Selekce v populaci a její důsledky

Rozměr: px
Začít zobrazení ze stránky:

Download "Selekce v populaci a její důsledky"


1 Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/

2 Poznámky: Rovnováha v populaci bez vlivu evolučních faktorů S,MI,MU,Drift = Genetický posun Selekce: *životaschopnost-vitalita, *plodnost -účast na reprodukci Zmeny frekvencí alel? větvení SM, vidličnatost bk, IDH-B2/B3 JD 1. q = 0,2, p + q = 1, p2 + 2pq + q2 = 1 - selekce proti recesivním homozygotům úplná a částečná 2. Po první generaci se změní poměry: Na reprodukci se podílí jenom zůstávající jedinci Dopočet na novou situaci, zjistí se *nejdřív frekvence dominantní alely, *pak recesivní alely a *následně genotypové četnosti 3. Pointa: Recesivní alela se jednorazovou selekcí z populace nestrácí, přenášejí ji heterozygoti. Prot se klade mimořádný důraz na absenci stromů s nevhodnými fenotypovými vlastnostmi v UP a jejich okolí se odstraňují porosty fenotypové kategorie E. Ukázat, jak se zjistí p, pokud p2 je 36% = 0,36 Zopakovat postup výpočtu 3x. Počítat na 3 desetinná místa. Kontrola se studenty podle hárku s výsledky

3 Poznámky: Částečná selekce v přírodě: proti homozygotům, heterozygotům Umělá: proti nositelům nežádoucích vlastností A) Nevhodný typ větvení a tvaru koruny = vrcholcové zlomy = nutnost nahradit chybějící vrchní část stromu = nižší plodnost B) Nevhodný genotyp v enzymech (izoenzymech) základního metabolismu = nižší vitalita / chřádnutí = nižší plodnost. Intenzita selekce udává, jaká část populace z ní vymizí aniž by dospěla a mohla se zreprodukovat /přispět k reprodukci / dala potomstvo, Číselné vyjádření int. sel. = koeficient selekce Jestli je frekvence recesivní alely vysoká, její četnost po opakované selekci klesá rychle. Když je nízká, klesá pomalu. Rychlost poklesu četnosti recesivní / nežádoucí alely je úměrná intenzitě selekce.

4 Selekce hlavní příčina porušování rovnováhy populace organismy s adaptivnějším genotypem (přizpůsobené) produkují víc potomstva působí snižování nebo zvyšování frekvence genů

5 adaptivní hodnota genotypů (0-1) selekční koeficient s udává, jaká část jedinců určitého genotypu uhyne, aniž by dala potomstvo působí-li proti některému genotypu selekční tlak, bude jeho adaptivní hodnota 1 s je-li s = 0, nepůsobí proti genotypu selekční tlak je-li s = 1, adaptivní hodnota = 0 (genotyp nepřispívá do gametového fondu) mění se frekvence genů a genotypů

6 selekce se uplatňuje při: a) přírodním výběru kriterium je životaschopnost a plodnost b) umělém výběru kriteriem jsou hosp. významné znaky možnost urychlení rozmnožení žádoucích forem

7 Hardy-Weinbergův zákon Ve velké panmiktické populaci nedochází z generace na generaci ke změně genových frekvencí - pokud nepůsobí selekce mutace, migrace nebo náhodné změny = genetický drfit /posun/ Pro genotypové frekvence v panmiktické populaci platí vztah: p 2 (AA) + 2pq(Aa) + q 2 (aa) = 1 p 2 + 2pq + q 2 = 1

8 V panmiktické populaci H-W zákon platí pro jakékoliv genové a genotypové frekvence Pomocí vztahu p 2 + 2pq + q 2 = 1 a p + q = 1 lze zjistit: 1) podíl genotypů, známe-li frekvenci alel: AA = p 2 aa = q 2 Aa = 2pq 2) frekvenci alel, známe-li frekvence genotypů p 2 = p q 2 = q 3) zda je populace v rovnováze, t.j. jestli zjištěné četnosti homozygotních a heterozygotních genotypů odpovídají četnostem vypočteným (očekávaným) z p 2 + 2pq + q 2 = 1

9 0,20 0,640 0,320 0,040 1,0 0,80 0,20 0,640 0, ,960 0,667 0, ,0 0,833 0,167 0,694 0,278 0,028 1,0 0,694 0, ,972

10 Frekvence genotypů Celková Frekvence alel v gametách Generace AA Aa aa frekvence A a 0 p q 1- zygoty před selekcí p 2 2pq q 2 1,0 1- po selekci p 2 2pq 0 p 2 + 2pq 1 -nové frekvence jedinců p 2 p 2 + 2pq 2pq p 2 + 2pq 0 p 2 + 2pq 1,0 p 2 + pq p 2 +2 pq pq p 2 + 2pq 0 0,80 0,20 1-zygoty před selekcí 1- po selekci 1- nové frekvence jedinců 2 zygoty před selekci 2 po selekci 2- nové frekvence jedinců 3- zygoty před selekcí 3- po selekci 3-nové frekvence jedinců 4- zygoty před selekcí 4 - po selekci 4-nové frekvence jedinců 0,640 0,320 0,040 1,0 0,640 0, ,960 0,667 0, ,0 0,694 0,278 0,028 1,0 0,694 0, ,972 0,833 0,167

11 Vliv výchozí frekvence alely q na účinnost selekce při úplné selekci recesivních homozygotů


13 S=0,5


Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským


Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že


Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém


V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


Pojem plemeno je používán pro rasy, které vznikly záměrnou činností člověka, např. plemena hospodářských zvířat.

Pojem plemeno je používán pro rasy, které vznikly záměrnou činností člověka, např. plemena hospodářských zvířat. POPULAČNÍ GENETIKA Populační genetika se zabývá genetickými zákonitostmi v definovaných souborech jedinců téhož druhu. Genetické vztahy uvnitř populace jsou komplikované, a proto se v populační genetice


Příbuznost a inbreeding

Příbuznost a inbreeding Příbuznost a inbreeding Příbuznost Přímá (z předka na potomka). Souběžná (mezi libovolnými jedinci). Inbreeding Inbrední koeficient je pravděpodobnost, že dva geny přítomné v lokuse daného jedince jsou


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií

Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Obecná genetika Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Ing. Roman Longauer, CSc. Ústav zakládání a pěstění lesů, LDF MENDELU Brno Tento projekt je spolufinancován Evropským


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem



GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou



GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


Genetika populací. Doposud genetika na úrovni buňky, organizmu

Genetika populací. Doposud genetika na úrovni buňky, organizmu Doposud genetika na úrovni buňky, organizmu - jedinec nás nezajímá - pouze jeho gamety a to jako jedny z mnoha = genofond = soubor všech gamet skupiny jedinců Populace mnoho různých definic - skupina organizmů


Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat



GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


Populační genetika Radka Reifová

Populační genetika Radka Reifová Populační genetika Radka Reifová Prezentace ke stažení: v záložce Courses Literatura An Introduction to Population Genetics. Rasmus Nielsen and Montgomery Slatkin. 2013.


12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat


- Definice inbreedingu a jeho teorie

- Definice inbreedingu a jeho teorie Negativní důsledky inbrední deprese v chovu skotu Ing. Jiří Bezdíček, Ph.D. Výzkumný ústav pro chov skotu, s.r.o., Rapotín 26. listopadu 2009 - Definice inbreedingu a jeho teorie - Proč je inbreeding v


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela


1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,


Hardy-Weinbergův princip

Hardy-Weinbergův princip 1) Modelová populace 2) Hardy-Weinbergův princip 3) Hardy-Weinbergův princip využití Testování HW poměru Stanovení četnosti heterozygotů při úplné dominanci Interpretace DNA profilů 4) Snyderovy podíly


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců



PRAKTIKUM Z OBECNÉ GENETIKY RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin


Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.


Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010


RURGenetika zápočtový program Programování II

RURGenetika zápočtový program Programování II RURGenetika zápočtový program Programování II Rudolf Rosa cvičící: Doc. RNDr. Pavel Töpfer, CSc. Obsah Specifikace...1 Původní specifikace...1 Upravená specifikace...2 Program...3 třída Populace...4 Datové


Genetika populací a. Gentika populací. Autogamická populace

Genetika populací a. Gentika populací. Autogamická populace Genetika populací a člověka Mgr. Aleš RUDA Gentika populací Populace = všichni jedinci téhož druhu, kteří obývají vdaném čase stejné území GENOFOND soubor alel v gametách všech členů populace GENETIKA


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého


Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým



TYPY DĚDIČNOSTI GONOSOMÁLNÍ DĚDIČNOST TYPY DĚDIČNOSTI GONOSOMÁLNÍ DĚDIČNOST DĚDIČNOST POHLAVNĚ VÁZANÁ geny lokalizované na pohlavních chromozomech X nebo Y řídí vznik nejen primárních pohlavních znaků přenos genů na potomky je vázán na přenos


