KLASICKÉ A ALTERNATIVNÍ METODY STUDIA STRUKTURY A INTERAKCÍ BIOMOLEKUL

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "KLASICKÉ A ALTERNATIVNÍ METODY STUDIA STRUKTURY A INTERAKCÍ BIOMOLEKUL"

Transkript

1 KLASICKÉ A ALTERNATIVNÍ METODY STUDIA STRUKTURY A INTERAKCÍ BIOMOLEKUL NÁVODY KE CVIČENÍM VÁCLAV BRÁZDA BIOFYZIKÁLNÍ ÚSTAV AV ČR, V.V.I

2

3 OPVK Praktický kurz, 2013 KLASICKÉ A ALTERNATIVNÍ METODY STUDIA STRUKTURY A INTERAKCÍ BIOMOLEKUL NÁVODY KE CVIČENÍM BIOFYZIKÁLNÍ ÚSTAV AV ČR, V.V.I ROZVOJ MODERNÍCH TRENDŮ V EXPERIMENTÁLNÍ BIOLOGII: VÝZNAM BIMOLEKULÁRNÍCH INTERAKCÍ PRO FUNKCI BUNĚČNÝCH STRUKTUR OPERAČNÍ PROGRAM VZDĚLÁVÁNÍ PRO KONKURENCESCHOPNOST ČÍSLO PROJEKTU: CZ.1.07/2.3.00/

4 OPVK Praktický kurz, 2013 KLASICKÉ A ALTERNATIVNÍ METODY STUDIA STRUKTURY A INTERAKCÍ BIOMOLEKUL návody ke cvičením Václav Brázda Vydal: Biofyzikální ústav Akademie věd České republiky, v.v.i., Královopolská 135, Brno, Česká republika Brno 2013 Česká Republika První vydání ISBN:

5 OPVK Praktický kurz, 2013 Obsah Obsah... 5 Kapitola 1: Transfekce savčích buněk, detekce genové exprese pomocí reporterových genů... 7 Transfekce savčích buněk... 7 Detekce GFP Mikroskopie ELISA stanovení GFP Detekce luciferázy Kapitola 2: Polymerázová řetězová reakce Izolace mrna Reverzní transkripce qrt-pcr Kapitola 3: Transformace, selekce a kultivace bakterií, izolace plazmidové DNA restrikční analýza Transformace, selekce a kultivace bakterií Izolace plazmidové DNA a restrikční analýza Kapitola 4: Detekce strukturních přechodů v DNA pomocí CD spektroskopie I. B-A přechod II. B-Z přechod Kapitola 5: Aplikace elektrochemické analýzy v kombinaci s redox značením pro detekci specifických sekvencí a genové exprese

6 - 6 - OPVK Praktický kurz, 2013

7 OPVK Praktický kurz, 2013 Kapitola 1: Transfekce savčích buněk, detekce genové exprese pomocí reporterových genů Garant: Václav Brázda Transfekce savčích buněk Princip a cíl: Transfekcí je označován přenos cizorodého genetického materiálu do eukaryotických buněk. Existuje celá řada metodik transfekce, mezi nejstarší a nejčastěji používané patří chemická metodika transfekce fosforečnanem vápenatým. Použitá metodika transfekce fosforečnanem vápenatým je modifikací původní metodiky, která se vyznačuje jednoduchostí a spolehlivostí. Metoda transfekce fosforečnanem vápenatým je velmi efektivní způsob zavedení DNA do buňky v mnoha systémech, nicméně v jiných může být zcela neefektivní. Nejlépe funguje v buněčných liniích, které rostou přisedlé, například u buněk Hela, U2OS, SAOS2, Ada a NPC-KT lze získat transfekční účinnost od 20% do 100% v závislosti na buněčné línii a podmínkách transfekce. Metoda funguje dobře pro vytváření jak tranzientní transformace, tak i pro generování stabilních buněčných linií. Metoda je poměrně citlivá na množství použitého plazmidu. Celkové množství transfekované DNA musí být cca 30 g (pro 100mm misky). Pro efektivní transfekci je vhodné použít jako nosič plazmid bez eukaryotického promotoru (například pbluescript). Pro typické transaktivační pokusy používáme mezi ng transfekovaného plazmidu a cca 29 µg nosičového plazmidu. Nicméně pro funkční tranfekci je někdy nutné poměr upravit až na 5-10 µg příslušného expresního vektoru a µg nosičové DNA. Je třeba mít na paměti několik důležitých aspektů. DNA přechází přes jadernou membránu pouze během mitózy. Nedojde tedy k expresi genu dokud buňka neprojde mitózou. Po transfekci dochází k synchronizaci buněk, ty by se měli analyzovat nejméně 24 hodin po transfekci. Cílem je připravit buněčné línie HCT116 a 293F s reporterovými plazmidy: A) s luciferázovým expresním systémem pcna3wtp3 a pmdm2-adp2; B) s GFP proteinem pbrca-gfp

8 OPVK Praktický kurz, 2013 Pracovní postup: Pro tranfekci použijeme 6ti jamkové desky. 1. Den před transfekcí naředíme kulturu konfluentních buněk (70-90%) v poměru 1:10 do 1:15 (poměr závisí na buněčných liniích, které jsou transfekovány, rychleji rostoucí buněčné linie ředíme více, velmi pomalu rostoucí buněčné linie mohou být rozředěny méně než 1:10). 2. Druhý den ráno odlejte medium (DMEM (10% FBS, + pen / strep)) a přidejte 2ml čerstvého média. 3. Vlastní transfekce 5 g celkové DNA s různým množstvím efektorového plazmidu dle tabulky (dopočítejte množství plazmidu pro transfekci). A1 A2 A3 B1 B2 B3 Deska číslo 1 (plazmid s GPF) GFP plazmid Označení 2400 g/ml pbluescript A1/B1 0 5 g A2/B2 20 ng 5 g A3/B ng 4 g Deska číslo 2 (plazmid s luciferázovým expresním systémem) Označení pcna3wtp53 pmdm2-adp2 pbluescript 857 g/ml 51 g/ml A1/B g A2/B2 20 ng 20 ng 5 g A3/B ng 1000 ng 3 g - 8 -

9 OPVK Praktický kurz, Pro každou transfekci dejte 86 l 1X HBS do sterilní zkumavky. 5. Přidejte odpovídající množství DNA do každé zkumavky a promíchejte. 6. Přidejte do každé zkumavky 5 l 2,5M CaCl 2 a promíchejte. 7. Inkubujte 20 minut při pokojové teplotě. 8. Přidejte k buňkám transfekční směs po kapkách a mírně míchejte - nemixujte! 9. Vložte do CO2 inkubátoru. 10. Další den vyměňte médium. 11. Pro stadium transientní exprese jsou buňky použity po hodinách. Seznam chemikálií: 1X HBS 1 litr HEPES 5 g NaCl 8 g Dextróza 1 g KCl 3,7 g Na 2 HPO 4 (7H 2 O) 10 ml zásobního roztoku 1. Přidejte H 2 O do cca 900 ml. 2. Upravte ph na 7,1 přesně. 3. Přidejte H 2 O do 1 litru. 4. Přefiltrujte přes sterilní filtr (0.2 m. 5. Rozdějte na alikvoty do sterilních zkumavek a uložte na -20 C. Na 2 HPO 4 (7H 2 O) zásobní roztok = 0,94 g Na 2 HPO 4 (7H 2 O) v 50 ml H 2 O 2.5M CaCl2 100ml CaCl 2 27,75 g bezvodého CaCl 2 nebo CaCl 2 36,75 g CaCl 2 (2H 2 O) Rozdělte na alikvoty do sterilních zkumavek 15 ml (10 ml do každé) a uložte v mrazničce

10 OPVK Praktický kurz, 2013 Detekce GFP K detekci GFP je možné použít celou řadu metodik. V rámci praktického cvičení se seznámíme s mikroskopickými technikami a ELISA stanovením. Mikroskopie Pro studium buněk se dlouhodobě používá mikroskopie. Jednou z nejčastějších metod zobrazení konkrétní molekuly či buněčných organel ve vysokém rozlišení je použití fluorescenčních značek, které umožní jednoznačnou identifikaci a lokalizaci proteinu v buňce. Klasická fluorescenční mikroskopie má tu nevýhodu, že se při zkoumání silnějších vzorků pletiv do roviny zaostření mikroskopu promítne i fluorescence z mimoohniskových částí. Tento rušivý šum způsobí zamlžení a sníženou ostrost snímku, kterou lze eliminovat technikou konfokální mikroskopie. Fluorescenční i konfokální mikroskopie využívají fluorescence, tj. schopnosti atomů a molekul absorbovat určité množství excitační energie a vzápětí ji vydat zpět v podobě emisního záření o vyšší vlnové délce s nižší energií. Princip laserového rastrovacího konfokálního mikroskopu zjednodušeně spočívá v osvětlování pozorovaného objektu bodovým zdrojem světla, který je clonou zaostřen na jeden bod pozorovaného vzorku. Sekundární světlo odražené z tohoto bodu přechází na konfokální clonu. Ta zaostřuje na detektor jen světlo pocházející ze zaostřených bodů, zatímco světlo emitované z osvětlených, ale nezaostřených bodů jde mimo ní. Výstupní digitální obraz celé zaostřené roviny je získáván jejím rastrováním bod po bodu. Konfokální mikroskopie představuje nedestruktivní pozorovací techniku a je proto ideální metodou pro pozorování nejrůznějších struktur v živých buňkách. Při studiu živých buněk se využívají často právě transgenní organismy s fúzními proteiny. Jako první byl izolován zelený fluorescenční protein (GFP) z mořské medúzy Aequoria victoria, u které byl objeven jako součást bioluminiscence. Tento protein s molekulovou mnotností 28 kda má maximum excitační vlnové délky cca 489 nm a maximum emisní vlnové délky 509 nm

11 OPVK Praktický kurz, 2013 V současné době je dostupná celá řada dalších mutací GFP s odlišnými spektrálními vlastnostmi. Díky široké škále fluorescenčních barviv můžeme s využitím laserů různých vlnových délek a správných bariérových filtrů pozorovat více buněčných struktur v živých buňkách. Výstupem konfokálního mikroskopu je digitální obraz, který můžeme dále kvalitativně i kvantitativně analyzovat, sestavovat trojrozměrný obraz studovaného objektu nebo pomocí časosběrného snímkování studovat dynamiku buněčných struktur. V rámkci praktického cvičení se seznámíme s prací na konfokálním mikroskopu Leica SP

12 OPVK Praktický kurz, 2013 ELISA stanovení GFP Pro stanovení účinnosti transfekce je možné využít citlivé měření na ELISA readeru. Fluorescence GFP je ale rychle zhášena, proto se pro citlivé stanovení používá zpravidla fluorescenčně značená monoklonální protilátka proti GFP. V našem případě se pokusíme změřit přímo fluorescenci buněk při 509 nm a srovnáme intenzity signálu se stanovením transformantů s luciferázovým expresním systémem. Pracovní postup: 1. Odstraň médium z kultury buněk. 2. Omyj buňky 1x PBS. 3. Přidej k buňkám 1x Trypsin 200 l na jednu jamku v 6-ti jamkové desce, (900 l na 100 mm misku 20 l na jamku v 96-ti jamkove desce) a nech působit cca 5 minut. 4. Odsaj buňky s 1 ml média do zkumavky a stoč (mikrocentrifuga rpm 5min.). 5. Resuspenduj buňky ve 100 l média a dej na 96-ti jamkovou ELISA desku. 6. Připrav blank (100 l média). 7. Změř fluorescenci na ELISA readeru. Seznam chemikálií a potřeb: PBS Trypsin Centrifuga ELISA reader s možností měření fluorescence

13 OPVK Praktický kurz, 2013 Detekce luciferázy Pro studium procesů spojených s genovou expresí se často používájí reporterové systémy. Dají se použít ke studiu expresní aktivity receptoru, intracelulární signální transdukce, skládání proteinů a studium interakcí. Luciferázový systém je používán zejména z následujích důvodů: Aktivita transfekovaného genu je k dispozici ihned po překladu do proteinu a nevyžaduje její posttranslační zpracování. Test je velmi citlivý a použité systémy nemají žádnou vnitřní luminiscenci. Test je rychlý, vyžaduje pouze několik sekund na vzorek. Světlo je produkováno přeměnou chemické energie oxidací luciferinu prostřednictvím elektronového přechodu při tvorbě oxyluciferinu. Luciferáza katalyzuje oxidaci luciferinu pomocí ATP a Mg2+. Promega systém pro detekci luciferázy obsahuje koenzym A pro zlepšení kinetiky, což umožňuje větší enzymatickou výtěžnost a zvýšení světlelné intenzity a stability signálu po dobu nejméně jedné minuty. Při optimálních podmínkách je možné detekovat okolo molů luciferázy. Cílem je změřit chemiluminiscenci u pokusných vzorků připravených transformací plazmidů s luciferázovým expresním systémem

14 OPVK Praktický kurz, 2013 Pracovní postup: 1. Odstraň médium z kultury buněk. 2. Omyj buňky 1x PBS (2ml). 3. Nalej na buňky 1x lysis reagent 200 l na jednu jamku v 6-ti jamkové desce (900 l na 100 mm misku 20 l na jamku v 96jamkove desce). 4. Seskřábni bunky z misky, přenes buňky do mikrozkumavky a odstraň debris (zbytky buněk na dně zkumavky) jemnou centrifugací (15s short spin). 5. Přenes 20 l supernatantu na ELISA desku. 6. Připrav blank (20 l 1x lysis reagent). 7. Přidej 100 l Luciferase Assay Reagent. 8. Změř intenzitu chemiluminiscence na ELISA readeru. Seznam chemikálií a potřeb: Promega E1500 Luciferase Assay Systém PBS Škrabka Centrifuga ELISA reader s možností měření chemiluminiscence

15 OPVK Praktický kurz, 2013 Kapitola 2: Polymerázová řetězová reakce Garant: Václav Brázda Princip a cíl úlohy Polymerázová řetězová reakce (PCR, Polymerase Chain Reaction) je enzymatická metoda umožňující zmnožení úseku DNA její replikací. PCR slouží k vytvoření až mnoha milionů kopií fragmentu DNA, což umožňuje provést analýzu DNA i z velmi malého vzorku. PCR probíhá v termocykleru, který dokáze během několika sekund zvýšit nebo snížit teplotu o několik desítek stupňů Celsia. Výsledkem PCR je obrovské množství kopií původní sekvence DNA. Metoda je tak citlivá, že dokáže v ideálním případě odhalit i jedinou molekulu DNA ve vzorku. Reverzní transkripční PCR (RT-PCR) se používá pro zmnožení DNA z RNA. Reverzní transkriptáza přepíše sekvenci RNA do cdna. Tato metoda je používaná pro stanovení exprese genů. Pokud je známa genomová sekvence, může se tato metoda použít také pro mapování exonů a intronů. Kvantitativní PCR (qpcr) slouží k měření množství cílové sekvence. Zpravidla se využívají fluorescenčně značené sondy nebo značení DNA fluorescenční barvou, například SYBR Green pro měření signalu DNA v reálném čase. Pracovní postup qpcr: Izolace mrna MagMAX-96 total RNA isolation kit AM1830 AB-Ambion Homogenizce vzorku 1. Připrav Lysis/Binding Solution -140 l na reakci - vždy čerstvý. Poměr LysisBinding Solution Concentrate: 100% izopropanolu 11:9). 2. Odstraň z buněk (2,5x10 2 2x10 6 ) médium a přidej 140 l Lysis/Binding Solution. 3. Míchej 1 minutu a poté dej zlyzované buňky do ELISA desky na izolaci. Purifikace nukleových kyselin 1. Připrav Bead mix smíchej 10 l RNA Binding Beads s 10 l Lysis/Binding Enhancer (množství na 1 reakci)

16 OPVK Praktický kurz, Přidej 20 l Mag-Bead Mix ke vzorku, míchej 5 min. 3. Vlož do magnetu a nech dokud se magnetické partikule s RNA neusadí (cca 2-3 minuty), poté odstraň opatrně supernatant. 4. Promyj 150 l Wash Solution 1, 1 minutu za míchání. 5. Vlož do magnetu a nech dokud se magnetické partikule s RNA neusadí (cca 2-3 minuty), poté opatrně odstraň supernatant. 6. Promyj 150 l Wash Solution 2 a dej míchat. 7. Dej do magnetu a nech dokud se magnetické partikule s RNA neusadí (cca 2-3 minuty), poté opatrně odstraň supernatant. 8. Připrav ředění TURBO DNase 49 l MagMAX TURBO DNase Buffer + 1 l TURBO DNase (množství na 1 reakci). Štepení DNA a čištění RNA 1. Přidej 50 l TURBO DNasy a míchej min. při pokojové teplotě (bez magnetu!). 2. Přidej 100 l RNA Rebinding Solution, míchej 3 minuty. 3. Dej do magnetu a nech dokud se magnetické partikule s RNA neusadí (cca 2-3 minuty), poté opatrně odstraň supernatant. 4. Omyj 2x 150 l Wash solution 2 a dej míchat. 5. Dej do magnetu a nech dokud se magnetické partikule s RNA neusadí (cca 2-3 minuty), poté opatrně odstraň supernatant. 6. Vysuš Beads mícháním 2 minuty. 7. Přidej 50 l Elution buffer a míchej 3 minuty. 8. Dej do magnetu a nech dokud se magnetické partikule s RNA neusadí (cca 2-3 minuty), poté supernatant s mrna přepipetuj do zkumavky pro další použití. 9. Změř vyizolovanou RNA na nanodropu. Reverzní transkripce High Capacity RNA-to-cDNA Kit (PN ) Použij až 2 g celkové RNA do 20 l reakce Nech kit rozmrznout na ledu, na reakci :

17 OPVK Praktický kurz, x RT buffer 20x RT Enzyme mix Nuclease free H20 Vzorek 10 l 1 l do 20 l až 9 l 1. Rozpipetuj reakční směs do zkumavek. 2. Uzavři zkumavky. 3. Stoč a dej na led. 4. Naprogramuj thermal cycler: a. Krok 1 37 C 60min. b. Krok 2 95 C 5min. c. Krok 3 4 C do nekonečna 5. Nastav objem reakce na 20 l. 6. Vlož stripy do cykleru. 7. Spusť. 8. Po ukončení reverzní transkripce přečistíme cdna pomocí QIAquick Nucleotide Removal Kitu (Quiagene, 28306). 9. Změříme koncentraci cdna na nanodropu. Uložení do 24hod. 2-8 C, dlouhodobě -15 až -25 C qrt-pcr na AB 7300 Příprava PCR reakce SYBR Select Master Mix Připrav cdna, pro optimální q-pcr použij množství cdna do 100ng na 20 l vzorek. Promýchej SYBR Select Master Mix před použitím. Pro optimální výsledky je doporučeno provést reakci ve čtyřech opakováních. Reakce pro 96-ti jamkovou desku: SYBR Select Master Mix Primery ( nM) 10 l

18 OPVK Praktický kurz, 2013 cdna template (10 a 100ng) Celkem 20 l Zamíchejte a opatrně stočte, aby byl vzorek bez bublin. Přeneste na PCR desku a uzavřete PCR vršky, lehce stočte, aby ve vzorcích nebyly bublinky (vlastní PCR by se měla jet do 72 hodin, vzorky uchovávejte ve tmě). Dejte do termocykleru AB Nastavte PCR reakci dle teploty tání (Tm) vašich primerů. 1. Aktivace - Hold 50 C 2 min. 2. Aktivace polymerázy Hold 95 C 2 min cyklů Denaturace 95 C 15 sec. 4. Anneal/Extend 60 C 1 min. Nastavte dissociační krok. Nastavte objem reakce na 20 l. Spusťte run

19 OPVK Praktický kurz, 2013 Kapitola 3: Transformace, selekce a kultivace bakterií, izolace plazmidové DNA restrikční analýza Garant: Petr Šebest Transformace, selekce a kultivace bakterií Princip úlohy: Transformace je přenos DNA (v našem případě se jedná o plazmidovou DNA) do hostitelských bakteriálních buněk. Bakteriální buňky musejí být nejprve uvedeny do stavu kompetence, ve kterém jsou schopny cizorodou DNA přijmout. Stav kompetence lze u buněk Escherichia coli navodit působením chloridu vápenatého za nízké teploty (0 C). Po přidání DNA a zahřátí na 42 C a následném ochlazení na 0 C (teplotní šok) přechází transformující DNA do buněk. Transformované buňky se selektují na agarových plotnách obsahujících příslušné antibiotikum. Vyselektované buňky se přeočkují do média s antibiotikem a inkubují se přes noc při teplotě 37 C. Úspešnost transformace je udávaná 1x10 9 cfu/µg superhelikální DNA. Pracovní postup: 1. den: 50 min. - 3 hod. přestavka 10 min. 2. den: 15 min. Po celou dobu pracujte sterilně a se sterilním materiálem (špičky, hokejky, ependorfky). 1. Kompetentní buňky E. coli TOP10 udržujte na ledu a napipetujte do ependorfky 10 µl. 2. Přidejte příslušnou DNA (500 ng) pbsk nebo ppgm1. 3. Nechejte 30 min. na ledu. 4. Rozehřejte termoblok na 42 C. 5. Transformace teplotním šokem: 45 sec. na 42 C a poté 5 min. na ledu. 6. Nechejte termoblok zchladnout na 37 C. 7. Přidejte 50 µl SOC média a nechejte kultivovat na termobloku 3 hod. při 37 C a 400 rpm

20 OPVK Praktický kurz, Vysejte na misky s Amp (napipetovat na misku a rozetřít hokejkou). 9. Inkubujte přes noc v termostatu při 37 C. 10. Z nejlepší kolonie odebrat špičkou buňky a přeočkovat do tekutého média s Amp, inkubujte na třepačce do druhého dne při 37 C

21 OPVK Praktický kurz, 2013 Izolace plazmidové DNA a restrikční analýza Princip úlohy: Plazmidy jsou mimochromozómové genofory tvořené kružnicovou dsdna. V bakteriálních buňkách se vyskytují v jedné až několika tisících kopií na buňku a jsou snadno dostupným zdrojem homogenní DNA. V přirozeném stavu v buňce mají plazmidy zpravidla negativní nadšroubovicové vinutí. Pro izolaci plazmidů pbluescript a ppgm1 použijeme metodu alkalické lýze s přídavkem SDS (Invisorb Spin Plazmid Mini Two kit), která vede k uvolnění vnitřního obsahu buněk. Plazmidová DNA, chromozomální DNA a proteiny jsou denaturovány a v dalším kroku dochází k jejich precipitaci kromě plazmidové DNA, která je renaturována a zůstává v roztoku. Následně je zachycena na koloně a nakonec uvolněna elučním pufrem. Pro další analýzy plazmidů použijeme restrikční endonukleázy. Restrikční endonukleázy jsou součástí tzv. restrikčně modifikačních mechanismů bakterií. Tento systém je zajišťován dvěma druhy enzymových aktivit metylační a restrikční. Enzymy s metylační aktivitou specificky modifikují (metylují) vlastní buněčnou DNA, čímž ji chrání před degradací restrikčními enzymy. Restrikční endonukleázy jsou bakteriemi využívány ke štěpení cizorodé DNA, která není v příslušných sekvencích metylována. Restrikční endonukleázy rozpoznávají krátké sekvence dvouřetězcové DNA a štěpí ji ve specifických místech nebo poblíž nich. V našem případě použijeme RE PvuII, která štepí námi izolovanou DNA ve 2 místech, takže získáme 2 fragmenty. Obr.: Plazmidy použité při transformaci

22 OPVK Praktický kurz, 2013 Pracovní postup: 3. den: 3 hod ml bakteriální kultury přenést do mikrocentrifugační zkumavky (ependorfky). 2. Centrifugujte v ependorfce 1 min rpm a odlijte supernatant. 3. Rozsuspendujte pelet v 250 µl roztoku A vortexováním nebo pipetováním, tak aby nebyly viditelné žádné shluky buněk. 4. Přidejte 250 µl roztoku B, a zamíchejte opatrně otočením ependorfky 5 krát (ne však déle než 5 minut). Nevortexovat! 5. Přidejte 250 µl roztoku C a zamíchejte jemně ale důkladně zatřepáním 4 až 6krát. Centrifugujte 5 minut při otáčkách rpm. Nevortexovat! 6. V průběhu centrifugace si připravte čisté ependorfky a umístěte do nich vazebnou kolonu. 7. Přelijte supernatant na kolonu a inkubujte 1 min. Centrifugujte 1 min. při rpm. 8. Vylijte filtrát a přidejte 750 µl promývacího roztoku (wash solution). Centrifugujte 1 min. při rpm. Vylijte filtrát. 9. Stočte 3 min. při rpm, aby došlo ke kompletnímu odstranění zbytkového etanolu. 10. Umístěte kolonku do nové ependorfky a přidejte µl elučního pufru. Inkubujte 1 min. (až 10 min.) při pokojové teplotě a nechejte centrifugovat 1 min rpm. 11. Změřte koncentraci DNA na nanodropu µg superhelikální DNA napipetujeme do čisté zkumavky. 13. Přidejte 1/10 objemu pufru z celkového výsledného objemu pro danou RE a 2U RE PvuII a vodu do výsledného objemu 20 µl. 14. Promýchejte a dejte na 37 C/1 hodinu. 15. V mezičase připravte 1,3% agarózový gel s 1x TAE pufrem. 16. Naneste vzorky na agarózový gel 10 µl + 1ul nanášecího pufru. 17. Zapněte elektroforézu na 100 V na 45 minut

23 OPVK Praktický kurz, 2013 Kapitola 4: Detekce strukturních přechodů v DNA pomocí CD spektroskopie Garant: Iva Kejnovská Princip a cíl: Spektroskopická metoda cirkulárního dichroismu (CD) je velmi citlivá ke vzájemné orientaci bazí ležících nad sebou ve šroubovici nukleových kyselin. Jednotlivé struktury poskytují charakteristická spektra CD. Postupným přidáváním činidel je možné vyvolat přechod z jedné uspořádané struktury do druhé. Kooperativnost přechodu spočívá v tom, že v úzkém rozmezí měnících se podmínek dojde ke změně natočení bazí a přitom je překonána energetická bariéra mezi lokálními enegetickými minimy. Příkladem kooperativního přechodu je přechod mezi dvoušroubovicí formy B do formy A působením dehydratačního účinku trifluoretanolu (TFE). V závislosti na primárním složení DNA, tedy na obsahu bazí, je možné vyvolat stejným činidlem přechod do jiné stuktury. Ve druhé úloze s DNA složenou z opakující se CG sekvence působením TFE dojde k přechodu do levotočivé formy Z. I. B-A přechod Pracovní postup: (120 minut) 1. Do křemenné kyvety s optickou dráhou 1 mm napipetujte 60 l připraveného heteroduplexu DNA: GCGGCGACTGGTGAGTACGC. GCGTACTCACCAGTCGCCGC a přidejte 90 l 100% TFE. Opatrně promíchejte a změřte CD spektrum. 2. V programu zadejte v General rozmezí vlnových délek nm, krok 0,5 nm, s rychlostí posuvu 100 nm/min, 3 akumulace. Dále zvolte Information a do Sample name vepište název ukládaného souboru, např. T

24 OPVK Praktický kurz, Během měření vypočítejte koncentraci přidaného TFE dle vzorečku: V 1 c 1 = V 2 c 2 : V 1 - přidaný objem TFE, c 1 - % koncentrace přidanéhotfe, V 2 - celkový objem v kyvetě c 2 - je koncentrace TFE v kyvetě 4. Pokračujte v přidávání TFE podle tabulky a měřte jednotlivá CD spektra s názvy Tn. Přídavek TFE Suma přidaného Celkový objem Koncentrace TFE Název CD spektra l] TFE l] v kyvetě l] [%] Výsledek 1: poslední CD spektra odpovídají DNA ve formě A, výchozí formě B. II. B-Z přechod Pracovní postup: (120 minut) 1. Do křemenné kyvety s optickou dráhou 1 mm napipetujte 56 l zásobního roztoku oligonukleotidu (CG) 4 a přidejte 84 l 100% TFE. Opatrně promíchejte a změřte CD spektrum. 2. V programu zadejte v General rozmezí vlnových délek nm, krok 0,5 nm, s rychlostí posuvu 100 nm/min, 3 akumulace. Dále zvolte Information a do Sample name vepište název ukládaného souboru, např. Z

25 OPVK Praktický kurz, Během měření vypočítejte koncentraci přidaného TFE dle vzorečku: V 1 c 1 = V 2 c 2 : V 1 - přidaný objem TFE, c 1 - % koncentrace přidanéhotfe, V 2 - celkový objem v kyvetě c 2 - je koncentrace TFE v kyvetě 4. Pokračujte v přidávání TFE podle tabulky a měřte jednotlivá CD spektra s názvy Zn. Přídavek TFE Suma přidaného Celkový objem Koncentrace TFE Název CD spektra l] TFE l] v kyvetě l] [%] Výsledek 1: poslední CD spektra odpovídají DNA ve formě Z, výchozí formě B. Seznam potřebného vybavení a chemikálií: dichrograf křemenné kyvety oligonukleotidy trifluoretanol

26 OPVK Praktický kurz, 2013 Kapitola 5: Aplikace elektrochemické analýzy v kombinaci s redox značením pro detekci specifických sekvencí a genové exprese Garant: Jan Špaček Princip a cíl: Detekce hybridizace DNA (analýza nukleotidových sekvencí) a analýza genové exprese patří mezi důležité úkoly moderní molekulární diagnostiky. Elektrochemické metody mohou hrát významnou roli ve vývoji nových detekčních technik v této oblasti. DNA je elektroaktivní biopolymer poskytující na různých pracovních elektrodách řadu analyticky využitelných signálů. V některých případech se jeví jako výhodnější přístup využití značení DNA elektroaktivnímy značkami, které poskytují vlastní elektrochemické signály. Aplikace těchto značek v analýze nukleotidových sekvencí je zvláště výhodná, neboť umožňuje velmi selektivně detekovat cílovou DNA (specifickou DNA) v nadbytku ostatní (nespecifické DNA). Jednou z metod, jak připravit takto značenou DNA je inkorporace chemicky modifikovaných nukleotid trifosfátů do DNA pomocí Polymerázové řetězové reakce (PCR). Tato úloha bude zaměřena na přípravu DNA obsahující 7-deazaguanin (dg*) a 7-deazaguanin modifikovaný nitrofenylem v poloze 7 (dg NO2 ) pomocí PCR a jejich následnou elektrochemickou detekci. dg*tp H 2 N HN O N N dg NO2 TP H 2 N HN O N N NO 2 HO O P O - O O P O - O O P O - O O HO O P O - O O P O - O O P O - O O OH OH

27 OPVK Praktický kurz, 2013 Pro procvičení před začátkem úlohy doplňte obrázek pojmy z tabulky: 5 elongace templát 5 polymeráza dntp 3 annealing 3 primer PCR Každá skupina připraví dvě reakční směsi. 1. Reakční směs: PCR s dg NO2 TP Reakční směs o celkovém objemu 100 µl bude obsahovat: 1 ng/µl templátové DNA (bluescript = plazmidová DNA) 3 U Pfu polymerázy 1x Pfu pufr 1 µm primery 0,2 mm datp, dctp, dttp 0,1 mm dgtp a 0,1 mm dg NO2 TP nebo 0,2 mm dgtp (kontrolní vzorek) 2. Reakční směs: PCR s dg*tp Reakční směs o celkovém objemu 100 µl bude obsahovat: 1 ng/µl templátové DNA (cdna připravená v předchozí úloze) 3 U Pfu polymerázy 1x Pfu pufr 1 µm primery

28 OPVK Praktický kurz, ,2 mm datp, dctp, dttp 0,1 mm dgtp a 0,1 mm dg*tp nebo 0,2 mm dgtp (kontrolní vzorek) Takto připravené směsi rozdělte do malých, 200 µl, zkumavek po 30 µl. Reakční směsi v 200 µl zkumavkách umístěte do thermocycleru a spusťte program: 30 cyklů: Denaturace: 94 C, 90 s Nasedání primerů: 60 C, 30 s Prodlužování řetězců: 72 C, 180 s Počítací úloha Spočítejte, kolik kusů datp je v každé 200 µl zkumavce (N A = 6, mol -1 ) a jakou hmotnostní koncentraci mají oba primery dohromady v 30 µl výše popsané reakční směsi (délka 20 bazí, průměrná hmotnost 330 g mol -1 ). datp = koncentrace primerů = Analýza PCR produktů na agarózovém gelu: Úspěšnost reakce zjistíme pomocí elektroforézy v 1 % agarózovém gelu (100 V / 30 min, 1x TAE pufr), následným obarvením gelu v ethidium bromidu a vyfocením po ozáření UV světlem. Přečištění produktů PCR Produkt PCR je po dokončení reakce stále ve směsi s přebytkem nukleotidů a primerů, které by zhoršily elektrochemickou analýzu. Proto je nutné provést přečištění. To provedeme PCR purification kitem od firmy Qiagen podle standardního protokolu, který je součástí kitu

29 OPVK Praktický kurz, 2013 Elektrochemické měření 1) PCR produkty značené dg*: Analýza bude prováděna pomocí adsorptivní přenosové rozpouštěcí square wave voltametrie na tužkové uhlíkové elektrodě v 0,2 M acetátovém pufru ph 5. Parametry měření: doba akumulace: 1 min počáteční potenciál: 0,3 V konečný potenciál: 1,5 V frekvence: 200 Hz 2) PCR produkty značené dg NO2 : Analýza bude prováděna pomocí adsorptivní přenosové rozpouštěcí cyklické voltametrie na visící rtuťové kapkové elektrodě ve 0,3 M fosfátovém pufru s mravenčanem amonným ph 7. Parametry měření: doba akumulace: 1 min počáteční potenciál: 0 V potenciál bodu obratu: -1,85 V a -0,75 V konečný potenciál: 0 V a 0,1 V rychlost posuvu potenciálu: 1 V/s

30 KLASICKÉ A ALTERNATIVNÍ METODY STUDIA STRUKTURY A INTERAKCÍ BIOMOLEKUL návody ke cvičením Václav Brázda Vydal: Biofyzikální ústav Akademie věd České republiky, v.v.i., Královopolská 135, Brno, Česká republika Brno 2013 Česká Republika První vydání ISBN:

31

32

33

34

35 Labolatoř molekulárních komplexů chromatinu CEITEC a Přírodovědecká fakulta, Masarykova univerzita 1. praktický Kurz pokročilých mikroskopických technik března 2013 Praktické seznámení s pokročilými mikroskopickými technikami, které jsou využitelné v laboratořích se zaměřením na experimentální biologii, biochemii a biofyziku. Budou představeny Pokročilé mikroskopické techniky FRAP, FLIM, FRET, FCS Účastníci se seznámí s konfokální mikroskopií a jejím využití pro in vivo experimenty a mikroskopii v reálném čase Místo konání Brno, Univerzitní kampus Bohunice, blok A2, seminární místnost 2.11 praktická výuka bude probíhat v laboratořích UKB Přihlášení Zájemci se přihlásí prostřednictvím u na Ctirad Hofr, Ph.D. Seminář je organizován v rámci projektu OP VK Rozvoj moderních trendů v experimentální biologii: význam biomolekulárních interakcí pro funkci buněčných struktur CZ.1.07/2.3.00/

36 Kurz pokročilých mikroskopických technik MU Brno březen 2013 teoretický blok oběd praktický blok Pondělí Úvod do pokročilých metod konfokální mikroskopie, přístrojové vybavení, organizace kurzu Praktické seznámení s konfokálním mikroskopem Tipy a triky pro optimální nastavení pozorování vzorků Úterý Využití časově rozlišené fluorescence FLIM v mikroskopii biologických preparátů Příprava vzorků pro měření za použití FLIM Vyhodnocení doby dohasínání fluorescence u preparátů Nejčastější chyby začátečníků Středa Čtvrtek Principy a přístrojové vybavení pro provedení experimentů metodami FRAP a FRET Kvantitativní studium interakce biomolekul za použití fluorescenční korelační spektroskopie FCS Příprava vzorků pro měření za použití metody FRAP a FRET Vyhodnocení výsledků měření FRAP za použití software ImageJ Příprava preparátů pro měření za použití fluorescenční korelační spektroskopie Základní nastavení pro FCS měření in vitro

37 OSNOVA UV-light mediated emission POKROČILÉ METODY STUDIA BIMOLEKULÁRNÍCH INTERAKCÍ únor Fluorescence a fluorescenční molekuly Martin Chalfie 2. Epifluorescence a konfokální mikroskopie Osamu Shimomura 3. Fluorescenční molekuly a jejich vlastnosti Roger Y. Tsien 2008 Nobel prize 4. FRAP, FLIP 5. FCS, FLIM, FRET FLUORESCENCE JABLONSKI DIAGRAM Vlastnost molekul: e - absorbují photony and tím získávají energii Část této energie je emitována jako fluorescence Emise probíhá v delších vlnových délkách než excitace AUTOFLUORESCENCE chlorofyl, karotenoidy, proteiny (Trp, Tyr, Phe), DNA SPECIFICKÁ FLUORESCENCE fluorofory fúzované s proteiny (GFP) nebo s DNA, sloučeniny a barviva interkalující se do DNA a biologických membrán atd. FLUORESCENČNÍ MOLEKULY a jejich vlastnosti Fluorofory polyaromaticke a heterocyklické sloučeniny Fluorescence lifetime čas, po který fluorofor zůstává v excitovaném stavu než předá/emituje foton (fluorescence lifetime imaging) (EPI)FLUORESCENČNÍ MIKROSKOPIE Cyklický proces, destrukce fluoroforu asociovaná s neradioaktivním rozkladem 4 Quantum Yield - poměr mezi emitovanými a absorbovanými fotony, hodnota by měla být co nejvyšší na škále 0-1 (GFP 0,7) FITC (fluorescein isothiokyanát) - maximum emise mezi nm Hoechst (bisbenzimid) - barví DNA. DAPI - váže se na DNA a RNA (barví se modře). Ethidium bromid - váže se na dvouřetězcovou DNA a RNA (svítí oranžově). Propidium Jodid - Barví DNA (červeně). Akridinová oranž - váže se na DNA (barví se zeleně) a RNA (barví se tmavě červeně). Congo Red - váže se na amyloid (barví se růžově) 6 1

38 FLUORESCENCE IN VIVO FLUORESCENČNÍ PROTEINY GFP green fluorescent protein Izolovaný z Aequorea victoria Společně s proteinem aequorin přeměňuje Ca2+ - závislou chemiluminiscenci na fluorescenci Ser65, Tyr66, Gly67 Sbaluje se do barelové struktury stabilizující celou molekulu FLUORESCENČNÍ PROTEINY CFP - ECFP - Cerulean BFP - EBFP YFP-EYFP-Venus Genetické inženýrství doba potřebná pro maturaci GFP je asi 6 hod 8 FLUORESCENČNÍ PROTEINY Pro experiment s více FP, emisní a excitační spektra musí být dobře separována Pro některé pokročilé mikroskopické techniky se spektra použitých molekul musí překrývat FRET, FRET-FLIM 9 FLUORESCENČNÍ PROTEINY =en cs&u= s/pagfpchroma/index.html Fotoaktivovatelné a proteiny s ON/OFF módem fluoreskují až po aktivaci UV světlem KONFOKÁLNÍ MIKROSKOPIE 12 PA-mRFP, PA-mCherry..etc

39 Organely rostlinné buňky Základní aplikace konfokalní mikroskopie je získání a analýza obrazu ZÁKLADNÍ APLIKACE POKROČILÉ TECHNIKY KONFOKÁLNÍ MIKROSKOPIE posouvají rozlišení mikroskopie do oblastí, kde rozdíly nejsou detekovatelné okem mikrospektroskopie kombinují výhody analýzy vzorků v kyvetě spektroskopicky (přesnost, vysoké rozlišení i při relativně nízkých koncentracích) a mikroskopie (sledování dynamiky jevů in vivo, tj. přímo v živém materiálu) výsledkem experimentu není obrázek, ale naměřené hodnoty Fluorescenční molekuly a jejich vlastnosti Quenching (zhášení) dynamic-, static-, self-, colormění intenzitu fluoroforu a někdy snižují lifetime Photobleaching opakovaná excitace a emise Resonance Energy transfer Foster 1940, neradioaktivni přenos energie mezi excitovaným fluoroforem (donor) a dalším fluoroforem, jehož excitační spektrum leží v oblasti emisního spektra donoru (akceptor) POKROČILÉ TECHNIKY Time-lapse microscopy (mikroskopie v čase) základ pro všechny ostatní pokročilé techniky FRAP/iFRAP (Fluorescence Recovery After Photobleaching) FLIP (Fluorescence Loss in Photobleaching) FLAP (Fluorescence Localisation after photobleaching) FRET (Fluorescence Resonance Energy Transfer) FRET-FLIM (FRET Lifetime imaging) FCS (Fluorescence Correlation Spectroskopy) a další FRAP FRAP/iFRAP Technika vyvinuta v 1970s, Axelrod et al Původně pro studium difúzních koeficientů molekul Dnes využíváno v buněčné biologii pro: měření difúze a pohybu molekul v buňce sledování kompartmentalizace a propojení uvnitř buněk sledování pohybu/výměny molekul mezi jednotlivými kompartmenty určení vazebných vlastností molekul KAM, ODKUD, JAK RYCHLE 3

40 FRAP (fluorescence recovery after photobleaching) FRAP (fluorescence recovery after photobleaching) FRAP/iFRAP Princip: lazer o vysoké síle vypálí (vybělí) fluorescenční molekuly v místě zájmu, jde o pulz světla Návrat molekul~obnovení fluorescence~dynamika proteinu FRAP nastavení mikroskopu Software Rozlišení Rychlost skenování Efektivita vysvícení FRAP experiment vyhledání objektu zájmu nastavení parametru mikroskopu výběr a označení regionu zájmu, nastavení času, po který je nutno experiment provádět nastavenení fluorescenčního pozadí, hladiny vysvícení vzorku v důsledku skenování korekce pohybu, ztráty roviny zaostření, schopnosti detekvat daný jev jevy velice pomalé vs velice rychlé

41 FRAP vyhodnocení FLIP (Fluorescence loss in photobleaching) Princip metody podobný jako u FRAP region je vysvěcován opakovaně v čase, zatímco a změny fluorescence jsou sledovány v okolních regionech. APLIKACE-FLIP sledování pohybu mrna v buňce Aplikace FLAP - sledování organizace chromatinu při dělení ÚLOHA 1. Popsat fluorescenci v různých částech rostlin u 3 neznámých vzorků 2. Provézt FRAP u vzorku 1 a 2 3. Pokusit se odhadnout o jaké vzorky se jedná Výsledky-vzorek 1 Gerlich et al, Cell

42 Výsledky vzorek 2 Vzorek 3 POKROČILÉ TECHNIKY KONFOKÁLNÍ MIKROSKOPIE posouvají rozlišení mikroskopie do oblastí, kde rozdíly nejsou detekovatelné okem mikrospektroskopie kombinují výhody analýzy vzorků v kyvetě spektroskopicky (přesnost, vysoké rozlišení i při relativně nízkých koncentracích) a mikroskopie (sledování dynamiky jevů in vivo, tj. přímo v živém materiálu) výsledkem experimentu není obrázek, ale naměřené hodnoty POKROČILÉ TECHNIKY Time-lapse microscopy (mikroskopie v čase) základ pro všechny ostatní pokročilé techniky FRAP/iFRAP (Fluorescence Recovery After Photobleaching) FLIP (Fluorescence Loss in Photobleaching) FLAP (Fluorescence Localisation after photobleaching) FRET (Fluorescence Resonance Energy Transfer) FRET-FLIM (FRET Lifetime imaging) FCS (Fluorescence Correlation Spectroskopy) a další 32 FRET Fluorescence (Foster s) Resonance Energy Transfer Kolokalizace vs interakce Rozlišení v desítkách nm (mikroskop 200nm) Neradioaktivní přenos energie (Polarisation anizotropy) Sensitized emission Acceptor bleaching Fluorescence lifetime imaging FRET - prerekvizity Vzdálenost mezi donorem a akceptorem je minimální (2-10nm) Excitační a emisní spektra akceptora a donora se překrývají Ideální FRET fluorescenční páry: původně nejčastěji používané CFP/YFP mtfp1/eyfp (long fluorescence lifetime, decay fitted to single exponent, no photoconversion) mrfp/egfp, msrawberry/egfp, ECFP/EGFP Molekuly mají stejně orientované dipólové momenty Pro některé pokročilé mikroskopické techniky se spektra použitých molekul musí překrývat FRET, FRET-FLIM FRET - parametry Účinnost FRET E frakce energie, která se přenese na akceptor při jedné excitační události (kvantový výtěžek,počet událostí vztažených na 1 foton absorbovaný systémem) E= kvantum energie přenesené donoru na akceptor po excitaci celkové množství energie absorbované donorem Kritická vzdálenost (radius) R0 vzdálenost mezi donorem a akceptorem když je účinnost FRET 50% 6

43 FRET FRET-aplikace METODY MĚŘENÍ FRET POMOCÍ MĚŘENÍ INTENZIT FLUORESCENCE Sensitised emission Měření intenzity fluorescence donoru a akceptoru mikroskopicky (konfokální, epifluorescenčním) Závislé na koncentraci akceptoru a donoru Nutno korigovat - prosvěcování fluorescence donoru do detekčního kanálu akceptoru - excitaci akceptor při excitaci donoru Acceptor photobleaching Intenzita akceptoru a donoru je měřena před a po aplikaci silného pulzu lazeru, který vysvítí akceptor Výsledkem je zvýšení intenzity fluorescence donoru Nutno povádět na fixovaném materálu aby se omezila difuze vzorku Spectral imaging Měření spekter jednolivých fluoroforů použitých pro FRET Umožňuje kvantitavní analýzu FRET namísto pouhé vizualizace intensity wavelength before pb after pb METODY MĚŘENÍ FRET POMOCÍ FLIM FRET-FLIM FRET-FLIM LIFETIME= průměrný čas po který molekula zůstává v excitovaném stavu. FRET by lifetime Stanovujeme fluorescence lifetime donoru Přítomnost akceptoru může signifikantně tento parametr měnit Měření signálu donora Výsledek není ovlivněn koncentrací molekul ve vzorku, vysvěcováním či intenzitou signálu Přídatná relaxační dráha která způsobí, že se excitovaná molekula dříve zbaví svojí přebytečné energie 7

44 FLIM požadavky TCSPC (time correlated single photon counting modul) Pulzní lazer- umožnuje dávkování fotonů na detektor v čase V několika časových intervalech dochází ke sběru fotonů na detektoru, získáme histogram vyjadřující úbytek fluorescence v čase, z něhož je přímo počítám fluorescence lifetime Analýzuje me rozložení fotonů pro každý pixel ve vzorku a místa, kde prpobíhá FRET Modely: 1 komponenta 2 komponenty a více FLIM shows a decrease in fluorescence lifetime of the donor (CFP) upon interaction with an acceptor ( YFP) Název prezentace v zápatí 45 8

45 ÚLOHA Pozorování preparátu 1. Vložte vzorek do mikroskopu a pomocí procházejícího světla a okuláru s malým zvětšením, najděte rovinu zaostření 2. Pokud máte zaostřeno, pod filtrem pro GFP zkontrolujte hladinu exprese ve vzorku. 3. Přepněte na zvětšení 40-60x, doostřete 4. Přepněte software na konfokální mode 5. Pomocí SMART setup nastavte konfokální snímání pro detekci GFP a mcherry 6. Snažte se získat co nejlepší obraz v obou kanálech 7. Posuďte, zda jde o pozadí, signál, posuďte jeho intenzitu 8. Prohlédněte si, jak vypadá se GFP signál v kořeni, hypokotylu, listu 9. Posuďte, zda se GFP lokalizuje do nějakých konkrétních kompartment buňky a zda se toto liší v různých částech rostlinného materiálu FRAP: 10. Začněte skenovat vzorek a pořádně si prohlédněte rozložení fluorescence ve vzorku 11. Popřemýšlejte, na co se díváte. Vidíte buňky ANO NE membrány ANO NE jádra ANO NE jadérka ANO NE chloroplasty ANO NE mitochondrie ANO NE Otázka: Pokud si myslíte, že se díváte na membránu, jádro, jak byste to ověřili. 12. Vyberte si jednu malou část uvnitř buňky např. uvnitř jádra či cytolazmy 13. Vyberte si pro FRAP co nejmenší region a sledujte, jak vypadá návrat fluorescence 14. V několika po sobě jdoucích experimentech postupně zvětšujte region zájmu pro vysvícení a pozorujte návrat fluorescence 15. Nakonec vyberte celou buňku a vysviťte a sledujte návrat fluorescence. 16. Měňte nastavení mikroskopu gain, laser power, resolutiona, sledujte, jak to ovlivňuje výsledek vašeho experimentu

46 Manual for a course in advanced microscopic techniques, March 2013: - Introduction to Zeiss es LSM780 confocal microscope with a spectral detector (GaAsP spectral detector) - Visualization of Alexa Fluor 488-phalloidin-stained actin cytoskeleton in HEK293T cells (human embryonic kidney cells) with the use of different: lasers: argon-ion laser, tunable laser (In Tune) pinhole size voltage on photomultiplier tubes (PMTs) offset digital gain averaging - lecture about fluorescence correlation/cross correlation spectroscopy, FCS/FCCS - preparation of dilutions of fluorescent dyes: Alexa Fluor 488, Alexa Fluor 633, in concentrations: 200 nm, 100 nm, 50 nm, 20 nm - measuring dynamics of fluorescent particles in solutions, in glass chamber slides, with the use of argon-ion/he-ne lasers and GaAsP detector calibration experiment.

47 MODERNÍ BIOFYZIKÁLNÍ METODY: POKROČILÉ PRAKTICKÉ VZDĚLÁVÁNÍ V EXPERIMENTÁLNÍ BIOLOGII Operační program Vzdělávání pro konkurenceschopnost Číslo projektu: CZ.1.07/2.3.00/ Praktický kurz pokročilých metod experimentální biologie konaný na Katedře biologie a ekologie Přírodovědecké fakulty Ostravské univerzity v Ostravě v termínu

48 Program praktického kurzu Čtvrtek Pátek Pondělí Úterý Středa Identifikace mikroorganismů izolovaných ze vzorků potravin s využitím systému Biolog GEN III MicroLog M Bakteriální identifikace s využitím souprav MIKRO-LA-TEST; Hodnocení růstu mikrobiálních kultur automatizovaným systémem BIOSCREEN C Detekce apoptózy pomocí ELISA kitu. Jednobuněčná gelová elektroforéza (kometový test) Biochemická analýza proteinů krevního séra pomocí gelové elektroforézy.

49

50 Identifikace mikroorganismů izolovaných ze vzorků potravin s využitím systému Biolog GEN III MicroLog M Identifikační systém Biolog GEN III MicroLog M slouží k identifikaci mikrobiologických kultur na základě přesných patentovaných biochemických testů, provedených v 96 jamkových destičkách (obr. 1).V kombinaci s širokou databází mikroorganismů se jedná o jeden z nejpřesnějších systémů mikrobiální identifikacea umožňuje identifikaci aerobních bakterií. Pomocí tohoto systému je možné v jednom testu stanovit jak grampozitivní, tak gramnegativní bakterie. Každá mikrodestička GEN III obsahuje 94 biochemických testů: 71 testů utilizace zdroje uhlíku (obr. 2, sloupce 1-9) a 23 senzitivních chemických testů (obr. 2, sloupce 10-12). Jamky, kolorimetricky indikující využití zdroje uhlíku, obsahují tetrazoliové redoxní barvivo. Před provedením inkubace jsou všechny jamky mikrodestičky bezbarvé. V případě pozitivní reakce dochází během inkubace k redukci tetrazoliového barviva a viditelné změně zbarvení jamky (tvorba fialového zbarvení). Jamka A-1 (obr. 2) představuje negativní kontrolu (bez zdroje uhlíku). Mikrodestička obsahuje také pozitivní kontrolu (obr. 2, jamka A- 10), tato jamka je srovnávána s výsledky chemických zkoušek v sloupcích Po inkubaci jsou zjištěné výsledky (pozitivní, negativní reakce) vyhodnocovány pomocí softwaru, jež je součástí identifikačního systému Biolog. Mezi nesporné výhody této metody patří získaní výsledků identifikace už od 3 hod., což dovoluje vyhodnotit získané výsledky během jednoho bloku cvičení. Jednou z možností aplikace tohoto identifikačního systému je jeho využití pro určení vykultivovaných rodů a druhů mikroorganismů z vybraných vzorků potravin. Způsob odběru vzorků z potravin k mikrobiologickému zkoušení a postupy mikrobiologického zkoušení se stanoví podle příslušných technických norem (v případě použití jiných metod musí být jejich validací doloženo, že jsou co do citlivosti, správnosti a reprodukovatelnosti výsledků ekvivalentní metodě podle české technické normy). Obr. 1. Ident ifika ční mikr odest ička GEN III Obr. 2. Rozvržení biochemických testů na mikrodestičce GEN III

51 Materiál: A. Odebrané vzorky potravin na mikrobiologický rozbor B. Média a chemikálie Maximum Recovery Diluent- ředicí roztok Violet Red Bile Glucose Agar w/o Lactose Violet Red Bile Agar 1,2% Nutrient Agar 1,5% Tryptone Yeast Extract Agar w/ BCP Oxidase Discs (50 discs / vl) Mikrodestičky GEN III Turbidity Standard Biolog Universal Growth (BUG) Agar Inoculating Fluid (IF) C. Laboratorní vybavení: Petriho misky, očkovací kličky, skleněné tyčinky, zkumavky, stojany na zkumavky, pipety, špičky, mikropipety, 8-multikanálová mikropipeta, ochranné rukavice, homogenizátor, váhy, termostat, autokláv, horkovzdušný sterilizátor, vodní lázeň, ph metr, spektrofotometr, kahan. Referenční kultury(doporučené výrobcem):

52 Escherichia coli(atcc 11775) Paenibacillus polymyxa (ATCC 842) Staphylococcus epidermidis (ATCC 12228) Stenotrophomonas maltophilia (ATCC 13637) Postup práce: Úkol A. Izolace a stanovení počtu bakterií čeledi Enterobacteriaceae (fermentují glukózu a mají negativní oxidázovou reakci - VČŽG médium- agar s krystalovou violetí, neutrální červení, žlučovými solemi a glukózou). 1. Připravíme řadu desetinásobných ředění ze zkušebního vzorku, je-li výrobek tekutý, nebo z výchozí suspenze v případě ostatních výrobků. 2. Použijeme dvě sterilní Petriho misky. Do každé z nich sterilní pipetou přeneseme po 1 ml vzorku. Tento postup opakujeme s dalšími ředěními. 3. Inokulum v každé Petriho misce přelijeme 10 ml živné půdy (44-47 ºC). Doba, která uplyne mezi ukončením přípravy výchozí suspenze (nebo ředění 10-1 je-li produkt tekutý) a přelitím inokula nesmí přesáhnout 15 min. 4. Inokulum s půdou pečlivě promícháme kolébáním Petriho miskou ve vodorovné poloze a směs necháme utuhnout ponecháním Petriho misek na chladné vodorovné ploše. 5. Po úplném ztuhnutí půdy převrstvíme půdu dalšími 15 ml živné půdy, aby se zabránilo plošnému přerůstání a bylo dosaženo semianaerobních podmínek. Půdu necháme utuhnout. 6. Inokulované plotny obrátíme dnem vzhůru a inkubujeme v termostatu při 37 ºC po dobu 24 h ± 2 h. Hodnocení výsledků a úkoly ke zpracování: Po provedené inkubaci vyberte plotny obsahující méně než 150 charakteristických kolonií a tyto kolonie spočítejte (Charakteristické kolonie jsou růžové až červené nebo fialové, se zónou nebo bez zóny precipitace). Pak náhodně vyberte pět takovýchto kolonií pro subkultivaci pro biochemické konfirmační zkoušky. Subkultivace vybraných kolonií na živný agar rozočkujte všechny kolonie vybrané pro konfirmaci. Tyto plotny inkubujte při 37 ºC po dobu 24 h ± 2 h. Z každé inkubované plotny vyberte dobře izolované kolonie pro biochemické konfirmační testy oxidázová reakce a zkouška fermentace. Oxidázová reakce: s použitím kličky nebo jehly nebo skleněné tyčinky odeberte část dobře izolované kolonie a rozetřete na filtrační papír zvlhčený oxidázovým činidlem nebo na komerčně dostupný disk. Nikl-chromová klička se nesmí použít. Zkouška se považuje za negativní, když barva filtračního papíru neztmavne během 10 s. V případě hotových disků se výsledek hodnotí podle návodu výrobce. Zkouška fermentace kolonie, které poskytly negativní oxidázový test, naočkujte vpichem do zkumavek s glukózovým agarem. Tyto zkumavky inkubujte při 37 ºC po dobu 24 h ± 2 h. Reakce se hodnotí jako pozitivní, když se obsah zkumavky zbarví žlutě. Kolonie, které jsou oxidáza negativní a glukóza pozitivní jsou potvrzeny jako Enterobacteriaceae. Na základě zjištěných výsledků stanovte počet mikroorganismů v mililitru nebo v gramu vzorku z počtu kolonií získaných na vybraných plotnách.

53 U vybraných izolátů proveďte identifikaci mikrobiální kultury pomocí systému Biolog GEN III MicroLog M úkol C. Úkol B. Izolace a stanovení počtu koliformních bakterií (VRBL médium - agar s krystalovou violetí, neutrální červení, žlučovými solemi a laktózou). 1. Připravíme řadu desetinásobných ředění ze zkušebního vzorku, je-li výrobek tekutý, nebo z výchozí suspenze v případě ostatních výrobků. 2. Použijeme dvě sterilní Petriho misky. Do každé z nich sterilní pipetou přeneseme po 1 ml vzorku. Tento postup opakujeme s dalšími ředěními. 3. Inokulum v každé Petriho misce přelijeme 15 ml živné půdy (45 ± 0,5ºC). Doba, která uplyne mezi zaočkováním do Petriho misek a přelitím inokula nesmí přesáhnout 15 min. 4. Inokulum s půdou pečlivě promícháme kolébáním Petriho miskou ve vodorovné poloze a směs necháme utuhnout ponecháním Petriho misek na chladné vodorovné ploše. 5. Po úplném ztuhnutí půdy přelijeme povrch zaočkované půdy ještě 4 ml téže půdy a necháme utuhnout popsaným způsobem. 6. Inokulované plotny obrátíme dnem vzhůru a inkubujeme v termostatu při 30 ºC, 35 ºC nebo 37 ºC po dobu 24 h ± 2 h. Hodnocení výsledků a úkoly ke zpracování: Po provedené inkubaci spočítejte charakteristické kolonie koliformních bakterií v každé misce, ve které nevyrostlo více než 150 kolonií. Charakteristické kolonie jsou fialově červené, o průměru 0,5mm nebo větším, někdy obklopené červenavou zónou precipitované žluče. Na základě zjištěných výsledků stanovte počet mikroorganismů v mililitru nebo v gramu vzorku z počtu kolonií získaných na vybraných plotnách. U vybraných izolátů proveďte identifikaci mikrobiální kultury pomocí systému Biolog GEN III MicroLog M úkol C. Poznámka: Způsob vyjádření nejvyšší mezní hodnoty počtu mikroorganismů (NMH): Způsob vyjádření přípustné hodnoty (PH) A. Množství mikroorganismů v 1 g nebo v 1 ml vzorku vyšetřuje se plotnovými metodami technikou počítání kolonií, jako mikroorganismy se počítají jednotky tvořící kolonie (cfu). B. Požadavek nepřítomnosti mikroorganismů v navážce nebo objemu vzorku určených k vyšetření, jak jsou uvedeny za šikmou čarou po čísle nula (vyšetřuje se naočkováním celé této navážky nebo celého objemu vzorku do příslušné tekuté půdy s následným pomnožením, vyočkováním na plotnové půdy a potvrzením podezřelých kolonií např. negat/25). Ředění: Výchozí suspenze (primární ředění): suspenze, roztok nebo emulze získaná poté, kdy odvážené či objemově odměřené množství výrobku určeného ke zkoušení (nebo odvážené či objemově odměřené množství analytického vzorku z výrobku připraveného)

54 bylo smícháno s devítinásobným množstvím ředicího roztoku a poté, kdy velké částice, pokud byly přítomny, byly ponechány sedimentovat. Další desetinásobná ředění: suspenze nebo roztoky získané smícháním určeného objemu výchozí suspenze s devítinásobným objemem ředicího roztoku a opakováním této pracovní operace s každým takto připraveným ředěním postupně tak, až se získá série desetinásobných ředění vhodná k inokulaci kultivačních půd. Úkol C. Identifikace získaných mikrobiálních izolátů pomocí systému Biolog GEN III MicroLog M 1. Mikrodestičky GEN III a inokulační roztok ponecháme před zahájením experimentu vytemperovat při pokojové teplotě. 2. Z čisté 24h kultury (připravené přeočkováním kultury na živném médiu BUG) připravíme pomocí inokulačního roztoku (IF) suspenzi tak, aby hustota buněk odpovídala 90-98% T. Před přípravou inokula nezapomeneme provést kalibraci přístroje. 3. Multikanálovou pipetou napipetujeme do všech jamek mikrodestičky 100 µl inokula. V tomto kroku je nutné pracovat velmi pečlivě. 4. Destičku inkubujeme v termostatu při 33 ºC po dobu 3-36 h. Hodnocení výsledků a úkoly ke zpracování: Po inkubaci vyhodnoťte jamky sloupců 1-9. Výsledky jednotlivých zkoušek porovnejte s negativní kontrolou (jamka A-1). Pokud zjištěný výsledek odpovídá této kontrole, označte reakci jako negativní (-). Pokud zaznamenáte znatelné fialové zbarvení, je výsledek reakce pozitivní (+). Jamky s velmi slabým zbarvením nebo malými fialovými skvrnami či shluky mohou být označeny jako hraniční (/). Jamky sloupců srovnejte s pozitivní kontrolou (A-10). Pokud jsou jamky fialově zbarveny (podobně jako jamka A-10), je reakce označena jako pozitivní (+). V případě výrazně slabšího zbarvení je reakce negativní (-). Hraniční reakce může být opět označena jako (/). Falešně pozitivní reakce je definována jako fialové zbarvení u negativní kontroly (jamka A-1). Takováto reakce se může vyskytnout u některých mikroorganismů (Aeromonas, Vibrio, Bacillus). V tomto případě je nutné v experimentu použít protokol B (viz příslušný manuál). Na základě vyhodnocení jednotlivých testů proveďte příslušným softwarem identifikaci testované kultury. Zamyslete se, jaké mohou být možné příčiny neúspěchu při mikrobiální identifikaci a jaké jsou výhody těchto testovacích systémů. Složení a příprava roztoků a kultivačních médií: Maximum Recovery Diluent (gramů látky/litr) ředicí roztok Pro přípravu ochranného a izotonického ředicího roztoku k maximální regeneraci mikroorganismů. Složení přípravku odpovídá požadavkům ČSN ISO ; 5541/1; 8261; 8199; ; a ČSN EN ISO masový pepton 1,00 chlorid sodný 8,5 ph (25 C) 7,0 ± 0,2 Navažte 9,5 g přípravku do 1000 ml destilované vody a je-li nezbytné zahřívejte do úplného rozpuštění. Sterilizujte v autoklávu při 121 C po dobu 15 minut.

55 Violet Red Bile Glucose Agar w/o Lactose (gramů látky/litr) Složení přípravku odpovídá požadavkům ČSN ISO , -2. masový pepton 7,00 kvasničný extrakt 3,00 žlučové soli (směs) 1,50 glukosa 10,00 chlorid sodný 5,00 neutrální červeň 0,03 krystalová violeť 0,002 agar 12,00 ph (25 C) 7,4 ± 0,2 Navažte 38,53 g přípravku do 1000 ml destilované vody a zahřívejte, při četnějším promíchávání, až do úplného rozpuštění. NEAUTOKLÁVOVAT! Ihned ochlaďte ve vodní lázni na 45 C. Před naléváním na Petriho misky důkladně promíchejte. Živný agar pro subkultivaci vybraných kolonií (gramů látky/litr) (Nutrient Agar 1,5%) Obecně použitelné kultivační médium, které může být obohaceno krví nebo jinými živočišnými deriváty. Složení přípravku odpovídá požadavkům ČSN ISO a ; -2; a ČSN EN ISO masový pepton 5,00 hovězí extrakt 3,00 chlorid sodný 5,00 Agar 15,00 ph (25 C) 7,0 ± 0,2 Navažte 28,0 g přípravku do 1000ml destilované vody a zahřívejte do úplného rozpuštění. Sterilizujte v autoklávu při 121 C po dobu 15 minut. Glukózový agar (gramů látky/litr) (Tryptone Yeast Extract Agar w/ BCP) Pro izolaci a stanovení počtu bakterií z čeledi Enterobacteriaceae. Složení přípravku odpovídá požadavkům ČSN ISO , -2. enzymatický hydrolyzát kaseinu 10,00 kvasničný extrakt 1,50 dextrosa 10,00 chlorid sodný 5,00 bromkresolová červeň 0,015 Agar 15,00 ph (25 C) 7,0 ± 0,2 Navažte 41,52 g přípravku do 1000 ml destilované vody a zahřívejte do úplného rozpuštění. Sterilizujte v autoklávu při 121 C po dobu 15 minut. Oxidase Discs (50 discs / vl) Pro detekci oxidázy (cytochromoxidázy) produkované mikroorganismy. Testuje se kolonie čisté, hodinové, bakteriální kultury. Oxidázový disk se umístí do sterilní Petriho misky, zvlhčí se destilovanou vodou. Testovanou kolonii přeneseme sterilní kličkou a rozetřeme na povrch zvlhčeného disku. Alternativní postup je, že pomocí sterilní pinzety uchopíme vlhký disk a dotkneme se testované kolonie. Pozitivní reakce se projeví během 5-10 sekund jako tmavě modrofialové zabarvení. Opožděná

56 pozitivní reakce se může projevit až do 60 sekund. Změna barvy po uplynutí této doby nebo žádná barvená změna značí negativní výsledek. Violet Red Bile Agar 1,2% (gramů látky/litr) masový pepton 7,00 kvasničný extrakt 3,00 žlučové soli (směs) 1,50 laktosa 10,00 chlorid sodný 5,00 neutrální červeň 0,03 krystalová violeť 0,002 agar 12,00 ph (25 C) 7,4 ± 0,2 Navažte 38,53 g přípravku do 1000 ml destilované vody a zahřívejte, při četnějším promíchávání, až do úplného rozpuštění. NEAUTOKLÁVOVAT! Ihned ochlaďte ve vodní lázni na 45 C. Po vychlazení zalijte inokulum na Petriho miskách.

57 Bakteriální identifikace s využitím souprav MIKRO-LA-TEST Úvod: Identifikace mikroorganismů zahrnuje postupy pro určování vykultivovaných rodů a druhů mikroorganismů. Prvním stupněm při určování mikroorganismů je makroskopická identifikace, při níž je zjišťována velikost kolonií, jejich tvar, povrch, zbarvení, okrajová zóna, produkce barviv, apod. Makroskopická identifikace se uplatňuje zejména u bakterií a plísní. U plísní jsou možnosti použití biochemických a fyziologických testů značně omezené, proto se nejčastěji využívá mikroskopické identifikace (příprava nativních, barevných preparátů). Při bakteriální identifikaci se v širokém měřítku využívá biochemické identifikace jednotlivých druhů a rodů bakterií, pro určité skupiny bakterií jsou sestavovány tzv. diagnostické tabulky a diagnostické klíče. K diagnostickým přípravkům pro standardizovanou, rutinní identifikaci klinicky významných mikroorganismů v klinických, potravinářských a vodohospodářských laboratořích patří např. identifikační produkty MIKRO-LA-TEST. Sortiment těchto přípravků zahrnuje vlastní identifikační soupravy, detekční proužky sloužící pro detekci bakteriálního enzymu nebo metabolitu, diagnostické disky umožňující diferenciaci bakterií přímo na kultivační živné půdě, doplňkové přístroje, činidla a pomůcky. Princip identifikačních souprav (MIKRO-LA-TEST): Identifikační soupravy obsahují dehydratované substráty pro biochemické reakce. Jednotlivé substráty jsou umístěny v jamkách stripů dělených mikrotitračních destiček. Přidáním definované suspenze vyšetřovaného bakteriálního kmene dojde k rehydrataci substrátu a v průběhu inkubace jsou substráty činností mikroorganismů metabolizovány za vzniku produktů, které jsou detekovány barevnými změnami. Soupravy jsou umístěny na dělených mikrotitračních destičkách s 1,2 nebo 3-řádkovými stripy pro 8,16 a 24 biochemických reakcí (toto uspořádání umožňuje využít vždy jen potřebnou část destičky). Identifikaci lze doplnit testy, dodávanými ve formě detekčních proužků, jednotlivé biochemické reakce na destičkách jsou lehce odlišitelné pomocí víčka s potiskem. Identifikace bakterií s využitím soupravy ENTEROtest 24 Princip: Souprava je určena pro rutinní identifikaci významných druhů střevních bakterií z čeledi Enterobacteriaceae. Souprava umožňuje provést identifikaci čtyřiceti kmenů, pomocí 24 biochemických testů. Testy jsou umístěny v jamkách mikrotitrační destičky, vždy tři řady po osmi jamkách obsahující testy pro identifikaci jednoho kmene. Identifikaci je možné doplnit testy, dodávanými ve formě diagnostických proužků: OXItest, COLItest pro detekci E. coli průkazem aktivity ß-glukuronidázy, PYRAtest. Materiál a pomůcky: Souprava ENTEROtest 24, činidlo pro test INDOL, činidlo pro test FENYLALANIN, činidlo pro test ACETOIN, OXItest, COLI test, parafinový olej sterilizovaný, sterilní zkumavky, sterilní fyziologický roztok, Petriho misky s kultivačním médiem, přístroj Densi-La-Meter II, vortex, mikropipety, sterilní špičky, termostat, kahan, očkovací klička, barevná srovnávací stupnice pro soupravu ENTEROtest 24, diagnostický seznam pro soupravu ENTEROtest 24, identifikační program TNW. Postup: 1. Izolace kultur (provádí se na médiích, doporučovaných pro enterobakterie). 2. Pro potvrzení příslušnosti ke střevním bakteriím proveďte test na detekci cytochromoxidázy (detekční proužek OXItest) 1.

58 3. Z čisté 24h kultury připravte ve fyziologickém roztoku suspenzi. Suspenzi dobře homogenizujte. Zákal suspenze musí odpovídat 1. stupni McFarlandovy zákalové stupnice (s využitím přístroje Densi-La-Meter II) 2. Slabší nebo hustší suspenze může vést k falešným reakcím. 4. Otevřete aluminiový sáček odstřihnutím těsně vedle sváru a vyjměte destičku. 5. Pomocí skalpelu odřízněte příslušný počet řad (stripů) destičky, odpovídající počtu testovaných kmenů (3 řady, tj. 3x8 testů, pro identifikaci 1 kmene). 6. Vyříznuté řady vyjměte z panelu, sejměte ochrannou Al fólii, řady umístěte do připraveného prázdného rámečku. Zaznamenejte čísla vyšetřovaných kultur na příslušné stripy. 7. Důkladně homogenizujte bakteriální suspenzi ve fyziologickém roztoku. Inokulujte 0,1 ml suspenze do všech jamek příslušných tří řad destičky. K jamkám H, G, F, E, D a C prvého řádku (testy IND, H 2 S, LYS, ORN, URE, ARG) přidejte po inokulaci po 2 kapkách parafínového oleje 3. V případě, že víčko v průběhu práce používáte na přikrytí destičky, před použitím jeho vnitřní stranu otřete ethanolem. 8. Vložte rámeček destičky s naočkovanými řadami do inkubačního PE sáčku. Otevřený konec sáčku zahněte pod destičku, aby nedošlo k vysychání inokula. Vložte destičku do termostatu (37 C) a inkubujte po dobu 24 hodin. 9. Po 24 hod. inkubaci zakapejte jamky na destičce činidly (1. řada, jamka H test Indol 2 kapky činidla pro IND 4, a dále 3. řada, jamka H test Acetoin po 1 kapce činidla pro VPT I, VPT II) 5. Destičku nechte inkubovat 30 minut při teplotě 37 C pro vývoj barevných reakcí. 10. Po uplynutí této doby zakapejte činidlem jamku H, 2. řada test Fenylalanin 1 kapka činidla pro PHE 6. Test ihned odečtěte (pozitivní reakce mizí do 2 minut po přikápnutí činidla). 11. Odečtěte ostatní testy a výsledky reakcí zaznamenejte do formuláře pro záznam výsledků. 12. Pro hodnocení barevných reakcí použijte Barevnou srovnávací stupnici pro soupravu ENTEROtest Identifikaci proveďte pomocí Diagnostického seznamu pro soupravu ENTEROtest 24, případně na počítači pomocí identifikačního programu TNW. 14. Po použití vložte destičku do nádoby pro infekční materiál a autoklávujte. Poznámky: 1, OXItest je individuální test pro detekci cytochromoxidázy; balení OXItestu obsahuje 50 proužků umožňujících provést 50 stanovení na detekci oxidázy. Přítomnost cytochromoxidázy je detekována barevnou reakcí N,N-dimethyl-1,4-fenylendiaminu s α-naftolem za vzniku indofenolové modři. Citlivost reakce lze zvýšit použitím Činidla pro test OXIDÁZA. 2, Densi-La-Meter II je optický přístroj, který umožňuje standardizaci bakteriálního inokula (např. při bakteriální identifikaci nebo stanovení citlivosti mikroorganismů k antimikrobiálním látkám). Přístroj pracuje na principu měření optické absorbance, naměřené hodnoty vykazuje přímo v jednotkách dle McFarlanda. 3, Parafinovaný olej sterilizovaný je pomocným přípravkem pro diagnostické soupravy, obsahující testy, které vyžadují inkubaci se zamezením přístupu kyslíku. 4, Činidlo pro test INDOL je pomocným barvotvorným činidlem pro test na produkci indolu, obsažený v souboru testů diagnostických souprav. 5, Souprava Činidlo pro test ACETOIN je pomocným barvotvorným činidlem pro test na tvorbu acetoinu (Voges-Proskauerův test), obsažený v souboru testů diagnostických souprav. 6, Souprava Činidlo pro test FENYLALANIN je pomocným přípravkem pro diagnostické soupravy, obsahující test na důkaz fenylalanindeaminázy a slouží pro barevné vyjádření tohoto testu.

