Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Rozměr: px
Začít zobrazení ze stránky:

Download "Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA"


1 Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné postupy, předcházející diagnostice (izolace a uchovávání nukleových kyselin). 2) Směrnice nezahrnují indikace pro molekulárně genetickou analýzu jaderně-kódovaných genů vedoucích k mitochondriálním onemocněním. Ve většině případů jsou tyto geny analyzovány až na základě biochemického (stanovení množství a funkce OXPHOS) nebo molekulárně-genetického (mtdna delece, deplece) vyšetření. Mitochondrie a mitochondriální DNA Mitochondriální onemocnění přes svou klinickou a genetickou heterogenitu jsou charakterizovány poruchami funkce komplexů dýchacího řetězce, respektive systému oxidativní fosforylace (OXPHOS)[1]. Systém OXPHOS je lokalizován ve vnitřní mitochondriální membráně. Jeho 5 enzymových komplexů je tvořeno z více než 80 podjednotek, velká většina z nich je kódována jadernou DNA a do mitochondrií importována. 13 klíčových podjednotek komplexů OXPHOS je kódováno mitochondriální DNA (mtdna), jedinou nechromozomální DNA přítomnou v lidských buňkách[2]. MtDNA je malá (16,5 kb) cirkulární molekula, v buňkách je přítomna v tisíci kopiích a vykazuje maternální dědičnost. Proteiny zodpovědné za údržbu, replikaci a expresi mtdna jsou kódovány jaderně, defekt ve kterémkoliv z nich může vést k mitochondriálnímu onemocnění[3, 4]. MtDNA heteroplazmie, threshold a segregace Přítomnost tisíců molekul mtdna v buňkách hraje důležitou roli v projevu patogenních mtdna mutací na úrovni fenotypu, jak biochemického, tak i klinického. Homoplazmie je stav, kdy jsou všechny molekuly mtdna v buňce identické. Naproti tomu, většina pacientů nesoucích patogenní mutaci v mtdna mají ve svých buňkách směs mutovaných a nemutovaných (normálních) molekul mtdna, stav označovaný jako heteroplazmie. K projevům heteroplazmické mutace dojde tehdy, pokud množství mutovaných molekul mtdna v buňce přesáhne určitou prahovou hodnotu (threshold). V průběhu buněčného dělení jsou mutované a normální molekuly mtdna pravděpodobně rozděleny náhodně do dceřiných buněk. Náhodná segregace vede k různým hladinám heteroplazmie mezi jednotlivými buňkami, tkáněmi a jednotlivci, což následně ovlivňuje fenotypové projevy mitochondriální onemocnění a jeho dědičnost. V post-mitotických tkáních (např. kosterní sval, bývá často i klinicky postižený) dochází k akumulaci mutovaných molekul mtdna (vyšší hladina heteroplazmie), proto je DNA z těchto tkání preferována pro diagnostiku některých mutací v mtdna, ačkoli řadu mutací lze spolehlivě detekovat i v krvi. Klinické projevy onemocnění způsobených mutacemi mtdna Přestože mitochondriální onemocnění představují klinicky heterogenní skupinu onemocnění, existuje řada dobře definovaných mitochondriálních Strana 1 (celkem 8)

