Enzymy používané v molekulární biologii

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "Enzymy používané v molekulární biologii"


1 Enzymy používané v molekulární biologii

2 Rozdělení enzymů 1. Podle substrátové specifity: většina metod molekulární biologie je závislá na použití enzymů, jejichž substrátem jsou nukleové kyseliny. Tyto reakce jsou velmi specifické a umožňují pracovat s velmi malým množstvím materiálu. Podle substrátové specifity se tyto enzymy dělí na dvě základní skupiny: Enzymy, jejichž substrátem je DNA Enzymy, jejichž substrátem je RNA Substrátová specifita je obvykle absolutní, i když rozlišení mezi oběma druhy nukleových kyselin je podmíněno pouze přítomností nebo absencí 2 -OH skupiny ribosy. 2. Podle typu reakcí: Enzymy syntetizující nukleové kyseliny (polymerázy) Enzymy modifikující nukleové kyseliny (fosfatázy, metylázy, kinázy) Enzymy spojující nukleotidové řetězce (ligázy) Enzymy odbourávající nukleové kyseliny (nukleázy) Podle substrátové specifity se enzymy jednotlivých skupin dále dělí, např. na DNA-polymerázy, RNA-polymerázy apod.

3 DNA-polymerázy DNA-polymeráza I (E. coli): katalyzuje 3 odlišné reakce, jejich rychlost je ovlivněna stavem DNA a koncentrací dntp v reakční směsi. Za vhodných podmínek degraduje polynukleotidový řetězec DNA ve směru 5 3 a současně degradovaný řetězec nahrazuje polymerační reakcí. Této vlastnosti se využívá ke značení DNA metodou tzv. posunu jednořetězcového zlomu ( nick translation ). Na dvouřetězcové DNA se vytvoří DNázou I náhodné jednořetězcové zlomy. Ty jsou substrátem pro působení DNA-polymerázy I. Klenowův fragment DNA-pol I: jde o větší ze dvou fragmentů DNA-pol I, které vznikají při štěpení subtilizinem. Vykazuje 5 3 polymerázovou a 3 5 exonukleázovou aktivitu, oproti DNA-pol I postrádá 5 3 exonukleázovou aktivitu. Používá se při syntéze DNA, kdy nesmí docházet k odbourávání primerů, např. při enzymové metodě sekvencování, při značení DNA prodloužením primeru nebo při doplnění přečuhujících 5 konců po restrikčním štěpení DNA.

4 Polymerázy používané při PCR Taq DNA-polymeráza (Thermus aquaticus): nejběžněji používaná polymeráza pro PCR, nemá korektorskou ( proofreading ) aktivitu, následkem se při syntéze delších úseků hromadí chyby. Frekvence chyb je zhruba 1 na 4-5 tisíc bp. Špatně začleněná báze většinou vede k terminaci řetězce a současně i syntézy DNA. Při použití PCR v molekulární diagnostice nejsou chybně začleněné báze problémem, protože vznik molekul DNA se stejnou chybou je málo pravděpodobný a molekuly s chybně inkorporovanou bází tvoří jen zlomek z celkového produktu. Chybné začlenění bází však nabývá na důležitosti v případě klonování PCR produktů, neboť každý klon je odvozen z jediné molekuly DNA. Případná mutace vlivem špatné inkorporace báze způsobí, že tuto mutaci ponesou všechny molekuly DNA v potomstvu. Tyto mutace také mohou znamenat substituci aminokyselin při expresi prováděné in vitro. Tyto problémy lze eliminovat buď použitím většího množství templátových molekul DNA při zahájení replikace. Pak je třeba méněcyklů a nasyntetizuje se méně DNA. Nebo lze použít termostabilní DNA-polymerázu s 3 -exonukleázovou aktivitou. Pwo DNA-polymeráza (Pyrococcus woesei) a Pfu DNA-polymeráza (Pyrococcus furiosus): frekvence chyb je 2-6 x nižší než u Taq DNA-polymerázy, což je způsobeno 3 -exonukleázovou aktivitou těchto enzymů. Na druhou stranu 3 -exonukleasová aktivita často způsobuje degradaci jednořetězcových primerů. Často se používají v kombinaci s Taq DNA-polymerázou pro amplifikaci dlouhých úseků DNA (stačí 1% Pwo nebo Pfu). Tth DNA-polymeráza (Thermus thermophillus): je doporučována pro PCR dlouhých molekul DNA místo Taq DNA-polymerázy.

5 Zpětná (reverzní) transkriptáza (retroviry) Patří do skupiny RNA-dependentních DNA-polymeráz. Katalyzuje přepis genetické informace z RNA do DNA. Využívá se k přípravě cdna z mrna. Zpětné transkripty se využívají také k sekvencování RNA, jako sondy pro hybridizaci, případně jako templát při PCR.