59 Vyhodnocení a úkoly ke zpracování: 1. Zjištěné výsledky barevných reakcí zaznamenejte do tabulek (interpretace reakcí). ENTEROtest 24 Sloupec Test Zkratka testu Reakce pozitivní Řádek 1 H Indol IND G Sirovodík H 2 S F Lysin LYS E Ornithin ORN D Ureáza URE C Arginin ARG B Simmons citrát SCI A Malonát MAL Řádek 2 H Fenylalanin PHE G β-galaktosidáza ONP F Inositol INO E Adonitol ADO D Cellobióza CEL C Sacharóza SUC B Trehalóza TRE A Mannitol MAN Řádek 3 H Acetoin VPT G Eskulin ESL F Sorbitol SOR E Rhamnóza RHA D Melibióza MLB C Raffinóza RAF B Dulcitol DUL A Glukóza GLU negativní 2. Uveďte podstatu provedených biochemických testů. 3. Jakým způsobem se provádí identifikace pomocí diagnostického seznamu a počítačového programu? Postup zaznamenejte. 4. Jaké mohou být nejčastější možné příčiny neúspěchu při identifikaci? 5. Zamyslete se nad výhodami těchto standardizovaných testovacích systémů. Použitá literatura: 1. Pracovní návody příslušných diagnostických souprav a činidel řady MIKRO- LA-TEST (produkty společnosti Erba Lachema s.r.o.). 2. Klaban, V. (2005): Ilustrovaný mikrobiologický slovník. Vydavatelství Galén. Praha. 3. Jandová, B., Kotoučková, L. (1996): Praktikum z mikrobiologie. Vydavatelství MU, Brno Schéma pracovního postupu:

60

61 Hodnocení růstu mikrobiálních kultur automatizovaným systémem BIOSCREEN C Charakteristika zařízení: Bioscreen je automatizované zařízení k hodnocení růstových vlastností kmene. Oproti standardním metodám pro stanovení růstové křivky jako jsou metoda plotnová (stanovení titru cfu/ml) výsevem bakterií na plotny nebo klasické nefelometrické metodě, umožňuje získání přesnějších výsledků, je rychlejší a levnější. Výsledky jsou získávány průběžně během celého inkubačního intervalu a jsou vyhodnocovány pomocí softwaru. Počáteční investice do zařízení se v rutinním mikrobiologické laboratoři, vzhledem k výše uvedeným přednostem, stává brzy rentabilní. Interval inkubační teploty je nastavitelný v rozmezí od 1-60 C, přičemž v jednotlivých krocích lze provádět velmi jemné změny v inkubační teplotě - po 0,1 C. Systém umožňuje inkubaci při teplotách -6 /+30 C vztaženo k aktuální pokojové teplotě. Pro inkubaci při nižších teplotách se doporučuje pracovat v chlazeném boxu. Maximální kapacita zařízení je nesrovnatelná s klasickými mikrobiologickými metodami, neboť umožňuje najednou hodnocení 200 vzorků. Velkou výhodou je, že systém může pracovat i dlouhodobě a to až 1600 hodin. Jistou nevýhodou je, že hodnocení růstu je možné provádět jen v tekutých médiích, neboť růst je hodnocen turbidometricky měřením zákalu odpovídajícímu aktuální hustotě buněk v suspenzi. Volbou vhodných vlnových délek lze měřit také barevné změny související s metabolismem mikroorganismů v průběhu kultivace. Standardní měření lze provádět při vlnových délkách 405, 420, 450, 492, 540, 580 a 600 nm, případně výrobce poskytne filtry i s dalšími vlnovými délkami. Některé příklady aplikačního využití BIOSCREENU C: Bioscreen představuje miniaturizovaný automatizovaný testovací systém nahrazující základní klasické mikrobiologické metody vyžadující určitou rutinní zručnost provedení i konvenční mikrobiologická spektrofotometrická měření včetně destičkových readrů. V mikrobiologické praxi představuje usnadnění a zejména urychlení experimentů. Zařízení lze použít pro: Sledování růstových parametrů simultánní stanovení růstových křivek současně pro 200 kultur. Lze hodnotit kinetiku růstu bakterií, kvasinek, hub i řas. Systém umožňuje záznam parametrů a srovnání růstových křivek různých kmenů a zhodnocení jejich fyziologických vlastností. Hodnocení celkového počtu mikroorganismů ve vzorcích potravin, vody, moči, apod. Hodnocení fyziologických požadavků na složení médií, např. obsah vitamínů, aminokyselin, ph, teploty, apod.

62 Hodnocení antimikrobiálních/ antimykotických účinků různých látek, např. antibiotik a desinfekčních prostředků, apod. Stanovení minimální inhibiční koncentrace (MIC) antimikrobiálních látek, nebo zjištění letálních dávek (LD). Sledování krátkodobých i dlouhodobých toxických efektů látek prostřednictvím inhibice růstu. Hodnocení biostimulačních účinků látek zvyšujících kinetiku růstu. Hodnocení růstu biotechnologicky významných kmenů v různých podmínkách ovlivňujících produkční a růstové schopnosti kmenů. Např. při výrobě enzymů, bílkovin, mastných kyselin nebo jiných látek. Studium biodegradačních schopností kmenů a podmínek optimalizujících průběh biodegradací kontaminant. Ke studiu mikrobiologických procesů uplatňujících se při výrobě jogurtu, piva, vína nebo dalších potravin a případně krmiv. K hodnocení kometabolismu ve smíšených kulturách. Studium kinetiky růstu bakteriofága. Popis zařízení: Systém Bioscreen C se skládá z inkubační a měřící jednotky, a z počítače, ve kterém je instalován odpovídající software sloužící k zaznamenávání růstových křivek a jejich vyhodnocení. Vzorky a bakterie se aplikují do jamek na dvou destičkách, které se vloží do inkubační komory. Inkubace, míchání a kinetická měření probíhají automaticky podle nastavených parametrů daného pokusu. Lampa a filtr Měřící zařízení OD Inkubační komora pro 2 Honeycomb destičky Otvor pro doplnění chladícího média Zahřívací a chladící modul Klavesnice Display

63 Úkol: 1 Využití BIOSCREENU C pro sledování růstu buněk v různých fyziologických podmínkách Materiál: LB ph=7 (bakterie), Sabouraud médium (kvasinky), 0,2M Na 2 HPO 4, 0,1M kyselina citronová, pipety, vícekanálová pipeta. Kultury: E. coli, Staphylococcus sp., Pseudomonas sp., kvasinky Postup práce: 1. Nastavení parametrů přístroje (provádíme podle návodu za přítomnosti vyučujícího): Otevřeme program v systému MS DOS. Nastavíme nový program podle návodu. Vyplníme kolonku pro bližší popis testu. Po zobrazení destičky zvolíme šipkami a mezerníkem Simple editor a Grafical well map. Zadáme konečný objem v jamce, zadáme jednotky, ve kterých bude provedeno měření, zvolíme počet opakování pro daný vzorek a popis vzorku. Zvolíme počet vzorků. Zadáme parametry měření (pomocí všech 4 šipek a potvrzujeme Enter). Stisknutím tlačítek Ctrl + Enter odsouhlasíme parametry, kurzor umístíme na Measurement a zahájíme měření stisknutím tlačítka Enter. 2. Příprava inokula: noční kulturu získáme naočkováním 20ml LB (ph=7) 1 kličkou kultury. Inkubujeme přes noc na třepačce při 28 C. Noční kultura by měla mít asi 10 8 CFU/ml (0,5 Mc Farlandovy stupnice = 1,5x 10 8 ) 3. Připravíme si LB pro bakterie a Sabouraud pro kvasinky o různém ph dle tabulky: ZKUMAVKA MPB 0,2M 0,1M k.citronová Předpo č. nebo Na 2 HPO 4 ml ml kládané Sabouraud ph ml 1 2 1,93 3,07 4, ,57 2,43 5, ,16 1,84 6, ,12 0,88 7, ,86 0,14 8,0 Naměřená hodnota ph 4. Aplikaci do sterilních destiček provedeme v přísně sterilním prostředí ve flowboxu. Papír s označením jamek si umístíme pod destičku.

64 5. Aplikaci 330 μl LB/ Sabouraud média o různém ph provedeme podle tabulky: ph Kmen č.1 jamky Kmen č.2 jamky Kmen č.3 jamky Kmen č.4 jamky Do příslušných jamek aplikujeme 10 μl čerstvého inokula příslušného kmene. 7. Kultivaci provádíme při teplotě 28 C po dobu 48 hodin. 8. Měření zákalu při vlnové délce λ =600 nm probíhá každé 2 hodiny podle nastavení parametrů na Bioscreenu C. Vyhodnocení a závěr Po zpracování výsledků softwarem Bioscreen C vytiskněte hodnoty OD600 do tabulky. Vypočítejte průměrné hodnoty zákalu z 5 opakování a sestrojte růstovou křivku. Z průměrných hodnot střední generační doby pro kultivační média o různé hodnotě ph (výpočet bude proveden automaticky softwarem po převedení do MS Excel) sestrojte graf závislosti průměrné generační doby na zvolené hodnotě ph kultivačního média.

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi. Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi

Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi. Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi Co je to vlastně ta fluorescence? Některé látky (fluorofory)

Více

FLUORESCENČNÍ MIKROSKOP

FLUORESCENČNÍ MIKROSKOP FLUORESCENČNÍ MIKROSKOP na gymnáziu Pierra de Coubertina v Táboře Pavla Trčková, kabinet Biologie, GPdC Tábor Co je fluorescence Fluorescence je jev spočívající v tom, že některé látky (fluorofory) po

Více

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)

Více

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction

Více

Fluorescenční mikroskopie

Fluorescenční mikroskopie Fluorescenční mikroskopie Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 1 VYUŽITÍ FLUORESCENCE, PŘÍMÁ FLUORESCENCE, PŘÍMÁ A NEPŘÍMA IMUNOFLUORESCENCE, BIOTIN-AVIDINOVÁ METODA IMUNOFLUORESCENCE

Více

Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách

Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách Teorie Stanovení celkových proteinů Celkové množství proteinů lze stanovit pomocí několika metod; například: Hartree-Lowryho

Více

WORKSHOP METOD EXPERIMENTÁLNÍ BIOLOGIE SBORNÍK

WORKSHOP METOD EXPERIMENTÁLNÍ BIOLOGIE SBORNÍK WORKSHOP METOD EXPERIMENTÁLNÍ BIOLOGIE SBORNÍK EDITOVAL: VÁCLAV BRÁZDA BIOFYZIKÁLNÍ ÚSTAV AV ČR, V.V.I. 31. 8. 5. 9. 2014 OPVK - WORSHOP METOD EXPERIMENTÁLNÍ BIOLOGIE, září 2014 WORKSHOP METOD EXPERIMENTÁLNÍ

Více

-fluorescenční mikroskopie. -konfokální mikroskopie -multifotonová konfokální mikroskopie

-fluorescenční mikroskopie. -konfokální mikroskopie -multifotonová konfokální mikroskopie Fluorescenční mikroskopie -fluorescenční mikroskopie -konfokální mikroskopie -multifotonová konfokální mikroskopie Fluorescence a fluorofory Schéma konvenčního fluorescenčního mikroskopu -Na fluorescenčně

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

analýza dat a interpretace výsledků

analýza dat a interpretace výsledků Genetická transformace bakterií III analýza dat a interpretace výsledků Předmět: Biologie ŠVP: Prokaryotní organismy, genetika Doporučený věk žáků: 16-18 let Doba trvání: 45 minut Specifické cíle: analyzovat

Více

ORGANICKÁ CHEMIE Laboratorní práce č. 9

ORGANICKÁ CHEMIE Laboratorní práce č. 9 Téma: Bílkoviny, enzymy ORGANICKÁ CHEMIE Laboratorní práce č. 9 Úkol 1: Dokažte, že mléko obsahuje bílkovinu kasein. Kasein je hlavní bílkovinou obsaženou v savčím mléce. Výroba řady mléčných výrobků je

Více

Diagnostické metody v lékařské mikrobiologii

Diagnostické metody v lékařské mikrobiologii Diagnostické metody v lékařské mikrobiologii Výuková prezentace z: Lékařské mikrobiologie Jan Smíšek ÚLM 3. LF UK 2009 Princip identifikace Soubor znaků s rozdílnou diskriminační hodnotou Základní problémy

Více

PRŮTOKOVÁ CYTOMETRIE - PERSPEKTIVNÍ ALTERNATIVA V ANALÝZE MIKROBIOLOGICKÝCH UKAZATELŮ KVALITY VOD

PRŮTOKOVÁ CYTOMETRIE - PERSPEKTIVNÍ ALTERNATIVA V ANALÝZE MIKROBIOLOGICKÝCH UKAZATELŮ KVALITY VOD PRŮTOKOVÁ CYTOMETRIE - PERSPEKTIVNÍ ALTERNATIVA V ANALÝZE MIKROBIOLOGICKÝCH UKAZATELŮ KVALITY VOD 1* P. Mikula, 1 B. Maršálek 1 Botanický ústav Akademie věd ČR, Oddělení experimentální fykologie a ekotoxikologie,

Více

Úloha č. 1 Odměřování objemů, ředění roztoků Strana 1. Úkol 1. Ředění roztoků. Teoretický úvod - viz návod

Úloha č. 1 Odměřování objemů, ředění roztoků Strana 1. Úkol 1. Ředění roztoků. Teoretický úvod - viz návod Úloha č. 1 Odměřování objemů, ředění roztoků Strana 1 Teoretický úvod Uveďte vzorec pro: výpočet směrodatné odchylky výpočet relativní chyby měření [%] Použitý materiál, pomůcky a přístroje Úkol 1. Ředění

Více

FLUORIMETRICKÉ STANOVENÍ FLUORESCEINU

FLUORIMETRICKÉ STANOVENÍ FLUORESCEINU FLUORIMETRICKÉ STANOVENÍ FLUORESCEINU návod vznikl jako součást bakalářské práce Martiny Vidrmanové Fluorimetrie s využitím spektrofotometru SpectroVis Plus firmy Vernier (http://is.muni.cz/th/268973/prif_b/bakalarska_prace.pdf)

Více

Praktický kurz. Moderní biofyzikální přístupy v experimentální biologii

Praktický kurz. Moderní biofyzikální přístupy v experimentální biologii Oddělení funkční genomiky a proteomiky Ústav experimentální biologie, Přírodovědecká fakulta Masarykova univerzita Praktický kurz Moderní biofyzikální přístupy v experimentální biologii Místo konání: Brno,

Více

Písemná zpráva zadavatele

Písemná zpráva zadavatele Písemná zpráva zadavatele veřejné zakázky zadávané dle zákona č. 137/2006 Sb., o veřejných zakázkách, ve znění účinném ke dni zahájení zadávacího řízení (dále jen ZVZ ). Veřejná zakázka Název: Ostatní

Více

Absorpční spektroskopie při biologické analýze molekul

Absorpční spektroskopie při biologické analýze molekul Absorpční spektroskopie při biologické analýze molekul Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 8.11.2007 7 1 UV spektroskopie DNA a proteinů Všechny atomy absorbují v UV oblasti