2 syndromů charakterizovaných konkrétními klinickými projevy. Mezi nejznámější syndromy patří chronická progresivní externí oftalmoplegie (CPEO), Kearns-Sayreův syndrom (KSS) externí oftalmoplegie, ptóza a rozsáhlé přestavby mtdna (jednoduché nebo násobné). Mitochondriální encefalomyopatie s laktátovou acidózou a iktu podobnými příhodami (MELAS syndrom), myoklonická epilepsie s ragged-red svalovými vlákny (MERRF syndrom) a neurogenní svalová slabost, ataxie a retinitispigmentosa (NARP syndrom) jsou spojovány s bodovými mutacemi v mtdna (3243A>G, 8344A>G a 8993T>G,C). Dalším častým mitochondriálním onemocněním, diagnostikovaným obvykle oftalmology, je Leberova hereditární optická neuropatie (LHON syndrom) je způsobena bodovými mutacemi v mtdna (3460G>A, 11778G>A nebo 14484T>C). Laboratorní diagnostika mitochondriálních onemocnění Stanovení diagnózy mitochondriálního onemocnění vyžaduje kombinaci informací z řady vyšetření. Vedle klinických údajů jsou to výsledky specifických analýz: histochemické vyšetření svalové biopsie, biochemické stanovení aktivit komplexů dýchacího řetězce a jejich složení a molekulárně-genetické vyšetření. V ideálním případě by klinická, biochemická a histochemická data měla nasměrovat molekulárně genetické vyšetření, ať už zahrnující analýzu mtdna nebo genů lokalizovaných na jaderné DNA. Výše uvedené mutace v mtdna jsou však vyšetřovány často jako první bez ohledu na výsledky biochemických vyšetření jenom na základě klinických projevů, screeningově jsou tyto mutace vyšetřovány v krvi. Diagnostika Pozn.: Jsou uvedeny metody, které jsou rutinně používány v Laboratoři pro studium mitochondriálních poruch, KDDL 1.LF UK a VFN v Praze. Sekvenování mtdna není popsáno neboť nepatří mezi rutinní vyšetření, je indikováno až po detailním biochemickém vyšetření a vyloučení častých mutací v mtdna. Přestože i pro diagnostiku mutací v mtdna jsou zaváděny nové metody, uvedené postupy jsou stále používány v bežném screeningu v řadě evropských laboratoří. Mutace 3243A>G v mtdna Tkáň vhodná k zachycení mutace: krev(*), močový sediment(**), sval(***) OMIM: * (klinické projevy spojené s mutací), #54000 (syndrom MELAS další mutace, nebývají součástí screeningu) Metoda: PCR-RFLP Amplifikace úseku mtdna od 3135 do Sekvence primerů: F 5 AGGACAAGAGAAATAAGGC 3 R 5 TAGAAGAGCGATGGTGAGAG 3 Podmínky PCR reakce: 30 x (95 C 10 sec, 58 C 15 sec, 72 C 45 sec), konečná elongace 72 C 5 min. PCR produkt o délce 428 bp je štěpen restrikčním enzymem ApaI. Jeli mutace přítomna, dojde k rozštěpení části (heteroplazmie) PCR produktu na fragmenty o délce 308 a 120 bp. Produkty jsou rozděleny ve 2,5% agarózovém gelu, obarveny etidiumbromidem a Strana 2 (celkem 8)

3 vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě pozitivního nálezu je stanovena hladina heteroplazmie (množství mutovaných mtdna molekul). Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). Následuje restrikce enzymem ApaI a separace restrikčních fragmentů na 8% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita rozštěpených fragmentů k intenzitě nerozštěpeného produktu. Na gelu je vždy přítomna pozitivní i negativní kontrola. Pozn. Radioaktivní značení je v některých laboratořích nahrazováno fluorescenčním a restrikční fragmenty jsou separovány kapilární elektroforézou a detekovány laserem. Od jara 2009 je v Laboratoři pro studium mitochondriálních poruch nově záváděna metoda detekce heteroplazmické mutace 3243A>G pomocí real-time PCR s využitím TaqMan sond. Interpretace: V případě pozitivního nálezu je vždy uvedena hladina heteroplazmie ve vyšetřované tkáni. K prognóze onemocnění však nemůže být použita, doposud nebyla jednoznačně prokázána souvislost mezi hladinou heteroplazmie v jednotlivých tkáních a závažností klinických projevů. Mutace 8344A>G Tkáň vhodná k zachycení mutace: krev(**), sval(***) OMIM: * (klinické projevy spojené s mutací), # (syndrom MERRF) Metoda: PCR-RFLP Amplifikace úseku mtdna od 8278 bp do 8385 bp. Sekvence primerů: F 5 CTACCCCCTCTAGAGCCCAC 3 R 5 GTAGTATTTAGTTGGGGCATTTCACTGTAAAGC * C * GTGTTGG 3 Podmínky PCR reakce: počáteční denaturace 95 C 2 min, 30 x (94 C 20 sec, 62 C 15 sec, 72 C 20 sec), konečná elongace 72 C 5 min. PCR produkt o délce 108 bp je štěpen restrikčním enzymem BglI. Je-li mutace přítomna, dojde k rozštěpení části (heteroplazmie) PCR produktu na fragmenty o délce 73 a 35 bp. Restrikční fragmenty jsou separovány v 3,5% agarózovém gelu, obarveny etidiumbromidem a vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě pozitivního nálezu je stanovena hladina heteroplazmie (množství mutovaných mtdna molekul). Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). Následuje restrikce enzymem BglI a separace restrikčních fragmentů na 10% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita rozštěpených Strana 3 (celkem 8)

