Počet chromosomů v buňkách. Genom

Rozměr: px
Začít zobrazení ze stránky:

Download "Počet chromosomů v buňkách. Genom"


1 Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým počtem chromosomů. Poloviční počet chromosomů (N) v pohlavních buňkách (gametách spermii a vajíčku) se označuje jako haploidní, celistvý počet chromosomů (2N) v somatických (tělních) buňkách se označuje jako diploidní. Živočichové se liší počtem chromosomů. Pro člověka je N = 23. Protože žádnému jedinci nesmí chybět žádný chromosom, znamená 2N, že od každého chromosomu existují dvě kopie (páry se vytvořily při vzniku zárodečné buňky). Mohlo by se zdát, že chromosomy jsou neměnné, ale při vzniku pohlavních buněk (biologové znají proces vzniku zvaný meiosa) se hojně vyměňují mnohé geny mezi chromosomy daného páru navzájem (Crossing-over), takže v pohlavní buňce není jeden z původních chromosomů, ale jejich kombinace. chromosom A B A chromosom B Obrázek: Crossing-over přechod genu A na chromosom B a naopak Genom Veškerá genetická informace organismu se nazývá genom. Chceme-li zkoumat genom, měli bychom poznat pořadí nukleotidů v chromosomech (a těch jsou u člověka 3 miliardy párů). Projekt lidského genomu (HGP) byl navržen v 80. letech, oficiální začátek práce začal r Očekávaná doba trvání byla 15 let a očekávaná cena 3 miliardy dolarů. R vzniká HUGO (Human Genome Organization) veřejné konsorcium, které práci organizuje. Průběžné výsledky zveřejňuje. R založena soukromá společnost Celera Genomics, která použila odlišný postup. V únoru 2001 Celera publikuje v časopise Science sekvenování 90% genomu člověka. Ve stejném týdnu publikuje totéž HUGO v časopise Nature (takže výsledek je remíza mezi oběma společnostmi). Jeden z největších projektů v dějinách vědy byl naplněn. Dnes jsou známy genomy celé řady organismů

2 Pohlavní chromosomy V jádrech lidských buněk je z celkového množství 23 párů chromosomů jeden pár chromosomů pohlavních, neboť tento pár chromosomů rozhoduje o pohlaví jedince. Tyto chromosomy se nazývají pohlavní chromosomy neboli gonosomy. Ostatní, nepohlavní chromosomy, se nazývají autosomy. Těch je tedy 22 párů. Pohlavní chromosomy se značí X nebo Y. Vajíčko savců obsahuje vždy chromosom X. Spermie obsahuje buď chromosom X, nebo chromosom Y. Při oplození spermií s chromosomem X vzniká zárodečná buňka (zygota) s párem pohlavních chromosomů XX, při oplození spermií s chromosomem Y vzniká zárodečná buňka (zygota) s párem pohlavních chromosomů XY. Kombinace XX se projeví jako pohlaví ženské, kombinace XY jako pohlaví mužské. Je tedy jasné, že o pohlaví při oplození rozhodla nejúspěšnější spermie, která se prosadila mezi jinými. Některé znaky mohou být vázány na pohlavní chromosom tzv. pohlavně vázané geny. Nebezpečné jsou např. mutace na chromozomu X u chlapců, neboť ten není vypárován druhým chromosomem X jako u děvčat, kde může být tento gen v pořádku. Příkladem nemoci je hemofilie. Hemofilie je geneticky podmíněné onemocnění projevující se poruchou srážlivosti krve, což se navenek projevuje chorobnou krvácivostí krevními výrony do svalů či kloubů a omezenou schopností organismu zastavit krvácení. Chorobou se zabývá hematologie. Muž hemofilik a zdravá žena budou mít všechny syny zdravé a všechny dcery budou přenašečky. U dětí ženy přenašečky mohou nastat vždycky s padesátiprocentní pravděpodobností tyto případy: Může se narodit syn, který dědí od otce zdravý chromozom Y a od matky poškozený chromozom X. Je tedy hemofilik. Se stejnou pravděpodobností ovšem může syn od téže matky získat zdravý chromozom X a pak je zdravý. Tím hemofilie v této dědičné linii končí. Narodí-li se dcera, získá od zdravého otce zdravý chromozom X a od matky s padesátiprocentní pravděpodobností poškozený chromozom X, je tedy také přenašečkou. Existuje ovšem padesátiprocentní naděje, že zdědí i od matky zdravý chromozom a pak řada přenašeček a nemocných končí. Nejznámější dědičná linie vznikla díky britské královně Viktorii. Než v roce 1901 zemřela, stačila osudové geny předat svému osmému potomku, synu Leopoldovi. Ten trpěl častými krváceními a psalo se o nich i v britských odborných časopisech. Leopold zemřel na krvácení do mozku v jednatřiceti letech. Ještě osudovější bylo dědictví jejích dcer Alice a Beatrice, které rozšířily onemocnění do královských rodin Německa, Španělska a Ruska.