6 Terminální deoxyribonukleotidyltransferáza (telecí brzlík) Katalyzuje připojování nukleotidů k 3 -koncům DNA. Nevyžaduje matrici ani primer, tím se liší od DNA-polymeráz. Je využívána k připojování polydeoxyribonukleotidových úseků (tzv. homopolymerních konců) k fragmentům DNA a vektorovým molekulám s tupými konci. Tím se vytvářejí kohesivní (lepivé) navzájem komplementární konce. Rovněž je využívána při koncovém značení nukleových kyselin.

7 DNA-ligáza Katalyzuje tvorbu fosfodiesterové vazby mezi 5 -fosfátovou skupinou a 3 -OH skupinou sousedního nukleotidu. Používá se k vzájemnému spojení dvou molekul DNA zakončených komplementárními konci, k připojení spojek a adaptorů a cirkularizaci lineárních molekul DNA. T4-DNA-ligáza (zdroj E. coli infikovaná bakteriofágem T4) dokáže na rozdíl od DNA-ligázy z E. coli spojovat i fragmenty s tupými konci.

8 Alkalická fosfatáza Zdroje: telecí střevo, bakterie Odstraňuje fosfátové skupiny z 5 -konců DNA, RNA a oligonukleotidů. Využívá se při koncovém značení DNA, kdy se původní fosfátová skupina odstraní a její místo zaujme značená fosfátová skupina ( 32 P, 35 S). Při klonování DNA se často odstraňují 5 koncové skupiny u vektoru zabraňuje se tím ligaci samotné vektorové molekuly bez inzertu, zvyšuje se účinnost klonování.

9 T4-DNA-polynukleotidkináza Zdroj: buňky E. coli infikované bakteriofágem T4 Katalyzuje přenos terminální fosfátové skupiny z ATP na 5 -OH skupinu DNA nebo RNA. Může katalyzovat i výměnu fosfátových skupin na 5 konci. Katalyzovaných reakcí se využívá ke značení fragmentů nukleových kyselin na 5 -koncích pomocí 32 P.

10 Uracil-DNA glykosylasa Účastní se oprav poškozené DNA. Uracil v DNA vzniká deaminací cytosinu. Uracil-DNA glykosylasa katalyzuje uvolnění volného uracilu z DNA. Hydrolyzuje uracil z jedno- nebo dvouřetězcové DNA, ne z krátkých oligomerů (6 a méně nukleotidů). Používá se preventivně v laboratořích k odstranění dříve amplifikované DNA: Protože přenesené sekvence z dříve amplifikované DNA patří k nejvýznamnějším zdrojům kontaminace vzorků podrobených PCR, používá se v laboratořích rutinně provádějících PCR 2 -deoxyuridin-5 -trifosfát (dutp) místo dttp. Před amplifikací dalších vzorků se do reakční směsi přidá uracil-dna-glykosylasa (uracil-nglykosylasa), která odstraní z případných kontaminant uracilové báze. Tím se v molekule DNA vytvoří abazická místa a DNA se stane termolabilní. Při první denaturaci dojde k rozštěpení DNA a zároveň denaturaci a inaktivaci uracil-dna-glykosylasy. Používá se spolu s dalšími reparačními enzymy ke studiu a detekci poškození DNA.

11 Exonukleázy Exonukleáza III (E.coli) Působí ve směru 3 5, na dvouřetězcové DNA odstraňuje od jejího 3 -konce jedno vlákno. Působí pouze na DNA, jejíž konce mají přesahující 5 -konec nebo jsou tupé, řetězce s přesahujícími 3 -konci štěpeny nejsou. Vzhledem k výše uvedené specifitě se používá k vytváření jednosměrných delecí. Druhý řetězec je následně odstraněn nukleasou S1. Exonukleáza Bal31 (Alteromonas espejiana) Štěpí lineární dvouřetězcovou DNA od obou konců za vzniku zkrácených fragmentů DNA se zarovnanými konci. Používá se k přípravě obousměrných delecí.

12 Sekvenčně nespecifické endonukleasy Mnoho z nich nachází uplatnění při reparačních procesech. Endonukleasa VIII (E. coli) funguje jako N- glykosylasa a AP-lyasa. N-glykosylasová aktivita uvolňuje poškozené pyrimidiny z dvouřetězcové DNA, tím se vytvářejí apyrimidinová místa (AP). Produkty poškození bází rozpoznávané endonukleasou VIII zahrnují močovinu, 5,6- dihydroxythymin, thyminglykol, uracilglykol, 6- hydroxy-5,6-dihydrothymin apod. Endonukleasa V (E. coli) rozpoznává deoxyinosin (deaminační produkt deoxyadenosinu), štěpí poškozenou DNA na 3 -straně poškozené báze. Sama báze neodstraňuje. Endonukleasa IV účastní se oprav mnoha oxidativních poškození DNA. Štěpí apurinová/apyrimidinová místa Endonukleasa III má podobné účinky jako endonukleasa VIII Fpg (8-oxoguanin DNA gykosylasa) enzym se vyznačuje jak N-glykosylasovou, tak AP-lyasovou aktivitou. Uvolňuje poškozené puriny z dsdna. APlyasová aktivita slouží ke štěpení vzniklého apurinového místa na 3 - i na 5 -konci. Výsledkem je jednonukleotidová mezera s fosfátovými skupinami na obou stranách.

