Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28."


1 Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/ )

2 Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že podíl jednotlivých alel se v panmiktické populaci nemění. V případě, že pro daný gen existuje pouze systém dvou alel, znamená to že: (četnost dominantní alely značíme p a recesívní q): p + q = 1 (tj. 100 %) Pravděpodobnost vzniku: homozygota dominantního je p p homozygota recesivního je q q heterozygota je 2pq. Celkové genotypové složení populace vyjadřuje: p² + 2pq + q² = 1

3 Hodnocení genetické variability Heterozygozita (He) (= genová diverzita) Zjištěná (H o ) x očekávaná (H e ) Malá (nižší) heterozygozita = malá diverizta (inbreeding) Vyšší heterozygozita než očekávaná = an isolate-breaking effect (the mixing of two previously isolated populations)

4 Inbreeding Produkce potomků při křížení příbuzných jedinců Jedinci jsou inbrední, pokud rodiče sdílejí aspoň jednoho společného předka

5 Inbríding problém malých populací Volf (1999) Generální plemenná kniha koní převalského.

6 Hodnocení inbrídingu koeficient inbrídingu (F) Stanovení pravděpodobnosti, že dvě alely téhož lokusu jsou identického původu. F < 0; 1 > Autozygotní x allozygotní homozygoti

7 koeficient inbrídingu (F) Stanovení pravděpodobnosti, že dvě alely téhož lokusu jsou identického původu. Samoopylení: Aa (A1A2) F (AA/A1A1 nebo aa/a2a2) A1 (½) A2 (½) A1 (½) A1A1 (¼) A1A2 A2 (½) A1A2 A2A2 (¼) F= P(A1A1 )+P(A2A2) = ¼ + ¼ = ½

8 koeficient inbrídingu (F) Stanovení pravděpodobnosti, že dvě alely téhož lokusu jsou identického původu. Příbuzenské křížení: 1/4 1/4 F= P(A1A1 )+P(A2A2)+P(A3A3)+P(A4A4) = 1/16 + 1/16 + 1/16 + 1/16 = 1/4

9 Genetické důsledky inbrídingu Zvyšování homozygozity Zvýšená exprese škodlivých alel Snížení fittness = narušení HW rovnováhy

10 Genetické důsledky inbrídingu Aa x Aa AA : 2Aa : aa 4AA, AA : 2Aa : aa, 4aa 16AA+4AA : 2 Aa : 4aa+16aa /p²+fpq / + / 2pq(1-F) / + / q²+fpq / = 1 /p²+fpq / + / 2pq - 2Fpq / + / q²+fpq / = 1 p + q = 1

11 Inbríding a malé populace Nárůst inbrídingu v průběhu času ( tj. mezi generacemi) Vliv velikosti populace a zastoupení pohlaví

12 Inbríding a malé populace Nárůst inbrídingu v průběhu času ( tj. mezi generacemi) Vliv velikosti populace a zastoupení pohlaví

13 Hodnocení / Odhady inbrídingu Z reálných frekvencí fenotypů (genotypů) Hodnocení zastoupení heterozygotů Z rodokmenu

14 Hodnocení inbrídingu- stanovení F Hodnocení výskytu heterozygotů H inbred H e = 1 F F = 1 H o H e ; F = 1 H t H 0 Avena fatua L. Hedrick (2005) Genotyp A-frekvence BB Bb bb p(b) q(b) i o 0,548 0,071 0,381 0,5835 0,4165 e i 0,340 0,485 0,173 F = 1 0,071/0,486 = 0,85

15 Hodnocení inbrídingu- stanovení F x Z rodokmenů Fx = (1/2) n F = Σ(1/2) n (1 +F ca ) F = (½) 3 F = (½) 7

16 Hodnocení inbrídingu- stanovení F x Z rodokmenů (zohlednění F jednotlivých příslušníků rodokmenu/předků) F = Σ(1/2) n (1 +F ca ) n F HECADGI 7 (½) 7 HECBDGI 7 (½) 7 HEBDGI 6 (½) 6 HEGI 4 (½) 4 x (1+1/4) HEI 3 (½) 3 (1+1/4) F x 0,2656