4 fragmentů k intenzitě nerozštěpeného produktu. Na gelu je vždy přítomna pozitivní i negativní kontrola. Interpretace: V případě pozitivního nálezu je vždy uvedena hladina heteroplazmie ve vyšetřované tkáni. K prognóze onemocnění však nemůže být použita, doposud nebyla jednoznačně prokázána souvislost mezi hladinou heteroplazmie v jednotlivých tkáních a závažností klinických projevů. Mutace 8993T>G,C Tkáň vhodná k zachycení mutace: krev(***), sval(***) OMIM: * (klinické projevy spojené s mutací), # (syndrom NARP) Metoda: PCR-RFLP Amplifikace úseku mtdna od 8798 bp do 9086 bp. Sekvence primerů: F 5 CATTTACACCAACCACCCAAC 3 R 5 GGAAGGTTAATGGTTGATATTGC 3. Podmínky PCR reakce: počáteční denaturace 95 C 2 min, 29 x (95 C 30 sec, 58 C 20 sec, 72 C 40 sec), konečná elongace 72 C 2 min. PCR produkt o velikosti 289 bp je štěpen restrikčním enzymem HpaII. Je-li přítomna mutace (G nebo C), dojde k rozštěpení většiny (bývá vysoká hladina heteroplazmie) PCR produktu na fragmenty o velikosti 194 a 95 bp. Pro rozlišení o jakou variantu mutace se jedná (G nebo C), je PCR produkt štěpen restrikčním enzymem AvaI. Je-li přítomna varianta G, dojde k rozštěpení PCR produktu na fragmenty o velikosti 193 a 96 bp. Variantu C enzym AvaI neštěpí. Restrikční fragmenty jsou separovány na 3,5% agaróze, obarveny etidiumbromidem a vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě pozitivního nálezu je stanovena hladina heteroplazmie (množství mutovaných mtdna molekul). Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). Následuje restrikce enzymem HpaII a separace restrikčních fragmentů na 10% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita rozštěpených fragmentů k intenzitě nerozštěpeného produktu. Na gelu je vždy přítomna pozitivní i negativní kontrola. Interpretace: V případě pozitivního nálezu je vždy uvedena hladina heteroplazmie ve vyšetřované tkáni. Hladina heteroplazmie bývá většinou velmi vysoká i v DNA izolované z krve, byla pozorována korelace mezi hladinou heteroplazmie a závažností klinických projevů onemocnění Strana 4 (celkem 8)

5 Mutace 3460G>A, 11778G>A a 14484T>C Leberova hereditární optická neuropatie Tkáň vhodná k zachycení mutace: krev(***) OMIM: # (syndrom LHON, vyšetřují se pouze 3 nejčastější mutace) Metoda: PCR-RFLP Mutace 3460G>A: Amplifikace mtdna v úseku od 3130 do 3557 bp. Sekvence primerů F 5 AGGACAAGAGAAATAAGGC 3 R 5 TAGAAGAGCGATGGTGAGAG 3. Podmínky PCR reakce: 29x(95 C 10 sec, 58 C 15 sec, 72 C 30 sec), konečná elongace 72 C 5 min. PCR produkt o délce 428 bp je štěpen restrikčním enzymem BsaHI. Je-li mutace přítomna, PCR produkt se neštěpí. V nepřítomnosti mutace dochází k jeho rozštěpení na fragmenty o velikosti 329 a 99 bp. Produkty jsou rozděleny ve 2,5% agarózovém gelu, obarveny etidiumbromidem a vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě pozitivního nálezu je stanovena hladina heteroplazmie (množství mutovaných mtdna molekul). Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). Následuje restrikce enzymem BsaHI a separace restrikčních fragmentů na 8% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita nerozštěpeného produktu k intenzitě rozštěpených fragmentů. Na gelu je vždy přítomna pozitivní i negativní kontrola. Mutace 11778G>A: Amplifikace oblasti mtdna od do bp. Sekvence primerů: F 5 GCTTCACCGGCGCAGTCATTCTC 3 R 5 AGCGAGGCTTGCTAGAAGTCATC 3. Podmínky PCR reakce: počáteční denaturace 95 C 2 min, 33x(95 C 15 sec, 66 C 25 sec, 72 C 15 sec), konečná elongace 72 C 5 min. PCR produkt o délce 174 bp je štěpen restrikčním enzymem MaeIII. Je-li mutace přítomna, PCR produkt se rozštěpí na fragmenty o velikosti 94 bp a 80 bp. V nepřítomnosti mutace se PCR produkt neštěpí. Produkty jsou rozděleny ve 3,5% agarózovém gelu, obarveny etidiumbromidem a vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě nálezu mutace je stanovena hladina heteroplazmie. K jejímu stanovení se využívá restrikčního enzymu AciI, protože enzym MaeIII neštěpí úplně všechny mutované molekuly mtdna. Amplifikace mtdna v oblasti od do bp. Sekvence primerů: F 5 CTCAAACTACGAACGCACTCACAGC * C 3 R 5 AGCGAGGCTTGCTAGAAGTCATC Strana 5 (celkem 8)

