Rozměr: px
Začít zobrazení ze stránky:




2 AFLP ANALÝZA *** Technika AFLP (Amplification Fragment Lenght Polymorphism - polymorfismus délky amplifikovaných fragmentů) je modifikací RFLP, která pro konečné zviditelnění fragmentu používá PCR. Dochází tak ke kombinaci specifičnosti restrikčního štěpení se snadností PCR. Tato metoda spočívá v selektivní amplifikaci sub-souboru restrikčních fragmentů po štěpení celkové genomové DNA restrikčními enzymy. Polymorfismus se zjišťuje na základě rozdílů ve velikosti amplifikovaných fragmentů po separaci na PAGE. Oproti metodám RFPL a RAPD má řadu výhod, mezi nejdůležitější patří generování velkého množství markerů. Kromě využití pro identifikaci genotypů kulturních rostlin je cílena zejména pro účely mapování významných kvalitativních a kvantitativních znaků. Tato metoda nachází uplatnění také při studiu biodiverzity a přípravě markerů. AFLP generuje dominantní markery a představuje velký počet signálů v jedné reakci. 25

3 AFLP protokol Pozn. Označení STOP krok znamená, že v tomto kroku je možné sled reakcí přerušit. Polymeráza není součástí kitu. 1. Restikční štěpení genomické DNA komponenty kontrola μl vzorky μl 5X reakční pufr 5 5 kontrolní DNA rajčete (100ng/μl) 2,5 - DNA vzorku (250ng v 18μl) - 18 EcoR I/Mse I 2 2 destilovaná voda 15,5 doplnit 25 celkový objem μl Všechny komponenty smícháme v 1,5 ml eppendorfce a krátce centrifugujeme. Vzorky necháme inkubovat 2 h při 37 C. Po inkubaci zahřejeme vzorky na 15 min. na 70 C, aby došlo k inaktivaci restrikčních enzymů. Vzorky dáme na led a po té krátce centrifugujeme. 2. Ligace adaptorů Ke vzorkům po restikčním stěpení přidáme: komponenty objem μl adapter ligation solution 24 T4 DNA ligase 1 Vzorky promícháme při pokojové teplotě, krátce centrifugujeme a potom inkubujeme 2 h při 20 C. Ředění 1:10 Ze vzorků po ligaci odebereme 10μl reakční směsi a přidáme 90μl TE pufru, dobře promícháme. Zředěné i nezředěné vzorky uchováváme při 20 C pro další použití. STOP krok 26

4 3. Preamplifikační reakce komponenty objem μl zředěný templát DNA 5 pre-amp primer mix 40 10X PCR pufr plus Mg 5 Taq DNA polymeráza (5U/μl) 1 celkový objem μl 51 Vzorky promícháme, krátce centrifugujeme a dáme preamplifikovat (program AFLP 1). Reakční cyklus: 20 cyklů: 94 C 30s 56 C 60s 72 C 60s Ředění 1:50 Ze vzorků po preamplifikaci odebereme 3μl reakční směsi a přidáme 147μl TE pufru, dobře promícháme. Zředěné i nezředěné vzorky uchováváme při 20 C pro další použití. STOP krok 4. Selektivní AFLP amplifikace Pozn. Pro neradioaktivní detekci nepoužíváme značení primerů radioaktivním fosforem 32 P nebo 33 P, ale ředíme primer EcoR I. Ředění primeru EcoR I: odebereme 18μl primeru a přidáme 32μl destilované vody. Mix 1 (na 10 vzorků) komponenty objem μl ředěný primer EcoR I 5 Mse I primer 45 celkový objem μl 50 Mix 2 (na 10 vzorků) komponenty objem μl destilovaná voda 79 10X PCR pufr plus Mg 20 Taq DNA polymeráza (5U/μl) 1 celkový objem μl

5 Z DNA, kterou jsme po preamplifikaci naředili 1:50, Mix 1 a Mix 2 připravíme reakční směs pro selektivní amplifikaci. komponenty objem μl DNA ředěná po preamplifikaci 1:50 a/nebo 5 kontrolní preamplifikavaná DNA rajčete (součást kitu) Mix 1 (primery/dntp) 5 Mix 2 (Taq DNA polymeráza/pufr) 10 celkový objem μl 20 Vzorky promícháme, krátce centrifugujeme a dáme amplifikovat (program AFLP 2). Reakční cyklus: 1 cyklus: 94 C 30s 65 C 30s 72 C 60s 12 cyklů: při, kterých během annealingu v každém kroku klesne teplota o 0,7 C, tzn. cyklus C 30s 64,3 C 30s 72 C 60s atd. 23 cyklů: 94 C 30s 56 C 30s 72 C 60s STOP krok Separace amplifikovaných produktů na sekvenační elektorforéze Po PCR přidáme ke vzorku (20μl) 16μl 98% formamidu a 4μl Loading buffer. Před nanášením na gel necháme vzorky denaturovat 3 min při 90 C (denaturaci opakujeme vždy před další separací na gelu). Po denaturaci vzorky zchladíme na ledu. 28