13 DNáza I (hovězí pankreas) Vytváří na DNA jednořetězcové zlomy. Od nich je pak DNA dále degradována na mono- a oligonukleotidy. Nevykazuje sekvenční specifitu. V přítomnosti Mg 2+ vytváří na obou řetězcích náhodné zlomy, v přítomnosti Mn 2+ iontů štěpí obě vlákna současně naproti sobě. V nízké koncentraci se používá při zavádění zlomů do molekul DNA, které se dále značí (např. DNA-polymerasa I) nebo se do nich zavádějí mutace. Ve vyšších koncentracích se DNáza I používá k odstranění DNA při izolaci RNA.

14 Nukleáza S1 (Aspergillus oryzae) Endonukleáza specifická pro jednořetězcovou DNA. Používá se k odstraňování jednořetězcových úseků na dsdna, smyček na cdna vznikajících při její syntéze, mapování intronů analýzou hybridních molekul DNA-mRNA. Také se využívá k detekci jednořetězcových úseků v molekulách DNA mohou indikovat přítomnost struktur vznikajících při genové expresi a regulaci. ph optimum leží v kyselé oblasti, kromě nukleázy S1 se používá nukleázy P1, která má podobnou specifitu, ale je aktivní při neutrálním ph.

15 Ribonukleasy Ribonukleasa T1 štěpí RNA v sousedství G G-3 -P. Ribonukleasa T2 štěpí RNA v sousedství A A-3 -P. Protože jsou sekvenčně specifické, využívají se obě ribonukleasy při analýze a sekvencování RNA. Ribonukleasa A používá se k odstranění RNA z roztoků DNA. Ribonukleasa P zkracuje trna, ribonukleoprotein: RNA vykazuje vlastní katalytickou aktivitu, proteinová složka má funkci pravděpodobně stabilizační.

16 Sekvenčně specifické (restrikční) endonukleázy Jde o sekvenčně specifické endonukleázy, produkované kmeny většiny bakteriálních druhů. Jejich přirozenou funkcí je degradace cizorodé DNA (například po infekci fágem). Dělí se do tří tříd. Nejvýznamnější jsou RE II. třídy. Jejich rozpoznávací místo je tvořeno krátkou (obvykle 4-8 bp) sekvencí. Sekvence má často charakter palindromu. K rozštěpení DNA dochází v místě, které je uvnitř nebo těsně vedle rozpoznávacího místa. Produktem štěpení jsou úseky DNA o definované délce. Označujeme je jako restrikční fragmenty. Nyní je známo asi 3500 RE, které rozpoznávají asi 160 různých sekvencí.

17 Sekvenčně specifické (restrikční) endonukleázy Názvy restrikčních endonukleáz jsou odvozeny z počátečního (Escherichia, Staphylococcus) písmene rodového a prvních dvou písmen druhového (coli, aureus) jména organismu, z něhož byly izolovány. V některých případech je součástí názvu zkrácené označení konkrétního kmene (RY13 R, 3A 3A). Pokud daný organismus produkuje více různých restrikčních endonukleáz, odlišují se navzájem římskými číslicemi (EcoRI, EcoRV). Některé RE se vyznačují tzv. relaxovanou specifitou, která se projevuje schopností enzymu štěpit za určitých reakčních podmínek blízce příbuzné sekvence. Např. EcoRI může vedle sekvence GAATTC štěpit i sekvence GGATTC, GGATTT a AGATTT. Jednotlivé RE jsou v různé míře citlivé k metylaci v rozpoznávaném místě. RE, které rozpoznávají stejnou sekvenci (izoschizomery), ale liší se svou citlivostí vůči metylacím, se využívají při studiu metylace DNA.

18 Využití restrikčních endonukleáz Štěpení DNA ve zcela konkrétních pozicích vytváření fragmentů DNA o přesně definované délce. Tyto fragmenty mohou být použity ke klonování, koncovému značení, konstrukci restrikčních map apod.

19 Konstrukce restrikční mapy kombinovaným štěpením dvěma restrikčními enzymy. Štěpení molekuly DNA enzymem 1 vedlo ke vzniku 3 kb, 6 kb a 8kb fragmentů. Štěpení molekuly DNA enzymem 2 vedlo ke vzniku fragmentů o délce 7 kb a 10 kb. Abychom byli schopní seřadit jednotlivé fragmenty ve správném pořadí, je třeba provést kombinované štěpení oběma enzymy. Protože kombinované štěpení nechalo netknuté fragmenty 6 kb a 8 kb ze štěpení 1, ale došlo k rozštěpení 3 kb fragmentu, musí být restrikční místo enzymu 2 uvnitř 3kb fragmentu a tento fragment musí ležet uprostřed molekuly DNA. Pokud by 3 kb fragment byl na konci a ne uprostřed analyzované molekuly, potom by i štěpení samotným enzymem 2 muselo poskytnout 1 kb nebo 2 kb fragment. To, že cílové místo pro enzym 2 leží blíže 6 kb fragmentu než 8 kb fragmentu lze odvodit z faktu, že po štěpení enzymem 2 vznikají fragmenty o velikostech 7 kb a 10 kb.