6 Podmínky PCR reakce: počáteční denaturace 95 C 2 min, 33x(95 C 15 sec, 66 C 25 sec, 72 C 15 sec), konečná elongace 72 C 5 min. Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). PCR produkt o délce 104 bp je štěpen restrikčním enzymem AciI. Je-li mutace přítomna, PCR produkt se neštěpí. V nepřítomnosti mutace dochází k jeho rozštěpení na fragmenty o velikosti 78 a 26 bp. Restrikční fragmenty jsou separovány na 10% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita nerozštěpeného produktu k intenzitě rozštěpených fragmentů. Na gelu je vždy přítomna pozitivní i negativní kontrola. Mutace 14484T>C: Amplifikace mtdna v úseku od do bp. Sekvence primerů: F 5 ATCCTCCCGAATCAACCCTGA 3 R 5 TTTTTTTAATTTATTTAGGGGGC * C * TG 3 Podmínky PCR reakce: 29x(95 C 10 sec, 45 C 15 sec, 72 C 30 sec), konečná elongace 72 C 5 min. PCR produkt o délce 250 bp je štěpen restrikčním enzymem MvaI. Jeli mutace přítomna, dojde k rozštěpení části (heteroplazmie) PCR produktu na fragmenty o délce 235 bp a 15 bp. Restrikční fragmenty jsou separovány v 3,5% agarózovém gelu, obarveny etidiumbromidem a vizualizovány pod UV světlem. S vyšetřovanými pacienty je vyšetřována vždy i pozitivní a negativní kontrola. V případě pozitivního nálezu je stanovena hladina heteroplazmie (množství mutovaných mtdna molekul). Do posledního cyklu PCR reakce je přidán 1μl 20x ředěného izotopu [α 32 P-dCTP](Amersham Biosciences, kat. č. A μCi). Následuje restrikce enzymem MvaI a separace restrikčních fragmentů na 10% vertikálním polakrylamidovém gelu v 1xTBE. Po vysušení je gel exponován přes noc v kazetě Storage Phosphor Screen (Molecular Dynamics). Následuje analýza pomocí PhosphorImageru, programem ImageQuant (Amersham Biosciences). Hladina heteroplazmie je stanovena jako intenzita rozštěpených fragmentů k intenzitě nerozštěpeného produktu. Na gelu je vždy přítomna pozitivní i negativní kontrola. Interpretace: V případě pozitivního nálezu je vždy uvedena nalezená mutace a hladina její heteroplazmie ve vyšetřované tkáni. Mutace bývají většinou homoplazmické i v krvi. Detekce nejčastějších mutací pro syndrom LHON je problematická, její nález je dobré ověřit další nezávislou metodou. Od jara 2009 je v Laboratoři pro studium mitochondriálních poruch nově záváděna metoda detekce heteroplazmické mutace 11778G>A pomocí real-time PCR s využitím TaqMan sond Strana 6 (celkem 8)

