Genetika populací. Doposud genetika na úrovni buňky, organizmu

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Genetika populací. Doposud genetika na úrovni buňky, organizmu"

Transkript

1

2 Doposud genetika na úrovni buňky, organizmu

3 - jedinec nás nezajímá - pouze jeho gamety a to jako jedny z mnoha = genofond = soubor všech gamet skupiny jedinců Populace mnoho různých definic - skupina organizmů téhož druhu žijící v určitém geograficky vymezeném areálu, čase a schopných páření

4 objevuje se jako výsledek sporu mendelistů x biometriků R. C. Punnet W. Bateson K. Pearson W. F. R. Weldon pro většinu měřitelných znaků neplatí Mendelovy principy Mendelovy principy neplatí v populacích ani pro jednoduché znaky př. brachydaktylie - jedinců s dominantním fenotypem není v populaci většina, jak biometrici vykládali Mendelovy štěpné poměry Brachydaktylie - abnormálně krátké, zavalité prsty. Často též malý vzrůst + krátké ruce a nohy.

5 Oba argumenty vyvráceny: měřitelné znaky podmíněny polygenní dědičností, tedy větším počtem genů s mendelovskou dědičností brachydaktylie četnost dominantních alel a fenotypů v populaci odvodil G. H. Hardy a W. Weinberg Podrobněji o tom za chvíli v rámci Historie genetiky populací Dvě tváře populační genetiky: genetika populací je tedy založena na matematice a statistice ale skrývá v sobě úžasné věci pro biology a genetiky Výpočty jsou jen prostředkem ke sledování populací.

6 Populace je z pohledu populační genetiky charakterizována alelovými četnostmi Studuje: strukturu populace - hodnoty alelových četností Četnost krevní středoevropská Papago skupiny populace (Arizona) A (I A I A, I A i) 42 % 6 % 0 (ii) B (I B I B, I B i) 14 0 AB (I A I B ) 6 0 Alelovéčetnosti SE Papago % I A 28 4 I B 11 0 i 61 96

7 Populace je z pohledu populační genetiky charakterizována alelovými četnostmi Studuje: strukturu populace - hodnoty alelových četností dynamiku populace - jak se mění alelové četnosti z generace na generaci = v dlouhém sledu generací = evoluce = Evoluční genetika ustavení genetické rovnováhy

8 budeme se učit jak studovat populace z pohledu genetiky konkrétní aplikace jen jako příklady Jak studujeme genetiku populací: Alelové četnosti jsou ovlivněny způsobem rozmnožování - autogamie x panmixie, příbuzenské křížení typem dědičnosti autozomální, gonozomální, vazba evolučními silami genetickým driftem, mutacemi, genovým tokem, selekcí Na populace v přírodě působí všechny faktory současně = sledujeme strukturu populací (alelovéčetnosti) u modelové populace např. když se jednotlivé generace nepřekrývají když nepůsobí žádné evoluční faktory a populace je pouze panmiktická když nepůsobí žádné evoluční faktory, ale v populaci probíhá příbuzenské křížení když se sleduje vliv jednotlivých faktorů na alelové četnosti odděleně apod. Tím se budeme zabývat v průběhu semestru pochopíme tak, co se asi vše může odehrávat v přírodních populacích.

9 Využití populační genetiky - Evoluční biologie (Bi8150) - Paleogenetika člověka (Bi6290)

10 Přednáška 2 hodiny Sylabus 1 Historie genetiky populací 2 Genetická variabilita v populacích (fenotypová, genotypová, genetická struktura populací) a její stanovení (polymorfizmus a heterozygotnost, typy polymorfizmů, měřítka rozmanitosti, měřítka genetické vzdálenosti, využití) 3 Organizace genetické variability (modelová populace, Hardy Weinbergův princip, Snyderovy podíly) 4 Speciální případy náhodného oplození (tři a více alel, Bruceho poměry, vazba na pohlaví, vazba a HW rovnováha) 5 Nenáhodné oplození (výběrové, nenáhodné oplození, inbríding, odhad příbuznosti) 6 Náhodný genetický posun (malé populace, důsledky, efektivní velikost populace, vliv zakladatele) 7 Mutace (mutační tlak, počet alel udržovaných v populaci, hypotéza neutrality) 8 Migrace - genový tok (jednosměrná, obousměrná, přerušení izolace, odhad velikosti migrace) 9 Přírodní výběr (zdatnost a adaptivní hodnota, výběr u haploidních, diploidních organizmů, výběr a rovnováha, rovnováha mezi výběrem a mutací)

11 Cvičení hodina Sylabus 1 hodina (v libovolném čase) řešení ukázkových příkladů ze skript (zdroj: skripta, e-skripta, Interaktivní osnova na ISu) formou e-výuky (doma u PC)

12 Cvičení hodina Sylabus 1 hodina (v libovolném čase) řešení ukázkových příkladů ze skript (zdroj: skripta, e-skripta, Interaktivní osnova na ISu) formou e-výuky (doma u PC) lze si zapsat samostatně bez experimentální části zápočet za vyřešené odpovědníky (celkem 21 příkladů, jako příprava na zkouškové příklady)

13 Cvičení hodina Sylabus 1 hodina (čt 14:00-14:50, A36-209) sledování ustavení genetické rovnováhy v populaci D. melanogaster u znaku vázaného na pohlaví vyhodnocení populačních dat a výpočet alelových četností pomocí Snyderových podílů (chutnačství a rolování jazyka) vyhodnocení DNA profilu pro kriminalistické a soudní účely exkurze na Ústavu soudního lékařství

14 Literatura Relichová, Jiřina.. Brno 1997 Relichová, Jiřina.. Brno 2009

15 Literatura Interaktivní osnova v IS

16 Literatura Elektronická skripta

17 Literatura Webová stránka s aktuálními zajímavostmi z Genetiky populací a Paleogenetiky

18 Zakončení Cvičení

19 Zakončení Přednáška zkouška složená ze dvou částí: 1. část: úspěšně vyřešit v odpovědníku tři vylosované příklady - velmi podobné příkladům ze cvičení - řešení doma nebo kdekoliv jinde s literaturou - neomezený čas s opakovaným spuštěním - pro splnění je potřeba 100% úspěšnost 2. část: ústní zkouška - jen v případě úspěšně vyřešených příkladů - rozhovor na téma populační genetika (případné vzorečky lze mít s sebou)

20 Historie genetiky populací Řecký historik Herodotos (5. st. př. n. l.) první podrobný popis lidské rozmanitosti. Píše například o tmavých a tajemných Libyjcích i o kmeni barbarských lidojedů z ruského severu a dále popisuje lidi, kteří připomínají Turky a Mongoly = první etnografické pojednání. 1. vědecký popis (genetické) variability 1859 Charles Darwin O původu druhů vývoj druhů umožňuje existence variability v populacích = zdroj evoluce přírodním výběrem - nebyl však vysvětlen mechanizmus smíšená dědičnost či dědičnost získaných vlastností neuměly vysvětlit mechanizmus působení přírodního výběru - sám Darwin (1868) navrhl jako hypotézu dědičnosti pangenezi - Darwin bohužel neznal Mendlovu práci, která vznikla ve stejnou dobu a která by dokázala Darwinovy výsledky vysvětlit

21 Historie genetiky populací Mendel a jeho práce - populační genetika při popisu struktury populací využívá základní principy genetiky - díky principu segregace a principu kombinace můžeme předpovídat distribuci genotypů v potomstvu - populační genetika tak vlastně vzniká s genetikou jako takovou a ve své podstatě lze Mendela považovat za jejího zakladatele Aa x Aa AA : Aa : aa 1 : 2 : Versuche über Pflanzen-Hybriden popsal mimo jiné i distribuci genotypů v potomstvu při opakovaném samooplození

22 Historie genetiky populací Mendelovo zobecnění genotypových štěpných poměrů při opakovaném samooplození monohybrida Aa. Generace v poměru A Aa a A : Aa : a : 2 : : 2 : : 2 : : 2 : : 2 : 31 n 2 n -1 : 2 : 2 n -1 četnost Aa 2/4 = 1/2 4/16 = 1/4 8/64 = 1/8 16/256 = 1/16 32/1024 = 1/32 1/2 n Sám Mendel ve své práci píše: V desáté generaci je např. 2 n -1 = Je proto mezi 2048 rostlinami, které vzejdou z této generace, 1023 s konstantním znakem dominantním, 1023 s recesivním a jen dva hybridi. Heterozygotnost se v každé generaci při opakovaném samooplození snižuje na polovinu.

23 Historie genetiky populací Dále předpokládal, že toto zobecnění má platnost pouze tehdy, jsou-li všechny genotypy stejně plodné, tedy nepůsobí-li selekce. Tento popis struktury populací odvozený Mendelem však platí jen pro případ samooplození hrách je typickou rostlinou rozmnožující se samosprášením. Ve většině živočišných populací však probíhá páření jedinců mezi sebou a to náhodně.

24 Historie genetiky populací Hardy-Weinbergův princip G. H. Hardy ( ) britský matematik Publikoval totéž několik měsíců po Weinbergovi, ale anglicky. Wilhelm Weinberg ( ) německý lékař Jako první v němčině - nepovšimnuto. Složení populace náhodně se křížících jedinců vyřešili v roce 1908 Hardy a Weinberg ve své podstatě velmi jednoduchý stal se základním principem genetiky populací umožňuje také předpovídat genotypové četnosti v dalších generacích princip se zrodil jako výsledek sporu mezi mendelisty a biometriky

25 Historie genetiky populací oponenti Mendelových principů tvrdili, že genotypový poměr 1:2:1 a fenotypový poměr 3:1 musí platit v jakékoliv populaci pro většinu znaků ovšem jen velmi málo znaků vykazovalo v populacích podobnost s těmito poměry (např. by muselo být v populaci 75 % brachydaktyliků) = zobecnění mendelovské dědičnosti bylo zpochybňováno R. C. Punnet jako mendelista vyzval právě Hardyho, aby dokázal, že i při platnosti mendelovských principů se nemusí v populacích tyto poměry objevit své zdůvodnění Hardy publikuje v jednostránkovém článku v roce 1908 v časopisu Science ( Mendelian proportions in a mixed population )

26 Historie genetiky populací Hardyho zdůvodnění proč v populacích člověka při platnosti Mendelových principů nepřevládnou jedinci s dominantní chorobou (př. brachydaktýlie) genotypové složení populace pro jeden gen se dvěma alelami A, a je: p : 2q : r pro genotypy AA : Aa : aa Dnes používáme symboly p a q pro alelové četnosti za předpokladu, že populace bude velká, s náhodným oplozením, stejnou distribucí genotypů u obou pohlaví a všichni jedinci budou stejně fertilní = pak tento poměr bude shodný i v následujících generacích ve druhé generaci se ustaví stabilní poměr zdravých a postižených jedinců, který závisí pouze na alelových četnostech

27 Historie genetiky populací Hardy-Weinbergův princip ve velké populaci s náhodným oplozením, kde nepůsobí migrace, mutace ani selekce - alelové četnosti se z generace na generaci nemění v dalších letech byl vyřešen vliv inbrídingu a selekce u populací s náhodným oplozením; vliv vícenásobných alelových lokusů a vazby na strukturu populací Další velikáni populační genetiky: Sir Ronald A. Fisher ( ) britský statistik, evoluční biolog a genetik mimo jiné vysvětlil vliv selekce na genetickou strukturu populací

28 Historie genetiky populací Další velikáni populační genetiky: Sewall Green Wright ( ) americký genetik posun v četnosti genů v malých populacích některé kombinace genů tak vznikají méněčastěji než v populacích větších rozdělení populace na malé subpopulace - nejpříznivější faktor pro rychlou evoluci (selekce nemá tak velký vliv) Wright a Fisher propojili Darwinovu evoluční teorii s genetikou - neodarwinizmus

29 Historie genetiky populací Další velikáni populační genetiky: J. B. S. Haldane ( ) britský genetik a evoluční biolog vliv přírodního výběru na strukturu populací sledoval změny genetické struktury populací při daných adaptivních hodnotách různých genotypů interakce mezi selekcí, mutací a migrací Zlatý věk populační genetiky Fisher, Wright a Haldane smířili genetiku a biometriku dědičnost metrických (kvantitativních) znaků je řízena velkým počtem mendelovských faktorů (polygenů) kvantifikovali evoluční změny a propojili matematiku, genetiku a evoluční biologii ( nejúspěšnější aplikace matematické teorie v biologii )

30 Historie genetiky populací Bylo již vše tou dobou objeveno? poznatky byly jen teoretické na modelových populacích nyní bylo potřeba platnost ověřit i na populacích reálných, přírodních obtížný úkol v přírodních populacích působí všechny faktory a proměnné současně a jejich vliv se jen těžko od sebe odlišuje závěry získané u jedné reálné populace tak nelze zobecnit s platností na populace ostatní Pokusy o to se však objevily (studium variability). Theodosius Dobzhansky ( ) původem ruský genetik Teodosij Grigorovič Dobžanskij po emigraci do USA (1927) pracoval ve Fly room studoval genetickou variabilitu různých lokálních přírodních populací D. melanogaster

31 Historie genetiky populací v té době již bylo známo, že v přírodních populacích je vysoká genetická rozmanitost - Sergej Sergejevič Četverikov ( ) nevědělo se ale, že ji lze studovat mendelovskými metodami jsou v přírodních populacích dostatečně zastoupeny recesivní alely? Nikolaj Petrovič Dubinin ( ), čestný doktorát MU z roku 1965 studoval řadu přírodních populací D. melanogaster z oblasti Kavkazu = vysoké procento letálních alel je skryto v heterozygotním stavu (potvrdil i Dobzhansky a další) = podíl letálních či jiných nepříznivých recesivních alel v populacích může být i více než 15%

32 Historie genetiky populací Motoo Kimura ( ) japonský genetik rozpracoval důsledky náhodného genetického driftu rozšířil Fisherovu teorii přírodní selekce o faktory jako dominance a epistáze evoluce na molekulární úrovni je především výsledkem náhodných procesů jako jsou mutace a drift ( The Neutral Theory of Molecular Evolution ) John Maynard Smith ( ) aplikoval teorii her v procesech evoluce Luigi Luca Cavalli-Sforza (1922) rozsáhlý výzkum genetické variability v lidských populacích odmítnut koncept lidských ras Richard Lewontin (1929) propojil genetiku populací a evoluční teorii na molekulární úrovni a položil základy směru molekulární evoluce

33 Historie genetiky populací V současnosti zažívá rozvoj právě oblast molekulární evoluce zkoumání evoluce dříve pomocí polymorfizmu izoenzymů, dnes již spíše na úrovni sekvence DNA. Zkoumá se také propojení právě mezi evolucí molekulární, fyziologickou, morfologickou a vlivem přírodního výběru (adaptivní hodnotou). Evoluce na úrovni DNA nemusí nutně odrážet evoluci na úrovni fenotypů skupiny jedinců. A jak je provázána s evolucí socio-kulturní (rozvoj technologií a umění).

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)

Více

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou

Více

Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém

Více

Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci

Více

PRAKTIKUM Z OBECNÉ GENETIKY

PRAKTIKUM Z OBECNÉ GENETIKY RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie lizal@sci.muni.cz 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin

Více

Paleogenetika člověka

Paleogenetika člověka Budeme se snažit najít odpověď na možná nejstarší otázku člověka: Kdo jsme a odkud pocházíme? Budeme se snažit najít odpověď na možná nejstarší otázku člověka: Kdo jsme a odkud pocházíme? Kdo je náš předek?

Více

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou

Více

Metody studia historie populací

Metody studia historie populací 1) Metody studia genetické rozmanitosti komplexní fenotypové znaky, molekulární znaky. 2) Mechanizmy evoluce jak lze studovat evoluci a jak funguje mutace, přírodní výběr, genový posun a genový tok 3)

Více

Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií

Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Obecná genetika Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Ing. Roman Longauer, CSc. Ústav zakládání a pěstění lesů, LDF MENDELU Brno Tento projekt je spolufinancován Evropským

Více

MENDELOVSKÁ DĚDIČNOST

MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp

Více

Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem

Více

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly

Více

Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků

Více

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Populační genetika Radka Reifová

Populační genetika Radka Reifová Populační genetika Radka Reifová Prezentace ke stažení: http://web.natur.cuni.cz/~radkas v záložce Courses Literatura An Introduction to Population Genetics. Rasmus Nielsen and Montgomery Slatkin. 2013.

