Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA"


1 Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné postupy, předcházející diagnostice (izolace a uchovávání nukleových kyselin). 2) Směrnice nezahrnují indikace pro molekulárně genetickou analýzu jaderně-kódovaných genů vedoucích k mitochondriálním onemocněním. Ve většině případů jsou tyto geny analyzovány až na základě biochemického (stanovení množství a funkce OXPHOS) nebo molekulárně-genetického (mtdna delece, deplece) vyšetření. Mitochondrie a mitochondriální DNA Mitochondriální onemocnění přes svou klinickou a genetickou heterogenitu jsou charakterizovány poruchami funkce komplexů dýchacího řetězce, respektive systému oxidativní fosforylace (OXPHOS)[1]. Systém OXPHOS je lokalizován ve vnitřní mitochondriální membráně. Jeho 5 enzymových komplexů je tvořeno z více než 80 podjednotek, velká většina z nich je kódována jadernou DNA a do mitochondrií importována. 13 klíčových podjednotek komplexů OXPHOS je kódováno mitochondriální DNA (mtdna), jedinou nechromozomální DNA přítomnou v lidských buňkách[2]. MtDNA je malá (16,5 kb) cirkulární molekula, v buňkách je přítomna v tisíci kopiích a vykazuje maternální dědičnost. Proteiny zodpovědné za údržbu, replikaci a expresi mtdna jsou kódovány jaderně, defekt ve kterémkoliv z nich může vést k mitochondriálnímu onemocnění[3, 4]. MtDNA heteroplazmie, threshold a segregace Přítomnost tisíců molekul mtdna v buňkách hraje důležitou roli v projevu patogenních mtdna mutací na úrovni fenotypu, jak biochemického, tak i klinického. Homoplazmie je stav, kdy jsou všechny molekuly mtdna v buňce identické. Naproti tomu, většina pacientů nesoucích patogenní mutaci v mtdna mají ve svých buňkách směs mutovaných a nemutovaných (normálních) molekul mtdna, stav označovaný jako heteroplazmie. K projevům heteroplazmické mutace dojde tehdy, pokud množství mutovaných molekul mtdna v buňce přesáhne určitou prahovou hodnotu (threshold). V průběhu buněčného dělení jsou mutované a normální molekuly mtdna pravděpodobně rozděleny náhodně do dceřiných buněk. Náhodná segregace vede k různým hladinám heteroplazmie mezi jednotlivými buňkami, tkáněmi a jednotlivci, což následně ovlivňuje fenotypové projevy mitochondriální onemocnění a jeho dědičnost. V post-mitotických tkáních (např. kosterní sval, bývá často i klinicky postižený) dochází k akumulaci mutovaných molekul mtdna (vyšší hladina heteroplazmie), proto je DNA z těchto tkání preferována pro diagnostiku některých mutací v mtdna, ačkoli řadu mutací lze spolehlivě detekovat i v krvi. Klinické projevy onemocnění způsobených mutacemi mtdna Přestože mitochondriální onemocnění představují klinicky heterogenní skupinu onemocnění, existuje řada dobře definovaných mitochondriálních Strana 1 (celkem 8)

2 syndromů charakterizovaných konkrétními klinickými projevy. Mezi nejznámější syndromy patří chronická progresivní externí oftalmoplegie (CPEO), Kearns-Sayreův syndrom (KSS) externí oftalmoplegie, ptóza a rozsáhlé přestavby mtdna (jednoduché nebo násobné). Mitochondriální encefalomyopatie s laktátovou acidózou a iktu podobnými příhodami (MELAS syndrom), myoklonická epilepsie s ragged-red svalovými vlákny (MERRF syndrom) a neurogenní svalová slabost, ataxie a retinitispigmentosa (NARP syndrom) jsou spojovány s bodovými mutacemi v mtdna (3243A>G, 8344A>G a 8993T>G,C). Dalším častým mitochondriálním onemocněním, diagnostikovaným obvykle oftalmology, je Leberova hereditární optická neuropatie (LHON syndrom) je způsobena bodovými mutacemi v mtdna (3460G>A, 11778G>A nebo 14484T>C). Laboratorní diagnostika mitochondriálních onemocnění Stanovení diagnózy mitochondriálního onemocnění vyžaduje kombinaci informací z řady vyšetření. Vedle klinických údajů jsou to výsledky specifických analýz: histochemické vyšetření svalové biopsie, biochemické stanovení aktivit komplexů dýchacího řetězce a jejich složení a molekulárně-genetické vyšetření. V ideálním případě by klinická, biochemická a histochemická data měla nasměrovat molekulárně genetické vyšetření, ať už zahrnující analýzu mtdna nebo genů lokalizovaných na jaderné DNA. Výše uvedené mutace v mtdna jsou však vyšetřovány často jako první bez ohledu na výsledky biochemických vyšetření jenom na základě klinických projevů, screeningově jsou tyto mutace vyšetřovány v krvi. Diagnostika Pozn.: Jsou uvedeny metody, které jsou rutinně používány v Laboratoři pro studium mitochondriálních poruch, KDDL 1.LF UK a VFN v Praze. Sekvenování mtdna není popsáno neboť nepatří mezi rutinní vyšetření, je indikováno až po detailním biochemickém vyšetření a vyloučení častých mutací v mtdna. Přestože i pro diagnostiku mutací v mtdna jsou zaváděny nové metody, uvedené postupy jsou stále používány v bežném screeningu v řadě evropských laboratoří. Mutace 3243A>G v mtdna Tkáň vhodná k zachycení mutace: krev(*), močový sediment(**), sval(***) OMIM: * (klinické projevy spojené s mutací), #54000 (syndrom MELAS další mutace, nebývají součástí screeningu) Metoda: PCR-RFLP Amplifikace úseku mtdna od 3135 do Sekvence primerů: F 5 AGGACAAGAGAAATAAGGC 3 R 5 TAGAAGAGCGATGGTGAGAG 3 Podmínky PCR reakce: 30 x (95 C 10 sec, 58 C 15 sec, 72 C 45 sec), konečná elongace 72 C 5 min. PCR produkt o délce 428 bp je štěpen restrikčním enzymem ApaI. Jeli mutace přítomna, dojde k rozštěpení části (heteroplazmie) PCR produktu na fragmenty o délce 308 a 120 bp. Produkty jsou rozděleny ve 2,5% agarózovém gelu, obarveny etidiumbromidem a Strana 2 (celkem 8)

3 vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě pozitivního nálezu je stanovena hladina heteroplazmie (množství mutovaných mtdna molekul). Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). Následuje restrikce enzymem ApaI a separace restrikčních fragmentů na 8% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita rozštěpených fragmentů k intenzitě nerozštěpeného produktu. Na gelu je vždy přítomna pozitivní i negativní kontrola. Pozn. Radioaktivní značení je v některých laboratořích nahrazováno fluorescenčním a restrikční fragmenty jsou separovány kapilární elektroforézou a detekovány laserem. Od jara 2009 je v Laboratoři pro studium mitochondriálních poruch nově záváděna metoda detekce heteroplazmické mutace 3243A>G pomocí real-time PCR s využitím TaqMan sond. Interpretace: V případě pozitivního nálezu je vždy uvedena hladina heteroplazmie ve vyšetřované tkáni. K prognóze onemocnění však nemůže být použita, doposud nebyla jednoznačně prokázána souvislost mezi hladinou heteroplazmie v jednotlivých tkáních a závažností klinických projevů. Mutace 8344A>G Tkáň vhodná k zachycení mutace: krev(**), sval(***) OMIM: * (klinické projevy spojené s mutací), # (syndrom MERRF) Metoda: PCR-RFLP Amplifikace úseku mtdna od 8278 bp do 8385 bp. Sekvence primerů: F 5 CTACCCCCTCTAGAGCCCAC 3 R 5 GTAGTATTTAGTTGGGGCATTTCACTGTAAAGC * C * GTGTTGG 3 Podmínky PCR reakce: počáteční denaturace 95 C 2 min, 30 x (94 C 20 sec, 62 C 15 sec, 72 C 20 sec), konečná elongace 72 C 5 min. PCR produkt o délce 108 bp je štěpen restrikčním enzymem BglI. Je-li mutace přítomna, dojde k rozštěpení části (heteroplazmie) PCR produktu na fragmenty o délce 73 a 35 bp. Restrikční fragmenty jsou separovány v 3,5% agarózovém gelu, obarveny etidiumbromidem a vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě pozitivního nálezu je stanovena hladina heteroplazmie (množství mutovaných mtdna molekul). Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). Následuje restrikce enzymem BglI a separace restrikčních fragmentů na 10% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita rozštěpených Strana 3 (celkem 8)

4 fragmentů k intenzitě nerozštěpeného produktu. Na gelu je vždy přítomna pozitivní i negativní kontrola. Interpretace: V případě pozitivního nálezu je vždy uvedena hladina heteroplazmie ve vyšetřované tkáni. K prognóze onemocnění však nemůže být použita, doposud nebyla jednoznačně prokázána souvislost mezi hladinou heteroplazmie v jednotlivých tkáních a závažností klinických projevů. Mutace 8993T>G,C Tkáň vhodná k zachycení mutace: krev(***), sval(***) OMIM: * (klinické projevy spojené s mutací), # (syndrom NARP) Metoda: PCR-RFLP Amplifikace úseku mtdna od 8798 bp do 9086 bp. Sekvence primerů: F 5 CATTTACACCAACCACCCAAC 3 R 5 GGAAGGTTAATGGTTGATATTGC 3. Podmínky PCR reakce: počáteční denaturace 95 C 2 min, 29 x (95 C 30 sec, 58 C 20 sec, 72 C 40 sec), konečná elongace 72 C 2 min. PCR produkt o velikosti 289 bp je štěpen restrikčním enzymem HpaII. Je-li přítomna mutace (G nebo C), dojde k rozštěpení většiny (bývá vysoká hladina heteroplazmie) PCR produktu na fragmenty o velikosti 194 a 95 bp. Pro rozlišení o jakou variantu mutace se jedná (G nebo C), je PCR produkt štěpen restrikčním enzymem AvaI. Je-li přítomna varianta G, dojde k rozštěpení PCR produktu na fragmenty o velikosti 193 a 96 bp. Variantu C enzym AvaI neštěpí. Restrikční fragmenty jsou separovány na 3,5% agaróze, obarveny etidiumbromidem a vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě pozitivního nálezu je stanovena hladina heteroplazmie (množství mutovaných mtdna molekul). Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). Následuje restrikce enzymem HpaII a separace restrikčních fragmentů na 10% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita rozštěpených fragmentů k intenzitě nerozštěpeného produktu. Na gelu je vždy přítomna pozitivní i negativní kontrola. Interpretace: V případě pozitivního nálezu je vždy uvedena hladina heteroplazmie ve vyšetřované tkáni. Hladina heteroplazmie bývá většinou velmi vysoká i v DNA izolované z krve, byla pozorována korelace mezi hladinou heteroplazmie a závažností klinických projevů onemocnění Strana 4 (celkem 8)

5 Mutace 3460G>A, 11778G>A a 14484T>C Leberova hereditární optická neuropatie Tkáň vhodná k zachycení mutace: krev(***) OMIM: # (syndrom LHON, vyšetřují se pouze 3 nejčastější mutace) Metoda: PCR-RFLP Mutace 3460G>A: Amplifikace mtdna v úseku od 3130 do 3557 bp. Sekvence primerů F 5 AGGACAAGAGAAATAAGGC 3 R 5 TAGAAGAGCGATGGTGAGAG 3. Podmínky PCR reakce: 29x(95 C 10 sec, 58 C 15 sec, 72 C 30 sec), konečná elongace 72 C 5 min. PCR produkt o délce 428 bp je štěpen restrikčním enzymem BsaHI. Je-li mutace přítomna, PCR produkt se neštěpí. V nepřítomnosti mutace dochází k jeho rozštěpení na fragmenty o velikosti 329 a 99 bp. Produkty jsou rozděleny ve 2,5% agarózovém gelu, obarveny etidiumbromidem a vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě pozitivního nálezu je stanovena hladina heteroplazmie (množství mutovaných mtdna molekul). Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). Následuje restrikce enzymem BsaHI a separace restrikčních fragmentů na 8% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita nerozštěpeného produktu k intenzitě rozštěpených fragmentů. Na gelu je vždy přítomna pozitivní i negativní kontrola. Mutace 11778G>A: Amplifikace oblasti mtdna od do bp. Sekvence primerů: F 5 GCTTCACCGGCGCAGTCATTCTC 3 R 5 AGCGAGGCTTGCTAGAAGTCATC 3. Podmínky PCR reakce: počáteční denaturace 95 C 2 min, 33x(95 C 15 sec, 66 C 25 sec, 72 C 15 sec), konečná elongace 72 C 5 min. PCR produkt o délce 174 bp je štěpen restrikčním enzymem MaeIII. Je-li mutace přítomna, PCR produkt se rozštěpí na fragmenty o velikosti 94 bp a 80 bp. V nepřítomnosti mutace se PCR produkt neštěpí. Produkty jsou rozděleny ve 3,5% agarózovém gelu, obarveny etidiumbromidem a vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě nálezu mutace je stanovena hladina heteroplazmie. K jejímu stanovení se využívá restrikčního enzymu AciI, protože enzym MaeIII neštěpí úplně všechny mutované molekuly mtdna. Amplifikace mtdna v oblasti od do bp. Sekvence primerů: F 5 CTCAAACTACGAACGCACTCACAGC * C 3 R 5 AGCGAGGCTTGCTAGAAGTCATC Strana 5 (celkem 8)

6 Podmínky PCR reakce: počáteční denaturace 95 C 2 min, 33x(95 C 15 sec, 66 C 25 sec, 72 C 15 sec), konečná elongace 72 C 5 min. Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). PCR produkt o délce 104 bp je štěpen restrikčním enzymem AciI. Je-li mutace přítomna, PCR produkt se neštěpí. V nepřítomnosti mutace dochází k jeho rozštěpení na fragmenty o velikosti 78 a 26 bp. Restrikční fragmenty jsou separovány na 10% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita nerozštěpeného produktu k intenzitě rozštěpených fragmentů. Na gelu je vždy přítomna pozitivní i negativní kontrola. Mutace 14484T>C: Amplifikace mtdna v úseku od do bp. Sekvence primerů: F 5 ATCCTCCCGAATCAACCCTGA 3 R 5 TTTTTTTAATTTATTTAGGGGGC * C * TG 3 Podmínky PCR reakce: 29x(95 C 10 sec, 45 C 15 sec, 72 C 30 sec), konečná elongace 72 C 5 min. PCR produkt o délce 250 bp je štěpen restrikčním enzymem MvaI. Jeli mutace přítomna, dojde k rozštěpení části (heteroplazmie) PCR produktu na fragmenty o délce 235 bp a 15 bp. Restrikční fragmenty jsou separovány v 3,5% agarózovém gelu, obarveny etidiumbromidem a vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě pozitivního nálezu je stanovena hladina heteroplazmie (množství mutovaných mtdna molekul). Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). Následuje restrikce enzymem MvaI a separace restrikčních fragmentů na 10% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita rozštěpených fragmentů k intenzitě nerozštěpeného produktu. Na gelu je vždy přítomna pozitivní i negativní kontrola. Interpretace: V případě pozitivního nálezu je vždy uvedena nalezená mutace a hladina její heteroplazmie ve vyšetřované tkáni. Mutace bývají většinou homoplazmické i v krvi. Detekce nejčastějších mutací pro syndrom LHON je problematická, její nález je dobré ověřit další nezávislou metodou. Od jara 2009 je v Laboratoři pro studium mitochondriálních poruch nově záváděna metoda detekce heteroplazmické mutace 11778G>A pomocí real-time PCR s využitím TaqMan sond Strana 6 (celkem 8)

7 Rozsáhlé delece v mtdna Tkáň vhodná k zachycení delece: sval (***), močový sediment (**pouze LX-PCR), krev (*pouze LX-PCR, nemusí být přítomny delece u všech pacientů s mtdna delecemi) OMIM: # (syndrom Kearns-Sayre), # (Pearsonův syndrom), #157640, #609286, #603041, * (progresivní externí oftalmoplegie) Metoda: Southern blot Celková DNA je štěpena restrikčním enzymem PvuII nebo BamHI, což vede k její linearizaci. Po elektroforetické separaci na 0,8% agaróze je přenesena na nylonovou membránu a hybridizována se sondou specifickou ke kontrolní oblasti mtdna (často je používaná i sonda specifická pro celou molekulu mtdna). Značení sondy pomocí [α 32 P]dCTP probíhá v průběhu PCR reakce. Na membráně je vždy přítomna pozitivní a negativní kontrola. Jsou-li ve vyšetřovaném vzorku přítomny deletované molekuly mtdna, na membráně je patrno více signálů pro daný vzorek. Množství deletovaných molekul mtdna se udává jako podíl intenzity signálu kratších fragmentů k intenzitě signálu o velikosti 16,5 kb. Primery: F 5 TACCATAAATACTTGACCACCTGTA 3 R 5 GCGGGGGTTGTATTGATGAGATTAG 3 Podmínky PCR reakce: 95 C 2 min, 30 x (95 C 10 sec, 59 C 30 sec, 72 C 1 min), konečná elongace 72 C 10 min. Interpretace: V případě pozitivního nálezu je vždy uvedena hladina heteroplazmie. Při interpretaci pozitivního nálezu je nutno si uvědomit, že delece mtdna mohou být přítomny i v důsledku věku pacienta nebo z důvodu jiných svalových onemocnění. Tyto sekundární mtdna delece bývají detekovány pomocí Southern blotu tehdy, je-li použito větší množství DNA (cca 10 μg). Naopak negativní nález pomocí Southern blotu neznamená, že deletované molekuly mtdna nejsou ve vzorku vůbec přítomny. Malé množství deletovaných mtdna bývá zjištěno u pacientů s některými mutacemi v genu POLG1 (kóduje mitochondriální polymerázu gama), jejich přítomnost je vodítkem pro další vyšetření. Pro jejich vyloučení je dobré použít větší množství DNA nebo citlivější metodu. Pozn. Metoda Southern blot je v současné době v Laboratoři pro studium mitochondriálních poruch prováděna pouze u vybraných pacientů a v rámci diagnostiky je plně nahrazenametodou long-range PCR (viz níže). Metoda: Long-range PCR (LX-PCR) Pomocí specifických primerů lokalizovaných v oblasti D-loopu nebo v genu 12S rrna je amplifikována celá molekula mtdna. Přítomnost dalších (kratších) PCR produktů reprezentuje deletované molekuly mtdna ve vzorku. Metoda je vysoce citlivá a může detekovat i velmi malá množství deletovaných mtdna, která nemusí přispívat ke klinickému fenotypu. Interpretace těchto nálezů je vždy obtížná a je nutné doplnit další vyšetření (Southern blot) nebo nález korelovat s biochemickým/klinickým nálezem. Při interpretaci nálezu LX-PCR je nutné si uvědomit, že násobné delece v mtdna mohou vznikat důsledkem stárnutí nebo mohou být způsobeny mutacemi v genech aparátu replikace mtdna. V takovém případě je dědičnost násobných Strana 7 (celkem 8)

8 mtdna delecí autosomálně dominantní nebo recesivní a je nutné s přihlédnutím ke klinickému fenotypu a rodinné anamnéze analyzovat další, jaderně kódované geny (POLG1, PEO1, ANT1, TYMP, OPA1). K rozhodnutí zda, zjištěné delece v mtdna jsou způsobené stárnutím nebo jsou příčinou klinického fenotypu, může pomoci intenzita PCR produktu odpovídajícího normální nedeletované molekule mtdna. Deplece mtdna Tkáň vhodná pro detekci sníženého množství mtdna: sval, játra OMIM: #609560, # (syndrome deplece mitochondriální DNA svalová, resp. hepatocerebrální forma), # (Alpersův syndrom) Metoda: kvantitativní real-time PCR Syndrom deplece mtdna je autosomálně recesivní onemocnění s nástupem v dětském věku a je charakterizováno výraznou ztrátou mtdna molekul v postižené tkáni/tkáních. Množství mtdna v tkáních se stanovuje pomocí real-time PCR, v Laboratoři pro studium mitochondriálních poruch s využitím SybrGreen a 1 páru specifických primerů pro mtdna a 1 páru specifických primerů pro vhodný referenční jaedrný gen (GAPDH), a vyjadřuje je se jako poměr množství mtdna a jaderného genu. Interpretace: Pro interpretaci nálezu, je nutné mít větší množství (5-10) věkově srovnatelných kontrol pro každou analyzovanou tkáň. Množství mtdna se mění s věkem a k poměrně výrazným změnám dochází i v průběhu prvního roku života. V případě pozitivního nálezu je nezbytné analyzovat kandidátní, jaderně kódované geny (POLG1, TK2, DGUOK, RRMB2, MPV17, SUCLA2, SUCLG1). Závěr: Je nutné si uvědomit, že mutace v mtdna mohou být přítomny v jakékoliv její části. Pro jejich úspěšnou detekci (např.pomocí sekvenování) je nutné analyzovat DNA izolovanou z postižené tkáně. Nepřítomnost jakékoli mutace v mtdna nevylučuje mitochondriální onemocnění. 1. DiMauro S, Schon EA. Mitochondrial respiratory-chain diseases. N Engl J Med. 2003; 348: Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F and others. Sequence and organization of the human mitochondrial genome. Nature. 1981; 290: Shoubridge EA. Nuclear genetic defects of oxidative phosphorylation. Hum Mol Genet. 2001; 10: Zeviani M, Spinazzola A, Carelli V. Nuclear genes in mitochondrial disorders. Curr Opin Genet Dev. 2003; 13: Strana 8 (celkem 8)

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění



DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit


Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních



EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence


DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 3 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 02.06.2014 Ročník: 6AF, 6BF Anotace DUMu: chromatin - stavba, organizace a struktura














Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). Orphanet - Volně přístupné webové stránky s informacemi


Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009 Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková Parent projekt Praha 19.2.2009 Diagnostika MD její vývoj 1981-1986: zdokonalování diferenciální diagnostiky


Dědičná mitochondriální onemocnění a poruchy mitochondriální beta oxidace mastných kyselin

Dědičná mitochondriální onemocnění a poruchy mitochondriální beta oxidace mastných kyselin Dědičná mitochondriální onemocnění a poruchy mitochondriální beta oxidace mastných kyselin prim.mudr. RNDr. Pavel Ješina, Ph.D. Ústav dědičných metabolických poruch 1.LF UK, VFN Metabolická jednotka Klinika



NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ Doc. MUDr. A. Šantavá, CSc. Ústav lékařské genetiky a fetální medicíny LF a UP Olomouc Význam genetiky v diagnostice neuromuskulárních onemocnění Podílí


Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní


Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje


Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace


Genetický screening predispozice k celiakii

Genetický screening predispozice k celiakii VETERINÁRN RNÍ A FARMACEUTICKÁ UNIVERZITA BRNO Farmaceutická fakulta Ústav humánn nní farmakologie a toxikologie Genetický screening predispozice k celiakii RNDr. Ladislava Bartošov ová,ph.d. 1, PharmDr.


Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ





Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové


Molekulární diagnostika pletencové svalové dystrofie typu 2A

Molekulární diagnostika pletencové svalové dystrofie typu 2A Molekulární diagnostika pletencové svalové dystrofie typu 2A Lenka Fajkusová Centrum molekulární biologie a genové terapie Fakultní nemocnice Brno Pletencové svalové dystrofie (Limb Girdle Muscular Dystrophy

Více Prevence vrozených vad z pohledu genetika MUDr. Vladimír Gregor, RNDr. Jiří Horáček odd. lékařské genetiky, Fakultní Thomayerova nemocnice v Praze Genetické poradenství Klinická genetika se zabývá diagnostikou


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi


Genetika dědičných neuropatií

Genetika dědičných neuropatií Genetika dědičných neuropatií P. Seeman Klinika dětské neurologie, DNA laboratoř, UK 2. LF a FN Motol Praha a CMT tým UK 2. LF a FNM CMT - dědičná choroba Známo již od Charcota, Marie a Tootha téměř 130


DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod.

DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. Od 1.1.2014 DYNEX jediným OFICIÁLNÍM (autorizovaným) distributorem společnosti


V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)


Studium genetické predispozice ke vzniku karcinomu prsu

Studium genetické predispozice ke vzniku karcinomu prsu Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie


Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování


Buňky, tkáně, orgány, soustavy

Buňky, tkáně, orgány, soustavy Lidská buňka buněčné organely a struktury: Jádro Endoplazmatické retikulum Goldiho aparát Mitochondrie Lysozomy Centrioly Cytoskelet Cytoplazma Cytoplazmatická membrána Buněčné jádro Jadérko Karyoplazma


Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží



POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek


Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny


Ondřej Scheinost Nemocnice České Budějovice, a.s.

Ondřej Scheinost Nemocnice České Budějovice, a.s. Ondřej Scheinost Nemocnice České Budějovice, a.s. Nové technologie přelomové období principy technologií klinická použitelnost chips (arrays) sekvenační technologie Důležitost genetických informací i další


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést


Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová

Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Centrum nádorové cytogenetiky Ústav klinické biochemie a laboratorní diagnostiky VFN a 1. LF UK v Praze Klinický význam cytogenetických





Centrální dogma molekulární biologie

Centrální dogma molekulární biologie řípravný kurz LF MU 2011/12 Centrální dogma molekulární biologie Nukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Mendel) 1869 objev nukleových kyselin (Miescher) 1944 genetická informace v nukleových


DY D NE N X Hana Vlastníková

DY D NE N X Hana Vlastníková DYNEX Hana Vlastníková Molekulární biologie: Vybavení laboratoře na klíč Přístrojová technika Kompatibilní diagnostické soupravy Profesionální přístup SOP Technická podpora Servis Přístrojové vybavení:


Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi


ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction)


Laboratorní přístrojová technika

Laboratorní přístrojová technika Laboratorní přístrojová technika Co najdeme v laboratoři? Přístroje pro obecné použití centrifugy, třepačky, pipety, biohazard boxy Trocha teorie o DNA a PCR Analytické přístroje a příprava vzorků elektroforézy


Doporučení Farmakovigilančního výboru pro posuzování rizik léčiv (PRAC) k signálům pro aktualizaci informací o přípravku

Doporučení Farmakovigilančního výboru pro posuzování rizik léčiv (PRAC) k signálům pro aktualizaci informací o přípravku 22. ledna 2015 EMA/PRAC/63322/2015 Farmakovigilanční výbor pro posuzování rizik léčiv Doporučení Farmakovigilančního výboru pro posuzování rizik léčiv (PRAC) k signálům pro aktualizaci informací o přípravku


Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right


Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Biotechnologický kurz Biotechnologický kurz II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně Zemědělská


Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk


Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin


Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00


Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající


Genetika člověka GCPSB

Genetika člověka GCPSB Inovace předmětu Genetika člověka GCPSB Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/28.0032 Genetika člověka / GCPSB 6. Genetika


Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Charakteristika testu: Set AMPLICOR HPV vyráběný firmou Roche je určený pro detekci vysoko-rizikových typů lidských


Nukleové kyseliny. Nukleové kyseliny. Genetická informace. Gen a genom. Složení nukleových kyselin. Centrální dogma molekulární biologie

Nukleové kyseliny. Nukleové kyseliny. Genetická informace. Gen a genom. Složení nukleových kyselin. Centrální dogma molekulární biologie Centrální dogma molekulární biologie ukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Transkripce D R Translace rotein Mendel) Replikace 1869 objev nukleových kyselin (Miescher) 1944 nukleové kyseliny


Plíšková L. Ústav klinické biochemie a diagnostiky LF a FN Hradec Králové

Plíšková L. Ústav klinické biochemie a diagnostiky LF a FN Hradec Králové PCR v diagnostice Lymeské boreliózy Plíšková L. Ústav klinické biochemie a diagnostiky LF a FN Hradec Králové obtížná Diagnostika lymeské boreliózy klinický obraz velmi rozmanitý anamnestické údaje (přisátí


Problematika molekulárněmikrobiologické diagnostiky

Problematika molekulárněmikrobiologické diagnostiky Problematika molekulárněmikrobiologické diagnostiky Jaroslav Hrabák Téma jednání 1. Nepodkročitelná minima vybavení molekulárněmikrobiologické laboratoře Schválení dokumentu 1. Vzdělávání v molekulární


Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR. Mgr. Silvie Dudová

Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR. Mgr. Silvie Dudová Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR Mgr. Silvie Dudová Centrum základního výzkumu pro monoklonální gamapatie a mnohočetný myelom, ILBIT LF MU Brno Laboratoř experimentální


CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder CADASIL analýza mutací v genu NOTCH3 H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder Ústav dědičných metabolických poruch 1. LF UK a VFN Oddělení patologie a nár. ref.


Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací Genetika Nauka o dědid dičnosti a proměnlivosti Genetika molekulárn rní buněk organismů populací Dědičnost na úrovni nukleových kyselin Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 I n v e s t i c e d o r o z v o j e v z d ě l á v á n í Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


KBI/GENE Mgr. Zbyněk Houdek

KBI/GENE Mgr. Zbyněk Houdek Genealogie KBI/GENE Mgr. Zbyněk Houdek Rodokmenové schéma Shromáždění informací o rodině je 1. důležitým krokem v genetickém poradenství. Rodokmenové schéma musí být srozumitelné a jednoznačné. Poskytuje


Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


Diagnostika a epidemiologie HIV. Vratislav Němeček, Marek Malý NRL pro HIV/AIDS, Státní zdravotní ústav, Praha

Diagnostika a epidemiologie HIV. Vratislav Němeček, Marek Malý NRL pro HIV/AIDS, Státní zdravotní ústav, Praha Diagnostika a epidemiologie HIV Vratislav Němeček, Marek Malý NRL pro HIV/AIDS, Státní zdravotní ústav, Praha Původ SIVy se přirozeně vyskytují u afrických primátů a není známo, že by vyvolávaly onemocnění


Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Dle čl. 7 odst. 2 Směrnice děkana pro realizaci bakalářských


Výskyt a význam infekce Borna disease virem u pacientů léčených

Výskyt a význam infekce Borna disease virem u pacientů léčených Výskyt a význam infekce Borna disease virem u pacientů léčených pro závislost Sylva Racková Psychiatrická klinika LF UK v Plzni AT konference 28.04. 2010, Špindlerův Mlýn Borna Disease virus (BDV) charakteristika


Sérologická diagnostika chřipky možnosti a diagnostická úskalí

Sérologická diagnostika chřipky možnosti a diagnostická úskalí Sérologická diagnostika chřipky možnosti a diagnostická úskalí Martina Havlíčková, Radka Limberková, Pavla Růžičková, Helena Jiřincová NRL pro chřipku, Státní zdravotní ústav K historii vyšetřování sér


Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto


Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,


Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený






REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK Molekulární základy dědičnosti - rozšiřující učivo REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK REPLIKACE deoxyribonukleové kyseliny (zdvojení DNA) je děj, při kterém se tvoří z jedné dvoušoubovice DNA dvě nová



ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN Fragmenty nukleových kyselin lze dle jejich velikosti rozdělit elektroforézou. Elektroforéza využívá rozdílné pohyblivosti jednotlivých fragmentů, danou právě


Hybridizace. doc. RNDr. Milan Bartoš, Ph.D.

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. Hybridizace doc. RNDr. Milan Bartoš, Ph.D. Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace


Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin

Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin Část Molekulární biologie a imunologie 6. Základy dědičnosti Mendelovská dědičnost (autozomálně recesivní, autozomálně dominantní a X-vázaný přenos mutací). Nemendelovská dědičnost (uniparentální disomie,


TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně


Lymfoscintigrafie horních končetin u pacientek po mastektomii

Lymfoscintigrafie horních končetin u pacientek po mastektomii Lymfoscintigrafie horních končetin u pacientek po mastektomii Lang O, Balon H, Kuníková I, Křížová H, Wald M KNM UK 3. LF a FNKV, 1. Chirurgická klinika UK 2. LF a FN Motol, Praha 51. DNM, Seč Ústupky,


Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární


Doporučený postup č. 3. Genetické laboratorní vyšetření v reprodukční genetice

Doporučený postup č. 3. Genetické laboratorní vyšetření v reprodukční genetice Účinnost k 1. 12. 2014 Doporučený postup č. 3 Genetické laboratorní vyšetření v reprodukční genetice Stav změn: 1. vydání Základním předpokladem genetického laboratorního vyšetření v reprodukční genetice


Okruhy otázek ke zkoušce

Okruhy otázek ke zkoušce Okruhy otázek ke zkoušce 1. Úvod do biologie. Vznik života na Zemi. Evoluční vývoj organizmů. Taxonomie organizmů. Původ a vývoj člověka, průběh hominizace a sapientace u předků člověka vyšších primátů.


Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010

Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010 Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem Milan Bartoš Forum veterinarium, Brno 2010 Vývoj farmakogenetické diagnostické soupravy pro stanovení genetických polymorfismů


Mitochondriální genom, úloha mitochondrií v buněčném metabolismu, signalizaci a apoptóze

Mitochondriální genom, úloha mitochondrií v buněčném metabolismu, signalizaci a apoptóze Mitochondriální genom, úloha mitochondrií v buněčném metabolismu, signalizaci a apoptóze MUDr. Jan Pláteník, PhD březen 2007 Mitochondrie:... původně fagocytované/parazitující bakterie čtyři kompartmenty:



VYUŽITÍ HMOTNOSTNÍ SPEKTROMETRIE V DIAGNOSTICE A VE VÝZKUMU AMYLOIDÓZY VYUŽITÍ HMOTNOSTNÍ SPEKTROMETRIE V DIAGNOSTICE A VE VÝZKUMU AMYLOIDÓZY A. Potáčová, R. Hájek Mikulov 13. 4. 2012 Diagnostika amyloidózy Amyloidóza = heterogenní skupina onemocnění Charakterizovaná extracelulární