6 Příprava sekvenační elektroforézy Roztoky: Bind silane: 4 ml bind silane rozmícháme v 1 l ultračisté vody (lze opakovaně použít) Pozn. Při přípravě sekvenační elektroforézy a PAGE pracujeme pouze s ultračistou vodou (UHP water) Obě skla, která se používají pro sekvenační elektroforézu, spacery a hřeben důkladně umyjeme detergentem a pečlivě odstraníme případné zbytky gelu. Po osušení skel, spacerů a hřebenu, vše opláchneme v ultračisté vodě a po té ve 100% ethanolu. Spodní sklo (to, na kterém po ELFO zůstává gel) vložíme na 1 h do roztoku bind silane a necháme ho silanizovat tzn. že na skle se vytvoří vrstva, která po té váže gel. Sklo opláchneme ultračistou vodou a potom 100% ethanolem. Na vrchní sklo (to, které odpuzuje gel) nalijeme cca 5 ml repel silane, dobře rozetřeme po skle, tak aby po celé ploše vznikla tenká vrstva a necháme 15 min působit. Sklo opláchneme ultračistou vodou. Sestavení skel pro sekvenační elektroforézu Na spodní bind sklo položíme k dlouhým okrajům spacery a přiložíme vrchní repel sklo tou vrstvou, kterou jsme potřeli repel silane. Soupravu pečlivě urovnáme a spojíme svorkami na jedné z dlouhých a jedné z krátkých stran. Tu stranu, na které není žádná ze svorek důkladně zalepíme přes hranu izolepou, tak aby skla zůstala pevně spojena. Svorky přendáme a postup opakujeme na druhé nezalepené straně. Když jsou obě dlouhé strany zalepené, zalepíme spodní stranu skel. Dbáme na to, aby tato strana byla velmi pečlivě zalepená, jinak gel bude vytékat. Spodní rohy skel zalepíme dvakrát popřípadě třikrát. Příprava denaturačního PAGE DNA gelu Chemikálie: 10% persíran amonný: 0,1g do 1ml vody (připravujeme čerstvý před každou ELFO) 100ml gelu připravíme podle tabulky, vše smícháme, zahříváme ve vodní lázni při 55 C (pozor ochlazuje se) po dobu 3 min, objem doplníme do 100ml. 6% 8% 10% AC/BIS 30% ml 20 26,6 33,3 5X TBE ml voda ml 24,7 18,1 11,4 močovina g

7 Z takto připraveného gelu odebereme 10ml přidáme 60μl 10% persíranu amonného a 5μl TEMEDU. Gel ihned nanášíme pipetou mezi skla, tak aby nevznikly žádné bubliny. Tato vrstva gelu má po ztuhnutí zabránit vytékaní zbývajícího gelu. Když spodní vrstva dobře ztuhne přidáme ke zbývajícím 90ml gelu 540μl 10% persíranu amonného a 45μl TEMEDU a pomocí střičky gel naneseme mezi skla, tak aby nevznikly žádné bubliny. Gel naneseme přesně k okraji vyříznutí vrchního skla, přebytečný gel odstraníme a přesah spodního skla očistíme, aby ne něm neulpívaly zbytky gelu. Hřeben zasuneme mezi skla asi 4mm hluboko tou stranou, na které nejsou zuby. Gel necháme ztuhnout. Trubičku ze střičky ihned umyjeme, aby v ní gel neztuhnul a neucpal ji. Pre-run sekvenační elektroforézy Když je gel dobře ztuhlý odstraníme izolepu ze spodní části, skla vložíme do vany a připevníme je k vaně pomocí svorek. Do vany nalijeme 1X TBE pufr a prázdný gel necháme cca min běžet při 1800V. Vlastní elektroforéza Po pre-run vypneme proud, vyndáme hřeben a do štěrbiny, kterou hřeben v gelu vytvořil, naneseme Loading buffer, po té vsuneme zpátky hřeben tou stranou, na které jsou zuby, tak hluboko, aby hřeben vytvořil mezi skly sloty pro vzorky. Do slotů naneseme vzorky (které jsme těsně před tím denaturovali) cca 3-4μl a necháme ELFO běžet při 1800V (cca 1 h). Po doběhnutí ELFO vypneme proud, odpojíme zdroj (!!!) a vyndáme skla. Odstraníme izolepu, vyndáme spacery a opatrně od sebe odlepíme skla. Na spodním bind skle by měl zůstat gel. Barvení stříbrem Roztoky: Fix/stop solution (10 % kyselina octová): 100 ml kyseliny octové přimícháme do 900ml ultračisté vody Staining solution: 1 l ultračisté vody, 1 g AgNO 3, 1 ml formaldehydu Developing solution (vývojka): 30 g NaCO 3, 1 l ultračisté vody, těsně před použitím přidáme 1,5 ml formaldehydu a 200 μl 1 % thiosulfátu sodného 1% thiosulfát sodný: 0,01 g do 1 ml vody (připravujeme čerstvý před každou ELFO) 30

8 Spodní sklo, na kterém zůstal gel vložíme do fix/stop solution a 20 min oplachujeme a třepeme. V tomto roztoku může gel zůstat přes noc bez třepání. STOP krok Gel přeneseme do nové misky a 3krát 5 min dobře oplachujeme ultračistou vodou za současného třepání. Gel ponoříme do staining solution a 30 min barvíme a třepeme. Po barvení gel 15 s oplachujeme ultračistou vodou a po té ho vložíme do vychlazeného developing solution, ke kterému jsme přidali 1,5 ml formaldehydu a 200 μl 1 % thiosulfátu sodného. 6 7 min omýváme, dokud nejsou proužky dobře viditelné. Po zviditelnění proužků přeneseme gel zpět do fix/stop solution a 3 min necháme působit, aby došlo k ukončení vyvíjecí reakce. Gel 2krát 5 min omyjeme ve vodě. Gel překryjeme celofánem, necháme uschnout a po té oscanujeme. Získaný elektroforeogram je takto připraven k hodnocení. Všechny pomůcky důkladně umyjeme. 31

9 Příprava sekvenační elektroforézy - Piešťany Roztoky: Při přípravě sekvenační elektroforézy a PAGE pracujeme pouze s ultračistou vodou (UHP water) Obě skla, která se používají pro sekvenační elektroforézu, spacery a hřeben důkladně umyjeme detergentem a pečlivě odstraníme případné zbytky gelu. Po osušení skel, spacerů a hřebenu, vše opláchneme v ultračisté vodě a po té ve 100% ethanolu. Spodní sklo (to, na kterém po ELFO zůstává gel) potřeme roztokem Bind silane a necháme ho silanizovat tzn. že na skle se vytvoří vrstva, která po té váže gel. Roztok 3 ml vody + 40 µl led. kys. octové + 40 µl Bind Silane. Roztok naneseme pipetou na sklo, rozetřeme, po zaschnutí přetřít 100% ethanolem. Na vrchní sklo (to, které odpuzuje gel) nalijeme cca 2-3 ml Repel silane, dobře rozetřeme po skle, tak aby po celé ploše vznikla tenká vrstva, po zaschnutí přetřít 100% ethanolem. Sestavení skel pro sekvenační elektroforézu Na spodní bind sklo položíme k dlouhým okrajům spacery a přiložíme vrchní repel sklo tou vrstvou, kterou jsme potřeli repel silane. Soupravu pečlivě urovnáme a spojíme svorkami, zalepí se pouze horní okraje skel u uší. Příprava denaturačního PAGE DNA gelu Chemikálie: 6% 8% 10% AC/BIS 30% ml 20 26,6 33,3 5X TBE ml voda ml 24,7 18,1 11,4 močovina g Smíchat vodu, AC/BIS, TBE, nalít horký roztok močoviny (močovinu rozehřát v mikrovlnce), nechat vychladit v mrazáku, jinak moc rychle tuhne. k vychlazenému roztoku na 100 ml přidat 500 µl 10 % PSA µl TEMED. 10% persíran amonný: 0,1g do 1ml vody (připravujeme čerstvý před každou ELFO) Roztok nalijeme do mírně šikmých skel (2-3 cm šikmina), po nalití se položí do roviny, snad to ztuhne a nevyteče. Přes noc na skla položit vlhký filtrák, vatu a alobal. 32

10 Hřeben zasuneme mezi skla asi 4mm hluboko tou stranou, na které nejsou zuby. Gel necháme ztuhnout. Pre-run sekvenační elektroforézy Když je gel dobře ztuhlý odstraníme izolepu ze spodní části, skla vložíme do vany a připevníme je k vaně pomocí svorek. Do vany nalijeme 1X TBE pufr a prázdný gel necháme cca min běžet při 1000V. Vlastní elektroforéza Vsuneme hřeben tou stranou, na které jsou zuby, tak hluboko, aby hřeben vytvořil mezi skly sloty pro vzorky. Do slotů naneseme vzorky (které jsme těsně před tím denaturovali) cca 3-4μl a necháme ELFO běžet při 1000V, 39 ma a 38 W. Nanášecí pufr LB: 4.8 g močovina, 10 ml voda, 0,05 g BPB, 10 µl 10 M NaOH, důkladně rozmíchat, min. 30 min., trvanlivost 2 týdny. LB se smíchá se vzorkem v poměru 1 : 1. Po doběhnutí ELFO vypneme proud, odpojíme zdroj (!!!) a vyndáme skla. Odstraníme izolepu, vyndáme spacery a opatrně od sebe odlepíme skla. Na spodním bind skle by měl zůstat gel. Barvení stříbrem Roztoky: Fix/stop solution (10 % kyselina octová): 200 ml kyseliny octové přimícháme do 1800ml ultračisté vody, vychlazené Staining solution: 2 l ultračisté vody, vychlazená, 2 g AgNO 3, 3 ml formaldehydu Developing solution (vývojka): 50 g NaCO 3, 2 l ultračisté vody, těsně před použitím přidáme 3 ml formaldehydu a 400 μl thiosulfátu sodného (10 mg/ml), vychlazený roztok, 6 min. před použitím do mrazáku 1% thiosulfát sodný: 0,01 g do 1 ml vody (připravujeme čerstvý před každou ELFO) Spodní sklo, na kterém zůstal gel vložíme do fix/stop solution a 25 min** třepeme. Gel přeneseme do nové misky a 2x 5 min** dobře oplachujeme vychlazenou ultračistou vodou (1 l). Gel ponoříme do staining solution a 25 min** barvíme a třepeme. Po barvení gel s oplachujeme vychlazenou ultračistou vodou (2 l), velmi intenzivně se protřepává a po té ho vložíme do vychlazeného developing solution, ke kterému jsme přidali 3 ml formaldehydu a 400 μl thiosulfátu sodného. 5-6 min velmi intenzivně 33

11 protřepáváme, v chlaďáku, ve tmě, při červeném fotosvětle. Barvit do objevení se skvrn, pak fixovat fix/stop solution, 30 min, pak sušit. Všechny pomůcky důkladně umyjeme. ** velmi intenzivní třepání s velkou amplitudou Všechny pomůcky důkladně umyjeme. 34


ANALÝZA SLG GENU U ŘEPKY OLEJKY (BRASSICA NAPUS) METODOU PCR-RFLP ANALÝZA SLG GENU U ŘEPKY OLEJKY (BRASSICA NAPUS) METODOU PCR-RFLP *** Metoda PCR-RFLP kombinuje amplifikaci určitého specifického úseku genomové DNA a následné štěpení amplifikovaného produktu různými






PROTOKOL WESTERN BLOT WESTERN BLOT 1. PŘÍPRAVA ELEKTROFORETICKÉ APARATURY Saponátem a vodou se důkladně umyjí skla, plastové vložky a hřebínek, poté se důkladně opláchnou deionizovanou/destilovanou vodou a etanolem a nechají


SDS polyakrylamidová gelová elektroforéza (SDS PAGE)

SDS polyakrylamidová gelová elektroforéza (SDS PAGE) SDS polyakrylamidová gelová elektroforéza (SDS PAGE) Princip SDS polyakrylamidová gelová elektroforéza slouží k separaci proteinů na základě jejich velikosti (molekulové hmotnosti). Zahřátím vzorku za


α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction


SDS-PAGE elektroforéza

SDS-PAGE elektroforéza SDS-PAGE elektroforéza Příprava gelu... 1 Recept na 0.75 mm gel (1 gel/2 gely)... 2 Recept na 1.5 mm gel (1 gel/2 gely)... 2 Příprava vzorku... 3 Elektroforéza... 3 Barvení gelů Blue Silver... 4 Chemikálie


Braf V600E StripAssay

Braf V600E StripAssay Braf V600E StripAssay Kat. číslo 5-570 20 testů 2-8 C Popis stripu: Pracovní postup 1. Izolace DNA Pro izolaci čerstvých nebo mražených biopsií použijte soupravy Qiagen QIAmp DNA Mini nebo Micro. Pro izolaci


Metody molekulární biologie v rostlinné ekologii a systematice

Metody molekulární biologie v rostlinné ekologii a systematice Protokoly a návody pro praktikum Metody molekulární biologie v rostlinné ekologii a systematice Laboratoř molekulární biologie rostlin, PřF JCU, Branišovská 31, České Budějovice 2008, Miroslava Herbstová,



PO STOPÁCH BAKTERIÍ V/KOLEM NÁS PO STOPÁCH BAKTERIÍ V/KOLEM NÁS Jana Spáčilová, UK v Praze, PřF, Katedra buněčné biologie Svět bakterií je nesmírně druhově bohatý a máme ho blíž než před očima. Mikroskopickými metodami můžeme obdivovat


Obsah Protein Gel Electrophoresis Kitu a jeho skladování

Obsah Protein Gel Electrophoresis Kitu a jeho skladování Obsah Protein Gel Electrophoresis Kitu a jeho skladování Protein Gel Electrophoresis Kit obsahuje veškerý potřebný materiál provádění vertikální polyakrilamidové gelové elektroforézy. Experiment provádějí


NRAS StripAssay. Kat. číslo 5-610. 20 testů 2-8 C

NRAS StripAssay. Kat. číslo 5-610. 20 testů 2-8 C NRAS StripAssay Kat. číslo 5-610 20 testů 2-8 C Popis stripu: Pracovní postup 1. Izolace DNA Pro izolaci DNA musí být použita vhodná metoda vzhledem k typu tkáně vzorku. Pro doporučení vhodné metody kontaktujte








EGFR XL StripAssay. Kat. číslo 5-630. 20 testů 2-8 C

EGFR XL StripAssay. Kat. číslo 5-630. 20 testů 2-8 C EGFR XL StripAssay Kat. číslo 5-630 20 testů 2-8 C Popis stripu Pracovní postup 1. Izolace DNA Pro izolaci DNA použijte vhodný izolační kit. Doporučené kity jsou následující: Pro izolaci čerstvých nebo


Elektroforéza v přítomnosti SDS SDS PAGE

Elektroforéza v přítomnosti SDS SDS PAGE Elektroforéza v přítomnosti SDS SDS PAGE Elektroforéza v přítomnosti SDS SDS PAGE je jednoduchá, rychlá a reprodukovatelná metoda pro kvalifikovanou charakterizaci a srovnání bílkovin.tato metoda separuje


ELFO: DNA testovaných vzorků společně se značeným velikostním markerem je separovaná standardně použitím agarosové elektroforézy.

ELFO: DNA testovaných vzorků společně se značeným velikostním markerem je separovaná standardně použitím agarosové elektroforézy. SOUTHERNOVA HYBRIDIZACE Existuje celá řada protokolů pro Southernovu hybridizaci. Tyto protokoly se do značné míry totožné co se týče úvodních fází, jako je příprava vzorků elektroforetickou separací,



POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek


Protokoly Transformace plasmidu do elektrokompetentních buněk BL21 Pracovní postup:

Protokoly Transformace plasmidu do elektrokompetentních buněk BL21 Pracovní postup: Protokoly Pracovní potřeby, pufry a chemikálie jsou uvedeny na konci protokolu. Pracovní postupy jsou odvozeny od těchto kitů: Champion pet160 Directional TOPO Expression Kit with Lumio Technology (Invitrogen)



DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby


Návod k laboratornímu cvičení. Cukry(sacharidy)

Návod k laboratornímu cvičení. Cukry(sacharidy) Návod k laboratornímu cvičení Cukry(sacharidy) Úkol č. 1: Odlišení glukosy a fruktosy Pomůcky: zkumavky, lžička na chemikálie, kádinka, stojan, držák, kruh, síťka, plynový kahan, zápalky Chemikálie: fruktosa,


CVD-T StripAssay. Kat. číslo 4-360. 20 testů 2-8 C

CVD-T StripAssay. Kat. číslo 4-360. 20 testů 2-8 C CVD-T StripAssay Kat. číslo 4-360 20 testů 2-8 C Popis stripu Pracovní postup Izolace DNA Použijte čerstvou nebo zmraženou krev s EDTA nebo citrátem, jako antikoagulans, vyhněte se krvi s obsahem heparinu.


Braf 600/601 StripAssay

Braf 600/601 StripAssay Braf 600/601 StripAssay Kat. číslo 5-560 20 testů 2-8 C Popis stripu: Pracovní postup Kit umožňuje detekci 9 mutací v genu BRAF (kodón 600 a 601) Další informace najdete v OMIM Online Mendelian Inheritance


Metody molekulární biologie v rostlinné ekologii a systematice

Metody molekulární biologie v rostlinné ekologii a systematice Protokoly a návody pro praktikum Metody molekulární biologie v rostlinné ekologii a systematice (verze 2013 2014) Laboratoř molekulární biologie rostlin Přírodovědecká fakulta JU Petr Koutecký & Jiří Košnar


Kras XL StripAssay. Kat. číslo 5-680. 20 testů 2-8 C

Kras XL StripAssay. Kat. číslo 5-680. 20 testů 2-8 C Kras XL StripAssay Kat. číslo 5-680 20 testů 2-8 C Popis stripu: Pracovní postup 1. Izolace DNA Musí být použity vhodné metody extrakce DNA, v závislosti na typu vzorku, který má být vyšetřován. Doporučení


Metodika izolace DNA a analýzy molekulárních markerů pro účely popisu genetických zdrojů řepky (Brassica napus L.) a hodnocení jejich diverzity

Metodika izolace DNA a analýzy molekulárních markerů pro účely popisu genetických zdrojů řepky (Brassica napus L.) a hodnocení jejich diverzity Metodika izolace DNA a analýzy molekulárních markerů pro účely popisu genetických zdrojů řepky (Brassica napus L.) a hodnocení jejich diverzity Metodika byla vypracovaná jako výstup výzkumného projektu


S filtračními papíry a membránou je nutno manipulovat pinzetou s tupým koncem.

S filtračními papíry a membránou je nutno manipulovat pinzetou s tupým koncem. Western Blotting Příprava blotovacího sendviče... 1 Blotování... 2 Kontrola přenesení proteinů na membránu... 2 Blokování membrány... 2 Aplikace protilátek... 2 Vizualizace... 3 Vyvolání filmu... 4 Chemikálie





Polymorfismus délky restrikčních fragmentů

Polymorfismus délky restrikčních fragmentů Polymorfismus délky restrikčních fragmentů Princip: Chemikálie: PCR produkt z předchozího praktického cvičení Endonukleáza KpnI 10 U μl -1 Pufr pro KpnI 10 koncentrovaný (Tris-HCl 100 mmol l -1 ph 7,5,



PROTOKOL NORTHERNOVA HYBRIDIZACE ! NORTHERNOVA HYBRIDIZACE Vzhledem k tomu, že se při Northern hybridizaci pracuje s RNA a RNA je extrémně citlivá na působení RNáz, je zapotřebí se vyvarovat jakékoliv kontaminace RNázami. Pro snížení


Metodika analýzy molekulárních markerů u jilmu, Ulmus L.

Metodika analýzy molekulárních markerů u jilmu, Ulmus L. Metodika analýzy molekulárních markerů u jilmu, Ulmus L. Metodika byla vypracovaná jako výstup projektu NAZV QI92A247 Charakterizace genetické struktury autochtonních populací jilmů pomocí DNA analýz,



KARBOXYLOVÉ KYSELINY LABORATORNÍ PRÁCE Č. 28 KARBOXYLOVÉ KYSELINY PRINCIP Karboxylové kyseliny jsou látky, které ve své molekule obsahují jednu nebo více karboxylových skupin. Odvozují se od nich dva typy derivátů, substituční






PROTEINOVÁ DENATURUJÍCÍ ELEKTROFORÉZA (SDS PAGE) PROTEINOVÁ DENATURUJÍCÍ ELEKTROFORÉZA (SDS PAGE) Denaturující proteinová elektroforéza (SDS PAGE - SDS Protein Acrylamide Gel Electrophoresis) je metoda, která se používá k separaci proteinů podle velikosti,


LP č. 6 - BÍLKOVINY. Autor: Mgr. Stanislava Bubíková. Datum (období) tvorby: 28. 2. 2013. Ročník: devátý

LP č. 6 - BÍLKOVINY. Autor: Mgr. Stanislava Bubíková. Datum (období) tvorby: 28. 2. 2013. Ročník: devátý LP č. 6 - BÍLKOVINY Autor: Mgr. Stanislava Bubíková Datum (období) tvorby: 28. 2. 2013 Ročník: devátý Vzdělávací oblast: Člověk a příroda / Chemie / Organické sloučeniny 1 Anotace: Žáci prakticky ověří



ÚSTAV LÉKAŘSKÉ BIOCHEMIE A LABORATORNÍ DIAGNOSTIKY 1. LF UK. Vyšetření moči ÚSTAV LÉKAŘSKÉ BIOCHEMIE A LABORATORNÍ DIAGNOSTIKY 1. LF UK Vyšetření moči močový sediment, stanovení sodíku, opakování Praktické cvičení z lékařské biochemie Všeobecné lékařství Martin Vejražka, Lenka



DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit


Molekulární markery v systematice a populační biologii rostlin (B120C44)

Molekulární markery v systematice a populační biologii rostlin (B120C44) Protokoly a návody pro praktikum Molekulární markery v systematice a populační biologii rostlin (B120C44) v DNA laboratoři Katedry botaniky PřF UK, Benátská 2, Praha verze leden 2014 Tomáš Fér Obsah Obsah...


Inkubace enzymů se substráty

Inkubace enzymů se substráty Inkubace enzymů se substráty Inkubace redukčních enzymů... 1 Inkubace oxidačních enzymů... 2 Extrakce látek z inkubační směsi... 2 Příprava vzorků k HPLC/UHPLC detekci... 3 Chemikálie a roztoky... 4 Substráty...





Inovace bakalářského studijního oboru Aplikovaná chemie CZ.1.07/2.2.00/15.0247

Inovace bakalářského studijního oboru Aplikovaná chemie CZ.1.07/2.2.00/15.0247 Papírová a tenkovrstvá chromatografie Jednou z nejrozšířenějších analytických metod je bezesporu chromatografie, umožňující účinnou separaci látek nutnou pro spolehlivou identifikaci a kvantifikaci složek


Metody molekulární biologie v rostlinné ekologii a systematice

Metody molekulární biologie v rostlinné ekologii a systematice Protokoly a návody pro praktikum Metody molekulární biologie v rostlinné ekologii a systematice Laboratoř molekulární biologie rostlin Přírodovědecká fakulta JU Petr Koutecký, Jiří Košnar & Miroslava Herbstová



MODERNÍ BIOFYZIKÁLNÍ METODY: MODERNÍ BIOFYZIKÁLNÍ METODY: POKROČILÉ PRAKTICKÉ VZDĚLÁVÁNÍ V EXPERIMENTÁLNÍ BIOLOGII Operační program Vzdělávání pro konkurenceschopnost Číslo projektu: CZ.1.07/2.3.00/09.0046 Praktický kurz pokročilých


MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční


Tkáňový homogenizátor MagNA Lyser od společnosti Roche

Tkáňový homogenizátor MagNA Lyser od společnosti Roche Izolace RNA Pracovní postup Homogenizace: Pozn. Postup homogenizace platí pouze pro izolaci RNA z nativní tkáně, v případě izolace z buněčné suspenze je tento krok vynechán a začíná se přídavkem homogenizačního



Téma: IZOLACE DNA Z ROSTLIN, DIRECT A NESTED PCR SPECIFICKÝMI A UNIVERZÁLNÍMI PRIMERY, RFLP. Ing. Jana Fránová, Dr., Biologické centrum AV ČR v.v.i. Téma: IZOLACE DNA Z ROSTLIN, DIRECT A NESTED PCR SPECIFICKÝMI A UNIVERZÁLNÍMI PRIMERY, RFLP Ing. Jana Fránová, Dr., Biologické centrum AV ČR v.v.i. Teorie: Zatímco do devadesátých let minulého století


Sure-MeDIP I. with magnetic beads and MNase.

