Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA"

Transkript

1 Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné postupy, předcházející diagnostice (izolace a uchovávání nukleových kyselin). 2) Směrnice nezahrnují indikace pro molekulárně genetickou analýzu jaderně-kódovaných genů vedoucích k mitochondriálním onemocněním. Ve většině případů jsou tyto geny analyzovány až na základě biochemického (stanovení množství a funkce OXPHOS) nebo molekulárně-genetického (mtdna delece, deplece) vyšetření. Mitochondrie a mitochondriální DNA Mitochondriální onemocnění přes svou klinickou a genetickou heterogenitu jsou charakterizovány poruchami funkce komplexů dýchacího řetězce, respektive systému oxidativní fosforylace (OXPHOS)[1]. Systém OXPHOS je lokalizován ve vnitřní mitochondriální membráně. Jeho 5 enzymových komplexů je tvořeno z více než 80 podjednotek, velká většina z nich je kódována jadernou DNA a do mitochondrií importována. 13 klíčových podjednotek komplexů OXPHOS je kódováno mitochondriální DNA (mtdna), jedinou nechromozomální DNA přítomnou v lidských buňkách[2]. MtDNA je malá (16,5 kb) cirkulární molekula, v buňkách je přítomna v tisíci kopiích a vykazuje maternální dědičnost. Proteiny zodpovědné za údržbu, replikaci a expresi mtdna jsou kódovány jaderně, defekt ve kterémkoliv z nich může vést k mitochondriálnímu onemocnění[3, 4]. MtDNA heteroplazmie, threshold a segregace Přítomnost tisíců molekul mtdna v buňkách hraje důležitou roli v projevu patogenních mtdna mutací na úrovni fenotypu, jak biochemického, tak i klinického. Homoplazmie je stav, kdy jsou všechny molekuly mtdna v buňce identické. Naproti tomu, většina pacientů nesoucích patogenní mutaci v mtdna mají ve svých buňkách směs mutovaných a nemutovaných (normálních) molekul mtdna, stav označovaný jako heteroplazmie. K projevům heteroplazmické mutace dojde tehdy, pokud množství mutovaných molekul mtdna v buňce přesáhne určitou prahovou hodnotu (threshold). V průběhu buněčného dělení jsou mutované a normální molekuly mtdna pravděpodobně rozděleny náhodně do dceřiných buněk. Náhodná segregace vede k různým hladinám heteroplazmie mezi jednotlivými buňkami, tkáněmi a jednotlivci, což následně ovlivňuje fenotypové projevy mitochondriální onemocnění a jeho dědičnost. V post-mitotických tkáních (např. kosterní sval, bývá často i klinicky postižený) dochází k akumulaci mutovaných molekul mtdna (vyšší hladina heteroplazmie), proto je DNA z těchto tkání preferována pro diagnostiku některých mutací v mtdna, ačkoli řadu mutací lze spolehlivě detekovat i v krvi. Klinické projevy onemocnění způsobených mutacemi mtdna Přestože mitochondriální onemocnění představují klinicky heterogenní skupinu onemocnění, existuje řada dobře definovaných mitochondriálních Strana 1 (celkem 8)

2 syndromů charakterizovaných konkrétními klinickými projevy. Mezi nejznámější syndromy patří chronická progresivní externí oftalmoplegie (CPEO), Kearns-Sayreův syndrom (KSS) externí oftalmoplegie, ptóza a rozsáhlé přestavby mtdna (jednoduché nebo násobné). Mitochondriální encefalomyopatie s laktátovou acidózou a iktu podobnými příhodami (MELAS syndrom), myoklonická epilepsie s ragged-red svalovými vlákny (MERRF syndrom) a neurogenní svalová slabost, ataxie a retinitispigmentosa (NARP syndrom) jsou spojovány s bodovými mutacemi v mtdna (3243A>G, 8344A>G a 8993T>G,C). Dalším častým mitochondriálním onemocněním, diagnostikovaným obvykle oftalmology, je Leberova hereditární optická neuropatie (LHON syndrom) je způsobena bodovými mutacemi v mtdna (3460G>A, 11778G>A nebo 14484T>C). Laboratorní diagnostika mitochondriálních onemocnění Stanovení diagnózy mitochondriálního onemocnění vyžaduje kombinaci informací z řady vyšetření. Vedle klinických údajů jsou to výsledky specifických analýz: histochemické vyšetření svalové biopsie, biochemické stanovení aktivit komplexů dýchacího řetězce a jejich složení a molekulárně-genetické vyšetření. V ideálním případě by klinická, biochemická a histochemická data měla nasměrovat molekulárně genetické vyšetření, ať už zahrnující analýzu mtdna nebo genů lokalizovaných na jaderné DNA. Výše uvedené mutace v mtdna jsou však vyšetřovány často jako první bez ohledu na výsledky biochemických vyšetření jenom na základě klinických projevů, screeningově jsou tyto mutace vyšetřovány v krvi. Diagnostika Pozn.: Jsou uvedeny metody, které jsou rutinně používány v Laboratoři pro studium mitochondriálních poruch, KDDL 1.LF UK a VFN v Praze. Sekvenování mtdna není popsáno neboť nepatří mezi rutinní vyšetření, je indikováno až po detailním biochemickém vyšetření a vyloučení častých mutací v mtdna. Přestože i pro diagnostiku mutací v mtdna jsou zaváděny nové metody, uvedené postupy jsou stále používány v bežném screeningu v řadě evropských laboratoří. Mutace 3243A>G v mtdna Tkáň vhodná k zachycení mutace: krev(*), močový sediment(**), sval(***) OMIM: * (klinické projevy spojené s mutací), #54000 (syndrom MELAS další mutace, nebývají součástí screeningu) Metoda: PCR-RFLP Amplifikace úseku mtdna od 3135 do Sekvence primerů: F 5 AGGACAAGAGAAATAAGGC 3 R 5 TAGAAGAGCGATGGTGAGAG 3 Podmínky PCR reakce: 30 x (95 C 10 sec, 58 C 15 sec, 72 C 45 sec), konečná elongace 72 C 5 min. PCR produkt o délce 428 bp je štěpen restrikčním enzymem ApaI. Jeli mutace přítomna, dojde k rozštěpení části (heteroplazmie) PCR produktu na fragmenty o délce 308 a 120 bp. Produkty jsou rozděleny ve 2,5% agarózovém gelu, obarveny etidiumbromidem a Strana 2 (celkem 8)