Více

nastavení real-time PCR cykleru Rotor Gene 3000

nastavení real-time PCR cykleru Rotor Gene 3000 Verze: 1.4 Datum poslední revize: 25. 3. 2015 nastavení real-time PCR cykleru Rotor Gene 3000 (Corbett Research) generi biotech OBSAH: 1. Nastavení teplotního profilu a spuštění cykleru... 3 2. Zadání

Více

Praktický kurz Monitorování hladiny metalothioneinu po působení iontů těžkých kovů Vyhodnocení měření

Praktický kurz Monitorování hladiny metalothioneinu po působení iontů těžkých kovů Vyhodnocení měření Laboratoř Metalomiky a Nanotechnologií Praktický kurz Monitorování hladiny metalothioneinu po působení iontů těžkých kovů Vyhodnocení měření Vyučující: Ing. et Ing. David Hynek, Ph.D., Prof. Ing. René

Více

Fluorescenční vyšetření rostlinných surovin. 10. cvičení

Fluorescenční vyšetření rostlinných surovin. 10. cvičení Fluorescenční vyšetření rostlinných surovin 10. cvičení Cíl cvičení práce s fluorescenčním mikroskopem detekce vybraných rostlinných surovin Princip nepřímé dvojstupňové IHC s použitím fluorochromu Fluorescenční

Více

Verze: 1.2 Datum poslední revize: 24.9.2014. Nastavení real-time PCR cykleru. Light Cycler 480 Instrument. (Roche) generi biotech

Verze: 1.2 Datum poslední revize: 24.9.2014. Nastavení real-time PCR cykleru. Light Cycler 480 Instrument. (Roche) generi biotech Verze: 1.2 Datum poslední revize: 24.9.2014 Nastavení real-time PCR cykleru Light Cycler 480 Instrument (Roche) generi biotech OBSAH 1. Nastavení teplotního profilu...3 1.1. Nastavení nového teplotního

Více

PROTOKOL WESTERN BLOT

PROTOKOL WESTERN BLOT WESTERN BLOT 1. PŘÍPRAVA ELEKTROFORETICKÉ APARATURY Saponátem a vodou se důkladně umyjí skla, plastové vložky a hřebínek, poté se důkladně opláchnou deionizovanou/destilovanou vodou a etanolem a nechají

Více

Spektroskopie v UV-VIS oblasti. UV-VIS spektroskopie. Roztok KMnO 4. pracuje nejčastěji v oblasti 200-800 nm

Spektroskopie v UV-VIS oblasti. UV-VIS spektroskopie. Roztok KMnO 4. pracuje nejčastěji v oblasti 200-800 nm Spektroskopie v UV-VIS oblasti UV-VIS spektroskopie pracuje nejčastěji v oblasti 2-8 nm lze měřit i < 2 nm či > 8 nm UV VIS IR Ultra Violet VISible Infra Red Roztok KMnO 4 roztok KMnO 4 je červenofialový

Více

Fluorescenční mikroskopie

Fluorescenční mikroskopie Fluorescenční mikroskopie Mgr. Jan Černý PhD. Oddělení vývojové biologie, Katedra fyziologie živočichů, Přírodovědecká fakulta UK v Praze janmartincerny@seznam.cz Klasická světelná mikroskopie sloužila

Více

Řasový test ekotoxicity na mikrotitračních destičkách

Řasový test ekotoxicity na mikrotitračních destičkách Řasový test ekotoxicity na mikrotitračních destičkách 1 Účel Řasové testy toxicity slouží k testování možných toxických účinků látek a vzorků na vodní producenty. Zelené řasy patří do skupiny necévnatých

Více

Molekulová spektroskopie 1. Chemická vazba, UV/VIS

Molekulová spektroskopie 1. Chemická vazba, UV/VIS Molekulová spektroskopie 1 Chemická vazba, UV/VIS 1 Chemická vazba Silová interakce mezi dvěma atomy. Chemické vazby jsou soudržné síly působící mezi jednotlivými atomy nebo ionty v molekulách. Chemická

Více

NMR spektroskopie. Úvod

NMR spektroskopie. Úvod NMR spektroskopie Úvod Zkratka NMR znamená Nukleární Magnetická Rezonance. Jde o analytickou metodu, která na základě absorpce radiofrekvenčního záření vzorkem umístěným v silném magnetickém poli poskytuje

Více

Písemná zpráva zadavatele

Písemná zpráva zadavatele Písemná zpráva zadavatele o veřejné zakázce zadávané dle zákona č. 137/2006 Sb., o veřejných zakázkách, ve znění účinném ke dni zahájení zadávacího řízení (dále jen ZVZ ). Veřejná zakázka Název: Spektrofotometry

Více

Úvod do laserové techniky KFE FJFI ČVUT Praha Michal Němec, 2014. Plynové lasery. Plynové lasery většinou pracují v kontinuálním režimu.

Úvod do laserové techniky KFE FJFI ČVUT Praha Michal Němec, 2014. Plynové lasery. Plynové lasery většinou pracují v kontinuálním režimu. Aktivní prostředí v plynné fázi. Plynové lasery Inverze populace hladin je vytvářena mezi energetickými hladinami některé ze složek plynu - atomy, ionty nebo molekuly atomární, iontové, molekulární lasery.

Více

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Charakteristika testu: Set AMPLICOR HPV vyráběný firmou Roche je určený pro detekci vysoko-rizikových typů lidských

Více

Fluorescenční a konfokální mikroskopie

Fluorescenční a konfokální mikroskopie Fluorescenční a konfokální mikroskopie Hana Sehadová, Biologické centrum AVČR, České Budějovice, 2011 Co je to fluorescence? některé látky (fluorofory) po ozáření (excitaci) světlem jsou schopny absorbovat

Více

LIDSKÁ CYTOGENETIKA Laboratorní diagnostika

LIDSKÁ CYTOGENETIKA Laboratorní diagnostika Pod Cihelnou 6 161 00 Praha 6 tel: 233 313 578, fax: 233 313 582 email: asco@ascomed.cz www.ascomed.cz 1. Kultivace lymfocytů LIDSKÁ CYTOGENETIKA Laboratorní diagnostika 1.1 Úvod Karyotypizace lidských

Více

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MELAMINU A KYSELINY KYANUROVÉ METODOU LC-MS

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MELAMINU A KYSELINY KYANUROVÉ METODOU LC-MS Národní referenční laboratoř Strana 1 STANOVENÍ OBSAHU MELAMINU A KYSELINY KYANUROVÉ METODOU LC-MS 1 Rozsah a účel Postup je určen pro stanovení obsahu melaminu a kyseliny kyanurové v krmivech. 2 Princip

Více

Derivační spektrofotometrie a rozklad absorpčního spektra

Derivační spektrofotometrie a rozklad absorpčního spektra Derivační spektrofotometrie a rozklad absorpčního spektra Teorie: Derivační spektrofotometrie, využívající derivace absorpční křivky, je obecně používanou metodou pro zvýraznění detailů průběhu záznamu,

Více

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR Mikrobiologický ústav AV ČR Příloha 6 Havarijní plán 1/5 Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR a) Adresa pracoviště Mikrobiologický ústav AV ČR

Více

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést

Více

Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE

Více

Úloha č. 9 Stanovení hydroxidu a uhličitanu vedle sebe dle Winklera

Úloha č. 9 Stanovení hydroxidu a uhličitanu vedle sebe dle Winklera Úloha č. 9 Stanovení hydroxidu a uhličitanu vedle sebe dle Winklera Princip Jde o klasickou metodu kvantitativní chemické analýzy. Uhličitan vedle hydroxidu se stanoví ve dvou alikvotních podílech zásobního

Více

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)

Více

Uhlíkové struktury vázající ionty těžkých kovů

Uhlíkové struktury vázající ionty těžkých kovů Uhlíkové struktury vázající ionty těžkých kovů 7. června/june 2013 9:30 h 17:30 h Laboratoř metalomiky a nanotechnologií, Mendelova univerzita v Brně a Středoevropský technologický institut Budova D, Zemědělská

Více

ANALYTICKÝ PRŮZKUM / 1 CHEMICKÉ ANALÝZY ZLATÝCH A STŘÍBRNÝCH KELTSKÝCH MINCÍ Z BRATISLAVSKÉHO HRADU METODOU SEM-EDX. ZPRACOVAL Martin Hložek

ANALYTICKÝ PRŮZKUM / 1 CHEMICKÉ ANALÝZY ZLATÝCH A STŘÍBRNÝCH KELTSKÝCH MINCÍ Z BRATISLAVSKÉHO HRADU METODOU SEM-EDX. ZPRACOVAL Martin Hložek / 1 ZPRACOVAL Martin Hložek TMB MCK, 2011 ZADAVATEL PhDr. Margaréta Musilová Mestský ústav ochrany pamiatok Uršulínska 9 811 01 Bratislava OBSAH Úvod Skanovací elektronová mikroskopie (SEM) Energiově-disperzní

Více

2. Určete frakční objem dendritických částic v eutektické slitině Mg-Cu-Zn. Použijte specializované programové vybavení pro obrazovou analýzu.

2. Určete frakční objem dendritických částic v eutektické slitině Mg-Cu-Zn. Použijte specializované programové vybavení pro obrazovou analýzu. 1 Pracovní úkoly 1. Změřte střední velikost zrna připraveného výbrusu polykrystalického vzorku. K vyhodnocení snímku ze skenovacího elektronového mikroskopu použijte kruhovou metodu. 2. Určete frakční

Více

14. Fluorescenční mikroskopie

14. Fluorescenční mikroskopie 14. Fluorescenční mikroskopie Fluorescenční mikroskop Rozlišení Abbého podmínka vysoká NA nebo kratší λ nízká NA nebo delší λ Proč mají olejové imerzní objektivy větší rozlišení? Slabý, NA~ 0.25 D~ 8 µm

Více

PŘÍBALOVÁ INFORMACE. www.geneproof.com. GeneProof PathogenFree DNA Isolation Kit IDNA050 IDNA250. In vitro diagnostický zdravotnický prostředek

PŘÍBALOVÁ INFORMACE. www.geneproof.com. GeneProof PathogenFree DNA Isolation Kit IDNA050 IDNA250. In vitro diagnostický zdravotnický prostředek PŘÍBALOVÁ INFORMACE GeneProof PathogenFree DNA Isolation Kit IDNA050 IDNA250 In vitro diagnostický zdravotnický prostředek Souprava je vyrobena v souladu s evropskou Směrnicí Rady 98/79/ES jako in vitro

Více

IVD Bacterial Test Standard

IVD Bacterial Test Standard Návod k použití IVD Bacterial Test Standard Standard pro kalibraci hmotnostního spektrometru s typickým profilem peptidů a proteinů Escherichia coli DH5 alfa a dalšími proteiny. Pro použití při hmotnostní

Více

nastavení real-time PCR cykléru icycler iq5 Multi-Color Real-Time PCR Detection System

nastavení real-time PCR cykléru icycler iq5 Multi-Color Real-Time PCR Detection System Verze: 1.0 Datum poslední revize: 2.1.2014 nastavení real-time PCR cykléru icycler iq5 Multi-Color Real-Time PCR Detection System (BioRad) generi biotech OBSAH: 1. Spuštění již existujícího či nastavení

Více

COMET ASSAY (SINGLE CELL GEL ELECTROPHORESIS)

COMET ASSAY (SINGLE CELL GEL ELECTROPHORESIS) COMET ASSAY (SINGLE CELL GEL ELECTROPHORESIS) OBSAH 1. Princip metody 2. Přístroje a zařízení 3. Příprava vzorků 3.1 Kultivace a sklízení buněk A549 3.2 Výpočet koncentrace buněk 3.3 Hodnocení viability

Více

Použití v laboratorních podmínkách

Použití v laboratorních podmínkách Použití v laboratorních podmínkách Obsah Velcorin použití v laboratorních podmínkách Strana 3 5 Úvod Strana 3 Bezpečnostní opatření Strana 3 Pracovní postup (senzoricky) Strana 4 Pracovní postup (mikrobiologicky)

Více

Projekt realizovaný na SPŠ Nové Město nad Metují

Projekt realizovaný na SPŠ Nové Město nad Metují Projekt realizovaný na SPŠ Nové Město nad Metují s finanční podporou v Operačním programu Vzdělávání pro konkurenceschopnost Královéhradeckého kraje Modul 02 Přírodovědné předměty Hana Gajdušková 1 Viry

Více

Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC

Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC 1 Výrobce Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC Tento návod k použití si důkladně přečtěte před použitím tohoto produktu. Uschovejte si tento návod k použití,

Více

Nukleární Overhauserův efekt (NOE)

Nukleární Overhauserův efekt (NOE) Nukleární Overhauserův efekt (NOE) NOE je důsledek dipolární interakce mezi dvěma jádry. Vzniká přímou interakcí volně přes prostor, tudíž není ovlivněn chemickými vazbami jako nepřímá spin-spinová interakce.

Více

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů

Více

Zdroje optického záření

Zdroje optického záření Metody optické spektroskopie v biofyzice Zdroje optického záření / 1 Zdroje optického záření tepelné výbojky polovodičové lasery synchrotronové záření Obvykle se charakterizují zářivostí (zářivý výkon

Více

Základy laboratorní techniky

Základy laboratorní techniky Předmět: Biologie ŠVP: prokaryotní organismy, genetika Doporučený věk žáků: 16 18 let Doba trvání: 2 x 45 min. Specifické cíle: naučit studenty pracovat s laboratorními pomůckami a přístroji Seznam pomůcek:

Více

Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové beranek@lfhk.cuni.cz

Více

MODERNÍ BIOFYZIKÁLNÍ METODY:

MODERNÍ BIOFYZIKÁLNÍ METODY: - 1 - MODERNÍ BIOFYZIKÁLNÍ METODY: POKROČILÉ PRAKTICKÉ VZDĚLÁVÁNÍ V EXPERIMENTÁLNÍ BIOLOGII Operační program Vzdělávání pro konkurenceschopnost Číslo projektu: CZ.1.07/2.3.00/09.0046 Praktický kurz základních

Více

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Kamila Zdeňková Transgenní rostliny, tj. takové rostliny, do jejichž dědičného základu byly metodami genového inženýrství

Více

Základy NIR spektrometrie a její praktické využití

Základy NIR spektrometrie a její praktické využití Nicolet CZ s.r.o. The world leader in serving science Základy NIR spektrometrie a její praktické využití NIR praktická metoda molekulové spektroskopie, nahrazující pracnější, časově náročnější a dražší

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený

Více

Vitamin C důkaz, vlastnosti

Vitamin C důkaz, vlastnosti Předmět: Doporučený ročník: 4. - 5. ročník Zařazení do ŠVP: biochemie, přírodní látky, vitaminy Doba trvání pokusu: 45 minut Seznam pomůcek: zkumavky, kádinky, pipety (automatické), míchací tyčinky, odměrné

Více

Název: Acidobazické indikátory

Název: Acidobazické indikátory Název: Acidobazické indikátory Autor: Mgr. Jiří Vozka, Ph.D. Název školy: Gymnázium Jana Nerudy, škola hl. města Prahy Předmět, mezipředmětové vztahy: chemie, biologie, fyzika Ročník: 3. (1. ročník vyššího

Více

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní

Více

ANTIBIOTICKÉ DISKY Antibiotické disky pro testování citlivosti

ANTIBIOTICKÉ DISKY Antibiotické disky pro testování citlivosti ANTIBIOTICKÉ DISKY Antibiotické disky pro testování citlivosti POPIS ANTIBIOTICKÉ DISKY jsou papírové disky se speciálními vlastnostmi, které jsou impregnované antibiotiky a používají se pro testy citlivosti

Více

cobas 4800 BRAF V600 Mutation Test BRAF

cobas 4800 BRAF V600 Mutation Test BRAF cobas 4800 BRAF V600 Mutation Test PRO ÚČELY DIAGNOSTIKY IN VITRO. cobas DNA Sample Preparation Kit DNA SP 24 Tests P/N: 05985536190 cobas 4800 BRAF V600 Mutation Test BRAF 24 Tests P/N: 05985595190 POZNÁMKA:

Více

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 3 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 02.06.2014 Ročník: 6AF, 6BF Anotace DUMu: chromatin - stavba, organizace a struktura

Více

STANOVENÍ REZIDUÍ INHIBIČNÍCH LÁTEK V MLÉCE

STANOVENÍ REZIDUÍ INHIBIČNÍCH LÁTEK V MLÉCE STANOVENÍ REZIDUÍ INHIBIČNÍCH LÁTEK V MLÉCE DAVID ŠILHA IVETA BROŽKOVÁ Univerzita Pardubice Fakulta chemicko technologická Katedra biologických a biochemických věd Centralizovaný rozvojový projekt MŠMT

Více

Experiment C-16 DESTILACE 2

Experiment C-16 DESTILACE 2 Experiment C-16 DESTILACE 2 CÍL EXPERIMENTU Získání informací o třech klasických skupenstvích látek, změnách skupenství (jedné z fázových změn), křivkách ohřevu a ochlazování a destilační křivce. Prozkoumání

Více

Gramovo barvení bakterií

Gramovo barvení bakterií Předmět: Biologie ŠVP: Prokaryotní organismy Doporučený věk žáků: 16-18 let Doba trvání: 45 minut Specifické cíle: poznat jednu z nejdůležitějších a nejpoužívanějších mikrobiologických technik Seznam pomůcek:

Více

ZÁVĚREČNÝ PROTOKOL O TESTOVÁNÍ BIOAKTIVNÍCH VLASTNOSTÍ LÁTKY CYTOPROTECT

ZÁVĚREČNÝ PROTOKOL O TESTOVÁNÍ BIOAKTIVNÍCH VLASTNOSTÍ LÁTKY CYTOPROTECT MIKROBIOLOGICKÝ ÚSTAV Akademie věd České republiky Vídeňská 1083, 420 20 Praha 4 Krč Imunologie a gnotobiologie ZÁVĚREČNÝ PROTOKOL O TESTOVÁNÍ BIOAKTIVNÍCH VLASTNOSTÍ LÁTKY CYTOPROTECT Zadání: Na základě

Více

Metody detekce poškození DNA

Metody detekce poškození DNA STABILITA GENOMU II. Metody detekce poškození DNA Metody detekce poškození DNA Možnosti stanovení: 1. poškození DNA per se nebo 2. jeho následky mutace genů a mutace chromosomů 1. Detekce poškození DNA

Více

Konfirmace HPLC systému

Konfirmace HPLC systému Mgr. Michal Douša, Ph.D. Obsah 1. Měření modulové... 2 1.1 Těsnost pístů tlakový test... 2 1.2 Teplota autosampleru (správnost a přesnost)... 2 1.3 Teplota kolonového termostatu... 2 1.3.1 Absolutní hodnota...

Více

ZÁKLADNÍ KURZ ANALÝZY STRUKTURY A INTERAKCÍ BIOMAKROMOLEKUL

ZÁKLADNÍ KURZ ANALÝZY STRUKTURY A INTERAKCÍ BIOMAKROMOLEKUL ZÁKLADNÍ KURZ ANALÝZY STRUKTURY A INTERAKCÍ BIOMAKROMOLEKUL NÁVODY KE CVIČENÍM EDITOVAL: VÁCLAV BRÁZDA BIOFYZIKÁLNÍ ÚSTAV AV ČR, V.V.I. I. TURNUS: 23. 4. 27. 4. 2012 / II. TURNUS: 14. 5. 18. 5. 2012 ZÁKLADNÍ

Více

Metody spektrální. Metody molekulové spektroskopie. UV-vis oblast. Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti

Metody spektrální. Metody molekulové spektroskopie. UV-vis oblast. Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Metody spektrální Metody molekulové spektroskopie UV-vis oblast Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Absorpční spektro(foto)metrie - v ultrafialové (UV) a viditelné (VIS)

Více

HyServe Lumitester PD20 + LuciPac Pen. Lumitester PD20 + LuciPac PEN. Inovované monitorování hygieny metodou stanovení ATP-AMP

HyServe Lumitester PD20 + LuciPac Pen. Lumitester PD20 + LuciPac PEN. Inovované monitorování hygieny metodou stanovení ATP-AMP HyServe Lumitester PD20 + LuciPac Pen Lumitester PD20 + LuciPac PEN Inovované monitorování hygieny metodou stanovení ATP-AMP Objevte novou dimenzi monitorování hygieny HACCP je záležitostí dokonalé čistoty

Více

Měření koncentrace roztoku absorpčním spektrofotometrem

Měření koncentrace roztoku absorpčním spektrofotometrem Měření koncentrace roztoku absorpčním spektrofotometrem Teoretický úvod Absorpční spektrofotometrie je metoda stanovení koncentrace disperzního podílu analytické disperze, založená na měření absorpce světla.

Více

POKROČILÝ KURZ MODERNÍ BIOFYZIKÁLNÍ METODY BIOFYZIKÁLNÍ ÚSTAV AV ČR, V.V.I. EDITOVAL: VÁCLAV BRÁZDA NÁVODY KE CVIČENÍM

POKROČILÝ KURZ MODERNÍ BIOFYZIKÁLNÍ METODY BIOFYZIKÁLNÍ ÚSTAV AV ČR, V.V.I. EDITOVAL: VÁCLAV BRÁZDA NÁVODY KE CVIČENÍM POKROČILÝ KURZ MODERNÍ BIOFYZIKÁLNÍ METODY NÁVODY KE CVIČENÍM BIOFYZIKÁLNÍ ÚSTAV AV ČR, V.V.I. EDITOVAL: VÁCLAV BRÁZDA BIOFYZIKÁLNÍ ÚSTAV AV ČR, V.V.I. I. TURNUS: 22. 10. 26. 10. 2012 / II. TURNUS: 29.

Více

STANOVENÍ, CHARAKTERIZACE A IDENTIFIKACE BIOREMEDIAČNÍCH MIKROORGANISMŮ

STANOVENÍ, CHARAKTERIZACE A IDENTIFIKACE BIOREMEDIAČNÍCH MIKROORGANISMŮ Abstrakt STANOVENÍ, CHARAKTERIZACE A IDENTIFIKACE BIOREMEDIAČNÍCH MIKROORGANISMŮ Jana Chumchalová, Eva Podholová, Jiří Mikeš, Vlastimil Píštěk EPS, s.r.o., V Pastouškách 205, 686 04 Kunovice, e-mail: eps@epssro.cz

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 I n v e s t i c e d o r o z v o j e v z d ě l á v á n í Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Jméno a příjmení. Ročník. Měřeno dne. 21.3.2012 Příprava Opravy Učitel Hodnocení

Jméno a příjmení. Ročník. Měřeno dne. 21.3.2012 Příprava Opravy Učitel Hodnocení FYZIKÁLNÍ PRAKTIKUM Ústav fyziky FEKT VUT BRNO Jméno a příjmení Vojtěch Přikryl Ročník 1 Předmět IFY Kroužek 35 ID 143762 Spolupracoval Měřeno dne Odevzdáno dne Daniel Radoš 7.3.2012 21.3.2012 Příprava

Více

Počítačová chemie. výpočetně náročné simulace chemických a biomolekulárních systémů. Zora Střelcová

Počítačová chemie. výpočetně náročné simulace chemických a biomolekulárních systémů. Zora Střelcová Počítačová chemie výpočetně náročné simulace chemických a biomolekulárních systémů Zora Střelcová Národní centrum pro výzkum biomolekul, Masarykova univerzita, Kotlářská 2, 611 37 Brno, Česká Republika

Více

Základy mikroskopie. Úkoly měření: Použité přístroje a pomůcky: Základní pojmy, teoretický úvod: Úloha č. 10

Základy mikroskopie. Úkoly měření: Použité přístroje a pomůcky: Základní pojmy, teoretický úvod: Úloha č. 10 Úloha č. 10 Základy mikroskopie Úkoly měření: 1. Seznamte se základní obsluhou třech typů laboratorních mikroskopů: - biologického - metalografického - stereoskopického 2. Na výše jmenovaných mikroskopech

Více

Využití UV/VIS a IR spektrometrie v analýze potravin

Využití UV/VIS a IR spektrometrie v analýze potravin Využití UV/VIS a IR spektrometrie v analýze potravin Chemické laboratorní metody v analýze potravin MVDr. Zuzana Procházková, Ph.D. MVDr. Michaela Králová, Ph.D. Spektrometrie: základy Interakce záření

Více

UNIVERZITA PARDUBICE FAKULTA CHEMICKO-TECHNOLOGICKÁ

UNIVERZITA PARDUBICE FAKULTA CHEMICKO-TECHNOLOGICKÁ UNIVERZITA PARDUBICE FAKULTA CHEMICKO-TECHNOLOGICKÁ BAKALÁŘSKÁ PRÁCE 2014 Aneta Sedlmajerová UNIVERZITA PARDUBICE FAKULTA CHEMICKO-TECHNOLOGICKÁ KATEDRA BIOLOGICKÝCH A BIOCHEMICKÝCH VĚD FLUORESCENČNÍ MIKROSKOPIE

Více

energetického využití odpadů, odstraňování produktů energetického využití odpadů, hodnocení dopadů těchto technologií na prostředí.

energetického využití odpadů, odstraňování produktů energetického využití odpadů, hodnocení dopadů těchto technologií na prostředí. Příjemce projektu: Partner projektu: Místo realizace: Ředitel výzkumného institutu: Celkové způsobilé výdaje projektu: Dotace poskytnutá EU: Dotace ze státního rozpočtu ČR: VŠB Technická univerzita Ostrava

Více

Eva Benešová. Dýchací řetězec

Eva Benešová. Dýchací řetězec Eva Benešová Dýchací řetězec Dýchací řetězec Během oxidace látek vstupujících do různých metabolických cyklů (glykolýza, CC, beta-oxidace MK) vznikají NADH a FADH 2, které následně vstupují do DŘ. V DŘ

Více

METABOLISMUS SACHARIDŮ

METABOLISMUS SACHARIDŮ METABOLISMUS SAHARIDŮ A. Odbourávání sacharidů - nejdůležitější zdroj energie pro heterotrofy - oxidací sacharidů až na. získávají aerobní organismy energii ve formě. - úplná oxidace glukosy: složitý proces

Více

Metodika detekce vnitřního genu hrachu setého lektinu pomocí PCR

Metodika detekce vnitřního genu hrachu setého lektinu pomocí PCR Aleš Vráblík, Jan Hodek, Jaroslava Ovesná Metodika detekce vnitřního genu hrachu setého lektinu pomocí PCR METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2012 Metodika byla vypracována pracovníky

Více

Laboratorní cvičení z kinetiky chemických reakcí

Laboratorní cvičení z kinetiky chemických reakcí Laboratorní cvičení z kinetiky chemických reakcí LABORATORNÍ CVIČENÍ 1. Téma: Ovlivňování průběhu reakce změnou koncentrace látek. podmínek průběhu reakce. Jednou z nich je změna koncentrace výchozích

Více

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno Zpracování a využití biologického materiálu pro výzkumné účely od nemocných s monoklonální gamapatií Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie,

Více

JIC, zájmové sdružení právnických osob Brno, U Vodárny 2, PSČ 616 00 tel. +420 511 205 330 fax +420 541 143 011 e-mail jic@jic.cz www.jic.

JIC, zájmové sdružení právnických osob Brno, U Vodárny 2, PSČ 616 00 tel. +420 511 205 330 fax +420 541 143 011 e-mail jic@jic.cz www.jic. JIC, zájmové sdružení právnických osob Brno, U Vodárny 2, PSČ 616 00 tel. +420 511 205 330 fax +420 541 143 011 e-mail jic@jic.cz www.jic.cz zprostředkovávání zaměstnanců na pracovní pozice v top, nižším

Více

POUŽITÍ PROPUSTNÉ REAKTIVNÍ BARIÉRY Z NULMOCNÉHO ŽELEZA V SANACI CHLOROVANÝCH ETYLENŮ A JEJÍ VLIV NA BAKTERIÁLNÍ OSÍDLENÍ PODZEMNÍ VODY

POUŽITÍ PROPUSTNÉ REAKTIVNÍ BARIÉRY Z NULMOCNÉHO ŽELEZA V SANACI CHLOROVANÝCH ETYLENŮ A JEJÍ VLIV NA BAKTERIÁLNÍ OSÍDLENÍ PODZEMNÍ VODY POUŽITÍ PROPUSTNÉ REAKTIVNÍ BARIÉRY Z NULMOCNÉHO ŽELEZA V SANACI CHLOROVANÝCH ETYLENŮ A JEJÍ VLIV NA BAKTERIÁLNÍ OSÍDLENÍ PODZEMNÍ VODY Mgr. Marie Czinnerová Technická univerzita v Liberci Ústav pro nanomateriály,

Více

Mobilní Ramanův spektrometr Ahura First Defender

Mobilní Ramanův spektrometr Ahura First Defender ČVUT v Praze, Kloknerův ústav, Šolínova 7, Praha 6 Mobilní Ramanův spektrometr Ahura First Defender Příručka Ing. Daniel Dobiáš, Ph.D. Doc. Ing. Tomáš Klečka, CSc. Praha 2009 Anotace Příručka obsahuje

Více

Analyzátory moči a močového sedimentu

Analyzátory moči a močového sedimentu KATALOG 2013 Dirui Industrial Co., Ltd Analyzátory moči a močového sedimentu Katalog produktů firmy DIRUI Analyzátory moči a močového sedimentu Analyzátory přístrojové vybavení Název Popis H-100 - analyzátor

Více

Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody

Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody Návod k použití souprav Wipe test Kontaminační kontrola Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody REF 7091 40 reakcí 1. Popis výrobku V posledních letech se

Více

TOP PRODUKTY PRO LABORATOŘ

TOP PRODUKTY PRO LABORATOŘ NO VÉ P RODUK TY TOP PRODUKTY PRO LABORATOŘ LABORATORNÍ PŘÍSTROJE SPOTŘEBNÍ LABORATORNÍ MATERIÁL Dialab spol.s r.o. je členem asociace CZEDMA ČESKÁ SPOLEČNOST KLINICKÉ BIOCHEMIE Česká lékařská společnost

Více