodnotách tohoto koeficientu jsou půdní mikroorganismy z půdního vzorku relativně lépe vyživovány organickými látkami než dusíkem to se týká většiny lokalit, nejvíce lesního porostu. Při vyšších hodnotách daného koeficientu je tomu naopak půdní mikroorganismy jsou lépe vyživovány dusíkem než organickými látkami a tato situace nastala u lokalit orné půdy. Dedikace Poděkování: Příspěvek byl zpracován s podporou Výzkumného záměru č. MSM uděleného Ministerstvem školství, mládeže a tělovýchovy České republiky a projektů NAZV QI91C054 a QJ udělených MZe ČR. Použitá literatura Fallih A.B.K.& Wainwright M., Microbial and enzyme activity in soils amended with natural source of easily available carbon, Biology and Fertility of Soils 21: Foukalová J., Pokorný E., 2006: Agroekologické limity vybraných biologických vlastností ornic černosolů v oblasti střední Moravy In: Mendelnet 06 Agro, Mendelova zemědělská a lesnická univerzita v Brně, s ISBN Foukalová J., 2011: Agroekologické limity vybraných biologických vlastností ornic černozemí v oblasti Moravy. Disertační práce. Mendelova univerzita v Brně, 2011 Novák B., Apfelthaler R. 1964: Příspěvek k metodice stanovení respirace jako indikátoru mikrobiologických pochodů. Rostlinná výroba, ročník 10, č. 2: Petrášová V., Pospíšilová L., Pokorný E.: Biological and chemical properties of eutric cambisol In: Mendelnet 09 Agro, Mendelova univerzita v Brně, 1-6. Rychnovská M. (ed.) Structure and functioning of seminatural meadows. Academia, Praha. Tesařová M. 1992: Biomasa mikroorganismů v půdě In Metody stanovení mikrobní biomasy v půdě sborník referátů ze semináře, ÚPB ČSAV České Budějovice Úlehlová B. 1989: Nitrogen Cycle in Grass Ecosystems. Academia, Praha: Kontaktní adresa: Ing. Martin Brtnický Agronomická fakulta Mendelova univerzita v Brně, Zemědělská 1, Brno 266

267 TECHNIKY ZPRACOVÁNÍ PŮDY A JEJÍ VLIV NA ZHUTNĚNÍ Soil Treatment Equipment And Its Influence On Compaction Červinka J., Pospíšil J., Svoboda M. Mendelova univerzita v Brně Abstrakt Na stanovišti v Lesonicích byly sledovány v letech možnosti různé intenzity zpracování půdy při zakládaní porostů. Byly hodnoceny tři různé varianty (orba, mělké kypření, hluboké kypření) a byl posouzen jejich vliv na penetrometrický odpor, který je indikátorem zhutnění půdy. Z výsledků vyplynulo, že varianty kypřením mají menší náchylnost ke zhutnění, mají vyšší pórovitost a jsou schopny zadržet více vláhy. Klíčová slova: půda, penetrační odpor, objemová hmotnost, zhutnění Abstract The aim of study was monitored different options of the soil tillage during plantation establishment in the habitat Lesonice since years 2008 till There were evaluated three diffrent variants (ploughing, shallow loosening and deep loosening) and were assess their effect on the penetration resistence, which is an indicator of soil compaction. The results showed that the variants with the loosening are prone to compaction less, have higher porosity and are able to hold more moisture. Keywords: soil, penetration resistance, porosity, bulk density, compaction Úvod Zemědělské technika ovlivňuje zhutnění půdy zejména působením podvozků na půdu prostřednictvím pneumatiky nebo pásu. Odvalující se pneumatika způsobí deformací plastického podloží. Lhotský (2000) uvádí, že zhutněním dochází k poškozování půdní struktury, k růstu objemové hmotnosti půdy a tím k poklesu její pórovitosti. Z hlediska intenzity zhutnění je rozhodující kontaktní tlak pneumatiky na půdu, který je dán napětím mezi půdou a pneumatikou, které působí kolmo na povrch půdy v ploše otisku. Grečenko (1994) uvádí, že se vzrůstajícím tlakem huštění u stejně zatížené pneumatiky roste i tlak na půdu. Při zvětšené vlhkosti půdy se zatížení přenáší až do podloží, kde způsobuje trvalé deformace. Použití moderních pneumatik a možnosti proměnlivého huštění je jednou z technických řešení snižování technogenního utužení. Další cestou je uplatnění moderních pěstebních technologií, které ovlivňuji strukturu půd danou stupněm zpracování a počtem pojezdů po půdě (Javůrek, 2008). Materiál a metody V rámci výzkumného projektu byl sledován vliv různých způsobů zpracování půdy na penetrometrický odpor půdy ve vybraných lokalitách České republiky, v tomto příspěvku konkrétně v Lesonicích - zemědělská výrobní podoblast B3. Při měření byly také zjišťovány objemová hmotnost redukovaná, celková pórovitost a vlhkost půdy. Byly sledovány varianty zpracování půdy s orbou do hloubky 220 mm var. 1, mělké kypření do hloubky 150 mm var. 2 a hluboké kypření do hloubky 350 mm var. 3. Penetrometrický odpor (odpor vniknutí kužele do půdy) byl měřen přístrojem PM 10 pro hloubky mm v intervalu po 40 mm. Měření se provádělo u každé varianty v jarním a podzimním období v pěti opakováních. Výsledky sledování byly statisticky zpracovány analýzou rozptylu v programu STATISTICA 267