Více

Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti

Více

Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k

Více

GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické

Více

Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat

Více

Hardy-Weinbergův princip

Hardy-Weinbergův princip 1) Modelová populace 2) Hardy-Weinbergův princip 3) Hardy-Weinbergův princip využití Testování HW poměru Stanovení četnosti heterozygotů při úplné dominanci Interpretace DNA profilů 4) Snyderovy podíly

Více

12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat

Více

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je

Více

Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny

Více

Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským

Více

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v

Více

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch

Více

Pojem plemeno je používán pro rasy, které vznikly záměrnou činností člověka, např. plemena hospodářských zvířat.

Pojem plemeno je používán pro rasy, které vznikly záměrnou činností člověka, např. plemena hospodářských zvířat. POPULAČNÍ GENETIKA Populační genetika se zabývá genetickými zákonitostmi v definovaných souborech jedinců téhož druhu. Genetické vztahy uvnitř populace jsou komplikované, a proto se v populační genetice

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák

Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák KVANTITATIVNÍ GENETIKA dědičnost kvantitativních znaků ZNAKY KVALITATIVNÍ: gen znak barva hrachu: žlutá zelená (i komplikovaněji penetrace, epresivita,

Více

Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u

Více

Výuka genetiky na Přírodovědecké fakultě MU

Výuka genetiky na Přírodovědecké fakultě MU MASARYKOVA UNIVERZITA Přírodovědecká fakulta Výuka genetiky na Přírodovědecké fakultě MU Jiří Doškař Ústav experimentální biologie, Oddělení genetiky a molekulární biologie 1 V akademickém roce 1964/1965

Více

genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Tradice šlechtění šlechtění zlepšování pěstitelsky, technologicky a spotřebitelsky významných vlastností

Více

Osnova přednášky volitelného předmětu Evoluční vývoj a rozmanitost lidských populací, letní semestr

Osnova přednášky volitelného předmětu Evoluční vývoj a rozmanitost lidských populací, letní semestr Osnova přednášky volitelného předmětu Evoluční vývoj a rozmanitost lidských populací, letní semestr Evoluční teorie Základy evoluce, adaptace na životní podmínky - poskytuje řadu unifikujících principů

Více

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil

Více

Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou

Více

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto

Více

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová

Více

Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

KVANTITATIVNÍ GENETIKA dědičnost kvantitativních znaků Doc. MVDr. Eva Bártová, Ph.D.

KVANTITATIVNÍ GENETIKA dědičnost kvantitativních znaků Doc. MVDr. Eva Bártová, Ph.D. KVANTITATIVNÍ GENETIKA dědičnost kvantitativních znaků 2014 Doc. MVDr. Eva Bártová, Ph.D. KVALITATIVNÍ ZNAK gen znak barva květů, srsti krevní skupiny rohatost, bezrohost KVANTITATIVNÍ ZNAK hmotnost, výška

Více

Ekologické a evoluční aspekty genetiky

Ekologické a evoluční aspekty genetiky Ekologické a evoluční aspekty genetiky Teoretická populační genetika popisuje na základě matematických modelů, jak se pod vlivem různých evolučních faktorů mění genové frekvence v populacích. Formuluje

Více

Příbuznost a inbreeding

Příbuznost a inbreeding Příbuznost a inbreeding Příbuznost Přímá (z předka na potomka). Souběžná (mezi libovolnými jedinci). Inbreeding Inbrední koeficient je pravděpodobnost, že dva geny přítomné v lokuse daného jedince jsou

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Nové směry v evoluční biologii. Jaroslav Flegr Katedra filosofie a dějin přírodních věd Přírodovědecká Fakulta UK Praha

Nové směry v evoluční biologii. Jaroslav Flegr Katedra filosofie a dějin přírodních věd Přírodovědecká Fakulta UK Praha Nové směry v evoluční biologii Jaroslav Flegr Katedra filosofie a dějin přírodních věd Přírodovědecká Fakulta UK Praha 2014 Genetika věda o dědění znaků Mendelismus původně spíše antidarwinistický