17 Změny alelových a genotypových frekvencí - Vytěsňování škodlivých alel, důsledku selekce = purging - Nižší selekční tlak u polyploidů P- genotyp Fenotypové poměry Blízko centroméry Dále od centroméry AAAA Všichni A Všichni A AAAa Všichni A 783A : 1a Aaaa 35A : 1a 20,8A : 1a Aaaa 3A : 1a 2,5A : 1a aaaa Všichni a Všichni a

18 Inbrední deprese Snížení reprodukční fitness jedinců v důsledku vzájemného křížení Jednotlivé složky jsou obvykle ovlivněny méně než celková reprodukční fitness

19 Inbrední deprese Snížení reprodukční fitness jedinců v důsledku vzájemného křížení Druh Vlastnost Inbrední deprese (%) Člověk Váha v 10tiletech 4 IQ 11 Skot Produkce mléka 8 Ovce Délka srsti 14 Myš domácí Počet potomků 10 Velikost těla -10 Prase domáci Velikost vrhu 8 Velikost těla 11 Kur domácí Reprodukce 26 Produkce vajec 10

20 Inbrední deprese v přirozených podmínkách Dietz JM et al. (2000) Demographic evidence of inbreeding depression in wild golden lion tamarins

21 Inbrední deprese (Lively et al. 1990)

22 Imbríding, jeho důsledky pro přežití druhu Zvýšení rizika vyhynutí Vliv velikosti a struktury populace Vliv podmínek prostředí

23 Příčiny inbrední deprese Hromadění, homozygotizace škodlivých alel Odlišný účinek kvalitativních a kvantitativních genů

24 Hodnocení inbrední deprese Porovnání přežívání a reprodukce jedinců /genotypů na základě porovnání inbredních a neinbredních populací δ = 1 - fitness inbredního potomstva fitness outbredního potomstva F Živě narozených Úhyn 0 86 (61%) 55 (39%) 0,125 5 (71%) 2 (29%) 0,25 12 (40%) 18 (60%) 0,375 1 (17%) 5 (83%)


Příbuznost a inbreeding

Příbuznost a inbreeding Příbuznost a inbreeding Příbuznost Přímá (z předka na potomka). Souběžná (mezi libovolnými jedinci). Inbreeding Inbrední koeficient je pravděpodobnost, že dva geny přítomné v lokuse daného jedince jsou


Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Genetika populací Studium dědičnosti a proměnlivosti skupin jedinců (populací)


- Definice inbreedingu a jeho teorie

- Definice inbreedingu a jeho teorie Negativní důsledky inbrední deprese v chovu skotu Ing. Jiří Bezdíček, Ph.D. Výzkumný ústav pro chov skotu, s.r.o., Rapotín 26. listopadu 2009 - Definice inbreedingu a jeho teorie - Proč je inbreeding v


Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém


Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci


Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/

Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/ Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/28.0018 Základy populační genetiky Osnova 1. Genetická struktura populace 2. Způsob reprodukce v



GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)


Heritabilita. Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability

Heritabilita. Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability Heritabilita Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability h 2 = V A / V P Výpočet genetické determinance znaku h 2 = V G / V P Heritabilita závisí


genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA


OBECNÁ GENETIKA. Gen ást DNA, schopná funkn zabezpeit syntézu aktivní jednotky. Genotyp soubor gen, uruje rozsah a míru fenotypových možností

OBECNÁ GENETIKA. Gen ást DNA, schopná funkn zabezpeit syntézu aktivní jednotky. Genotyp soubor gen, uruje rozsah a míru fenotypových možností GENETIKA A ŠLECHTNÍ Ivana Gardiánová Katedra genetiky a šlechtní OBECNÁ GENETIKA Genetika nauka o ddinosti a promnlivosti živých organism Ddinost schopnost organism penést znaky a vlastnosti na potomstvo


Pojem plemeno je používán pro rasy, které vznikly záměrnou činností člověka, např. plemena hospodářských zvířat.

Pojem plemeno je používán pro rasy, které vznikly záměrnou činností člověka, např. plemena hospodářských zvířat. POPULAČNÍ GENETIKA Populační genetika se zabývá genetickými zákonitostmi v definovaných souborech jedinců téhož druhu. Genetické vztahy uvnitř populace jsou komplikované, a proto se v populační genetice



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Populační genetika Radka Reifová

Populační genetika Radka Reifová Populační genetika Radka Reifová Prezentace ke stažení: http://web.natur.cuni.cz/~radkas v záložce Courses Literatura An Introduction to Population Genetics. Rasmus Nielsen and Montgomery Slatkin. 2013.