3 Pohled do minulosti za našimi předky GENETICKÁ GENEALOGIE se zabývá hledáním předků prostřednictvím analýzy DNA. V jádrech lidských buněk je z celkového množství 23 párů chromosomů jeden pár chromosomů pohlavních, neboť tyto chromosomy rozhodují o pohlaví jedince. Tyto chromosomy se nazývají pohlavní chromosomy neboli gonosomy. Muž má pár pohlavních chromosomů XY, žena XX. Y-chromosom nalezneme pouze u mužů, a dědí se striktně z otce na syna, podobně jako rodné příjmení. Tyto systémy přenosu dědičné generace vytvářejí nepřerušitelnou spojnici mezi generacemi a mohou být velkým pomocníkem při rekonstrukci rodinné historie. Pokud bychom důkladně analyzovali strukturu chromosomu X a porovnávali ji s ostatními muži, tak příbuzní by se lišili méně než nepříbuzní. Takovým genetickým srovnáváním lze dokonce odhadnout, odkud nejpravděpodobněji naši předkové pochází. Kdo byl Y-chromozomální praotec Adam? Nejstarší známý či nejvíce pravděpodobný společný prapředek pro mužské linie se narodil v Africe přibližně před tisíci let někde v oblasti Čadu. V průběhu následujících tisíců let jeho potomci postupně osidlovali další oblasti Afriky a posléze i další kontinenty. Pohlavní chromosom X má muž i žena, s tím rozdílem, že žena má tyto chromosomy dva. Logicky tedy vyplývá, že hledat nějakou pramáti Evu srovnáváním X chromosomu by nám moc nepomohlo. Ale. Pokud víme, jak vypadá vajíčko a jak spermie, pak zjistíme, že vajíčko dodává budoucí zárodečné buňce i důležité organely mitochondrie. A mitochondrie má svou vlastní mitochondriální (mt)dna (Mitochondrie pochází ze samostatné aerobní prokaryontní buňky, která kdysi v prehistorii vytvořila trvalou symbiózu s eukaryotní buňkou). Když tedy půjdeme-li po linii mt-dna, můžeme se vydat i dosti daleko a najít nejstaršího nejvíce pravděpodobného společného prapředka pro mateřské mitochondriální linie. Z mitochondriální linie této ženy vychází všechny dnes známé mitochondriální/mateřské linie, které lze nalézt v lidské populaci. Mitochondriální Eva se narodila v Africe přibližně před tisíci let někde v oblasti dnešní Keni, Tanzanie, Etiopie. V průběhu následujících tisíců let její potomci postupně osidlovali další oblasti Afriky a posléze i další kontinenty. Ale to je pouze pravděpodobné. O mitochondriální Evě s jistotou víme pouze, že byla žena, která měla nejméně dvě dcery, jejichž potomci přežili do dnešních dní.