Ekologické a evoluční aspekty genetiky

Ekologické a evoluční aspekty genetiky Ekologické a evoluční aspekty genetiky Teoretická populační genetika popisuje na základě matematických modelů, jak se pod vlivem různých evolučních faktorů mění genové frekvence v populacích. Formuluje


Osnova přednášky volitelného předmětu Evoluční vývoj a rozmanitost lidských populací, letní semestr

Osnova přednášky volitelného předmětu Evoluční vývoj a rozmanitost lidských populací, letní semestr Osnova přednášky volitelného předmětu Evoluční vývoj a rozmanitost lidských populací, letní semestr Evoluční teorie Základy evoluce, adaptace na životní podmínky - poskytuje řadu unifikujících principů


GENETIKA U VLS ČR, s. p. Ing. Pavel Češka Vojenské lesy a statky ČR, s. p.

GENETIKA U VLS ČR, s. p. Ing. Pavel Češka Vojenské lesy a statky ČR, s. p. GENETIKA U VLS ČR, s. p. Ing. Pavel Češka Vojenské lesy a statky ČR, s. p. STRUČNÝ POPIS SOUČASNÉHO STAV GENETIKY U VLS je v současnosti využíván především reprodukční materiál z identifikovaných a kvalifikovaných


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání


Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním


Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových


OBECNÁ GENETIKA. Gen ást DNA, schopná funkn zabezpeit syntézu aktivní jednotky. Genotyp soubor gen, uruje rozsah a míru fenotypových možností

OBECNÁ GENETIKA. Gen ást DNA, schopná funkn zabezpeit syntézu aktivní jednotky. Genotyp soubor gen, uruje rozsah a míru fenotypových možností GENETIKA A ŠLECHTNÍ Ivana Gardiánová Katedra genetiky a šlechtní OBECNÁ GENETIKA Genetika nauka o ddinosti a promnlivosti živých organism Ddinost schopnost organism penést znaky a vlastnosti na potomstvo


Kontaktní osoba: Prof. Ing. Oldřich Mauer, DrSc.,

Kontaktní osoba: Prof. Ing. Oldřich Mauer, DrSc., POZVÁNKA ZAKLÁDÁNÍ LESA 22. 24. 10. 2012 ŠLP Křtiny, Lesy města Brna a.s., Semenářský závod LČR Týniště n. Orlicí, školka Udánky Cílem stáže exkurze je seznámit studenty s problematikou pěstování sadebního


S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef


PhD. České Budějovice

PhD. České Budějovice PhD. České Budějovice Sledování a využívání poznatků o genetické biodiverzitě mezi populacemi hospodářských zvířat Dvořák Josef prof. Genetiky živočichů Ústavu genetiky MZLU v Brně Pro seminář doktorského



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


II. ročník, zimní semestr 2. týden P O P U L A Č N Í G E N E T I K A

II. ročník, zimní semestr 2. týden P O P U L A Č N Í G E N E T I K A II. ročník, zimní emetr. týden 3.0. - 7.0.008 P O P U L A Č N Í G E N E T I K A I. . Odhad frekvence receivní alely a zadání v úkolu č. 8a/tr. 0 Kot 30 % nechutnačů PTC ve zkoumané oulaci fenoty genotyy



21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka


Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského


Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace Pojmy k zpmtování Gen -část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN Gen je různě dlouhá sekvence nukleotidů Gen je jednotk funkce


genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace


Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o.

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o. Genetické markery ve šlechtění skotu pro masnou produkci Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Genetické markery Polymorfní místa v DNA, které vykazují asociaci na sledované znaky Příčinné


Hodnocení plemenných + chovných + užitkových prasat

Hodnocení plemenných + chovných + užitkových prasat Hodnocení plemenných + chovných + užitkových prasat Metodické pokyny SCHP Hodnocení plemenných prasat Cíl hodnocení stanovit předpoklad využití zvířat v plemenitbě k dalšímu šlechtění populace k masovému


Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák

Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák KVANTITATIVNÍ GENETIKA dědičnost kvantitativních znaků ZNAKY KVALITATIVNÍ: gen znak barva hrachu: žlutá zelená (i komplikovaněji penetrace, epresivita,


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Druhová a mezidruhová hybridizace

Druhová a mezidruhová hybridizace Druhová a mezidruhová hybridizace Obsah Druhová a mezidruhová hybridizace... 1 Obsah... 1 Monohybridní křížení... 1 Dihybridní křížení... 2 Polyhybridní křížení... 3 Souhrn Mendelismus v dědičnosti kvalitativních


Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u


Hodnocení plemenných + chovných + užitkových prasat

Hodnocení plemenných + chovných + užitkových prasat Hodnocení plemenných + chovných + užitkových prasat Metodické pokyny SCHP Hodnocení plemenných prasat Cíl hodnocení stanovit předpoklad využití zvířat v plemenitbě k dalšímu šlechtění populace k masovému


Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Níže uvedené komentáře by měly pomoci soutěžícím z kategorie B ke snazší orientaci


Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus


Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu Genetický olymorfizmus ois struktury oulací Tok GI v buňce Dr. Ing. Urban Tomáš ÚSTAV GEETIKY MZLU Brno htt:// Seminář doktorského grantu 53/03/H076 : Molekulárn


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti


Budoucnost chovu chladnokrevných koní v ČR

Budoucnost chovu chladnokrevných koní v ČR Budoucnost chovu chladnokrevných koní v ČR Změna v chovu koní za posledních 23 let 1989-28 000 koní 1995-18 000 koní 2011-77 000 koní Nárůst počtů Nárůst kvality??? Cesty ke zlepšení Plemenitba V chovu


Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový


Národní program uchování a využívání genetických zdrojů zvířat

Národní program uchování a využívání genetických zdrojů zvířat METODIKA CHOVU GENETICKÝCH ZDROJŮ KRÁLÍKŮ První zmínky o chovu králíků na území Čech pocházejí ze 13. století, chovatelství jako takové se však začíná rozvíjet na počátku 19. století. V polovině 19. století


KBI/GENE Mgr. Zbyněk Houdek

KBI/GENE Mgr. Zbyněk Houdek Genealogie KBI/GENE Mgr. Zbyněk Houdek Rodokmenové schéma Shromáždění informací o rodině je 1. důležitým krokem v genetickém poradenství. Rodokmenové schéma musí být srozumitelné a jednoznačné. Poskytuje


Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae).

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). Populační studie Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). American Journal of Botany 87(8): 1128


13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu


Obecná charakteristika živých soustav

Obecná charakteristika živých soustav Obecná charakteristika živých soustav Vypracoval: RNDr. Milan Zimpl, Ph.D. TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM ROZPOČTEM ČESKÉ REPUBLIKY Kategorie živých soustav Existují


Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Tradice šlechtění šlechtění zlepšování pěstitelsky, technologicky a spotřebitelsky významných vlastností


ZNALECKÝ POSUDEK č. 180-2 020/14

ZNALECKÝ POSUDEK č. 180-2 020/14 ZNALECKÝ POSUDEK č. 80-2 020/4 Předmět : Znalecký posudek byl zpracován za účelem zhodnocení aktuálního stavu stromů, rostoucích v oboustranném stromořadí v obci Horní Újezd. Objednatel posudku : Krajská


Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by - Ned?le, B?ezen 01, 2015 Otázka: Genetika I P?edm?t: Biologie P?idal(a):


Zachování a reprodukce genových zdrojů lesních dřevin

Zachování a reprodukce genových zdrojů lesních dřevin Genetika a šlechtění lesních dřevin Zachování a reprodukce genových zdrojů lesních dřevin Doc. Ing. RNDr. Eva Palátová, PhD. Ing. R. Longauer, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento


Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením


Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k


Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů

Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů Imunogenetika Vědní odvětví zabývající se imunitním systémem obratlovců, který je výrazně odlišuje od nižších organizmů se nazývá imunologie. Její náplní je zejména studium imunity mechanizmů stálosti


Heritabilita. Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability

Heritabilita. Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability Heritabilita Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability h 2 = V A / V P Výpočet genetické determinance znaku h 2 = V G / V P Heritabilita závisí


Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat

Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Genetické markery ve studiu genetické diverzity v populacích hospodářských zvířat Bakalářská


Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 Mutace Mutace - náhodná změna v genomu organismu - spontánní


Reprodukční systémy vyšších rostlin

Reprodukční systémy vyšších rostlin Reprodukční systémy vyšších rostlin Ivana Doležalová Osnova přednášky: Allogamie, autogamie, apomixie Výhody a nevýhody jednotlivých systémů Kombinované reprodukční systémy Evoluce reprodukčních systémů