3 vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě pozitivního nálezu je stanovena hladina heteroplazmie (množství mutovaných mtdna molekul). Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). Následuje restrikce enzymem ApaI a separace restrikčních fragmentů na 8% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita rozštěpených fragmentů k intenzitě nerozštěpeného produktu. Na gelu je vždy přítomna pozitivní i negativní kontrola. Pozn. Radioaktivní značení je v některých laboratořích nahrazováno fluorescenčním a restrikční fragmenty jsou separovány kapilární elektroforézou a detekovány laserem. Od jara 2009 je v Laboratoři pro studium mitochondriálních poruch nově záváděna metoda detekce heteroplazmické mutace 3243A>G pomocí real-time PCR s využitím TaqMan sond. Interpretace: V případě pozitivního nálezu je vždy uvedena hladina heteroplazmie ve vyšetřované tkáni. K prognóze onemocnění však nemůže být použita, doposud nebyla jednoznačně prokázána souvislost mezi hladinou heteroplazmie v jednotlivých tkáních a závažností klinických projevů. Mutace 8344A>G Tkáň vhodná k zachycení mutace: krev(**), sval(***) OMIM: * (klinické projevy spojené s mutací), # (syndrom MERRF) Metoda: PCR-RFLP Amplifikace úseku mtdna od 8278 bp do 8385 bp. Sekvence primerů: F 5 CTACCCCCTCTAGAGCCCAC 3 R 5 GTAGTATTTAGTTGGGGCATTTCACTGTAAAGC * C * GTGTTGG 3 Podmínky PCR reakce: počáteční denaturace 95 C 2 min, 30 x (94 C 20 sec, 62 C 15 sec, 72 C 20 sec), konečná elongace 72 C 5 min. PCR produkt o délce 108 bp je štěpen restrikčním enzymem BglI. Je-li mutace přítomna, dojde k rozštěpení části (heteroplazmie) PCR produktu na fragmenty o délce 73 a 35 bp. Restrikční fragmenty jsou separovány v 3,5% agarózovém gelu, obarveny etidiumbromidem a vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě pozitivního nálezu je stanovena hladina heteroplazmie (množství mutovaných mtdna molekul). Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). Následuje restrikce enzymem BglI a separace restrikčních fragmentů na 10% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita rozštěpených Strana 3 (celkem 8)

4 fragmentů k intenzitě nerozštěpeného produktu. Na gelu je vždy přítomna pozitivní i negativní kontrola. Interpretace: V případě pozitivního nálezu je vždy uvedena hladina heteroplazmie ve vyšetřované tkáni. K prognóze onemocnění však nemůže být použita, doposud nebyla jednoznačně prokázána souvislost mezi hladinou heteroplazmie v jednotlivých tkáních a závažností klinických projevů. Mutace 8993T>G,C Tkáň vhodná k zachycení mutace: krev(***), sval(***) OMIM: * (klinické projevy spojené s mutací), # (syndrom NARP) Metoda: PCR-RFLP Amplifikace úseku mtdna od 8798 bp do 9086 bp. Sekvence primerů: F 5 CATTTACACCAACCACCCAAC 3 R 5 GGAAGGTTAATGGTTGATATTGC 3. Podmínky PCR reakce: počáteční denaturace 95 C 2 min, 29 x (95 C 30 sec, 58 C 20 sec, 72 C 40 sec), konečná elongace 72 C 2 min. PCR produkt o velikosti 289 bp je štěpen restrikčním enzymem HpaII. Je-li přítomna mutace (G nebo C), dojde k rozštěpení většiny (bývá vysoká hladina heteroplazmie) PCR produktu na fragmenty o velikosti 194 a 95 bp. Pro rozlišení o jakou variantu mutace se jedná (G nebo C), je PCR produkt štěpen restrikčním enzymem AvaI. Je-li přítomna varianta G, dojde k rozštěpení PCR produktu na fragmenty o velikosti 193 a 96 bp. Variantu C enzym AvaI neštěpí. Restrikční fragmenty jsou separovány na 3,5% agaróze, obarveny etidiumbromidem a vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě pozitivního nálezu je stanovena hladina heteroplazmie (množství mutovaných mtdna molekul). Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). Následuje restrikce enzymem HpaII a separace restrikčních fragmentů na 10% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita rozštěpených fragmentů k intenzitě nerozštěpeného produktu. Na gelu je vždy přítomna pozitivní i negativní kontrola. Interpretace: V případě pozitivního nálezu je vždy uvedena hladina heteroplazmie ve vyšetřované tkáni. Hladina heteroplazmie bývá většinou velmi vysoká i v DNA izolované z krve, byla pozorována korelace mezi hladinou heteroplazmie a závažností klinických projevů onemocnění Strana 4 (celkem 8)