4 Co jsou geny Gen je podle klasické genetiky jednotka odpovědná za vznik určité dědičné vlastnosti. Podle dnešních vědomostí je určen úsekem molekuly DNA, který se přepisuje do RNA. Známe 3 typy RNA. Jako strukturní geny označujeme ty, které se přepisují do molekul mrna, protože právě ty určují složení proteinů. Gen se může objevovat v různých alternativních formách alelách. Chromosomy máme v párech (jen pohlavní buňky gamety obsahují jednotlivé chromosomy, aby se jejich spojením při oplození vytvořil pár), takže každý jedinec má dvě alely pro každý gen. Jsou-li obě alely stejné, jedinec je homozygot, jsou-li alely různé, jde o heterozygota. Jak se projevují alternativní alely nám napomohl poznat svými výzkumy GREGOR J. MENDEL už r na základě mnohaletého výzkumu křížení hrachu. Provádějme pokusy s ním: U hrachu je gen určující tvar semen. Označme jeho možné alely A nebo a. Alela A určuje kulatý tvar semen, alela a hranatý. Homozygot AA má kulatá semena, homozygot aa hranatá. Heterozygoti Aa resp. aa mají také kulatý hrášek. Proto alela A se nazývá dominantní a alela a recesivní. U heterozygota se vždy prosadí alela dominantní. Vyzkoušejme si hrášek křížit. Rodiče (P) splňují tyto vlastnosti: Jeden homozygotní rodič má dvě shodné alely pro kulatá semena hrachu (označíme AA). Jeho gamety (pyl i vajíčka v semeníku pestíku) proto mají alelu A. Druhý homozygotní rodič má obě shodné alely pro hranatá semena hrachu (aa). Jeho gamety (pyl i vajíčka v semeníku pestíku) proto mají alelu A. Výsledky křížení (P rodiče, F 1 = první filiální generace): P generace kulatá AA hranatá aa F 1 generace gamety A gamety a kulatá Aa Z těchto rodičů vzniká uniformní heterozygotní potomstvo F 1 první filiální (dceřinná) generace s různými alelami A a a, ale všechno s kulatými semeny. Pokračujme s křížením. Nechť jsou rodiče z generace F 1 : Jeden i druhý heterozygotní rodič má různé alely Aa. Jejich gamety (pyl i vajíčka v semeníku pestíku) proto mají z 50% alelu A a z 50% alelu a. F 1 generace kulatá Aa gamety A nebo a gamety A nebo a F 2 generace kulatá AA kulatá Aa kulatá aa hranatá aa Potomci rodičů pocházejících z F1, tvořící generaci F2 druhou filiální generaci, již nejsou jednotní. Gamety u obou rodičů obsahují se stejnou pravděpodobností alely A nebo a. Dominantní alela se v kulatých semenech projevuje u tří čtvrtin potomstva homozygotů AA a heterozygotů Aa a aa. Hranatá semena má jen jedna čtvrtina potomstva druhé generace homozygoti aa. Pro krevní skupiny existují v populaci alely A, B a 0 (Můžete si pohrát s děděním krevní skupiny podobně jako u tvaru hrášku). homozygot AA - krevní skupina A; homozygot 00 - krevní skupina nula; homozygot BB - krevní skupina B; heterozygot A0 - krevní skupina A, heterozygot B0 - krevní skupina B.

5 Vznikne-li např. křížením rodičů rostlin s bílým květem a červeným květem potomstvo první filiální generace s růžovým květem, hovoříme, že alely pro bílý a červený květ jsou projeví se stejnou měrou jako průměr.


MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


Hemofilie dnes. Investice do rozvoje a vzdělávání Operační program Vzdělávání pro konkurenceschopnost

Hemofilie dnes. Investice do rozvoje a vzdělávání Operační program Vzdělávání pro konkurenceschopnost Hemofilie dnes Investice do rozvoje a vzdělávání Operační program Vzdělávání pro konkurenceschopnost Zdroje: Evropský sociální fond v ČR Evropská unie Ministerstvo školství, mládeže a tělovýchovy OPVK


Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi


Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem


Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


VY_32_INOVACE_11.18 1/6 Genetika Genetika

VY_32_INOVACE_11.18 1/6 Genetika Genetika 1/6 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků



GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky


Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat


REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce?