Hodnocení plemenných + chovných + užitkových prasat

Hodnocení plemenných + chovných + užitkových prasat Hodnocení plemenných + chovných + užitkových prasat Metodické pokyny SCHP Hodnocení plemenných prasat Cíl hodnocení stanovit předpoklad využití zvířat v plemenitbě k dalšímu šlechtění populace k masovému


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat


V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem


QTL u koní. Kmen je skupina koní v rámci plemene, odlišných morfologických a užitkových vlastností (šlechtění na tažné a jezdecké využití).

QTL u koní. Kmen je skupina koní v rámci plemene, odlišných morfologických a užitkových vlastností (šlechtění na tažné a jezdecké využití). QTL u koní Dnešní plemena koní se odvozují od divokých předků, od: Equus przewalskii (kůň Převalského-kertaka) Equus gmelini (kůň západní) Equus gracilis (kůň severský) Pojmy plemenitby Plemeno je skupina


Šlechtitelské + hybridizační programy

Šlechtitelské + hybridizační programy Šlechtitelské + hybridizační programy Plemenářská práce širší pojetí souhrn zootechnických + organizačních + ekonomických opatření cíl všestranné zvyšování užitkovosti prasat užší pojetí zásahy do genotypové


Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák

Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák KVANTITATIVNÍ GENETIKA dědičnost kvantitativních znaků ZNAKY KVALITATIVNÍ: gen znak barva hrachu: žlutá zelená (i komplikovaněji penetrace, epresivita,


Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


1) Je vydána na základě a v mezích zákona, do něhož již byly příslušné směrnice Evropských společenství promítnuty.

1) Je vydána na základě a v mezích zákona, do něhož již byly příslušné směrnice Evropských společenství promítnuty. 448/2006 Sb. VYHLÁŠKA Ministerstva zemědělství ze dne 1. září 2006 o provedení některých ustanovení plemenářského zákona ve znění vyhlášky č. 57/2011 Sb. Ministerstvo zemědělství stanoví podle 33 zákona


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání


Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého



PRAKTIKUM Z OBECNÉ GENETIKY RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie lizal@sci.muni.cz 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin


Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae).

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). Populační studie Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). American Journal of Botany 87(8): 1128


Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické


PhD. České Budějovice

PhD. České Budějovice PhD. České Budějovice Sledování a využívání poznatků o genetické biodiverzitě mezi populacemi hospodářských zvířat Dvořák Josef prof. Genetiky živočichů Ústavu genetiky MZLU v Brně Pro seminář doktorského


Budoucnost chovu chladnokrevných koní v ČR

Budoucnost chovu chladnokrevných koní v ČR Budoucnost chovu chladnokrevných koní v ČR Změna v chovu koní za posledních 23 let 1989-28 000 koní 1995-18 000 koní 2011-77 000 koní Nárůst počtů Nárůst kvality??? Cesty ke zlepšení Plemenitba V chovu



GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


Genetika populací. Doposud genetika na úrovni buňky, organizmu

Genetika populací. Doposud genetika na úrovni buňky, organizmu Doposud genetika na úrovni buňky, organizmu - jedinec nás nezajímá - pouze jeho gamety a to jako jedny z mnoha = genofond = soubor všech gamet skupiny jedinců Populace mnoho různých definic - skupina organizmů


KBI/GENE Mgr. Zbyněk Houdek

KBI/GENE Mgr. Zbyněk Houdek Genealogie KBI/GENE Mgr. Zbyněk Houdek Rodokmenové schéma Shromáždění informací o rodině je 1. důležitým krokem v genetickém poradenství. Rodokmenové schéma musí být srozumitelné a jednoznačné. Poskytuje


Hodnocení plemenných + chovných + užitkových prasat

Hodnocení plemenných + chovných + užitkových prasat Hodnocení plemenných + chovných + užitkových prasat Metodické pokyny SCHP Hodnocení plemenných prasat Cíl hodnocení stanovit předpoklad využití zvířat v plemenitbě k dalšímu šlechtění populace k masovému