20 Polymorfizmus délky restrikčních fragmentů - RFLP Tato metoda se používá při analýze genomu. Využívá rozdíly v restrikčních mapách jedinců téhož druhu. Rozdíly jsou podmíněny různou délkou a počtem restrikčních fragmentů, které vznikají štěpením genomové DNA určitou restrikční endonukleázou. Tyto rozdíly vznikají jako důsledek buď mutací, které vedou ke vzniku (nebo zániku) cílových sekvencí pro tento typ enzymů, nebo jako důsledek přítomnosti různého počtu repetitivních sekvencí, delecí, inzercí, případně přestaveb ve specifických oblastech chromozomů. Vzniklé fragmenty lze rozdělit a detekovat gelovou elektroforézou. Výsledky se používají v lékařské diagnostice, v kriminalistice apod. AFLP polymorfismus délky amplifikovaných fragmentů: jde o rozdíly v délce amplifikovaných fragmentů vznikajících při použití některých variant PCR. Podstatou zde jsou změny v sekvencích pro vazebná místa primerů, případně delece a inzerce v amplifikovaných úsecích DNA. MstII - CCTNAGG

21 Specifická endonukleasa upravená metodami genového inženýrství. Její cílové místo se nachází vždy u paty vlásenky vytvořené v molekule jednořetězcové DNA. Používá se při diagnostické metodě CFLP (Polymorfizmus délky fragmentů DNA vytvořených cleavasou). Touto metodou se detekují a lokalizují polymorfizmy v molekulách ssdna připravených denaturací fragmentů koncově značené genomové DNA. Optimální velikost těchto fragmentů je do 2700 bp. ssdna vytváří po rychlém ochlazení roztoku různé sekundární struktury v závislosti na své primární struktuře. Cleavasa I nepůsobí na všechny vlásenky, dochází pouze k částečnému štěpení ssdna. Mutace a modifikace v nukleotidových sekvencích ovlivňují sekundární strukturu ssdna. Konečným výsledkem je vytvoření rozdílných míst rozpoznávaných enzymem a vznik spektra fragmentů, které je charakteristické pro danou molekulu. Jde vlastně o analogii s RFLP metodou. Cleavasa I

22 Metylázy Patří mezi tzv. modifikující enzymy, které přisyntetizováním skupin do určitých poloh (v tomto případě metylové skupiny) vytvářejí minoritní nukleotidy (nacházejí se např. v trna, účastní se tvorby terciární struktury). U prokaryot v DNA působením metylázy vzniká 6-Nmetyladenin. 5-metylcytosin se nachází jak u prokaryot, tak i eukaryot. Význam metylovaných bází spočívá u prokaryot ve specifickém označení určitých sekvenčních motivů vlastní DNA tím je DNA organismu vlastní označena a chráněna před působením endonukleáz, které vyhledávají a štěpí cizí (fágovou) DNA. U eukaryot má metylace cytosinu význam pro regulaci genové exprese. Pokud je cytosin v určitých sekvenčních motivech metylován, je zabráněno transkripci příslušného genu.

23 Reparační enzymy Glykosylasy štěpí vazbu mezi cukrem a basí Excidasy přeruší cukrfosfátový řetězec před a za porušeným místem. Demetylasy odstraňují metyly z basí. Oprava špatného párování v E. coli: opravný systém rozpoznává a vystřihuje špatně spárovanou bázi z nově nasyntetizovaného řetězce ten je dosud nemetylovaný. Vystřižení a oprava tyminového dimeru Oprava O6-methylguaninu

24 Souhrn T4-DNA-polynukleotidkinasa

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:


Metody molekulární biologie

Metody molekulární biologie školní rok 2010/2011, kurz Bi6400 Metody molekulární biologie prof. Jan Šmarda doc. Roman Pantůček Ústav experimentální biologie Přírodovědecká fakulta MU Osnova kurzu manipulace s nukleovými kyselinami:


2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné:

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné: Výběrové otázky: 1. Součástí všech prokaryotických buněk je: a) DNA, plazmidy b) plazmidy, mitochondrie c) plazmidy, ribozomy d) mitochondrie, endoplazmatické retikulum 2. Z následujících tvrzení, týkajících


Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin


Hybridizace nukleových kyselin

Hybridizace nukleových kyselin Hybridizace nukleových kyselin Tvorba dvouřetězcových hybridů za dvou jednořetězcových a komplementárních molekul Založena na schopnosti denaturace a renaturace DNA. Denaturace DNA oddělení komplementárních


Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární


Molekulární základy dědičnosti. Ústřední dogma molekulární biologie Struktura DNA a RNA

Molekulární základy dědičnosti. Ústřední dogma molekulární biologie Struktura DNA a RNA Molekulární základy dědičnosti Ústřední dogma molekulární biologie Struktura DNA a RNA Ústřední dogma molekulární genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace DNA RNA


MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční


Struktura a funkce nukleových kyselin

Struktura a funkce nukleových kyselin Struktura a funkce nukleových kyselin ukleové kyseliny Deoxyribonukleová kyselina - DA - uchovává genetickou informaci Ribonukleová kyselina RA - genová exprese a biosyntéza proteinů Složení A stavební


Detekce Leidenské mutace

Detekce Leidenské mutace Detekce Leidenské mutace MOLEKULÁRNÍ BIOLOGIE 3. Restrikční štěpení, elektroforéza + interpretace výsledků Restrikční endonukleasy(restriktasy) bakteriální enzymy štěpící cizorodou dsdna na kratší úseky


Nukleové kyseliny Replikace DNA Doc. MVDr. Eva Bártová, Ph.D.

Nukleové kyseliny Replikace DNA Doc. MVDr. Eva Bártová, Ph.D. Nukleové kyseliny Replikace DNA 2013 Doc. MVDr. Eva Bártová, Ph.D. Nukleové kyseliny 7% cytozin Monomer: NUKLEOTID, tvoří jej: uracil kyselina fosforečná pentóza (ribóza, deoxyribóza) tymin organická dusíkatá


Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny


a) Primární struktura NK NUKLEOTIDY Monomerem NK jsou nukleotidy

a) Primární struktura NK NUKLEOTIDY Monomerem NK jsou nukleotidy 1 Nukleové kyseliny Nukleové kyseliny (NK) sice tvoří malé procento hmotnosti buňky ale významem v kódování genetické informace a její expresí zcela nezbytným typem biopolymeru všech živých soustav a)



REPLIKACE A REPARACE DNA REPLIKACE A REPARACE DNA 1 VÝZNAM REPARACE DNA V MEDICÍNĚ Příklad: Reparace DNA: enzymy reparace nukleotidovou excizí Onemocnění: xeroderma pigmentosum 2 3 REPLIKACE A REPARACE DNA: Replikace DNA: 1. Podstata


Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip


Polymorfizmy detekované. polymorfizmů (Single Nucleotide

Polymorfizmy detekované. polymorfizmů (Single Nucleotide Polymorfizmy detekované speciálními metodami s vysokou rozlišovací schopností Stanovení jednonukleotidových polymorfizmů (Single Nucleotide Polymorphisms - SNPs) Příklad jednonukleotidových polymorfizmů


Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Zavedení PCR v roce 1983 (Kary B. Mullis) Nobelova cena 1993 Metodika


Molekulární genetika

Molekulární genetika Molekulární genetika Genetické inženýrství Technologie rekombinantní DNA Vektor Genomová DNA Štěpení RE Rozštěpení stejnou RE, lepivé konce Ligace Transformace Bakteriální chromozóm Rekombinantní vektor


Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace


Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje


Nukleové kyseliny. DeoxyriboNucleic li Acid

Nukleové kyseliny. DeoxyriboNucleic li Acid Molekulární lární genetika Nukleové kyseliny DeoxyriboNucleic li Acid RiboNucleic N li Acid cukr (deoxyrobosa, ribosa) fosforečný zbytek dusíkatá báze Dusíkaté báze Dvouvláknová DNA Uchovává genetickou



REKOMBINACE Přestavby DNA REKOMBINACE Přestavby DNA variace v kombinacích genů v genomu adaptace evoluce 1. Obecná rekombinace ( General recombination ) Genetická výměna mezi jakýmkoli párem homologních DNA sekvencí - často lokalizovaných


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Vztah struktury a funkce nukleových kyselin. Replikace, transkripce

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Vztah struktury a funkce nukleových kyselin. Replikace, transkripce Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Vztah struktury a funkce nukleových kyselin. Replikace, transkripce Nukleová kyselina gen základní jednotka informace v živých systémech,


Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,


Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Mária Čudejková 2. Transkripce genu a její regulace Transkripce genetické informace z DNA na RNA Transkripce dvou genů zachycená na snímku z elektronového mikroskopu.


Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 1. Struktura a replikace DNA Literatura: Alberts a kol.: Základy buněčné biologie Espero Publishing, 2000 Garrett & Grisham: Biochemistry 2nd ed., Saunders


6. Nukleové kyseliny

6. Nukleové kyseliny 6. ukleové kyseliny ukleové kyseliny jsou spolu s proteiny základní a nezbytnou složkou živé hmoty. lavní jejich funkce je uchování genetické informace a její přenos do dceřinné buňky. ukleové kyseliny


Přednáška kurzu Bi4010 Základy molekulární biologie, 2016/17 Replikace DNA

Přednáška kurzu Bi4010 Základy molekulární biologie, 2016/17 Replikace DNA Přednáška kurzu Bi4010 Základy molekulární biologie, 2016/17 Replikace DNA Jan Šmarda Ústav experimentální biologie, PřF MU 1 Buněčné dělení a reprodukce každá buňka potřebuje svou úplnou sadu genů: rodičovská



DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit






POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek


Klonování gen a genové inženýrství

Klonování gen a genové inženýrství Klonování gen a genové inženýrství Genové inženýrství užite né termíny Rekombinantní DNA = DNA, ve které se nachází geny nejmén ze dvou zdroj, asto ze dvou zných druh organism Biotechnologie = manipulace


4) pokračování struktury nukleových kyselin

4) pokračování struktury nukleových kyselin Denaturace a renaturace DNA 4) pokračování struktury nukleových kyselin Genofor, chromozom, genom Genofor struktura nesoucí geny seřazené za sebou (DNA nebo RNA) a schopná replikace. U prokaryot, eukaryot



MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Využití živých organismů pro uskutečňování definovaných chemických procesů pro průmyslové nebo komerční aplikace Organismus je geneticky upraven metodami genetického


Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk


Zdrojem je mrna. mrna. zpětná transkriptáza. jednořetězcová DNA. DNA polymeráza. cdna

Zdrojem je mrna. mrna. zpětná transkriptáza. jednořetězcová DNA. DNA polymeráza. cdna Obsah přednášky 1) Klonování složených eukaryotických genů 2) Úprava rekombinantních genů 3) Produkce rekombinantních proteinů v expresních systémech 4) Promotory 5) Vektory 6) Reportérové geny Zdrojem


Nukleové kyseliny (NK)

Nukleové kyseliny (NK) Eva Roubalová B10 2007/2008 Předmět: - Obecná biologie - Biologie a genetika Zdroj velké části materiálů: učebnice Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava


NUKLEOVÉ KYSELINY. Složení nukleových kyselin. Typy nukleových kyselin:

NUKLEOVÉ KYSELINY. Složení nukleových kyselin. Typy nukleových kyselin: NUKLEOVÉ KYSELINY Deoxyribonukleová kyselina (DNA, odvozeno z anglického názvu deoxyribonucleic acid) Ribonukleová kyselina (RNA, odvozeno z anglického názvu ribonucleic acid) Definice a zařazení: Nukleové


Vzdělávací materiál. vytvořený v projektu OP VK CZ.1.07/1.5.00/34.0211. Anotace. Biosyntéza nukleových kyselin. VY_32_INOVACE_Ch0219.

Vzdělávací materiál. vytvořený v projektu OP VK CZ.1.07/1.5.00/34.0211. Anotace. Biosyntéza nukleových kyselin. VY_32_INOVACE_Ch0219. Vzdělávací materiál vytvořený v projektu OP VK Název školy: Gymnázium, Zábřeh, náměstí Osvobození 20 Číslo projektu: Název projektu: Číslo a název klíčové aktivity: CZ.1.07/1.5.00/34.0211 Zlepšení podmínek


Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,


Svět RNA a bílkovin. RNA svět, 1. polovina. RNA svět. Doporučená literatura. Struktura RNA. Transkripce. Regulace transkripce.

Svět RNA a bílkovin. RNA svět, 1. polovina. RNA svět. Doporučená literatura. Struktura RNA. Transkripce. Regulace transkripce. RNA svět, 1. polovina Struktura RNA Regulace transkripce Zrání pre-mrna Svět RNA a bílkovin Sestřih pre-mrna Transport a lokalizace RNA Stabilita RNA Doporučená literatura RNA svět Alberts B., et al.:


Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 4. Metody molekulární biologie I Izolace DNA a RNA Specifické postupy pro baktérie, kvasinky, rostlinné a živočišné tkáně U RNA nutno zabránit kontaminaci


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním





Projekt SIPVZ č.0636p2006 Buňka interaktivní výuková aplikace

Projekt SIPVZ č.0636p2006 Buňka interaktivní výuková aplikace Nukleové kyseliny Úvod Makromolekulární látky, které uchovávají a přenášejí informaci. Jsou to makromolekulární látky uspořádané do dlouhých. Řadí se mezi tzv.. Jsou přítomny ve buňkách a virech. Poprvé


Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Čtvrtek 11:30 13:00 1. Struktura a replikace DNA (25.09.2014, Mgr. M. Čudejková, Ph.D) 2. Metody molekulární biologie I (09.10.2014, Doc. Mgr. P. Galuszka, Ph.D)