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce? REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince Co bylo dřív? Slepice nebo vejce? Rozmnožování Rozmnožování (reprodukce) může být nepohlavní (vegetativní, asexuální) pohlavní (sexuální;


GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela


Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.cz Mutace Mutace - náhodná změna v genomu organismu - spontánní


http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace Pojmy k zpmtování Gen -část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN Gen je různě dlouhá sekvence nukleotidů Gen je jednotk funkce


lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické Gonozomáln lní dědičnost Mgr. Aleš RUDA Chromozomové určení pohlaví autozomy gonozomy člověk má 22 párůp autozomů a 1 pár p gonozomů označen ení pohlavních chromozomů: : X a Y. jsou možné celkem 3 kombinace:


Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni

Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Hemofilie Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Definice hemofilie Nevyléčitelná vrozená krvácivá choroba s nedostatkem plazmatických faktorů FVIII hemofile A FIX hemofile


Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje


Chromosomové translokace

Chromosomové translokace 12 Unique - Britská svépomocná skupina pro vzácné chromosomové vady. Tel: + 44 (0) 1883 330766 Email: info@rarechromo.org www.rarechromo Chromosomové translokace EuroGentest - Volně přístupné webové stránky


- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI



http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u


Testování lidské identity

Testování lidské identity Testování lidské identity Brno, 2009 J.M.Butler Forensic DNA Typing workshop, 2006 Bryan Sykes Sedm dcer Eviných, 2005 Využití testování lidské identity Řešení trestních činů shoda mezi podezřelým a stopou


Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu Genealogie Monogenní dědičnost rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu onemocnění v rodině Genealogické


Chromosomové změny. Informace pro pacienty a rodiny

Chromosomové změny. Informace pro pacienty a rodiny 12 Databáze pracovišť poskytujících molekulárně genetická vyšetření velmi častých genetických onemocnění v České republice (CZDDNAL) www.uhkt.cz/nrl/db Chromosomové změny Unique - Britská svépomocná skupina


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Genetická "oblast nejasnosti" u HCH: co to znamená? Genetický základ

Genetická oblast nejasnosti u HCH: co to znamená? Genetický základ Novinky ve výzkumu Huntingtonovy nemoci. Ve srozumitelném jazyce. Napsáno vědci. Určeno široké huntingtonské veřejnosti. Genetická "oblast nejasnosti" u HCH: co to znamená? Přechodní alely a alely s redukovanou


13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu


V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865



TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy


Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový


Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho


Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace


Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus


Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům Karlova univerzita, Lékařská fakulta Hradec Králové Obor: všeobecné lékařství - test z biologie Vyberte tu z nabídnutých odpovědí (1-5), která je nejúplnější. Otázka Odpověď 1. Mezi organely membránového


Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


GENETICKÉ PORADENSTVÍ. u pacientů s epidermolysis bullosa congenita. MUDr. Renata Gaillyová, Ph.D.

GENETICKÉ PORADENSTVÍ. u pacientů s epidermolysis bullosa congenita. MUDr. Renata Gaillyová, Ph.D. GENETICKÉ PORADENSTVÍ u pacientů s epidermolysis bullosa congenita MUDr. Renata Gaillyová, Ph.D. Homozygot jedinec, který zdědil po rodičích tutéž alelu. Jedinec nebo genotyp s identickými alelami v daném


Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol 20.5.2015 Popis klinických příznaků, možnosti léčby Muži: střední až těžká mentální


Zvyšování kvality výuky technických oborů

Zvyšování kvality výuky technických oborů Zvyšování kvality výuky technických oborů Klíčová aktivita V.2 Inovace a zkvalitnění výuky směřující k rozvoji odborných kompetencí žáků středních škol Téma V.2.18 Dřeviny Kapitola 2 Rozmnožování rostlin


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu


NÁZEV ŠKOLY: Základní škola Javorník, okres Jeseník REDIZO: 600 150 585 NÁZEV: VY_32_INOVACE_87_Oběhová soustava I. AUTOR: NADĚŽDA ČMELOVÁ ROČNÍK,