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat


Předm luva A notace/a n n o tatio n... 15

Předm luva A notace/a n n o tatio n... 15 Obsah Předm luva... 13 A notace/a n n o tatio n... 15 A Selekce 37 1 Selekce k valitativních v la stn o stí 41 1.1 Definice populace a genetiky p o p u la c í...41 1.2 Principy selekce...42 1.3 Genetické



http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto


Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef


Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je



METODIKA CHOVU VALAŠSKÉ OVCE METODIKA CHOVU VALAŠSKÉ OVCE PLEMENO, jeho chov a šlechtění 1. Stručný historický vývoj plemene Valašské ovce se na území ČR dostaly spolu s valašskou kolonizací Karpat, která začala ve 14. století a v


Jak pokračovat dále v chovu leopardího psa I. Kritéria výběru správného partnera

Jak pokračovat dále v chovu leopardího psa I. Kritéria výběru správného partnera Jak pokračovat dále v chovu leopardího psa I. Kritéria výběru správného partnera Jarní klubová výstava (viz článek.) nás přiměla k zamyšlení nad tím, jak vlastně dál v chovu leopardů pokračovat a co doporučit


Populační genetika II

Populační genetika II Populační genetika II 4. Mechanismy měnící frekvence alel v populaci Genetický draft (genetické svezení se) Genetický draft = zvýšení frekvence alely díky genetické vazbě s výhodnou mutací. Selekční vymetení


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


Proč nový systém odhadu plemenných hodnot?

Proč nový systém odhadu plemenných hodnot? Proč nový systém odhadu plemenných hodnot? Faktory ovlivňující užitkovost Chovatel Výživa Prostředí Užitkovost Genetická výbava 5-15% Zisk chovatele Spotřebitel Hodnocení zvířat 1900 KU 1920 vývoj metod


Aplikace molekulárně- genetických dat ve šlechtění. Humpolíček Petr

Aplikace molekulárně- genetických dat ve šlechtění. Humpolíček Petr Aplikace molekulárně- genetických dat ve šlechtění Humpolíček Petr Co vás čeká Tradiční šlechtitelské postupy Typy molek-gen. dat Přístupy k aplikaci molek-gen. dat Srovnání přístupů Šlechtění na odolnost


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


Genetika populací a. Gentika populací. Autogamická populace

Genetika populací a. Gentika populací. Autogamická populace Genetika populací a člověka Mgr. Aleš RUDA Gentika populací Populace = všichni jedinci téhož druhu, kteří obývají vdaném čase stejné území GENOFOND soubor alel v gametách všech členů populace GENETIKA


Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti


9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů

9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů 9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou


Experiment s dlouhodobou selekcí krav na ukazatele produkce a zdravotního stavu v Norsku Ing. Pavel Bucek, Českomoravská společnost chovatelů, a.s.

Experiment s dlouhodobou selekcí krav na ukazatele produkce a zdravotního stavu v Norsku Ing. Pavel Bucek, Českomoravská společnost chovatelů, a.s. Experiment s dlouhodobou selekcí krav na ukazatele produkce a zdravotního stavu v Norsku Ing. Pavel Bucek, Českomoravská společnost chovatelů, a.s. Z chovatelské praxe a z celé řady vědeckých experimentů


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


Národní program uchování a využívání genetických zdrojů zvířat

Národní program uchování a využívání genetických zdrojů zvířat METODIKA CHOVU GENETICKÝCH ZDROJŮ KRÁLÍKŮ První zmínky o chovu králíků na území Čech pocházejí ze 13. století, chovatelství jako takové se však začíná rozvíjet na počátku 19. století. V polovině 19. století


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci



TYPY DĚDIČNOSTI GONOSOMÁLNÍ DĚDIČNOST TYPY DĚDIČNOSTI GONOSOMÁLNÍ DĚDIČNOST DĚDIČNOST POHLAVNĚ VÁZANÁ geny lokalizované na pohlavních chromozomech X nebo Y řídí vznik nejen primárních pohlavních znaků přenos genů na potomky je vázán na přenos


Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o.