Genetika člověka GCPSB

Genetika člověka GCPSB Inovace předmětu Genetika člověka GCPSB Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/28.0032 Genetika člověka / GCPSB 7. Genetika


ný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 gen Prohlášení Informace k onemocn BRCA1 gen

ný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 gen Prohlášení Informace k onemocn BRCA1 gen Dědičný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 genů. Foretová L., Macháčková E. Oddělení epidemiologie a genetiky nádorů, Masarykův onkologický ústav, Brno


Microfluidic systems, advantages and applications Monika Kremplová, Mgr.

Microfluidic systems, advantages and applications Monika Kremplová, Mgr. Název: Školitel: Microfluidic systems, advantages and applications Monika Kremplová, Mgr. Datum: 21. 6. 2013 Reg.č.projektu: CZ.1.07/2.3.00/20.0148 Název projektu: Mezinárodní spolupráce v oblasti "in


Metody detekce poškození DNA

Metody detekce poškození DNA STABILITA GENOMU II. Metody detekce poškození DNA Metody detekce poškození DNA Možnosti stanovení: 1. poškození DNA per se nebo 2. jeho následky mutace genů a mutace chromosomů 1. Detekce poškození DNA



NÁDOROVÁ RIZIKA. poznejme OBSAH poznejme NÁDOROVÁ RIZIKA OBSAH Úvod... 3 Proč bychom se měli dozvědět o svých vlastních rizicích?... 4 Jaké jsou naše služby?... 4 Kdo by měl být vyšetřen?... 5 Jaký je postup při vyšetřování?... 6 Informace



METODY STUDIA PROTEINŮ METODY STUDIA PROTEINŮ Mgr. Vlasta Němcová OBSAH PŘEDNÁŠKY 1) Stanovení koncentrace proteinu 2) Stanovení AMK sekvence proteinu Hmotnostní spektrometrie Edmanovo odbourávání


Studie zdravotního stavu dětí

Studie zdravotního stavu dětí Studie zdravotního stavu dětí z Radvanic a Bartovic Miroslav Dostál Ústav experimentální mediciny AV ČR, v.v.i., Praha 1 Zdravotní stav dětí Cíl porovnat zdravotní stav dětí žijících v Radvanicích & Bartovicích



KONGENITÁLNÍ SVALOVÉ DYSTROFIE KONGENITÁLNÍ SVALOVÉ DYSTROFIE Vondráček P. Hermanová M. Fajkusová L. Klinika dětské neurologie LF MU a FN Brno Patologicko-anatomický ústav LF MU a FN Brno CMBGT IHOK FN Brno Kongenitální svalové dystrofie


ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii ONKOGENETIKA Spojuje: - lékařskou genetiku - buněčnou biologii - molekulární biologii - cytogenetiku - virologii Důležitost spolupráce různých specialistů při detekci hereditárních forem nádorů - (onkologů,internistů,chirurgů,kožních


Progrese HIV infekce z pohledu laboratorní imunologie

Progrese HIV infekce z pohledu laboratorní imunologie Progrese HIV infekce z pohledu laboratorní imunologie 1 Lochmanová A., 2 Olbrechtová L., 2 Kolčáková J., 2 Zjevíková A. 1 OIA ZÚ Ostrava 2 klinika infekčních nemocí, FN Ostrava HIV infekce onemocnění s


Mikromorfologická diagnostika bronchogenního karcinomu z pohledu pneumologické cytodiagnostiky

Mikromorfologická diagnostika bronchogenního karcinomu z pohledu pneumologické cytodiagnostiky Mikromorfologická diagnostika bronchogenního karcinomu z pohledu pneumologické cytodiagnostiky P. Žáčková Pneumologická klinika 1. LFUK Thomayerova nemocnice Úvod a definice Každá buňka obsahuje informace


Mikročipy v mikrobiologii

Mikročipy v mikrobiologii Mikročipy v mikrobiologii doc. RNDr. Milan Bartoš, Ph.D. Přírodovědecká fakulta MU, 2014 Obsah přednášky 1) Charakteristika biočipů, DNA microarrays a DNA chip 2) Výroba čipů, charakteristika





Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8





Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký

Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký Kapitola 3 Biomolecular Design and Biotechnology Překlad: Jaroslav Krucký Problémy chemie a biologie mohou být velmi nápomocné, jestliže se naše schopnost vidět to, co děláme, a dělat věci na atomární


Co se děje v genetické laboratoři?

Co se děje v genetické laboratoři? 12 Co se děje v genetické laboratoři? Tento letáček byl vytvořen s pomocí Dr Iana M Fraylinga, Institute of Medical Genetics, University Hospital of Wales, Cardiff, UK; Dr Domenica Coviella, Laboratory