NÁZEV ŠKOLY: Základní škola Javorník, okres Jeseník REDIZO: 600 150 585 NÁZEV: VY_32_INOVACE_87_Oběhová soustava I. AUTOR: NADĚŽDA ČMELOVÁ ROČNÍK, NÁZEV ŠKOLY: Základní škola Javorník, okres Jeseník REDIZO: 600 150 585 NÁZEV: VY_32_INOVACE_87_Oběhová soustava I. AUTOR: NADĚŽDA ČMELOVÁ ROČNÍK, DATUM: 8., 21. 11. 2011 VZDĚL. OBOR, TÉMA: PŘÍRODOPIS,


ANOTACE vytvořených/inovovaných materiálů

ANOTACE vytvořených/inovovaných materiálů ANOTACE vytvořených/inovovaných materiálů Číslo projektu Číslo a název šablony klíčové aktivity Tematická oblast Formát Druh učebního materiálu Druh interaktivity CZ.1.07/1.5.00/34.0722 III/2 Inovace a


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 3 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 02.06.2014 Ročník: 6AF, 6BF Anotace DUMu: chromatin - stavba, organizace a struktura



GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou


Paleogenetika člověka

Paleogenetika člověka Budeme se snažit najít odpověď na možná nejstarší otázku člověka: Kdo jsme a odkud pocházíme? Budeme se snažit najít odpověď na možná nejstarší otázku člověka: Kdo jsme a odkud pocházíme? Kdo je náš předek?


Buňky, tkáně, orgány, soustavy

Buňky, tkáně, orgány, soustavy Lidská buňka buněčné organely a struktury: Jádro Endoplazmatické retikulum Goldiho aparát Mitochondrie Lysozomy Centrioly Cytoskelet Cytoplazma Cytoplazmatická membrána Buněčné jádro Jadérko Karyoplazma


Pojem plemeno je používán pro rasy, které vznikly záměrnou činností člověka, např. plemena hospodářských zvířat.

Pojem plemeno je používán pro rasy, které vznikly záměrnou činností člověka, např. plemena hospodářských zvířat. POPULAČNÍ GENETIKA Populační genetika se zabývá genetickými zákonitostmi v definovaných souborech jedinců téhož druhu. Genetické vztahy uvnitř populace jsou komplikované, a proto se v populační genetice


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


GENETIKA. zkoumá dědičnost a proměnlivost organismů

GENETIKA. zkoumá dědičnost a proměnlivost organismů GENETIKA zkoumá dědičnost a proměnlivost organismů Dědičnost: schopnost organismů uchovávat informace o své struktuře a funkčních schopnostech a předávat je svým potomkům Proměnlivost (variabilita) je


Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením


Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů

9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů 9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou


Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Petr Lesný 1, Pavel Seeman 2, Daniel Groh 1 1 ORL klinika UK 2. LF a FN Motol Subkatedra dětské ORL IPVZ Přednosta doc. MUDr. Zdeněk Kabelka


-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě Otázka: Genetika I Předmět: Biologie Přidal(a): Paris -věda, která se zabývá dědičností a proměnlivostí -zakladatelem je Johan Gregor Mendel (1822 1884), který se narodil v Hynčicích na Moravě 1. MOLEKULÁRNÍ


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická oblast Odborná biologie, část biologie organismus


1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


Základní škola a mateřská škola, Ostrava-Hrabůvka, Mitušova 16, příspěvková organizace Školní vzdělávací program 2. stupeň, Člověk a příroda

Základní škola a mateřská škola, Ostrava-Hrabůvka, Mitušova 16, příspěvková organizace Školní vzdělávací program 2. stupeň, Člověk a příroda Přírodopis 8. ročník Výstupy ŠVP Učivo Přesahy, metody a průřezová témata Žák popíše stavbu těla savců a základní charakteristiku. Vysvětlí přizpůsobení savců prostředí a způsobu života (např. kytovci,


Výchova ke zdraví poučení. o lidském těle. A-Z kviz finále T U V W X Z Ž

Výchova ke zdraví poučení. o lidském těle. A-Z kviz finále T U V W X Z Ž Výchova ke zdraví poučení A o lidském těle B C A-Z kviz finále D E F G H Ch I J K L M N O P R Ř S Š T U V W X Z Ž Trvalé osvojení dítěte se nazývá A adopce správná odpověď náhradní otázka Porucha stravování,


Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním