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o. Genetické markery ve šlechtění skotu pro masnou produkci Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Genetické markery Polymorfní místa v DNA, které vykazují asociaci na sledované znaky Příčinné


Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k



GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky


Metody studia historie populací

Metody studia historie populací 1) Metody studia genetické rozmanitosti komplexní fenotypové znaky, molekulární znaky. 2) Mechanizmy evoluce jak lze studovat evoluci a jak funguje mutace, přírodní výběr, genový posun a genový tok 3)


Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus


Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v





Selekční indexy v praxi. Josef Kučera

Selekční indexy v praxi. Josef Kučera Selekční indexy v praxi Josef Kučera Selekce Cílem selekce je výběr zvířat k produkci potomstva pro obměnu stáda nebo v celé populaci k produkci další generace zvířat na všech úrovních šlechdtelského programu


Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Tradice šlechtění šlechtění zlepšování pěstitelsky, technologicky a spotřebitelsky významných vlastností


Hardy-Weinbergův princip

Hardy-Weinbergův princip 1) Modelová populace 2) Hardy-Weinbergův princip 3) Hardy-Weinbergův princip využití Testování HW poměru Stanovení četnosti heterozygotů při úplné dominanci Interpretace DNA profilů 4) Snyderovy podíly


BARVY BORDER COLLIÍ. Na konci tohoto dokumentu naleznete schéma hlavních barev podle lokusů.

BARVY BORDER COLLIÍ. Na konci tohoto dokumentu naleznete schéma hlavních barev podle lokusů. BARVY BORDER COLLIÍ Barva psí srsti je dána geneticky. Pro všechny border collie (snad až na vzácné výjimky) platí, že ve své genetické výbavě nesou alelu Si, která determinuje irské zbarvení (bílé znaky)


Osnova přednášky volitelného předmětu Evoluční vývoj a rozmanitost lidských populací, letní semestr

Osnova přednášky volitelného předmětu Evoluční vývoj a rozmanitost lidských populací, letní semestr Osnova přednášky volitelného předmětu Evoluční vývoj a rozmanitost lidských populací, letní semestr Evoluční teorie Základy evoluce, adaptace na životní podmínky - poskytuje řadu unifikujících principů


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského


Jihočeská univerzita v Českých Budějovicích Zemědělská fakulta

Jihočeská univerzita v Českých Budějovicích Zemědělská fakulta Jihočeská univerzita v Českých Budějovicích OP Vzdělávání pro konkurenceschopnost CZ. Koordinátor: Mgr. Martin Šlachta, Ph.D. Metodik: prof. Ing. Jan Frelich, CSc. Finanční manažerka:


RURGenetika zápočtový program Programování II

RURGenetika zápočtový program Programování II RURGenetika zápočtový program Programování II Rudolf Rosa cvičící: Doc. RNDr. Pavel Töpfer, CSc. Obsah Specifikace...1 Původní specifikace...1 Upravená specifikace...2 Program...3 třída Populace...4 Datové


8 Odhad plemenné hodnoty (OPH)

8 Odhad plemenné hodnoty (OPH) Genetika ve šlechtění zvířat TGU 006 část 7. (rough draft version) 8 Odhad plemenné hodnot (OPH) V populaci jedinců je genetická variabilita způsobená jedinci s různými genotp. U kvantitativních vlastností


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


Selekční efekt. Úvod do šlechtění zvířat 1

Selekční efekt. Úvod do šlechtění zvířat 1 Selekční efekt Úvod do šlechtění zvířat 1 Dědičnost tělesné výšky u lidí ( F. Galton 1800-1911) Generac Odchylky od průměru populace e Rodičů -6,0-4,5-3,0-1,5 0 +1,5 +3,0 +4,5 +5,0 Potomků -4,0-2,5-1,5-1,0


Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových


4. Genetické základy šlechtění hospodářských zvířat

4. Genetické základy šlechtění hospodářských zvířat část 3. (rough draft version) 4. Genetické základy šlechtění hospodářských zvířat Obecné principy postupu šlechtění Šlechtění je ekonomicky výhodnější než prostá produkce živočišných produktů ať v krátkodobém


Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu Genetický olymorfizmus ois struktury oulací Tok GI v buňce Dr. Ing. Urban Tomáš ÚSTAV GEETIKY MZLU Brno urban@mendelu.cz htt://www.mendelu.cz/af/genetika/ Seminář doktorského grantu 53/03/H076 : Molekulárn


1. Úvod do genetických algoritmů (GA)

1. Úvod do genetických algoritmů (GA) Obsah 1. Úvod do genetických algoritmů (GA)... 2 1.1 Základní informace... 2 1.2 Výstupy z učení... 2 1.3 Základní pomy genetických algoritmů... 2 1.3.1 Úvod... 2 1.3.2 Základní pomy... 2 1.3.3 Operátor



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného
