12. Mendelistická genetika

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "12. Mendelistická genetika"

Transkript

1 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat znaky potomkům Prvním vědcem, který se doloženě zabýval takříkajíc moderní genetikou byl J.G. Mendel: Johann Gregor Mendel ( ) slezský řeholník, studoval na universitě v Olomouci, věnoval se pokusům s dědičností. V klášterní zahradě pěstil hrach, měl jej rozdělen na 7 částí. Zabraňoval samovolnému rozmnožování kytek, uměle je křížil. Pokaždé sledoval jenom jednu vlastnost hrachu. Tímto pozorováním se zabýval celých 7 let, o všem vedl pečlivé poznámky, ty vyšli v r v němčině pod názvem Pokusy s rostlinnými hybridy (Versuche über Pflanzen-Hybriden).

2 Gaston Bonnier ( ) fr. botanik, mezi jehož nejvýznamnější přínosy vědě počítáme pozorování pampelišek. Rozřízl jeden kořen a půlku zasadil doma v pařížské zahrádce, druhou půlku odnesl do Alp, kde ji zasadil ve volné přírodě. Dvě rostliny, které mu vyrostly, nesly více charakteristických rozdílů: Tímto Bonnier dokázal, že i prostředí má zásadní vliv na vývoj a podobu organismů. Mendelovy závěry Na základě svých pozorování zavedl Mendel několik základních pojmů: (neprojevený) gen znak (vnější projev) Gen je vloha jednotka informace, která se může/nemusí projevit, určuje vzezření a jednotliivé aspekty jedince. Geny se dědí v párech, potomek získá od každého rodiče náhodně jeden z dvou genů. alela konkrétní forma jednoho genu, může jich být i víc na jeden gen Příklad: gen určující barvu u hrachu má dvě podoby žlutou a zelenou alelu genotyp x fenotyp Mluvíme-li o genotypu, myslíme tím genetický materiál daného jedince, tedy výpis všech genů, i těch, které se neprojevují. Fenotyp je vnější projev (vzhled) jedince. Příklad: genotyp Aa se projeví jako fenotyp A

3 dominance x recesivita dominance se navenek vyskytuje častěji, projevuje se; recesivita ustupuje, neprojevuje se Příklad: žlutá alela (A) je dominantní nad zelenou alelou (a) homozygot jedinec, který má z jednoho genu jenom jednu alelu (AA nebo aa) heterozygot jedinec, který má z jednoho genu dvě odlišné alely (Aa) monohybrid jedinec, který má jenom jeden gen, většinou se o monohybridech mluví z relativního pohledu, kdy ostatní geny nebereme do úvahy a pozorujeme jenom jeden konkrétní (AA nebo aa) sledujeme-li více znaků u jednoho jedince, musíme už o něm mluvit jako o dihybridovy má více rozdílných genů (AABB nebo AaBB atd.) MENDELOVY ZÁKONY 1) O uniformitě F 1 generace Při křížení dvou čistých linií (dominantního a recesivního homozygóta) je potomstvo uniformní (s dominantními fenotypovými znaky). Jinak řečeno, pokud jsou v parentální generaci homozygoti (jeden dom. a druhý rec.), budou v první filiální generaci jenom heterozygoti, všichni se stejným fenotypem. 2) O segregaci alel a jejich kombinaci Při produkci pohlavních buněk se alely segregují (oddělují) a při oplození dochází k jejich kombinaci. Při křížení dvou heterozygotů je fenotypový štěpný poměr 3:1 (ve prospěch dominantního znaku). Nebo by se dalo říct, že pokud mezi sebou křížíme heterozygoty, nebo-li 1. filiální generaci vzniklou křížením recesivního a dominantního homozygota, dostaneme genotyp dominantního homozygota, heterozygoty a recesivního homozygota v pevném poměru 1:2:1 a fenotyp dominantní gen:recesivní v poměru 3:1.

4 3) O nezávislé kombinovatelnosti alel Alely dvou různých genů se v potomstvu segregují a kombinují nezávisle na sobě. Při křížení heterozygotního dihybrida je fenotypový štěpný poměr 9:3:3:1. Tedy tolik, že když se díváme na dva geny, tyto se kombinují zcela samostatně, jiné geny je vůbec neovlivňují. Křížení dihybrida je skvělým příkladem. Křížení dihybrida Krevní skupiny (Vsuvka, kdyby už nebylo o čem mluvit. Nejsem si jist, jestli tam budou příklady i na krevní skupiny.) Existují 3 krevní alely, A, B a 0. A a B jsou dominantní vůči 0, jinak vše funguje dle Mendelových zákonů. Dá se ilustrovat třeba příkladem č. 6.

5 Příklady: 1. U skotu je bezrohost dominantní vůči rohatosti. Jaké potomstvo můžeme očekávat ze zkřížení bezrohého býka s roahatými kravami, když víme, že jedna z nich již dříve při zkřížení s týmž býkem porodila rohaté tele? řešení: B bezrohovitost b rohatost krávy bb (rohaté krávy jsou fenotypně recesivní, nemohou mít proto žádnou dominantní alelu B) býk Bb (musí mít i recesivní alelu b, nakolik měl v minulosti fenotypně recesivní potomky) Potomství může být fenotypně dominantní (Bb) nebo i recesivní (bb). 2. Normální pigentace kůže je u lidí dominantní nad albinotickou. Normálně pigmentovaný muž se ožení s albinotickou ženou. Jejich první dítě je albinotické. Jaké jsou genotypy všech tří osob? Budou-li mít rodiče více dětí, jaká je pravděpodobnost, že budou albinotické? řešení: P normální pigmentace p albinotická pigmentace žena pp muž Pp dítě pp pravděpodobnost jednotlivých možností pigmentace u dalších dětí je stejná (1:1) (žena dá pokaždé alelu p, u muže je šance 50/50) 3. U okurky jsou listy typicky dlanité, je však znám gen, který podmiňuje vějířovité listy nazývané Ginkgo. Po křížení homozygotní rostliny s listy dlanitými s homozygotní rostlinou s listy Ginkgo byly listy všech rostlin F 1 dlanité. Která z obou alel je dominantní? Uveďte genotypy rodičů a potomků. řešení: dominantní je alela podmiňující dlanité listy (víme podle fenotypu F 1 generace) l tvar listů normální L Ginkgo rodiče DD a dd potomci Dd

6 4. U andaluského plemene slepis podmiňuje alela B tmavou barvu peří, alela b bílou. Slepice heterozygotní mají peří modravé. Jaké bude potomstvo po křížení modravé slepice s kohoutem a) s tmavým peřím b) s modravým peřím c) s bílým peřím? řešení: a) tmavé i modravé potomstvo (1:1) b) tmavé, modravé i bílé potomstvo (1:2:1) c) bílé i modravé potomstvo (1:1) 5. U králika domácího označujeme černou barvu srsti (Č), hnědou barvu (č). Srst krátká je dominantní (K) nad dlouhou (k). Homozygotně černý samec s krátkou srstí byl zkřížen s homozygotní hnědou samicí s dlouhou srstí. Jaké budou genotypy a fenotypy v generacích F 1 a F 2? řešení: můžeme očekávat uniformní potomstvo s genotypem ČčKk (fenotyp černý krátkosrstý). Generace F 2 bude zahrňovat králíky všeho druhu černé krátkosrsté, černé dlouhosrsté, hnědé krátkosrsté a hnědé dlouhosrsté (v poměru 9:3:3:1). Genotyp F 2 : AABB, AABb, AaBB, AaBb, Aabb, aabb, aabb (poměr 1:2:1:2:4:2:1:2:1). 6. Kterého z mužů lze vyloučit jako otce dítěte? a) matka má krevní skupinu B, dítě 0, jeden muž A, druhý AB b) matka má krevní skupinu B, dítě AB, jeden muž A, druhý B řešení: a) muž AB nemůže být otcem dítě by muselo mít nutně A nebo B krev b) muže B můžeme vyloučit jako otce dítě by nemělo kde vzít prvek A 7. Zjistěte krevní skupiny mužů, u kterých lze vyloučit paternitu, znáte-li krevní skupiny matky a dítěte: a) matka 0, dítě 0 b) matka 0, dítě A c) matka A, dítě B d) matka AB,dítě B řešení: a) otcem nemůže být AA, BB, AB (musí mít alespoň jednu 0) b) otcem nemůže být BB, 0 (musí mít alespoň jedno A) c) otcem nemůže být AA, 0 (musí mít alespoň jedno B) d) otcem nemůže být AA (to by dítě rovněž muselo mít prvek A) zdroj: sešit a nejmenší úlomek wikipedie časové rozložení: 10 min kecačka + 5 min příklady (tak mi to vyšlo)

Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem

Více

Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat

Více

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

MENDELOVSKÁ DĚDIČNOST

MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp

Více

Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků

Více

Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského

Více

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je

Více

Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny

Více

Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje

Více

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly

Více

Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou

Více

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

GENETIKA A JEJÍ ZÁKLADY

GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky

Více

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické

Více

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil

Více

Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových

Více

Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u

Více

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem

Více

Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus

Více

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou

Více

Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém

Více

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák MENDELISMUS Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák 1822-1884 In the ten years G. Mendel worked on his plants in the garden of the monastery, he made the greatest discovery in biology that

Více

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto

Více

GENETIKA V MYSLIVOSTI

GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností

Více

Druhová a mezidruhová hybridizace

Druhová a mezidruhová hybridizace Druhová a mezidruhová hybridizace Obsah Druhová a mezidruhová hybridizace... 1 Obsah... 1 Monohybridní křížení... 1 Dihybridní křížení... 2 Polyhybridní křížení... 3 Souhrn Mendelismus v dědičnosti kvalitativních

Více

13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Tradice šlechtění šlechtění zlepšování pěstitelsky, technologicky a spotřebitelsky významných vlastností

Více

GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných

Více

S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef

Více

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým

Více

Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci

Více

Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého

Více

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010

Více

Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.

Více

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace Pojmy k zpmtování Gen -část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN Gen je různě dlouhá sekvence nukleotidů Gen je jednotk funkce

Více

RURGenetika zápočtový program Programování II

RURGenetika zápočtový program Programování II RURGenetika zápočtový program Programování II Rudolf Rosa cvičící: Doc. RNDr. Pavel Töpfer, CSc. Obsah Specifikace...1 Původní specifikace...1 Upravená specifikace...2 Program...3 třída Populace...4 Datové

Více

1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,

Více

BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.

Více

Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u

Více

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika 1/6 3.2.11.18 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost

Více

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že

Více

genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace

Více

9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů

9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů 9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou

Více

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.cz Mutace Mutace - náhodná změna v genomu organismu - spontánní

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních

Více

OLYMPIÁDA MLADÝCH CHOVATELŮ 2015

OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 Genetika a plemenné znaky u králíků Chov králíků, II. Kategorie Johana Vinšová *13. 8. 1997 Žabonosy 113, Kolín 2, 280 02 ZO ČSCH Kolín 1 Práce započata dne: 25. 11. 2014

Více

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová

Více

Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická

Více

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový

Více

Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho

Více

Příbuznost a inbreeding

Příbuznost a inbreeding Příbuznost a inbreeding Příbuznost Přímá (z předka na potomka). Souběžná (mezi libovolnými jedinci). Inbreeding Inbrední koeficient je pravděpodobnost, že dva geny přítomné v lokuse daného jedince jsou

Více

BARVY BORDER COLLIÍ. Na konci tohoto dokumentu naleznete schéma hlavních barev podle lokusů.

BARVY BORDER COLLIÍ. Na konci tohoto dokumentu naleznete schéma hlavních barev podle lokusů. BARVY BORDER COLLIÍ Barva psí srsti je dána geneticky. Pro všechny border collie (snad až na vzácné výjimky) platí, že ve své genetické výbavě nesou alelu Si, která determinuje irské zbarvení (bílé znaky)

Více

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním

Více

Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů

Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů Imunogenetika Vědní odvětví zabývající se imunitním systémem obratlovců, který je výrazně odlišuje od nižších organizmů se nazývá imunologie. Její náplní je zejména studium imunity mechanizmů stálosti

Více

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto

Více

PRAKTIKUM Z OBECNÉ GENETIKY

PRAKTIKUM Z OBECNÉ GENETIKY RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie lizal@sci.muni.cz 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin

Více

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro

Více

Studie landseera. Studie landseera - zbarvení srsti

Studie landseera. Studie landseera - zbarvení srsti Studie landseera Při studiu landseera jsem se musela aspoň zlehýnka dotknout i genetického minima, jinak bych si nedovolila tvrdit, že jsem něco studovala. Tato studie se týká zbarvení srsti landseera.

Více

=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům

=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům Otázka: Genetika Předmět: Biologie Přidal(a): t.klodnerova REALIZACE GENETICKÉ INFORMACE, MUTACE, ZÁKLADNÍ GENETICKÉ POJMY: GEN, ZNAK, ALELA, GENOTYP, FENOTYP, HOMOZYGOT, HETEROZYGOT, HYBRIDIZACE, DOMINANCE,

Více

Proč jsme podobní rodičům? A jak k tomu vlastně může dojít?

Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Základy genetiky Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Johann Gregor Mendel (1822 1884) O jeho životě byl mnich, zakladatel genetiky a opat augustiniánského kláštera v Brně studium

Více

Základní barvy holuba domácího

Základní barvy holuba domácího Základní barvy holuba domácího Ing. Juraj Kafka Národní komise pro standardy holubů ČSCH 5 Popis původního zbarvení Columba livia, (L.) modré černopruhé 4 3 1 2 1. Krk část opeření s rozprostřenými pigmentovými

Více

Nadaní v přírod. vědách. Jiřina Novotná Katedra matematiky Pedagogická fakulta MU Brno

Nadaní v přírod. vědách. Jiřina Novotná Katedra matematiky Pedagogická fakulta MU Brno Nadaní v přírod. vědách Jiřina Novotná Katedra matematiky Pedagogická fakulta MU Brno Úvod charakteristika nadaných Oblast poznávání: - schopnost manipulovat abstraktními symbolickými systémy, - schopnost

Více

Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák

Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák KVANTITATIVNÍ GENETIKA dědičnost kvantitativních znaků ZNAKY KVALITATIVNÍ: gen znak barva hrachu: žlutá zelená (i komplikovaněji penetrace, epresivita,

Více

QTL u koní. Kmen je skupina koní v rámci plemene, odlišných morfologických a užitkových vlastností (šlechtění na tažné a jezdecké využití).

QTL u koní. Kmen je skupina koní v rámci plemene, odlišných morfologických a užitkových vlastností (šlechtění na tažné a jezdecké využití). QTL u koní Dnešní plemena koní se odvozují od divokých předků, od: Equus przewalskii (kůň Převalského-kertaka) Equus gmelini (kůň západní) Equus gracilis (kůň severský) Pojmy plemenitby Plemeno je skupina

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)

Více

Mendelistická genetika

Mendelistická genetika Mendelova práce Se svými hybridizačními pokusy s hrachem (Pisum L.) začal Mendel v roce 1856 v klášterní zahradě na Starém Brně. Experimenty prováděl do roku 1868, když byl zvolen za opata kláštera. V

Více

Zkoumání přírody. Myšlení a způsob života lidí vyšší nervová činnost odlišnosti člověka od ostatních organismů

Zkoumání přírody. Myšlení a způsob života lidí vyšší nervová činnost odlišnosti člověka od ostatních organismů Předmět: PŘÍRODOPIS Ročník: 9. Časová dotace: 1 hodina týdně Výstup předmětu Rozpracované očekávané výstupy Učivo předmětu Přesahy, poznámky Konkretizované tématické okruhy realizovaného průřezového tématu

Více

Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):

Více

Genová vazba. Obr. č. 1: Thomas Hunt Morgan

Genová vazba. Obr. č. 1: Thomas Hunt Morgan Genová vazba Jednou ze základních podmínek platnosti Mendelových zákonů je lokalizace genů, které podmiňují různé vlastnosti na různých chromozómech. Toto pravidlo umožňuje volnou kombinovatelnost genů

Více

Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií

Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Obecná genetika Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Ing. Roman Longauer, CSc. Ústav zakládání a pěstění lesů, LDF MENDELU Brno Tento projekt je spolufinancován Evropským

Více

- Definice inbreedingu a jeho teorie

- Definice inbreedingu a jeho teorie Negativní důsledky inbrední deprese v chovu skotu Ing. Jiří Bezdíček, Ph.D. Výzkumný ústav pro chov skotu, s.r.o., Rapotín 26. listopadu 2009 - Definice inbreedingu a jeho teorie - Proč je inbreeding v

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Využití algebraických hyperstruktur při určování dědičnosti krevních skupin

Využití algebraických hyperstruktur při určování dědičnosti krevních skupin PWSZ Nowy SĄcz Zeszyty Naukowe PWSZ NS, Nowy SĄcz 2013 Využití algebraických hyperstruktur při určování dědičnosti krevních skupin Eva Bártková 1, David Nocar 2, Květoslav Bártek 3 1 Katedra matematiky

Více

Zvyšování kvality výuky technických oborů

Zvyšování kvality výuky technických oborů Zvyšování kvality výuky technických oborů Klíčová aktivita V.2 Inovace a zkvalitnění výuky směřující k rozvoji odborných kompetencí žáků středních škol Téma V.2.18 Dřeviny Kapitola 2 Rozmnožování rostlin

Více

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o.

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o. Genetické markery ve šlechtění skotu pro masnou produkci Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Genetické markery Polymorfní místa v DNA, které vykazují asociaci na sledované znaky Příčinné

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

ŠKOLNÍ VZDĚLÁVACÍ PROGRAM

ŠKOLNÍ VZDĚLÁVACÍ PROGRAM Vyučovací předmět : Období ročník : Učební texty : Přírodopis 3. období 9. ročník Danuše Kvasničková, Ekologický přírodopis pro 9. ročník ZŠ a nižší ročníky víceletých gymnázií, nakl. Fortuna Praha 1998

Více

Proč nový systém odhadu plemenných hodnot?

Proč nový systém odhadu plemenných hodnot? Proč nový systém odhadu plemenných hodnot? Faktory ovlivňující užitkovost Chovatel Výživa Prostředí Užitkovost Genetická výbava 5-15% Zisk chovatele Spotřebitel Hodnocení zvířat 1900 KU 1920 vývoj metod

Více

Předmět:: Přírodopis. Savci funkce základních orgánů. Savci - anatomie a morfologie typických zástupců skupin živočichů, funkce orgánů

Předmět:: Přírodopis. Savci funkce základních orgánů. Savci - anatomie a morfologie typických zástupců skupin živočichů, funkce orgánů Obecná biologie a genetika 3 rozpozná, porovná a objasní funkci základních orgánů (orgánových soustav) rostlin i živočichů Biologie živočichů 16 porovná základní vnější a vnitřní stavbu vybraných živočichů

Více

STŘEDOŠKOLSKÁ ODBORNÁ ČINNOST

STŘEDOŠKOLSKÁ ODBORNÁ ČINNOST STŘEDOŠKOLSKÁ ODBORNÁ ČINNOST Obor SOČ: 7. Zemědělství, potravinářství, lesní a vodní hospodářství Genetika kvalitativních znaků králíků Johana Vinšová Kraj: Praha Praha 2016 STŘEDOŠKOLSKÁ ODBORNÁ ČINNOST

Více

Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským

Více

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě Otázka: Genetika I Předmět: Biologie Přidal(a): Paris -věda, která se zabývá dědičností a proměnlivostí -zakladatelem je Johan Gregor Mendel (1822 1884), který se narodil v Hynčicích na Moravě 1. MOLEKULÁRNÍ

Více

Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina

Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina Přehled GMH Seminář z biologie GENETIKA Molekulární genetika Základní dogma molekulární biologie Základním nosičem genetické informace je molekula DNA. Tato molekula se může replikovat (kopírovat). Informace

Více

Využití masných plemen chovaných v ČR pro křížení a produkci jatečného skotu

Využití masných plemen chovaných v ČR pro křížení a produkci jatečného skotu VÝZKUMNÝ ÚSTAV ŽIVOČIŠNÉ VÝROBY, v.v.i. Praha Uhříněves CERTIFIKOVANÁ METODIKA Využití masných plemen chovaných v ČR pro křížení a produkci jatečného skotu Autoři: Ing. Daniel Bureš, Ph.D. Ing. Luděk Bartoň,

Více