7 Rozsáhlé delece v mtdna Tkáň vhodná k zachycení delece: sval (***), močový sediment (**pouze LX-PCR), krev (*pouze LX-PCR, nemusí být přítomny delece u všech pacientů s mtdna delecemi) OMIM: # (syndrom Kearns-Sayre), # (Pearsonův syndrom), #157640, #609286, #603041, * (progresivní externí oftalmoplegie) Metoda: Southern blot Celková DNA je štěpena restrikčním enzymem PvuII nebo BamHI, což vede k její linearizaci. Po elektroforetické separaci na 0,8% agaróze je přenesena na nylonovou membránu a hybridizována se sondou specifickou ke kontrolní oblasti mtdna (často je používaná i sonda specifická pro celou molekulu mtdna). Značení sondy pomocí [α 32 P]dCTP probíhá v průběhu PCR reakce. Na membráně je vždy přítomna pozitivní a negativní kontrola. Jsou-li ve vyšetřovaném vzorku přítomny deletované molekuly mtdna, na membráně je patrno více signálů pro daný vzorek. Množství deletovaných molekul mtdna se udává jako podíl intenzity signálu kratších fragmentů k intenzitě signálu o velikosti 16,5 kb. Primery: F 5 TACCATAAATACTTGACCACCTGTA 3 R 5 GCGGGGGTTGTATTGATGAGATTAG 3 Podmínky PCR reakce: 95 C 2 min, 30 x (95 C 10 sec, 59 C 30 sec, 72 C 1 min), konečná elongace 72 C 10 min. Interpretace: V případě pozitivního nálezu je vždy uvedena hladina heteroplazmie. Při interpretaci pozitivního nálezu je nutno si uvědomit, že delece mtdna mohou být přítomny i v důsledku věku pacienta nebo z důvodu jiných svalových onemocnění. Tyto sekundární mtdna delece bývají detekovány pomocí Southern blotu tehdy, je-li použito větší množství DNA (cca 10 μg). Naopak negativní nález pomocí Southern blotu neznamená, že deletované molekuly mtdna nejsou ve vzorku vůbec přítomny. Malé množství deletovaných mtdna bývá zjištěno u pacientů s některými mutacemi v genu POLG1 (kóduje mitochondriální polymerázu gama), jejich přítomnost je vodítkem pro další vyšetření. Pro jejich vyloučení je dobré použít větší množství DNA nebo citlivější metodu. Pozn. Metoda Southern blot je v současné době v Laboratoři pro studium mitochondriálních poruch prováděna pouze u vybraných pacientů a v rámci diagnostiky je plně nahrazenametodou long-range PCR (viz níže). Metoda: Long-range PCR (LX-PCR) Pomocí specifických primerů lokalizovaných v oblasti D-loopu nebo v genu 12S rrna je amplifikována celá molekula mtdna. Přítomnost dalších (kratších) PCR produktů reprezentuje deletované molekuly mtdna ve vzorku. Metoda je vysoce citlivá a může detekovat i velmi malá množství deletovaných mtdna, která nemusí přispívat ke klinickému fenotypu. Interpretace těchto nálezů je vždy obtížná a je nutné doplnit další vyšetření (Southern blot) nebo nález korelovat s biochemickým/klinickým nálezem. Při interpretaci nálezu LX-PCR je nutné si uvědomit, že násobné delece v mtdna mohou vznikat důsledkem stárnutí nebo mohou být způsobeny mutacemi v genech aparátu replikace mtdna. V takovém případě je dědičnost násobných Strana 7 (celkem 8)

8 mtdna delecí autosomálně dominantní nebo recesivní a je nutné s přihlédnutím ke klinickému fenotypu a rodinné anamnéze analyzovat další, jaderně kódované geny (POLG1, PEO1, ANT1, TYMP, OPA1). K rozhodnutí zda, zjištěné delece v mtdna jsou způsobené stárnutím nebo jsou příčinou klinického fenotypu, může pomoci intenzita PCR produktu odpovídajícího normální nedeletované molekule mtdna. Deplece mtdna Tkáň vhodná pro detekci sníženého množství mtdna: sval, játra OMIM: #609560, # (syndrome deplece mitochondriální DNA svalová, resp. hepatocerebrální forma), # (Alpersův syndrom) Metoda: kvantitativní real-time PCR Syndrom deplece mtdna je autosomálně recesivní onemocnění s nástupem v dětském věku a je charakterizováno výraznou ztrátou mtdna molekul v postižené tkáni/tkáních. Množství mtdna v tkáních se stanovuje pomocí real-time PCR, v Laboratoři pro studium mitochondriálních poruch s využitím SybrGreen a 1 páru specifických primerů pro mtdna a 1 páru specifických primerů pro vhodný referenční jaedrný gen (GAPDH), a vyjadřuje je se jako poměr množství mtdna a jaderného genu. Interpretace: Pro interpretaci nálezu, je nutné mít větší množství (5-10) věkově srovnatelných kontrol pro každou analyzovanou tkáň. Množství mtdna se mění s věkem a k poměrně výrazným změnám dochází i v průběhu prvního roku života. V případě pozitivního nálezu je nezbytné analyzovat kandidátní, jaderně kódované geny (POLG1, TK2, DGUOK, RRMB2, MPV17, SUCLA2, SUCLG1). Závěr: Je nutné si uvědomit, že mutace v mtdna mohou být přítomny v jakékoliv její části. Pro jejich úspěšnou detekci (např.pomocí sekvenování) je nutné analyzovat DNA izolovanou z postižené tkáně. Nepřítomnost jakékoli mutace v mtdna nevylučuje mitochondriální onemocnění. 1. DiMauro S, Schon EA. Mitochondrial respiratory-chain diseases. N Engl J Med. 2003; 348: Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F and others. Sequence and organization of the human mitochondrial genome. Nature. 1981; 290: Shoubridge EA. Nuclear genetic defects of oxidative phosphorylation. Hum Mol Genet. 2001; 10: Zeviani M, Spinazzola A, Carelli V. Nuclear genes in mitochondrial disorders. Curr Opin Genet Dev. 2003; 13: Strana 8 (celkem 8)

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění



DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit


Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Petr Lesný 1, Pavel Seeman 2, Daniel Groh 1 1 ORL klinika UK 2. LF a FN Motol Subkatedra dětské ORL IPVZ Přednosta doc. MUDr. Zdeněk Kabelka


Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární


Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika


Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2


Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních


Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc.