Sure-MeDIP I. with magnetic beads and MNase. Sure-MeDIP I with magnetic beads and MNase 1 Obsah soupravy a skladování MeDIP souprava obsahuje reagencie na provedení 25 reakcí. Souprava je rozdělen do dvou částí, jedna je distribuována


Praktikum izolace mikrosatelitů a designování mikrosatelitových primerů PROTOKOLY

Praktikum izolace mikrosatelitů a designování mikrosatelitových primerů PROTOKOLY Praktikum izolace mikrosatelitů a designování mikrosatelitových primerů PROTOKOLY Realizace praktika byla umožněna díky finanční podpoře grantem FRVŠ, kategorie F4B, č. projektu 844 2009 Eva Dušková 0



Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Popis Column DNA Lego Kit je základ moderní stavebnicové (Lego) soupravy pro izolaci čisté DNA různého


CENÍK. Restrikční enzymy

CENÍK. Restrikční enzymy CENÍK obchodní divize Forenzní DNA servis, s.r.o. Budínova 2, 180 81 Praha 8, CZE tel/fax: 233 931 123, GSM: 731 503 250 e-mail: Cena chlazených a mražených produktů neobsahuje dopravné


Proteinový fingerprinting vaječného bílku

Proteinový fingerprinting vaječného bílku Proteinový fingerprinting vaječného bílku Proteinový fingerprinting je technika studia populací organizmů založená na izoelektrické fokuzaci (IEF). IEF spočívá v elektroforetickém dělení proteinů podle


Návod k laboratornímu cvičení. Bílkoviny

Návod k laboratornímu cvičení. Bílkoviny Úkol č. 1: Důkazy bílkovin ve vaječném bílku a) natvrdo uvařené vejce s kyselinou dusičnou Pomůcky: Petriho miska, pipeta, nůž. Návod k laboratornímu cvičení Bílkoviny Chemikálie: koncentrovaná kyselina


Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Detekce polymorfizmu DNA tritikale (XTriticosecale Wittmack.) mikrosatelitními markery Metodické návody pro laboratorní cvičení z



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,


Hmotnostní detekce biologicky významných sloučenin pro biotechnologie část 3 - Provedení štěpení proteinů a následné analýzy,

Hmotnostní detekce biologicky významných sloučenin pro biotechnologie část 3 - Provedení štěpení proteinů a následné analýzy, Laboratoř Metalomiky a Nanotechnologií Hmotnostní detekce biologicky významných sloučenin pro biotechnologie část 3 - Provedení štěpení proteinů a následné analýzy, vyhodnocení výsledků, diskuse Anotace





OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14 OBSAH DNA polymerázy pro PCR a pufry.................. 3 Taq DNA polymeráza 4 Taq DNA polymeráza Unis 5 TaqPurple DNA polymeráza 6 Taq DNA polymeráza 1.1 7 Combi Taq DNA polymeráza 8 LA DNA Polymerases


Popis výsledku QC1156/01/2004 Identifikace projektu:

Popis výsledku QC1156/01/2004 Identifikace projektu: Popis výsledku QC1156/01/2004 Identifikace projektu: ČÍSLO PROJEKTU QC1156 PROGRAM TÉMA PRIORITA Program I B) Zlepšování biologického potenciálu rostlin a zvířat a jeho efektivní využívání 3) Metody charakterizace



ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN Fragmenty nukleových kyselin lze dle jejich velikosti rozdělit elektroforézou. Elektroforéza využívá rozdílné pohyblivosti jednotlivých fragmentů, danou právě


Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,


Laboratorní úlohy z molekulární biologie

Laboratorní úlohy z molekulární biologie ČESKÁ ZEMĚDĚLSKÁ UNIVERZITA V PRAZE FAKULTA TROPICKÉHO ZEMĚDĚLSTVÍ Katedra tropických a subtropických plodin a agrolesnictví Laboratoř molekulární biologie Laboratorní úlohy z molekulární biologie Plant


Genetické markery - princip a využití

Genetické markery - princip a využití Genetika a šlechtění lesních dřevin Genetické markery - princip a využití Doc. Ing. RNDr. Eva Palátová, PhD. Ing. R. Longauer, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován



ELEKTROFORETICKÉ METODY ELEKTROFORETICKÉ METODY ELEKTROFORETICKÁ SEPARACE AMINOKYSELIN NA PAPÍROVÉM NOSIČI Aminokyseliny lze rozdělit elektroforézou na papíře. Protože molekulová hmotnost jednotlivých aminokyselin není příliš


167 ml Folinova činidla doplníme do 500 ml destilovanou vodou. Toto činidlo je nestabilní, je nutné připravit vždy čerstvé a uložit při 4 C.

167 ml Folinova činidla doplníme do 500 ml destilovanou vodou. Toto činidlo je nestabilní, je nutné připravit vždy čerstvé a uložit při 4 C. ROZTOKY 1. Činidlo A 12,5 g (NH 4 ) 6 MO 7 O 4. 4H 2 O rozpustíme ve 125 ml bidestilované vody; 0,5 g K(SbO)C 4 H 4 O 6. 0,5 H 2 O rozpustíme ve 20 ml bidestilované vody; Oba tyto roztoky důkladně promícháme


Praktické cvičení: Izolace a purifikace rekombinantního proteinu

Praktické cvičení: Izolace a purifikace rekombinantního proteinu Praktické cvičení: Izolace a purifikace rekombinantního proteinu Toto blokové praktické cvičení spočívá v teoretickém i praktickém seznámení s rekombinantními proteiny, jejich izolací, purifikací a využitím.



ODLIŠENÍ ODRŮD PŠENICE OBECNÉ TRITICUM AESTIVUM L. METODOU RAPD ODLIŠENÍ ODRŮD PŠENICE OBECNÉ TRITICUM AESTIVUM L. METODOU RAPD Distinguishing of Wheat Varieties (Tritium aestivum L.) by Method RAPD Zuzana Kohutová, Zuzana Kocourková, Hana Vlastníková, Petr Sedlák


cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)


Vliv ředění na kyselost/zásaditost roztoků pomocí čidla kyselosti ph

Vliv ředění na kyselost/zásaditost roztoků pomocí čidla kyselosti ph Zvyšování kvality výuky v přírodních a technických oblastech CZ.1.07/1.1.28/02.0055 Vliv ředění na kyselost/zásaditost roztoků pomocí čidla kyselosti ph (laboratorní práce) Označení: EU-Inovace-Ch-8-11


Uživatelská příručka

Uživatelská příručka PGM Barcoding Set 1-8 Navrženo pro PGM ION-TORRENT KÓD PRODUKTU: 2001 (1-8) BALEN9: 32 testů Uživatelská příručka Rev02.2015 Str. 1 Rejstřík 1. POUŽITÍ VÝROBKU 3 2. OBSAH KITU 4 3. SKLADOVÁNÍ 4 4. STABILITA



IZOLACE DNA PRO STANOVENÍ GMO METODOU PCR (KIT NUCLEOSPIN FOOD) 1252.1 Izolace DNA pro stanovení GMO metodou Strana 1 IZOLACE DNA PRO STANOVENÍ GMO METODOU PCR (KIT NUCLEOSPIN FOOD) 1 Účel a rozsah Postup slouží k získání deoxyribonukleové kyseliny (DNA) ze vzorku


Oborový workshop pro ZŠ CHEMIE

Oborový workshop pro ZŠ CHEMIE PRAKTICKÁ VÝUKA PŘÍRODOVĚDNÝCH PŘEDMĚTŮ NA ZŠ A SŠ CZ.1.07/1.1.30/02.0024 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Oborový workshop pro ZŠ CHEMIE


Návod k laboratornímu cvičení. Alkoholy

Návod k laboratornímu cvičení. Alkoholy Úkol č. 1: Ověřování fyzikálních vlastností alkoholů Návod k laboratornímu cvičení Alkoholy Pomůcky: 3 velké zkumavky - A,B,C, hodinové sklíčko, kapátko nebo skleněná tyčinka Chemikálie: etanol (F), etan-1,2-


Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů CZ.1.07/1.1.00/14.

Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů CZ.1.07/1.1.00/14. Praktické cvičení z chemie 1) Stanovení lipofilních listových barviv pomocí adsorpční chromatografie. 2) Stanovení proteinů v roztoku. 3) Homogenizace rostlinného materiálu pomocí tekutého dusíku a stanovení



COMET ASSAY (SINGLE CELL GEL ELECTROPHORESIS) COMET ASSAY (SINGLE CELL GEL ELECTROPHORESIS) OBSAH 1. Princip metody 2. Přístroje a zařízení 3. Příprava vzorků 3.1 Kultivace a sklízení buněk A549 3.2 Výpočet koncentrace buněk 3.3 Hodnocení viability


Jazykové gymnázium Pavla Tigrida, Ostrava-Poruba Název projektu: Podpora rozvoje praktické výchovy ve fyzice a chemii

Jazykové gymnázium Pavla Tigrida, Ostrava-Poruba Název projektu: Podpora rozvoje praktické výchovy ve fyzice a chemii Datum: Teplota vzduchu: Jazykové gymnázium Pavla Tigrida, Ostrava-Poruba Název projektu: Podpora rozvoje praktické výchovy ve fyzice a chemii Laboratorní cvičení č. Cukry(sacharidy) Tlak vzduchu: Vlhkost


Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Inovace praktických cvičení molekulárně-biologických předmětů o sekvenční úlohy PRACOVNÍ PROTOKOL PRO PŘEDMĚT GENETCKÁ DIVERZITA Vypracováno


Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Molekulární markery PCR, RAPD, RFLP, AFLP, mikrosatelity, sekvenace Genetické markery Genetické markery


Praktický kurz Příprava nanočástic metodami syntézy v žížalách, charakterizace - Imunohistochemické barvení

Praktický kurz Příprava nanočástic metodami syntézy v žížalách, charakterizace - Imunohistochemické barvení Laboratoř Metalomiky a Nanotechnologií Praktický kurz Příprava nanočástic metodami syntézy v žížalách, charakterizace - Imunohistochemické barvení Vyučující: Mgr. Bc. Markéta Komínková Postup imunohistochemického


Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Využití techniky RACE (Rapid amplification of complementary DNA ends) pro identifikaci genů pro metalothioneiny Metodické návody pro


Výzkumný ústav rostlinné výroby Praha Ruzyně

Výzkumný ústav rostlinné výroby Praha Ruzyně Výzkumný ústav rostlinné výroby Praha Ruzyně Optimalizovaná metodika PAGE pro analýzu peroxidáz v hlízách brambor (Solanum tuberosum L.) Vypracovaná jako výstup projektu 1B 44011 VÝVOJ A TESTOVÁNÍ SYSTÉMU


Vyjadřuje poměr hmotnosti rozpuštěné látky k hmotnosti celého roztoku.

Vyjadřuje poměr hmotnosti rozpuštěné látky k hmotnosti celého roztoku. Koncentrace roztoků Hmotnostní zlomek w Vyjadřuje poměr hmotnosti rozpuštěné látky k hmotnosti celého roztoku. w= m A m s m s...hmotnost celého roztoku, m A... hmotnost rozpuštěné látky Hmotnost roztoku


Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Speciální ZŠ a MŠ Adresa. U Červeného kostela 110, 415 01 TEPLICE Číslo op. programu CZ. 1. 07 Název op. programu

Speciální ZŠ a MŠ Adresa. U Červeného kostela 110, 415 01 TEPLICE Číslo op. programu CZ. 1. 07 Název op. programu Subjekt Speciální ZŠ a MŠ Adresa U Červeného kostela 110, 415 01 TEPLICE Číslo op. programu CZ. 1. 07 Název op. programu OP Vzdělávání pro konkurenceschopnost Číslo výzvy 21 Název výzvy Žádost o fin. podporu


Western blotting. 10% APS 20,28 µl 40,56 µl 81,12 µl 20,28 µl 40,56 µl 81,12 µl

Western blotting. 10% APS 20,28 µl 40,56 µl 81,12 µl 20,28 µl 40,56 µl 81,12 µl Western blotting 1. Příprava gelu složení aparatury hustotu gelu volit podle velikosti proteinů příprava rozdělovacího gelu: 10% 12% počet gelů 1 2 4 1 2 4 objem 6 ml 12 ml 24 ml 6 ml 12 ml 24 ml 40% akrylamid


TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně



MOLEKULÁRNÍ BIOLOGIE I PŘÍPRAVA TKÁNĚ K IZOLACI DNA Cvičení 9,10,11: MOLEKULÁRNÍ BIOLOGIE Jméno: Skupina: Cíl: Seznámení se se základními metodami, využívanými k analýze DNA 1. izolace DNA 2. amplifikace DNA pomocí PCR 3. restrikční štěpení PCR produktu


C V C. Návod k použití pro Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revize 2. Červenec 2014

C V C. Návod k použití pro Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revize 2. Červenec 2014 DOT130v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Strana 1 / 7 Návod k použití pro Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revize 2 Červenec 2014 DOT130v1



KURZ ZÁKLADNÍCH METOD MOLEKULÁRNÍ BIOLOGIE EKOTECH KURZ ZÁKLADNÍCH METOD MOLEKULÁRNÍ BIOLOGIE Biologické centrum AV ČR, České Budějovice Lektoři: Radmila Čapková Frydrychová Miroslava Sýkorová Jindra Šíchová Václav Brož OBSAH STR. PŘÍPRAVA ROZTOKŮ.


2) Připravte si 3 sady po šesti zkumavkách. Do všech zkumavek pipetujte 0.2 ml roztoku BAPNA o různé koncentraci podle tabulky.

2) Připravte si 3 sady po šesti zkumavkách. Do všech zkumavek pipetujte 0.2 ml roztoku BAPNA o různé koncentraci podle tabulky. CVIČENÍ Z ENZYMOLOGIE 1) Stanovení Michaelisovy konstanty trypsinu pomocí chromogenního substrátu. Aktivita trypsinu se určí změřením rychlosti hydrolýzy chromogenního substrátu BAPNA (Nα-benzoyl-L-arginin-p-nitroanilid)



JODOMETRICKÉ STANOVENÍ ROZPUŠTĚNÉHO KYSLÍKU JODOMETRICKÉ STANOVENÍ ROZPUŠTĚNÉHO KYSLÍKU (dle Winklera v Alsterbergově modifikaci) Cílem je stanovení rozpuštěného kyslíku v pitné vodě z vodovodního řádu. Protokol musí osahovat veškeré potřebné hodnoty



VYUŽITÍ AFLP PRO DNA GENOTYPIZACI ROSTLIN RNDr. Jaroslava Ovesná, CSc. Mgr. Jan Hodek VYUŽITÍ AFLP PRO DNA GENOTYPIZACI ROSTLIN METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2007 Metodika byla vypracována pracovníky Národní Referenční


Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody

Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody Návod k použití souprav Wipe test Kontaminační kontrola Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody REF 7091 40 reakcí 1. Popis výrobku V posledních letech se



JOGURTOVÝ POHÁR S JAHODAMI JOGURTOVÝ POHÁR S JAHODAMI 450 g jahod 10 g želatiny 250 ml bílého jogurtu 1 vanilkový cukr 50 g cukru krupice Želatinu přelijeme 30 ml horké vody a za stálého míchání ji necháme rozpustit a zchladnout.


Objednací číslo Určení Ig-třída Substrát Formát EI 2192-9601 M Chlamydia pneumoniae IgM Ag-potažené mikrotitrační jamky

Objednací číslo Určení Ig-třída Substrát Formát EI 2192-9601 M Chlamydia pneumoniae IgM Ag-potažené mikrotitrační jamky Protilátky proti Chlamydia pneumoniae (IgM) Návod na použití ELISA testu Objednací číslo Určení Ig-třída Substrát Formát EI 2192-9601 M Chlamydia pneumoniae IgM Ag-potažené mikrotitrační jamky 96 x 01


Laboratorní pomůcky, chemické nádobí

Laboratorní pomůcky, chemické nádobí Laboratorní pomůcky, chemické nádobí Laboratorní sklo: měkké (tyčinky, spojovací trubice, kapiláry) tvrdé označení SIMAX (většina varného a odměrného skla) Zahřívání skla: Tenkostěnné nádoby (kádinky,


Teplé housky s překvapením. Anglické rohlíky. Ingredience

Teplé housky s překvapením. Anglické rohlíky. Ingredience Anglické rohlíky těsto: 175 ml vlažné vody, 120 ml vlažného mléka, 1 lžička cukru, 1,5 lžičky soli, 2 lžíce sušené bramborové kaše, 400 g hladké mouky, 1 kostka čerstvého droždí nebo 2 lžičky sušeného


Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní


Chemikálie a chemické nádobí

Chemikálie a chemické nádobí Chemikálie a chemické nádobí Klasifikace a označování chemických látek a směsí Třída nebezpečnosti fyzikální nebezpečnost, nebezpečnost pro lidské zdraví, nebezpečnost pro životní prostředí, nebezpečí


Výzkumný ústav rostlinné výroby Praha Ruzyně. Metodika byla vypracována jako výstup výzkumného záměru MZe č. 0002700602. Autor: Ing.

Výzkumný ústav rostlinné výroby Praha Ruzyně. Metodika byla vypracována jako výstup výzkumného záměru MZe č. 0002700602. Autor: Ing. Výzkumný ústav rostlinné výroby Praha Ruzyně Optimalizovaná metodika SDS-PAGE pro analýzu LMW podjednotek gluteninů pšenice Metodika byla vypracována jako výstup výzkumného záměru MZe č. 0002700602 Autor:



RNA Blue REAGENS PRO RYCHLOU PŘÍPRAVU ČISTÉ A NEDEGRADOVANÉ RNA (katalogové číslo R011, R012, R013) RNA Blue REAGENS PRO RYCHLOU PŘÍPRAVU ČISTÉ A NEDEGRADOVANÉ RNA (katalogové číslo R011, R012, R013) Upozornění: RNA Blue obsahuje fenol a další toxické komponenty. Při kontaktu s kůží je nutné omytí velkým