ENZYMY A NUKLEOVÉ KYSELINY ENZYMY A NUKLEOVÉ KYSELINY Autor: Mgr. Stanislava Bubíková Datum (období) tvorby: 28. 3. 2013 Ročník: devátý Vzdělávací oblast: Člověk a příroda / Chemie / Organické sloučeniny 1 Anotace: Žáci se seznámí


Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních





TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Přehled Molekulárně-biologický úvod, DNA struktura, replikace, DNA polymerasa Princip procesu PCR Optimalizace PCR Typy PCR Aplikace


Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika



MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Termín biotechnologie byl poprvé použit v roce 1917 Procesy, při kterých se na tvorbě výsledného produktu podílejí živé organismy Širší definice: biotechnologie


ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction)



Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální


POLYPEPTIDY. Provitaminy = organické sloučeniny bez vitaminózního účinku, které se v živočišném těle mění působením ÚV záření nebo enzymů na vitaminy.

POLYPEPTIDY. Provitaminy = organické sloučeniny bez vitaminózního účinku, které se v živočišném těle mění působením ÚV záření nebo enzymů na vitaminy. POLYPEPTIDY Provitaminy = organické sloučeniny bez vitaminózního účinku, které se v živočišném těle mění působením ÚV záření nebo enzymů na vitaminy. Hormony = katalyzátory v živočišných organismech (jsou


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


Příprava rekombinantních molekul pro diagnostické účely

Příprava rekombinantních molekul pro diagnostické účely 1 Příprava rekombinantních molekul pro diagnostické účely doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 2 Obsah přednášky 1) Pojem rekombinantní DNA 2) Historické milníky



TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy


Základy molekulární a buněčné biologie. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy molekulární a buněčné biologie. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy molekulární a buněčné biologie Přípravný kurz Komb.forma studia oboru Všeobecná sestra Genetický aparát buňky DNA = nositelka genetické informace - dvouvláknová RNA: jednovláknová mrna = messenger


Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza

Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza Exprese genetického kódu Centrální dogma molekulární biologie - genetická informace v DNA -> RNA -> primárního řetězce proteinu 1) transkripce - přepis z DNA do mrna 2) translace - přeložení z kódu nukleových


GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu


Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní


Centrální dogma molekulární biologie

Centrální dogma molekulární biologie řípravný kurz LF MU 2011/12 Centrální dogma molekulární biologie Nukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Mendel) 1869 objev nukleových kyselin (Miescher) 1944 genetická informace v nukleových


Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Modifikace PCR, sekvenování Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Multiplex PCR Reakční směs obsahuje ne jeden, ale několik párů primerů rozpoznávajících různé cílové sekvence


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování


Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi


Struktura a funkce biomakromolekul

Struktura a funkce biomakromolekul Struktura a funkce biomakromolekul KBC/BPOL 7. Interakce DNA/RNA - protein Ivo Frébort Interakce DNA/RNA - proteiny v buňce Základní dogma molekulární biologie Replikace DNA v E. coli DNA polymerasa a


Globální pohled na průběh replikace dsdna

Globální pohled na průběh replikace dsdna Globální pohled na průběh replikace dsdna 3' 5 3 vedoucí řetězec 5 3 prodlužování vedoucího řetězce (polymerace ) DNA-ligáza směr pohybu enzymů DNA-polymeráza I DNA-polymeráza III primozom 5' 3, 5, hotový



ZÁKLADY BAKTERIÁLNÍ GENETIKY Zdroj rozmanitosti mikrorganismů ZÁKLADY BAKTERIÁLNÍ GENETIKY Různé sekvence nukleotidů v DNA kódují různé proteiny Různé proteiny vedou k různým organismům s různými vlastnostmi Exprese genetické informace



REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK Molekulární základy dědičnosti - rozšiřující učivo REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK REPLIKACE deoxyribonukleové kyseliny (zdvojení DNA) je děj, při kterém se tvoří z jedné dvoušoubovice DNA dvě nová


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin


Molekulární základ dědičnosti

Molekulární základ dědičnosti Molekulární základ dědičnosti Dědičná informace je zakódována v deoxyribonukleové kyselině, která je uložena v jádře buňky v chromozómech. Zlomovým objevem pro další rozvoj molekulární genetiky bylo odhalení


První testový úkol aminokyseliny a jejich vlastnosti

První testový úkol aminokyseliny a jejich vlastnosti První testový úkol aminokyseliny a jejich vlastnosti Vysvětlete co znamená pojem α-aminokyselina Jaký je rozdíl mezi D a L řadou aminokyselin Kolik je základních stavebních aminokyselin a z čeho jsou odvozeny


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


Nukleové kyseliny. Nukleové kyseliny. Genetická informace. Gen a genom. Složení nukleových kyselin. Centrální dogma molekulární biologie

Nukleové kyseliny. Nukleové kyseliny. Genetická informace. Gen a genom. Složení nukleových kyselin. Centrální dogma molekulární biologie Centrální dogma molekulární biologie ukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Transkripce D R Translace rotein Mendel) Replikace 1869 objev nukleových kyselin (Miescher) 1944 nukleové kyseliny


Metody studia exprese mrna. jádro a genová exprese 2007

Metody studia exprese mrna. jádro a genová exprese 2007 Metody studia exprese mrna Buněčné jádro a genová exprese 2007 Aktivita genu je primárn ě vyjád ř ena jeho transkripcí-prvním krokem vedoucím k syntéze kódovaného proteinu. Cíle metod Ur č ení mno ž ství



DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení


Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Inovace laboratorních úloh genetických předmětů metodikami pracujícími s ribonukleovými kyselinami pšenice Metodické návody pro laboratorní


Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace


7. Regulace genové exprese, diferenciace buněk a epigenetika

7. Regulace genové exprese, diferenciace buněk a epigenetika 7. Regulace genové exprese, diferenciace buněk a epigenetika Aby mohl mnohobuněčný organismus efektivně fungovat, je třeba, aby se jednotlivé buňky specializovaly na určité funkce. Nový jedinec přitom


Definice genového inženýrství

Definice genového inženýrství Definice genového inženýrství Genové inženýrství se zabývá vytvářením pozměněných či nových genů nebo přípravou nových ( nepřirozených ) kombinací genů a jejich zaváděním do genomu organizmů s cílem rekonstruovat


Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží



ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 10 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 26.06.2014 Ročník: 6AF, 6BF Anotace DUMu: Procesy následující bezprostředně po transkripci.


ÚVOD. Úvod ke struktuře nukleových kyselin Struktura DNA Replikace DNA Opravy DNA

ÚVOD. Úvod ke struktuře nukleových kyselin Struktura DNA Replikace DNA Opravy DNA NUKLEVÉ KYSELINY ÚVD Úvod ke struktuře nukleových kyselin Struktura DNA Replikace DNA pravy DNA * Základní pojmy struktury nukleových kyselin Nukleotidy mohou být spojovány do řetězců ve formě ribonukleové


Nukleové kyseliny příručka pro učitele. Obecné informace:

Nukleové kyseliny příručka pro učitele. Obecné informace: Obecné informace: Nukleové kyseliny příručka pro učitele Téma Nukleové kyseliny je završením základních kapitol z popisné chemie a je tedy zařazeno až na její závěr. Probírá se v rámci jedné, eventuálně



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní


Radiobiologický účinek záření. Helena Uhrová

Radiobiologický účinek záření. Helena Uhrová Radiobiologický účinek záření Helena Uhrová Fáze účinku fyzikální fyzikálně chemická chemická biologická Fyzikální fáze Přenos energie na e Excitace molekul, ionizace Doba trvání 10-16 - 10-13 s Fyzikálně-chemická


6. Nukleové kyseliny a molekulová genetika

6. Nukleové kyseliny a molekulová genetika 6. Nukleové kyseliny a molekulová genetika Obtížnost A Odhadněte celkové nukleotidové složení dvouvláknové DNA, u níž bylo experimentálně stanoveno, že ze 100 deoxynukleotidů tvoří průměrně 22 deoxyadenosin-5


Izolace RNA. doc. RNDr. Jan Vondráček, PhD..

Izolace RNA. doc. RNDr. Jan Vondráček, PhD.. Izolace RNA doc. RNDr. Jan Vondráček, PhD.. Metodiky izolace RNA celková buněčná RNA ( total RNA) zahrnuje řadu typů RNA, které se mohou lišit svými fyzikálněchemickými vlastnostmi a tedy i nároky na jejich


Eva Benešová. Genetika

Eva Benešová. Genetika Eva Benešová Genetika Význam nukleotidů - Energetický metabolismus (oběh energie). - Propojení odpovědi buňky na hormony a další stimuly. - Komponenty enzymových kofaktorů a dalších metabolických intermediátů.


Vzdělávací materiál. vytvořený v projektu OP VK. Anotace. Název školy: Gymnázium, Zábřeh, náměstí Osvobození 20. Číslo projektu:

Vzdělávací materiál. vytvořený v projektu OP VK. Anotace. Název školy: Gymnázium, Zábřeh, náměstí Osvobození 20. Číslo projektu: Vzdělávací materiál vytvořený v projektu VK ázev školy: Gymnázium, Zábřeh, náměstí svobození 20 Číslo projektu: ázev projektu: Číslo a název klíčové aktivity: CZ.1.07/1.5.00/34.0211 Zlepšení podmínek pro


Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký

Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký Kapitola 3 Biomolecular Design and Biotechnology Překlad: Jaroslav Krucký Problémy chemie a biologie mohou být velmi nápomocné, jestliže se naše schopnost vidět to, co děláme, a dělat věci na atomární


4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie.

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. 4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. Od genu k proteinu - centrální dogma biologie Geny jsou zakódovány v DNA - Jakým způsobem? - Jak se projevují? Již v roce 1902