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc. Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské praxi doc. RNDr. Ivan Mazura, CSc. Historie forenzní genetiky 1985-1986 Alec Jeffreys a satelitní DNA 1980 Ray



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,


Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.


DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 3 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 02.06.2014 Ročník: 6AF, 6BF Anotace DUMu: chromatin - stavba, organizace a struktura



EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence


Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní














2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné:

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné: Výběrové otázky: 1. Součástí všech prokaryotických buněk je: a) DNA, plazmidy b) plazmidy, mitochondrie c) plazmidy, ribozomy d) mitochondrie, endoplazmatické retikulum 2. Z následujících tvrzení, týkajících


Dědičná mitochondriální onemocnění způsobená poruchou oxidativní fosforylace

Dědičná mitochondriální onemocnění způsobená poruchou oxidativní fosforylace Univerzita Karlova v Praze Pedagogická fakulta Katedra biologie a environmentálních studií Dědičná mitochondriální onemocnění způsobená poruchou oxidativní fosforylace Bakalářská práce Autor: Eva Hanušová


Pokročilé biofyzikální metody v experimentální biologii

Pokročilé biofyzikální metody v experimentální biologii Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 1/1 Proč biofyzikální metody? Biofyzikální metody využívají fyzikální principy ke studiu biologických systémů Poskytují kvantitativní


Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). Orphanet - Volně přístupné webové stránky s informacemi



DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby


Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009 Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková Parent projekt Praha 19.2.2009 Diagnostika MD její vývoj 1981-1986: zdokonalování diferenciální diagnostiky


Dědičná mitochondriální onemocnění a poruchy mitochondriální beta oxidace mastných kyselin

Dědičná mitochondriální onemocnění a poruchy mitochondriální beta oxidace mastných kyselin Dědičná mitochondriální onemocnění a poruchy mitochondriální beta oxidace mastných kyselin prim.mudr. RNDr. Pavel Ješina, Ph.D. Ústav dědičných metabolických poruch 1.LF UK, VFN Metabolická jednotka Klinika



NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ Doc. MUDr. A. Šantavá, CSc. Ústav lékařské genetiky a fetální medicíny LF a UP Olomouc Význam genetiky v diagnostice neuromuskulárních onemocnění Podílí


A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům Karlova univerzita, Lékařská fakulta Hradec Králové Obor: všeobecné lékařství - test z biologie Vyberte tu z nabídnutých odpovědí (1-5), která je nejúplnější. Otázka Odpověď 1. Mezi organely membránového


Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka


Nemendelovská dědičnost

Nemendelovská dědičnost Nemendelovská dědičnost Některá onemocnění a znaky, za které zodpovídají variace jednotlivých genů, nesledují do značné míry pravidla přenosu do dalších generací, která platí pro dědičnost "klasických"


Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace


Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní


Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA Cytogenetika telomera chromosom jádro centomera telomera buňka histony páry bazí dvoušroubovice DNA Typy chromosomů Karyotyp člověka 46 chromosomů 22 párů autosomů (1-22 od největšího po nejmenší) 1 pár


Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ


Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové


1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.


Genetický screening predispozice k celiakii

Genetický screening predispozice k celiakii VETERINÁRN RNÍ A FARMACEUTICKÁ UNIVERZITA BRNO Farmaceutická fakulta Ústav humánn nní farmakologie a toxikologie Genetický screening predispozice k celiakii RNDr. Ladislava Bartošov ová,ph.d. 1, PharmDr.


Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Mgr. Klára Vilimovská Dědečková, Ph.D. Synlab genetics s.r.o. Molekulární


2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou





Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní


Molekulární diagnostika pletencové svalové dystrofie typu 2A

Molekulární diagnostika pletencové svalové dystrofie typu 2A Molekulární diagnostika pletencové svalové dystrofie typu 2A Lenka Fajkusová Centrum molekulární biologie a genové terapie Fakultní nemocnice Brno Pletencové svalové dystrofie (Limb Girdle Muscular Dystrophy


Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace

Více Prevence vrozených vad z pohledu genetika MUDr. Vladimír Gregor, RNDr. Jiří Horáček odd. lékařské genetiky, Fakultní Thomayerova nemocnice v Praze Genetické poradenství Klinická genetika se zabývá diagnostikou


Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková Diagnostika retrovirů Lentiviry - HIV Vladislava Růžičková VI. Třída RNA-viry se zpětnou transkriptázou RT Čeleď: Retroviridae (hostitelé: Obratlovci) Rody: Alpharetrovirus Betaretrovirus Gammaretrovirus


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi


DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod.

DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. Od 1.1.2014 DYNEX jediným OFICIÁLNÍM (autorizovaným) distributorem společnosti


Detekce Leidenské mutace

Detekce Leidenské mutace Detekce Leidenské mutace MOLEKULÁRNÍ BIOLOGIE 3. Restrikční štěpení, elektroforéza + interpretace výsledků Restrikční endonukleasy(restriktasy) bakteriální enzymy štěpící cizorodou dsdna na kratší úseky


V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)


Návrh směrnice pro vydávání a interpretaci výsledků v molekulárně genetických laboratořích

Návrh směrnice pro vydávání a interpretaci výsledků v molekulárně genetických laboratořích Návrh směrnice pro vydávání a interpretaci výsledků v molekulárně genetických laboratořích Úvodní informace Tento dokument vychází z doporučení OECD (Organisation for Economic Co-operation and Development;


Studium genetické predispozice ke vzniku karcinomu prsu

Studium genetické predispozice ke vzniku karcinomu prsu Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie


Genetika dědičných neuropatií

Genetika dědičných neuropatií Genetika dědičných neuropatií P. Seeman Klinika dětské neurologie, DNA laboratoř, UK 2. LF a FN Motol Praha a CMT tým UK 2. LF a FNM CMT - dědičná choroba Známo již od Charcota, Marie a Tootha téměř 130


Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování


Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží


Buňky, tkáně, orgány, soustavy

Buňky, tkáně, orgány, soustavy Lidská buňka buněčné organely a struktury: Jádro Endoplazmatické retikulum Goldiho aparát Mitochondrie Lysozomy Centrioly Cytoskelet Cytoplazma Cytoplazmatická membrána Buněčné jádro Jadérko Karyoplazma



Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální


Metody testování humorální imunity

Metody testování humorální imunity Metody testování humorální imunity Co je to humorální imunita? Humorální = látková Buněčné produkty Nespecifická imunita příklady:» Lysozym v slinách, slzách» Sérové proteiny (proteiny akutní fáze)» Komplementový


Ondřej Scheinost Nemocnice České Budějovice, a.s.

Ondřej Scheinost Nemocnice České Budějovice, a.s. Ondřej Scheinost Nemocnice České Budějovice, a.s. Nové technologie přelomové období principy technologií klinická použitelnost chips (arrays) sekvenační technologie Důležitost genetických informací i další


Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová

Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Centrum nádorové cytogenetiky Ústav klinické biochemie a laboratorní diagnostiky VFN a 1. LF UK v Praze Klinický význam cytogenetických


Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci





Imunochemické metody. na principu vazby antigenu a protilátky

Imunochemické metody. na principu vazby antigenu a protilátky Imunochemické metody na principu vazby antigenu a protilátky ANTIGEN (Ag) specifická látka (struktura) vyvolávající imunitní reakci a schopná vazby na protilátku PROTILÁTKA (Ab antibody) molekula bílkoviny


DY D NE N X Hana Vlastníková

DY D NE N X Hana Vlastníková DYNEX Hana Vlastníková Molekulární biologie: Vybavení laboratoře na klíč Přístrojová technika Kompatibilní diagnostické soupravy Profesionální přístup SOP Technická podpora Servis Přístrojové vybavení:





Centrální dogma molekulární biologie

Centrální dogma molekulární biologie řípravný kurz LF MU 2011/12 Centrální dogma molekulární biologie Nukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Mendel) 1869 objev nukleových kyselin (Miescher) 1944 genetická informace v nukleových


Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014

Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014 Molekulárně biologické metody v mikrobiologii Mgr. Martina Sittová Jaro 2014 Harmonogram 1. den Izolace DNA 2. den Měření koncentrace DNA spektrofotometricky, real-time PCR 3. den Elektroforéza Molekulární


dokument: LP : 2016/06

dokument: LP : 2016/06 G Pokyny a instrukce G 1 Pokyny a instrukce pro lékaře G 1.1 Pokyny pro vyšetření orálního glukózového tolerančního testu (ogtt) Úvodní informace Diagnostika diabetes mellitus (DM) a porušené glukózové


Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


Tekuté biopsie u mnohočetného myelomu

Tekuté biopsie u mnohočetného myelomu Tekuté biopsie u mnohočetného myelomu Mgr. Veronika Kubaczková Babákova myelomová skupina ÚPF LF MU Pacientský seminář 11. května 2016, Brno Co jsou tekuté biopsie? Představují méně zatěžující vyšetření


Dědičná mitochondriální onemocnění a poruchy mitochondriální beta oxidace mastných kyselin

Dědičná mitochondriální onemocnění a poruchy mitochondriální beta oxidace mastných kyselin Dědičná mitochondriální onemocnění a poruchy mitochondriální beta oxidace mastných kyselin Pavel Ješina Ústav dědičných metabolických poruch 1.LF UK, VFN Metabolická jednotka Klinika dětského a dorostového


MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční


Doporučení Farmakovigilančního výboru pro posuzování rizik léčiv (PRAC) k signálům pro aktualizaci informací o přípravku

Doporučení Farmakovigilančního výboru pro posuzování rizik léčiv (PRAC) k signálům pro aktualizaci informací o přípravku 22. ledna 2015 EMA/PRAC/63322/2015 Farmakovigilanční výbor pro posuzování rizik léčiv Doporučení Farmakovigilančního výboru pro posuzování rizik léčiv (PRAC) k signálům pro aktualizaci informací o přípravku


Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right


Akreditovaný subjekt podle ČSN EN ISO 15189:2007: CGB laboratoř a.s Kořenského 10, Ostrava, Vítkovice

Akreditovaný subjekt podle ČSN EN ISO 15189:2007: CGB laboratoř a.s Kořenského 10, Ostrava, Vítkovice List 1 z 6 Pracoviště zdravotnické laboratoře: 1., Laboratoř klinické patologie a cytologie Kořenského 10, 70300 Ostrava Vítkovice Postupy vyšetření: 1 Histologická vyšetření tkání 2 Peroperační histologická


Pohled genetika na racionální vyšetřování v preventivní kardiologii

Pohled genetika na racionální vyšetřování v preventivní kardiologii Pohled genetika na racionální vyšetřování v preventivní kardiologii Tomáš Freiberger Genetická laboratoř, Centrum kardiovaskulární a transplantační chirurgie Brno, ČR Osnova Genetické faktory vzniku KV


Genetické aspekty vrozených vad metabolismu

Genetické aspekty vrozených vad metabolismu Genetické aspekty vrozených vad metabolismu Doc. MUDr. Alena Šantavá, CSc. Ústav lékařské genetiky a fetální medicíny FN a LF UP Olomouc Johann Gregor Mendel (1822-1884) Sir Archibald Garrod britský pediatr


Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin


Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk






MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


Genotypování markerů užitkovosti a zdraví u skotu

Genotypování markerů užitkovosti a zdraví u skotu Mezinárodní odborný seminář Využití chovatelských dat onemocnění skotu pro management stád, šlechtění a pro racionální užívání antimikrobik. Genotypování markerů užitkovosti a zdraví u skotu Jitka Kyseľová



TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy



POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek


Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést


Změny sazebníku výkonů pro mikrobiologické obory

Změny sazebníku výkonů pro mikrobiologické obory Změny sazebníku výkonů pro mikrobiologické obory Ing. Hana Hrbáčková LTK CEM SZÚ 2011 - Původní návrh MZ Grant Evropského fondu pro regionální rozvoj Vítěznou nabídku na řešení Kultivace Seznamu zdravotních


Laboratorní přístrojová technika

Laboratorní přístrojová technika Laboratorní přístrojová technika Co najdeme v laboratoři? Přístroje pro obecné použití centrifugy, třepačky, pipety, biohazard boxy Trocha teorie o DNA a PCR Analytické přístroje a příprava vzorků elektroforézy


Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00


ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction)


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Analýza transkriptomu Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s moderními metodami komplexní


Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip


Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Biotechnologický kurz Biotechnologický kurz II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně Zemědělská


Genetické markery - princip a využití

Genetické markery - princip a využití Genetika a šlechtění lesních dřevin Genetické markery - princip a využití Doc. Ing. RNDr. Eva Palátová, PhD. Ing. R. Longauer, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován


Genetika člověka GCPSB

Genetika člověka GCPSB Inovace předmětu Genetika člověka GCPSB Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/28.0032 Genetika člověka / GCPSB 6. Genetika


Laboratorní workshop s teoreticko praktickou ukázkou molekulárně biologických technik ve spolupráci s firmou ROCHE

Laboratorní workshop s teoreticko praktickou ukázkou molekulárně biologických technik ve spolupráci s firmou ROCHE BiochemNet vytvoření sítě pro podporu spolupráce biomedicínských pracovišť a zvýšení uplatnitelnosti absolventů biochemických oborů v praxi Laboratorní workshop s teoreticko praktickou ukázkou molekulárně