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

Heritabilita. Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability

Heritabilita. Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability Heritabilita Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability h 2 = V A / V P Výpočet genetické determinance znaku h 2 = V G / V P Heritabilita závisí

Více

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí,

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí, Využití molekulárních markerů v systematice a populační biologii rostlin 12. Shrnutí, Přehled molekulárních markerů 1. proteiny isozymy 2. DNA markery RFLP (Restriction Fragment Length Polymorphism) založené

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem

Více

Populační genetika II

Populační genetika II Populační genetika II 4. Mechanismy měnící frekvence alel v populaci Genetický draft (genetické svezení se) Genetický draft = zvýšení frekvence alely díky genetické vazbě s výhodnou mutací. Selekční vymetení

Více

Hodnocení plemenných + chovných + užitkových prasat

Hodnocení plemenných + chovných + užitkových prasat Hodnocení plemenných + chovných + užitkových prasat Metodické pokyny SCHP Hodnocení plemenných prasat Cíl hodnocení stanovit předpoklad využití zvířat v plemenitbě k dalšímu šlechtění populace k masovému

Více

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním

Více

Evoluční mechanismy. Biologie I. Evoluce pohledů na evoluci

Evoluční mechanismy. Biologie I. Evoluce pohledů na evoluci http://biomikro.vscht.cz/ Biologie I Evoluční mechanismy Evoluce pohledů na evoluci Evoluce populací - populační genetika - genetická rovnováha - mikroevoluce příčiny, mechanismy Genetická variabilita

Více

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae).

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). Populační studie Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). American Journal of Botany 87(8): 1128

Více

Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.

Více

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865

Více

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

GENETIKA A JEJÍ ZÁKLADY

GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky

Více

Genová vazba. Obr. č. 1: Thomas Hunt Morgan

Genová vazba. Obr. č. 1: Thomas Hunt Morgan Genová vazba Jednou ze základních podmínek platnosti Mendelových zákonů je lokalizace genů, které podmiňují různé vlastnosti na různých chromozómech. Toto pravidlo umožňuje volnou kombinovatelnost genů

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

Sylabus kurzu: Biologie

Sylabus kurzu: Biologie Sylabus kurzu: Biologie Výchozí úroveň studentů: Vědomosti z biologie na gymnaziální úrovni Cílová úroveň studentů: Cílem je zopakovat a prohloubit vědomosti v oblasti biologie nabyté na gymnáziu, případně

Více

TYPY DĚDIČNOSTI GONOSOMÁLNÍ DĚDIČNOST

TYPY DĚDIČNOSTI GONOSOMÁLNÍ DĚDIČNOST TYPY DĚDIČNOSTI GONOSOMÁLNÍ DĚDIČNOST DĚDIČNOST POHLAVNĚ VÁZANÁ geny lokalizované na pohlavních chromozomech X nebo Y řídí vznik nejen primárních pohlavních znaků přenos genů na potomky je vázán na přenos

Více

21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST

21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka

Více

ŠKOLNÍ VZDĚLÁVACÍ PROGRAM

ŠKOLNÍ VZDĚLÁVACÍ PROGRAM Vyučovací předmět : Období ročník : Učební texty : Přírodopis 3. období 9. ročník Danuše Kvasničková, Ekologický přírodopis pro 9. ročník ZŠ a nižší ročníky víceletých gymnázií, nakl. Fortuna Praha 1998

Více

Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho

Více

Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus

Více

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu Genetický olymorfizmus ois struktury oulací Tok GI v buňce Dr. Ing. Urban Tomáš ÚSTAV GEETIKY MZLU Brno urban@mendelu.cz htt://www.mendelu.cz/af/genetika/ Seminář doktorského grantu 53/03/H076 : Molekulárn

Více

Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových

Více

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.cz Mutace Mutace - náhodná změna v genomu organismu - spontánní

Více

Cvičení z genetiky a cytogenetiky na Přírodovědecké fakultě UK v Praze

Cvičení z genetiky a cytogenetiky na Přírodovědecké fakultě UK v Praze Cvičení z genetiky a cytogenetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Studenti si tvoří vlastní studijní plán, ale musejí naplnit povinný limit kreditů Velká pestrost