5 Mutace 3460G>A, 11778G>A a 14484T>C Leberova hereditární optická neuropatie Tkáň vhodná k zachycení mutace: krev(***) OMIM: # (syndrom LHON, vyšetřují se pouze 3 nejčastější mutace) Metoda: PCR-RFLP Mutace 3460G>A: Amplifikace mtdna v úseku od 3130 do 3557 bp. Sekvence primerů F 5 AGGACAAGAGAAATAAGGC 3 R 5 TAGAAGAGCGATGGTGAGAG 3. Podmínky PCR reakce: 29x(95 C 10 sec, 58 C 15 sec, 72 C 30 sec), konečná elongace 72 C 5 min. PCR produkt o délce 428 bp je štěpen restrikčním enzymem BsaHI. Je-li mutace přítomna, PCR produkt se neštěpí. V nepřítomnosti mutace dochází k jeho rozštěpení na fragmenty o velikosti 329 a 99 bp. Produkty jsou rozděleny ve 2,5% agarózovém gelu, obarveny etidiumbromidem a vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě pozitivního nálezu je stanovena hladina heteroplazmie (množství mutovaných mtdna molekul). Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). Následuje restrikce enzymem BsaHI a separace restrikčních fragmentů na 8% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita nerozštěpeného produktu k intenzitě rozštěpených fragmentů. Na gelu je vždy přítomna pozitivní i negativní kontrola. Mutace 11778G>A: Amplifikace oblasti mtdna od do bp. Sekvence primerů: F 5 GCTTCACCGGCGCAGTCATTCTC 3 R 5 AGCGAGGCTTGCTAGAAGTCATC 3. Podmínky PCR reakce: počáteční denaturace 95 C 2 min, 33x(95 C 15 sec, 66 C 25 sec, 72 C 15 sec), konečná elongace 72 C 5 min. PCR produkt o délce 174 bp je štěpen restrikčním enzymem MaeIII. Je-li mutace přítomna, PCR produkt se rozštěpí na fragmenty o velikosti 94 bp a 80 bp. V nepřítomnosti mutace se PCR produkt neštěpí. Produkty jsou rozděleny ve 3,5% agarózovém gelu, obarveny etidiumbromidem a vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě nálezu mutace je stanovena hladina heteroplazmie. K jejímu stanovení se využívá restrikčního enzymu AciI, protože enzym MaeIII neštěpí úplně všechny mutované molekuly mtdna. Amplifikace mtdna v oblasti od do bp. Sekvence primerů: F 5 CTCAAACTACGAACGCACTCACAGC * C 3 R 5 AGCGAGGCTTGCTAGAAGTCATC Strana 5 (celkem 8)

6 Podmínky PCR reakce: počáteční denaturace 95 C 2 min, 33x(95 C 15 sec, 66 C 25 sec, 72 C 15 sec), konečná elongace 72 C 5 min. Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). PCR produkt o délce 104 bp je štěpen restrikčním enzymem AciI. Je-li mutace přítomna, PCR produkt se neštěpí. V nepřítomnosti mutace dochází k jeho rozštěpení na fragmenty o velikosti 78 a 26 bp. Restrikční fragmenty jsou separovány na 10% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita nerozštěpeného produktu k intenzitě rozštěpených fragmentů. Na gelu je vždy přítomna pozitivní i negativní kontrola. Mutace 14484T>C: Amplifikace mtdna v úseku od do bp. Sekvence primerů: F 5 ATCCTCCCGAATCAACCCTGA 3 R 5 TTTTTTTAATTTATTTAGGGGGC * C * TG 3 Podmínky PCR reakce: 29x(95 C 10 sec, 45 C 15 sec, 72 C 30 sec), konečná elongace 72 C 5 min. PCR produkt o délce 250 bp je štěpen restrikčním enzymem MvaI. Jeli mutace přítomna, dojde k rozštěpení části (heteroplazmie) PCR produktu na fragmenty o délce 235 bp a 15 bp. Restrikční fragmenty jsou separovány v 3,5% agarózovém gelu, obarveny etidiumbromidem a vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě pozitivního nálezu je stanovena hladina heteroplazmie (množství mutovaných mtdna molekul). Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). Následuje restrikce enzymem MvaI a separace restrikčních fragmentů na 10% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita rozštěpených fragmentů k intenzitě nerozštěpeného produktu. Na gelu je vždy přítomna pozitivní i negativní kontrola. Interpretace: V případě pozitivního nálezu je vždy uvedena nalezená mutace a hladina její heteroplazmie ve vyšetřované tkáni. Mutace bývají většinou homoplazmické i v krvi. Detekce nejčastějších mutací pro syndrom LHON je problematická, její nález je dobré ověřit další nezávislou metodou. Od jara 2009 je v Laboratoři pro studium mitochondriálních poruch nově záváděna metoda detekce heteroplazmické mutace 11778G>A pomocí real-time PCR s využitím TaqMan sond Strana 6 (celkem 8)

7 Rozsáhlé delece v mtdna Tkáň vhodná k zachycení delece: sval (***), močový sediment (**pouze LX-PCR), krev (*pouze LX-PCR, nemusí být přítomny delece u všech pacientů s mtdna delecemi) OMIM: # (syndrom Kearns-Sayre), # (Pearsonův syndrom), #157640, #609286, #603041, * (progresivní externí oftalmoplegie) Metoda: Southern blot Celková DNA je štěpena restrikčním enzymem PvuII nebo BamHI, což vede k její linearizaci. Po elektroforetické separaci na 0,8% agaróze je přenesena na nylonovou membránu a hybridizována se sondou specifickou ke kontrolní oblasti mtdna (často je používaná i sonda specifická pro celou molekulu mtdna). Značení sondy pomocí [α 32 P]dCTP probíhá v průběhu PCR reakce. Na membráně je vždy přítomna pozitivní a negativní kontrola. Jsou-li ve vyšetřovaném vzorku přítomny deletované molekuly mtdna, na membráně je patrno více signálů pro daný vzorek. Množství deletovaných molekul mtdna se udává jako podíl intenzity signálu kratších fragmentů k intenzitě signálu o velikosti 16,5 kb. Primery: F 5 TACCATAAATACTTGACCACCTGTA 3 R 5 GCGGGGGTTGTATTGATGAGATTAG 3 Podmínky PCR reakce: 95 C 2 min, 30 x (95 C 10 sec, 59 C 30 sec, 72 C 1 min), konečná elongace 72 C 10 min. Interpretace: V případě pozitivního nálezu je vždy uvedena hladina heteroplazmie. Při interpretaci pozitivního nálezu je nutno si uvědomit, že delece mtdna mohou být přítomny i v důsledku věku pacienta nebo z důvodu jiných svalových onemocnění. Tyto sekundární mtdna delece bývají detekovány pomocí Southern blotu tehdy, je-li použito větší množství DNA (cca 10 μg). Naopak negativní nález pomocí Southern blotu neznamená, že deletované molekuly mtdna nejsou ve vzorku vůbec přítomny. Malé množství deletovaných mtdna bývá zjištěno u pacientů s některými mutacemi v genu POLG1 (kóduje mitochondriální polymerázu gama), jejich přítomnost je vodítkem pro další vyšetření. Pro jejich vyloučení je dobré použít větší množství DNA nebo citlivější metodu. Pozn. Metoda Southern blot je v současné době v Laboratoři pro studium mitochondriálních poruch prováděna pouze u vybraných pacientů a v rámci diagnostiky je plně nahrazenametodou long-range PCR (viz níže). Metoda: Long-range PCR (LX-PCR) Pomocí specifických primerů lokalizovaných v oblasti D-loopu nebo v genu 12S rrna je amplifikována celá molekula mtdna. Přítomnost dalších (kratších) PCR produktů reprezentuje deletované molekuly mtdna ve vzorku. Metoda je vysoce citlivá a může detekovat i velmi malá množství deletovaných mtdna, která nemusí přispívat ke klinickému fenotypu. Interpretace těchto nálezů je vždy obtížná a je nutné doplnit další vyšetření (Southern blot) nebo nález korelovat s biochemickým/klinickým nálezem. Při interpretaci nálezu LX-PCR je nutné si uvědomit, že násobné delece v mtdna mohou vznikat důsledkem stárnutí nebo mohou být způsobeny mutacemi v genech aparátu replikace mtdna. V takovém případě je dědičnost násobných Strana 7 (celkem 8)

8 mtdna delecí autosomálně dominantní nebo recesivní a je nutné s přihlédnutím ke klinickému fenotypu a rodinné anamnéze analyzovat další, jaderně kódované geny (POLG1, PEO1, ANT1, TYMP, OPA1). K rozhodnutí zda, zjištěné delece v mtdna jsou způsobené stárnutím nebo jsou příčinou klinického fenotypu, může pomoci intenzita PCR produktu odpovídajícího normální nedeletované molekule mtdna. Deplece mtdna Tkáň vhodná pro detekci sníženého množství mtdna: sval, játra OMIM: #609560, # (syndrome deplece mitochondriální DNA svalová, resp. hepatocerebrální forma), # (Alpersův syndrom) Metoda: kvantitativní real-time PCR Syndrom deplece mtdna je autosomálně recesivní onemocnění s nástupem v dětském věku a je charakterizováno výraznou ztrátou mtdna molekul v postižené tkáni/tkáních. Množství mtdna v tkáních se stanovuje pomocí real-time PCR, v Laboratoři pro studium mitochondriálních poruch s využitím SybrGreen a 1 páru specifických primerů pro mtdna a 1 páru specifických primerů pro vhodný referenční jaedrný gen (GAPDH), a vyjadřuje je se jako poměr množství mtdna a jaderného genu. Interpretace: Pro interpretaci nálezu, je nutné mít větší množství (5-10) věkově srovnatelných kontrol pro každou analyzovanou tkáň. Množství mtdna se mění s věkem a k poměrně výrazným změnám dochází i v průběhu prvního roku života. V případě pozitivního nálezu je nezbytné analyzovat kandidátní, jaderně kódované geny (POLG1, TK2, DGUOK, RRMB2, MPV17, SUCLA2, SUCLG1). Závěr: Je nutné si uvědomit, že mutace v mtdna mohou být přítomny v jakékoliv její části. Pro jejich úspěšnou detekci (např.pomocí sekvenování) je nutné analyzovat DNA izolovanou z postižené tkáně. Nepřítomnost jakékoli mutace v mtdna nevylučuje mitochondriální onemocnění. 1. DiMauro S, Schon EA. Mitochondrial respiratory-chain diseases. N Engl J Med. 2003; 348: Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F and others. Sequence and organization of the human mitochondrial genome. Nature. 1981; 290: Shoubridge EA. Nuclear genetic defects of oxidative phosphorylation. Hum Mol Genet. 2001; 10: Zeviani M, Spinazzola A, Carelli V. Nuclear genes in mitochondrial disorders. Curr Opin Genet Dev. 2003; 13: Strana 8 (celkem 8)

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Dědičná mitochondriální onemocnění a poruchy mitochondriální beta oxidace mastných kyselin

Dědičná mitochondriální onemocnění a poruchy mitochondriální beta oxidace mastných kyselin Dědičná mitochondriální onemocnění a poruchy mitochondriální beta oxidace mastných kyselin prim.mudr. RNDr. Pavel Ješina, Ph.D. Ústav dědičných metabolických poruch 1.LF UK, VFN Metabolická jednotka Klinika

Více

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 3 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 02.06.2014 Ročník: 6AF, 6BF Anotace DUMu: chromatin - stavba, organizace a struktura

Více

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní

Více

Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové beranek@lfhk.cuni.cz

Více

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ

Více

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)

Více

Doporučení Farmakovigilančního výboru pro posuzování rizik léčiv (PRAC) k signálům pro aktualizaci informací o přípravku

Doporučení Farmakovigilančního výboru pro posuzování rizik léčiv (PRAC) k signálům pro aktualizaci informací o přípravku 22. ledna 2015 EMA/PRAC/63322/2015 Farmakovigilanční výbor pro posuzování rizik léčiv Doporučení Farmakovigilančního výboru pro posuzování rizik léčiv (PRAC) k signálům pro aktualizaci informací o přípravku

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová

Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Centrum nádorové cytogenetiky Ústav klinické biochemie a laboratorní diagnostiky VFN a 1. LF UK v Praze Klinický význam cytogenetických

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

Genetika člověka GCPSB

Genetika člověka GCPSB Inovace předmětu Genetika člověka GCPSB Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/28.0032 Genetika člověka / GCPSB 6. Genetika

Více

Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený

Více

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající

Více

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést

Více

Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

Metody detekce poškození DNA

Metody detekce poškození DNA STABILITA GENOMU II. Metody detekce poškození DNA Metody detekce poškození DNA Možnosti stanovení: 1. poškození DNA per se nebo 2. jeho následky mutace genů a mutace chromosomů 1. Detekce poškození DNA

Více

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Charakteristika testu: Set AMPLICOR HPV vyráběný firmou Roche je určený pro detekci vysoko-rizikových typů lidských

Více

Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární

Více

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder CADASIL analýza mutací v genu NOTCH3 H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder Ústav dědičných metabolických poruch 1. LF UK a VFN Oddělení patologie a nár. ref.

Více

Co se děje v genetické laboratoři?

Co se děje v genetické laboratoři? 12 Co se děje v genetické laboratoři? Tento letáček byl vytvořen s pomocí Dr Iana M Fraylinga, Institute of Medical Genetics, University Hospital of Wales, Cardiff, UK; Dr Domenica Coviella, Laboratory

Více

Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí

Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí Stárnutí organismu Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí poklesy funkcí se liší mezi orgánovými systémy Některé projevy stárnutí ovlivňuje výživa Diagnostické metody odlišují

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 I n v e s t i c e d o r o z v o j e v z d ě l á v á n í Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

VÝSLEDKY FISH ANALÝZY U NEMOCNÝCH S MM ZAŘAZENÝCH VE STUDII CMG 2002 VÝZKUMNÝ GRANT NR/8183-4 CMG CZECH GROUP M Y E L O M A Č ESKÁ MYELOMOVÁ SKUPINA

VÝSLEDKY FISH ANALÝZY U NEMOCNÝCH S MM ZAŘAZENÝCH VE STUDII CMG 2002 VÝZKUMNÝ GRANT NR/8183-4 CMG CZECH GROUP M Y E L O M A Č ESKÁ MYELOMOVÁ SKUPINA VÝSLEDKY FISH ANALÝZY U NEMOCNÝCH S MM ZAŘAZENÝCH VE STUDII CMG 2002 VÝZKUMNÝ GRANT NR/8183-4 CZECH CMG M Y E L O M A GROUP Č ESKÁ MYELOMOVÁ SKUPINA Zhodnocení spolupráce Přehled molekulárně cytogenetických

Více

NÁDOROVÁ RIZIKA. poznejme OBSAH

NÁDOROVÁ RIZIKA. poznejme OBSAH poznejme NÁDOROVÁ RIZIKA OBSAH Úvod... 3 Proč bychom se měli dozvědět o svých vlastních rizicích?... 4 Jaké jsou naše služby?... 4 Kdo by měl být vyšetřen?... 5 Jaký je postup při vyšetřování?... 6 Informace

Více

Studie zdravotního stavu dětí

Studie zdravotního stavu dětí Studie zdravotního stavu dětí z Radvanic a Bartovic Miroslav Dostál Ústav experimentální mediciny AV ČR, v.v.i., Praha 1 Zdravotní stav dětí Cíl porovnat zdravotní stav dětí žijících v Radvanicích & Bartovicích

Více

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:

Více

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací Genetika Nauka o dědid dičnosti a proměnlivosti Genetika molekulárn rní buněk organismů populací Dědičnost na úrovni nukleových kyselin Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci

Více

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD Shrnutí webináře Dystrofin 101: vše, co jste kdy chtěli vědět o dystrofinu (a nebáli jste se zeptat) Francesco Muntoni (University College of London), John Porter (PPMD) Dystrofinopatie: DMD versus BMD

Více

Příloha list Laboratorní příručky

Příloha list Laboratorní příručky _ Datum aktualizace: 15. 2.2014 Příloha list Laboratorní příručky Název metody: ASGPR Název metody na výsledcích laboratorního vyšetření: S_ASGPR IgG Jednotky: index Indikace: diferenciální diagnostika

Více

Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor

Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor Moto: Nejvyšším štěstím každé rodiny je zdravé dítě Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor ČLK, 14. února 2013 Úvod Od poznání možností, které nám nabízí prenatální diagnostika, se embryo či později

Více

SEZNAM LABORATORNÍCH VYŠETŘENÍ

SEZNAM LABORATORNÍCH VYŠETŘENÍ Laboratoř morfologická SME 8/001/01/VERZE 01 SEZNAM LABORATORNÍCH VYŠETŘENÍ Cytologické vyšetření nátěru kostní dřeně Patologické změny krevního obrazu, klinická symptomatologie s možností hematologického

Více

Genomia s.r.o. Genomia Janáčkova 51, 323 00 Plzeň

Genomia s.r.o. Genomia Janáčkova 51, 323 00 Plzeň Laboratoř uplatňuje flexibilní přístup k rozsahu akreditace upřesněný v dodatku. Aktuální seznam činností prováděných v rámci požadovaného flexibilního rozsahu je k dispozici na webových stránkách laboratoře

Více

Progrese HIV infekce z pohledu laboratorní imunologie

Progrese HIV infekce z pohledu laboratorní imunologie Progrese HIV infekce z pohledu laboratorní imunologie 1 Lochmanová A., 2 Olbrechtová L., 2 Kolčáková J., 2 Zjevíková A. 1 OIA ZÚ Ostrava 2 klinika infekčních nemocí, FN Ostrava HIV infekce onemocnění s

Více

Písemná zpráva zadavatele

Písemná zpráva zadavatele Písemná zpráva zadavatele veřejné zakázky zadávané dle zákona č. 137/2006 Sb., o veřejných zakázkách, ve znění účinném ke dni zahájení zadávacího řízení (dále jen ZVZ ). Veřejná zakázka Název: Ostatní

Více

Myopatie u koní a jejich diferenciální diagnostika

Myopatie u koní a jejich diferenciální diagnostika Myopatie u koní a jejich diferenciální diagnostika Eva Ludvíková Diagnostika onemocnění svalů je založena na správném získání anamnézy, klinickém vyšetření pacienta a biochemickém vyšetření krve (stanovení

Více

Projekt realizovaný na SPŠ Nové Město nad Metují

Projekt realizovaný na SPŠ Nové Město nad Metují Projekt realizovaný na SPŠ Nové Město nad Metují s finanční podporou v Operačním programu Vzdělávání pro konkurenceschopnost Královéhradeckého kraje Modul 02 Přírodovědné předměty Hana Gajdušková 1 Viry

Více

2,00-4,00. 6 týdnů - koagulačně 60-120 Protein S (PS) koagulačně 50-150 % citrát 1:10-6 týdnů APC-řeď.FV deficientní

2,00-4,00. 6 týdnů - koagulačně 60-120 Protein S (PS) koagulačně 50-150 % citrát 1:10-6 týdnů APC-řeď.FV deficientní Laboratorní příručka Příloha1: Přehled vyšetření prováděných v laboratoři 105_LP_08_01_Přílohač1 sodný k provádění laboratorních testů: doby odezvy (tzv Turn-Around Time, TAT) jsou ve shodě s doporučeními

Více

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Brno, 17.5.2011 Izidor (Easy Door) Osnova přednášky 1. Proč nás rakovina tolik zajímá?

Více

Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013 Lékařská genetika a onkologie Renata Gaillyová OLG a LF MU Brno 2012/2013 *genetické souvislosti *onkogenetická vyšetření u onkologických onemocnění * genetické vyšetření u hereditárních nádorů *presymptomatické

Více

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Kamila Zdeňková Transgenní rostliny, tj. takové rostliny, do jejichž dědičného základu byly metodami genového inženýrství

Více

FLUORESCENČNÍ MIKROSKOP

FLUORESCENČNÍ MIKROSKOP FLUORESCENČNÍ MIKROSKOP na gymnáziu Pierra de Coubertina v Táboře Pavla Trčková, kabinet Biologie, GPdC Tábor Co je fluorescence Fluorescence je jev spočívající v tom, že některé látky (fluorofory) po

Více

Vaše cesta ke zdravému dítěti

Vaše cesta ke zdravému dítěti Vážení klienti, Vaše cesta ke zdravému dítěti Preimplantační genetická diagnostika Sanatorium REPROMEDA patří již téměř 15 let mezi přední česká i evropská centra reprodukční medicíny. Již od počátku své

Více

Variabilita heterochromatinové oblasti lidského chromosomu 9 z evolučního a klinického hlediska

Variabilita heterochromatinové oblasti lidského chromosomu 9 z evolučního a klinického hlediska Variabilita heterochromatinové oblasti lidského chromosomu 9 z evolučního a klinického hlediska A. Šípek jr. (1), R. Mihalová (1), A. Panczak (1), L. Hrčková (1), P. Lonský (2), M. Janashia (1), M. Kohoutová

Více

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno Zpracování a využití biologického materiálu pro výzkumné účely od nemocných s monoklonální gamapatií Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie,

Více

Informace VZP ČR k indikaci a vykazování laboratorních genetických vyšetření (odbornost 816)

Informace VZP ČR k indikaci a vykazování laboratorních genetických vyšetření (odbornost 816) Příloha č.1 Informace VZP ČR k indikaci a vykazování laboratorních genetických vyšetření (odbornost 816) Upozorňujeme smluvní partnery, lékaře i laboratoře, na základní pravidla a postupy při indikaci

Více

Projekt vyhledávání pacientů s Pompeho nemocí v ČR metodou suché kapky krve

Projekt vyhledávání pacientů s Pompeho nemocí v ČR metodou suché kapky krve Projekt vyhledávání pacientů s Pompeho nemocí v ČR metodou suché kapky krve Stanislav Voháňka, Hana Ošlejšková Eva Slouková, Janette Fartelová Neurologická klinika FN a LF MU Brno Klinika dětské neurologie

Více

Chromosomové změny. Informace pro pacienty a rodiny

Chromosomové změny. Informace pro pacienty a rodiny 12 Databáze pracovišť poskytujících molekulárně genetická vyšetření velmi častých genetických onemocnění v České republice (CZDDNAL) www.uhkt.cz/nrl/db Chromosomové změny Unique - Britská svépomocná skupina

Více

Genetická "oblast nejasnosti" u HCH: co to znamená? Genetický základ

Genetická oblast nejasnosti u HCH: co to znamená? Genetický základ Novinky ve výzkumu Huntingtonovy nemoci. Ve srozumitelném jazyce. Napsáno vědci. Určeno široké huntingtonské veřejnosti. Genetická "oblast nejasnosti" u HCH: co to znamená? Přechodní alely a alely s redukovanou

Více

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11.

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. Personalizovaná medicína Roche v oblasti onkologie Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. listopadu 2013 Personalizovaná vs standardní péče Cílená léčba Spojení diagnostiky

Více

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza Iveta Valášková ivalskova@fnbrno.cz Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza nejčastěji se vyskytující autozomálně recesivní dědičná metabolická porucha v zakavkazské

Více

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction

Více

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetik Ústv biologie lékřské genetiky.lf UK VFN, Prh Polymorfismy lidské DN vyu ívné ve vzebné nlýze, p ímé nep ímé dignostice Mikrostelity (syn. krátké tndemové repetice) STR short tndem

Více

Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12

Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12 Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12 Firma Abbott Laboratories nabízí na imunoanalytických systémech ARCHITECT test ke stanovení biologicky aktivní části vitaminu

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

Martina Havlíčková Helena Jiřincová. NRL pro chřipku, Státní zdravotní ústav

Martina Havlíčková Helena Jiřincová. NRL pro chřipku, Státní zdravotní ústav Pandemic H1N1 2009 Martina Havlíčková Helena Jiřincová NRL pro chřipku, Státní zdravotní ústav Z historie H1N1 1916-1917 pravděpodobná cirkulace viru, malá ohniska, lokální epidemie ve vojenských táborech,

Více

Zkušenosti s diagnostikou sepse pomocí testu SeptiFast Test M GRADE. Zdeňka Doubková Klinická mikrobiologie a ATB centrum VFN Praha

Zkušenosti s diagnostikou sepse pomocí testu SeptiFast Test M GRADE. Zdeňka Doubková Klinická mikrobiologie a ATB centrum VFN Praha Zkušenosti s diagnostikou sepse pomocí testu SeptiFast Test M GRADE Zdeňka Doubková Klinická mikrobiologie a ATB centrum VFN Praha Definice: Sepse je definována jako syndrom systémové zánětlivé odpovědi

Více

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba?

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? HD - Huntingtonova chorea monogenní choroba HD 4 HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? 0% geny 100% podíl genů a prostředí na rozvoji chorob 0% prostředí 100% F8 - hemofilie A monogenní

Více

Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi. Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi

Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi. Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi Co je to vlastně ta fluorescence? Některé látky (fluorofory)

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

,, Cesta ke zdraví mužů

,, Cesta ke zdraví mužů PREZENTACE VÝSLEDKŮ ŘEŠENÍ PILOTNÍHO PROJEKTU PREVENTIVNÍ PÉČE PRO MUŢE,, Cesta ke zdraví mužů prim. MUDr. Monika Koudová GHC GENETICS, s.r.o.- NZZ, Praha Projekt byl realizován ve dvou etapách: I. etapa

Více

Vzdělávací program specializačního vzdělávání v oboru

Vzdělávací program specializačního vzdělávání v oboru Vzdělávací program specializačního vzdělávání v oboru 1 Cíl specializačního vzdělávání... 2 2 Minimální požadavky na specializační vzdělávání... 2 2.1 Základní kmen pro klinické laboratorní obory klinická

Více

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 10 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 26.06.2014 Ročník: 6AF, 6BF Anotace DUMu: Procesy následující bezprostředně po transkripci.

Více

Transplantace jater pro erythropoetickou protoporfýriivýznam adekvátní biliární drenáže

Transplantace jater pro erythropoetickou protoporfýriivýznam adekvátní biliární drenáže Transplantace jater pro erythropoetickou protoporfýriivýznam adekvátní biliární drenáže J. Šperl, S. Fraňková, M. Jirsa, I. Subhanová, L. Vítek, P. Martásek, M. Adamec, P. Trunečka, J. Špičák Institut

Více

Co se o sobě dovídáme z naší genetické informace

Co se o sobě dovídáme z naší genetické informace Genomika a bioinformatika Co se o sobě dovídáme z naší genetické informace Jan Pačes, Mgr, Ph.D Ústav molekulární genetiky AVČR, CZECH FOBIA (Free and Open Bioinformatics Association) hpaces@img.cas.cz

Více

Interpretace výsledků měření základních lymfocytárních subpopulací očima (průtokového J ) cytometristy a klinického imunologa

Interpretace výsledků měření základních lymfocytárních subpopulací očima (průtokového J ) cytometristy a klinického imunologa Interpretace výsledků měření základních lymfocytárních subpopulací očima (průtokového J ) cytometristy a klinického imunologa Marcela Vlková, Zdeňka Pikulová Fakultní nemocnice u sv. Anny v Brně Ústav

Více

Návrh směrnice pro správnou laboratorní praxi pro molekulárně genetické vyšetřování Huntingtonovy choroby

Návrh směrnice pro správnou laboratorní praxi pro molekulárně genetické vyšetřování Huntingtonovy choroby Návrh směrnice pro správnou laboratorní praxi pro molekulárně genetické vyšetřování Huntingtonovy choroby Připravily: V.Kebrlová, J.Židovská Poslední revize: březen 2007 Směrnice jsou sestaveny podle doporučení

Více

Laboratorní diagnostika Močových onemocnění

Laboratorní diagnostika Močových onemocnění Laboratorní diagnostika Močových onemocnění Onemocnění močového aparátu Chronická močová onemocnění jsou jedny z nejčastějších onemocnění psů a koček Častou příčinou jsou chronické infekce močových cest

Více

Pavel Čermák. Thomayerova nemocnice Praha - Krč. 14.2.2013 výroční zasedání SLM

Pavel Čermák. Thomayerova nemocnice Praha - Krč. 14.2.2013 výroční zasedání SLM Pavel Čermák Thomayerova nemocnice Praha - Krč Úkoly na rok 2012 Vytvoření seznamu přístrojů Doplnění podkladů pro kalkulaci Možná úprava některých stávajících výkonů?? Revize pracovních časů u všech výkonů

Více

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Níže uvedené komentáře by měly pomoci soutěžícím z kategorie B ke snazší orientaci

Více

CLP ANALYSIS OF MOLECULAR MARKERS DIGITAL IMAGE ANALYSIS OF ELECTROPHOEROGRAMS CZECH VERSION

CLP ANALYSIS OF MOLECULAR MARKERS DIGITAL IMAGE ANALYSIS OF ELECTROPHOEROGRAMS CZECH VERSION CLP ANALYSIS OF MOLECULAR MARKERS DIGITAL IMAGE ANALYSIS OF ELECTROPHOEROGRAMS CZECH VERSION DIGITÁLNÍ OBRAZOVÁ ANALÝZA ELEKTROFORETICKÝCH GELŮ *** Vyhodnocování získaných elektroforeogramů: Pro vyhodnocování

Více

Klinické sledování. Screening kardiomyopatie na podkladě familiární transthyretinové amyloidózy. u pacientů s nejasnou polyneuropatií

Klinické sledování. Screening kardiomyopatie na podkladě familiární transthyretinové amyloidózy. u pacientů s nejasnou polyneuropatií Klinické sledování Screening kardiomyopatie na podkladě familiární transthyretinové amyloidózy u pacientů s nejasnou polyneuropatií Informace pro pacienta Vážená paní, vážený pane, Na základě dosud provedených

Více

GENETICKÉ PORADENSTVÍ. u pacientů s epidermolysis bullosa congenita. MUDr. Renata Gaillyová, Ph.D.

GENETICKÉ PORADENSTVÍ. u pacientů s epidermolysis bullosa congenita. MUDr. Renata Gaillyová, Ph.D. GENETICKÉ PORADENSTVÍ u pacientů s epidermolysis bullosa congenita MUDr. Renata Gaillyová, Ph.D. Homozygot jedinec, který zdědil po rodičích tutéž alelu. Jedinec nebo genotyp s identickými alelami v daném

Více

Pavlína Tinavská Laboratoř imunologie, Nemocnice České Budějovice

Pavlína Tinavská Laboratoř imunologie, Nemocnice České Budějovice Pavlína Tinavská Laboratoř imunologie, Nemocnice České Budějovice nízce agresivní lymfoproliferativní onemocnění základem je proliferace a akumulace klonálních maligně transformovaných vyzrálých B lymfocytů

Více

Charakteristika analýzy:

Charakteristika analýzy: Charakteristika analýzy: Identifikace: DIAGNOSTIKA PORUCHY JATERNÍCH FUNKCÍ, DECHOVÝ TEST S C 13 -METHACETINEM Využití: diagnostika poruch jaterních funkcí (demetylační, oxidační) Referenční mez: viz tabulka

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Diagnostické metody v lékařské mikrobiologii

Diagnostické metody v lékařské mikrobiologii Diagnostické metody v lékařské mikrobiologii Výuková prezentace z: Lékařské mikrobiologie Jan Smíšek ÚLM 3. LF UK 2009 Princip identifikace Soubor znaků s rozdílnou diskriminační hodnotou Základní problémy

Více

DEN OTEVŘENÝCH DVEŘÍ NA ÚMG

DEN OTEVŘENÝCH DVEŘÍ NA ÚMG DEN OTEVŘENÝCH DVEŘÍ NA ÚMG Místo konání: Datum a doba konání: Budova F, Vídeňská 1083, 142 20 Praha 4-Krč 31. 10. 2014 od 9:00 do 16:00 hod. Kontakt pro styk s veřejností: Organizační záležitosti: Leona

Více

Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření

Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření Název sondy / vyšetřovaného syndromu vyšetřovaný gen / oblast použití Fast FISH souprava prenatálních sond DiGeorge

Více

CÉVNÍ MALFORMACE MOZKU - KAVERNOMY

CÉVNÍ MALFORMACE MOZKU - KAVERNOMY CÉVNÍ MALFORMACE MOZKU - KAVERNOMY E.Vítková, D.Krajíčková, J.Náhlovský Neurologická a Neurochirurgická klinika LF UK a FN Hradec Králové Kavernomy Makroskopicky Morušovitý útvar mm až několik cm Dutinky

Více

P ehled výsledk z Referen ní laborato e

P ehled výsledk z Referen ní laborato e P ehled výsledk z Referen ní laborato e 1,3 Hajdúch M, 1,3 Trojanec R, 2,3 Kolá Z, 1,3 Bouchalová K, 2,3 Sedláková E. 1 Laborato experimentální medicíny p i D tské klinice LF UP a FN Olomouc 2 Laborato

Více

Výuka genetiky na Přírodovědecké fakultě MU

Výuka genetiky na Přírodovědecké fakultě MU MASARYKOVA UNIVERZITA Přírodovědecká fakulta Výuka genetiky na Přírodovědecké fakultě MU Jiří Doškař Ústav experimentální biologie, Oddělení genetiky a molekulární biologie 1 V akademickém roce 1964/1965

Více

Sylabus pro předmět Biochemie pro jakost

Sylabus pro předmět Biochemie pro jakost Sylabus pro předmět Biochemie pro jakost Kód předmětu: BCHJ Název v jazyce výuky: Biochemie pro Jakost Název česky: Biochemie pro Jakost Název anglicky: Biochemistry Počet přidělených ECTS kreditů: 6 Forma

Více

PROVÁDĚNÍ VŠEOBECNÉHO PRENATÁLNÍHO SCREENINGU

PROVÁDĚNÍ VŠEOBECNÉHO PRENATÁLNÍHO SCREENINGU Doporučený postup č. 1: PROVÁDĚNÍ VŠEOBECNÉHO PRENATÁLNÍHO SCREENINGU VROZENÝCH VÝVOJOVÝCH VAD Účinnost k 15. 1. 2014 Stav změn: 1. vydání. Tento postup navazuje na snahu o vytvoření Metodického návodu

Více

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR Mikrobiologický ústav AV ČR Příloha 6 Havarijní plán 1/5 Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR a) Adresa pracoviště Mikrobiologický ústav AV ČR

Více

V organismu se bílkoviny nedají nahradit žádnými jinými sloučeninami, jen jako zdroj energie je mohou nahradit sacharidy a lipidy.

V organismu se bílkoviny nedají nahradit žádnými jinými sloučeninami, jen jako zdroj energie je mohou nahradit sacharidy a lipidy. BÍLKOVINY Bílkoviny jsou biomakromolekulární látky, které se skládají z velkého počtu aminokyselinových zbytků. Vytvářejí látkový základ života všech organismů. V tkáních vyšších organismů a člověka je

Více

PŘEHLED OBECNÉ HISTOLOGIE

PŘEHLED OBECNÉ HISTOLOGIE PŘEDMLUVA 8 1. ZÁKLADY HISTOLOGICKÉ TECHNIKY 9 1.1 Světelný mikroskop a příprava vzorků pro vyšetření (D. Horký) 9 1.1.1 Světelný mikroskop 9 1.1.2 Zásady správného mikroskopování 10 1.1.3 Nejčastější

Více

analýza dat a interpretace výsledků

analýza dat a interpretace výsledků Genetická transformace bakterií III analýza dat a interpretace výsledků Předmět: Biologie ŠVP: Prokaryotní organismy, genetika Doporučený věk žáků: 16-18 let Doba trvání: 45 minut Specifické cíle: analyzovat

Více

Metody nukleární medicíny. Doc.RNDr. Roman Kubínek, CSc. Předmět: lékařská přístrojová technika

Metody nukleární medicíny. Doc.RNDr. Roman Kubínek, CSc. Předmět: lékařská přístrojová technika Metody nukleární medicíny Doc.RNDr. Roman Kubínek, CSc. Předmět: lékařská přístrojová technika Nukleární medicína Zobrazení metodami nukleární medicíny (rovněž označované jako skenování) patří mezi diagnostické

Více

Genetické testování pro zdravotní účely

Genetické testování pro zdravotní účely Genetické testování pro zdravotní účely ZA JAKÝCH OKOLNOSTÍ PŘICHÁZÍ V ÚVAHU GENETICKÉ TESTOVÁNÍ? PROFESIONÁLNÍ GENETICKÉ PORADENSTVÍ CO HLEDÁ GENETICKÉ VYŠETŘENÍ VAŠE ROZHODNUTÍ Genetické testování pro

Více

Molekulární základ dědičnosti

Molekulární základ dědičnosti Molekulární základ dědičnosti Dědičná informace je zakódována v deoxyribonukleové kyselině, která je uložena v jádře buňky v chromozómech. Zlomovým objevem pro další rozvoj molekulární genetiky bylo odhalení

Více

CDT a další. laboratorní markery. objektivizaci abusu a efektivity léčby. MUDr. Pavla Vodáková, RNDr. Milan Malý

CDT a další. laboratorní markery. objektivizaci abusu a efektivity léčby. MUDr. Pavla Vodáková, RNDr. Milan Malý CDT a další laboratorní markery používan vané v našem zařízen zení při objektivizaci abusu a efektivity léčby MUDr. Pavla Vodáková, RNDr. Milan Malý Nejčastější užívané markery CDT GGT AST/ALT MCV Méně

Více

Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku. Richard J W Currie

Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku. Richard J W Currie Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku Richard J W Currie Virus infekční bronchitidy RNA (nukleová kyselina) uvnitř Proteiny (spike proteiny S1 a S2) na vnější straně

Více