268 CZ. Výsledky sledování v letech na lokalitě Lesonice jsou uvedeny v grafické podobě v grafech 1 4. Výsledky a diskuze Zhutnění orniční vrstvy, především podloží, omezuje růst kořenů a snižuje prosakování vody. Úrodnost půdy je snížena vlivem omezeného pronikání vzduchu (snížením pórovitosti). Zhutnění se ve svém důsledku projevuje zvýšením redukované objemové hmotnosti a tím zvýšení penetračního odporu půdy. V grafu 1 je vidět, že v jednotlivých letech je penetrometrický odpor největší u varianty 3 - minimalizace, v letech se pohyboval v intervalu od 2,9 3,4 MPa, což je podle Arshalda et. al. (1996) vysoký odpor (Arshald uvádí 2 4 MPa), podle Lhotskejho (2000) je u hlinité půdy hranice zhutnění 3,7 4,2 MPa což tato varianta nedosahuje. Srovnáme-li varianty jarního a podzimního měření (graf 1 a 2) vidíme, že v roce 2009 dosahovaly všechny varianty extremních hodnot, které byly ovlivněny suchem v dané lokalitě. V podzimním měření viz graf 2, se ukazuje, že v roce 2010 a 2011 se varianty 3 a 1 vyrovnaly a z hlediska penetrometrického odporu nebyly výrazné rozdíly. Na grafu 3 je průměrná hodnota penetrometrického odporu v jednotlivých hloubkách u jednotlivých variant. Vezmeme-li referenční hloubku h= 280 mm, tak u orby var. 1 je v této hloubce rozpětí odporu od 1,9 3,4 MPa, varianty 2 a 3 nepřesáhly hodnotu 3,1 MPa. Graf 1. Průměrný penetrometrický odpor v letech (jaro) 4,0 Průměrný penetrometrický odpor - Lesonice (jarní měření) 3,8 3,6 3,4 3,2 3,0 MPa 2,8 2,6 2,4 2,2 2,0 1,8 1, rok v arianta: orba v arianta: podrýv ání v arianta: minimalizace 268

269 Graf 2. Průměrný penetrometrický odpor v letech (podzim) 7 Průměrný penetrometrický odpor - Lesonice (podzimní měření) MPa rok varianta: orba varianta: podrývání varianta: minimalizace Graf 3. Průměrný penetrometrický odpor v jednotlivých hloubkách a variantách Průměrný penetrometrický odpor - Lesonice (v letech , za jarní i podzimní měření) 5,5 5,0 4,5 4,0 3,5 [MPa] 3,0 2,5 2,0 1,5 1,0 0,5 orba podrývání minimalizace varianta hloubka 80 hloubka 120 hloubka 160 hloubka 200 hloubka 240 hloubka 280 hloubka 320 hloubka 360 hloubka 400 hloubka 440 hloubka 480 hloubka

270 Penetrometrický odpor půdy byl korigován podle vlhkosti půdy zjištěné v době měření odporu (tab. 1). Tab. 1 Průměrné hodnoty momentálního objemu vody (%obj.) při různém zpracování půdy, Lesonice var. 1 20,41 20,57 25,87 25,44 var. 2 22,57 23,78 27,88 27,08 var. 3 21,12 23,85 27,92 27,22 Závěr Pro technogenní zhutnění jsou rozhodující limitní hodnoty penetrometrického odporu a kontaktních tlaků. Limitní hodnoty penetrometrického odporu závisí na druhu půdy. Výsledky čtyřletého sledování ukázaly závislosti na měnících se klimatických podmínkách. Přesto varianta s podrýváním a varianta s minimalizací může úspěšně nahradit orbu, aniž by z hlediska penetrometrického odporu došlo k výraznému navýšení hodnot a tím v k výraznému zhoršení podmínek pro růst a pěstování rostlin. Hranice 1 MPa je odstranitelná následnou agrotechnikou. Zhutnění větší a do větších hloubek musíme odstranit samostatnou operací kypření a provzdušnění půdy hloubkovým kypřičem. Uvedené výsledky prokázaly nutnost posuzování zhutnění půdy vždy z několika úhlů. Kromě penetrometrického odporu a objemové hmotnosti je nutno sledovat obsah vody, a to vše konfrontovat s výnosy plodiny. Také organická hmota u těchto variant působí pozitivně na půdní vlhkost a na zhutnění. Nahrazení orby zpracováním půdy bez převracení skývy (podrýváním, kypřením) nesmí ale snížit výslednou kvalitu sklízeného produktu a nesmí snížit půdní úrodnost. Dedikace Příspěvek vznikl na základě řešení projektu MZe ČR NAZV č. QH Stanovení stupně degradačních změn v půdě vlivem antropogenní činnosti v souvislosti s pěstováním plodin řešený na Mendelově univerzitě v Brně a na ZV s.r.o. Troubsko. Přehled literatury Arshad, M. A., Lowery, B., Grossman, B., 1996: Physical tests formonitoring soil quality. In: Doran, W., Jones, J. (Eds.), Methods for Assessing Soil Quality, Madison, WI, Soil Sci. Soc.Am. 49, Grečenko,A. (1994). Vlastnosti terénních vozidel, ES VŠZ Praha, 1994, 183s. Javůrek.M.,Vach, (2008): negativní vliv zhutnění půd a soustava opatření k jejich odstranění. Metodika pro praxi, VURV, v, vi., 24s. ISBN Lhotský,J.(2000): Zhutnění půd a opatření proti němu. Studijní zpráva UZPI Praha, 61s. Kontaktní adresa: doc. Ing. Jan Červinka, CSc. Ústav zemědělské, potravinářské a evironmentální techniky AF, Mendelova univerzita v Brně Zemědělská 1, Brno 270

271 HODNOCENÍ GENETICKÉ VARIABILITY AUTOCHTONNÍCH POPULACÍ JILMU Evaluation of genetic diversity of autochthonous elm populations Dědouchová M. 1, Kubátová B. 1, Cvrčková H. 2, Máchová P. 2, Vortelová L. 2 1 Jihočeská univerzita v Českých Budějovicích 2 Výzkumný ústav lesního hospodářství a myslivosti, v.v.i., Jíloviště Abstrakt Příspěvek se zabývá posouzením mezipopulační a vnitropopulační diverzity u autochtonních populací jilmu, přičemž úkolem je najít zdroje genetické diverzity, které by poskytly materiál vhodný pro doplnění stávající genové banky explantátů uchovávané VÚLHM ve Strnadech. Práce si uvědomuje důležitost detekce genetické variability, která je předpokladem pro schopnost druhu reagovat na pozměněné životní podmínky a zachovat tak svou existenci, a ke stanovení její úrovně využívá v ČR pro tyto účely dosud opomíjených metod molekulární biologie. Jako nástroje pro zjištění genetické struktury vybraných populací jilmu byla využita metoda AFLP (amplified fragment length polymorphism). Výsledky získané s využitím vybraných AFLP markerů ukazují na vhodnost tohoto přístupu k hodnocení genetické diverzity populací jilmu, a to až na úrovni vnitropopulační. Klíčová slova: jilm, Ulmus, genetická diverzita, AFLP markery, populace Abstract Interpopulation and intrapopulation diversity in autochthonous elm populations was examined. The task was to find the source of genetic diversity, which would provide material to supplement existing gene bank explants kept by VÚLHM in Strnady. This work recognizes the importance of characterization of genetic variability, which is a prerequisite for the ability of species to respond to the changing environment and to preserve its existence, and for the purpose to determine the level of variability it uses in the Czech republic still neglected techniques of molecular biology. To determine the genetic structure of selected populations AFLP (amplified fragment length polymorphism) method was used. Obtained results indicate the suitability of this approach for the evaluation of genetic diversity of the elm populations. Key words: elm, Ulmus, genetic variability, AFLP markers, population Úvod Jilmy představují skupinu dřevin rostoucích v mírném podnebném pásmu, ceněnou jednak jako zdroj dřeva vysoké kvality a dále jako významný krajinotvorný prvek. Z důvodu dobré snášenlivosti stresových podmínek prostředí jako jsou znečištěné ovzduší, zasolení půd, sucho a záplavy se jilm výborně hodí do městských výsadeb a díky bohaté kořenové soustavě se řadí mezi meliorační a zpevňující dřeviny. Ačkoli byly od 30. let minulého století autochtonní populace jilmu na našem území zdecimovány houbovým onemocněním zvaným grafióza, jsou u nás jilmy dřevinami původními a v lesních společenstvech vždy představovaly významnou složku biocenologické rovnováhy. Po ataku grafiózy z území České republiky téměř vymizel jilm habrolistý (Ulmus minor), v hojnějším počtu je zachován jilm vaz (Ulmus laevis) a dosud nejpočetněji zastoupeným jilmem je jilm horský (Ulmus glabra). Pokud uvažujeme o záchraně jilmu na našem území, pak zásadní význam pro prognózu budoucího osudu zbytkových populací má zjištění stávajícího rozsahu genetické diverzity. Právě g