Více

- Definice inbreedingu a jeho teorie

- Definice inbreedingu a jeho teorie Negativní důsledky inbrední deprese v chovu skotu Ing. Jiří Bezdíček, Ph.D. Výzkumný ústav pro chov skotu, s.r.o., Rapotín 26. listopadu 2009 - Definice inbreedingu a jeho teorie - Proč je inbreeding v

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

Genetická determinace zbarvení vlasů u člověka. Genetická determinace zbarvení očí u člověka

Genetická determinace zbarvení vlasů u člověka. Genetická determinace zbarvení očí u člověka Genetická determinace zbarvení vlasů u člověka Genetická determinace zbarvení očí u člověka znaky polygenní, které však při studiu dědičnosti v rodinách vykazují zdánlivě jednoduchou dědičnost výzkumem

Více

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Níže uvedené komentáře by měly pomoci soutěžícím z kategorie B ke snazší orientaci

Více

Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého

Více

Evoluční genetika KBI/GENE Mgr. Zbyněk Houdek Evoluční teorie Evoluční teorii vyslovil Ch. Darwin v díle O původu druhů (1859), kde ukazoval, že druhy se postupně měnily v dlouhých časových periodách.

Více

Vývoj názorů na variabilitu rostlin a její klasifikaci (od typologických přístupů k evolučně systematickým)

Vývoj názorů na variabilitu rostlin a její klasifikaci (od typologických přístupů k evolučně systematickým) Vývoj názorů na variabilitu rostlin a její klasifikaci (od typologických přístupů k evolučně systematickým) Ivana Doležalová Použitá literatura: Briggs D., Walters S.M. 2001. Proměnlivost a evoluce rostlin.

Více

GENETIKA V MYSLIVOSTI

GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností

Více

Úvod do studia historie moderního člověka

Úvod do studia historie moderního člověka Paleogenetika člověka Úvod do studia historie moderního člověka 1) Studium historie člověka - před první analýzou DNA - po první analýze DNA 2) Kronika našeho druhu všichni naši předkové (rychlý náhled)

Více

Úvod (1) Pojem a rozdělení biologie, biologické vědy, význam biologie. (1/1) Pojem a rozdělení biologie, biologické vědy, význam biologie.

Úvod (1) Pojem a rozdělení biologie, biologické vědy, význam biologie. (1/1) Pojem a rozdělení biologie, biologické vědy, význam biologie. Úvod (1) Pojem a rozdělení biologie, biologické vědy, význam biologie. (1/1) 1 Biologie = přírodní věda řec. Bios = život Řec. logos = nauka studuje vlastnosti a funkce organismů vztahy mezi organismy

Více

Hodnocení plemenných + chovných + užitkových prasat

Hodnocení plemenných + chovných + užitkových prasat Hodnocení plemenných + chovných + užitkových prasat Metodické pokyny SCHP Hodnocení plemenných prasat Cíl hodnocení stanovit předpoklad využití zvířat v plemenitbě k dalšímu šlechtění populace k masovému

Více

Genetické rozdíly mezi populacemi aneb něco o migracích a genovém toku. Genetické rozdíly mezi populacemi

Genetické rozdíly mezi populacemi aneb něco o migracích a genovém toku. Genetické rozdíly mezi populacemi Genetické rozdíly mezi populacemi Genetické rozdíly mezi populacemi 1) Genetická vzdálenost populací a její příčiny 3) Proč jsou subsaharské africké populace geneticky vzdálenější od populací ostatních?

Více

Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým

Více

Genetika populací a. Gentika populací. Autogamická populace

Genetika populací a. Gentika populací. Autogamická populace Genetika populací a člověka Mgr. Aleš RUDA Gentika populací Populace = všichni jedinci téhož druhu, kteří obývají vdaném čase stejné území GENOFOND soubor alel v gametách všech členů populace GENETIKA

Více

Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická

Více

PhD. České Budějovice

PhD. České Budějovice PhD. České Budějovice Sledování a využívání poznatků o genetické biodiverzitě mezi populacemi hospodářských zvířat Dvořák Josef prof. Genetiky živočichů Ústavu genetiky MZLU v Brně Pro seminář doktorského

Více