Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin. Tvorba vektorů pro indukci rezistence u rostlin Bakalářská práce

Rozměr: px
Začít zobrazení ze stránky:

Download "Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin. Tvorba vektorů pro indukci rezistence u rostlin Bakalářská práce"

Transkript

1 Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Tvorba vektorů pro indukci rezistence u rostlin Bakalářská práce Vedoucí práce: Ing. Pavel Hanáček, Ph.D. Vypracovala: Denisa Hamplová Brno 2013

2 PROHLÁŠENÍ Prohlašuji, že jsem bakalářskou práci na téma Tvorba vektorů pro indukci rezistence u rostlin vypracoval(a) samostatně a použil(a) jen pramenů, které cituji a uvádím v přiloženém seznamu literatury. Bakalářská práce je školním dílem a může být použita ke komerčním účelům jen se souhlasem vedoucího diplomové práce a děkana Agronomické fakulty Mendelovy univerzity v Brně. dne. podpis bakaláře.

3 PODĚKOVÁNÍ Ráda bych touto cestou poděkovala vedoucímu mé bakalářské práce Ing. Pavlu Hanáčkovi, Ph.D., za pomoc a odborné rady při zpracování práce, také za ochotu a vřelý přístup mi vše vysvětlit. Dále bych chtěla poděkovat Ing. Michalu Röhrerovi za pomoc při práci v laboratoři. Veliké díky patří také mé rodině, která mě vždy podporovala při studiu.

4 ABSTRAKT S pokrokem v zemědělství došlo k vývoji technologií, které umožňují vnášet do genetické informace nové geny pocházející z různých organismů. To vede mimo jiné k pěstování rostlin, které nesou rezistenci k hmyzím škůdcům. Díky tomu dochází k poklesu množství používaných insekticidů a snižuje se tak negativní dopad na životní prostředí. V této práci bylo cílem vytvořit funkční konstrukt, kterým bude možno pomocí bakterie Agrobacterium tumefaciens transformovat dvouděložné rostliny. Vytvořený konstrukt pwell16 nesoucí gen pro inhibitor proteáz (NcPIb) ze slin švába šedého (Nauphoeta cinerea) byl testován na modelové rostlině tabáku virginském (Nicotiana tabacum). Pro zajištění exprese genu NcPIb v rostlinách byl tento gen vložen pod promotor rbcs, jedná se o silný světlem řízený promotor, který pochází z hexaploidní chryzantémy (Outchkourov et al., 2003). Pro ověření správnosti transformace listových disků tabáku byl použit histochemický GUS test. Klíčová slova: transformace, NcPIb, inhibitor proteáz, Agrobacterum tumefaciens, tabák virginský, GUS test

5 ABSTRACT The development of technologies that alow us to transfer gene to genetic information from various organisms is the part of progress in a agriculture. This leeds among others to growing plants which are resistant to insect pest. This causes a decrease in the amount of used insecticides and reduce the negative effects on the environment. The goal of this work has been to create a functional construct that will be able to trasform dicotyledonous plants. The construct pwell16 has been created and the gene for protease inhibitor (NcPIb) of cockroach`s saliva (Nauphoeta cinerea) is a part of that. Tobacco (Nicotiana tabacum) was a model plant for transformatoin. The gene NcPIb was inserted among the rbcs1 sequences (strong promotor that comes from hexaploid chrysanthemum controlled by light) to ensure the expression of gene in plants. The validity of transformation of tobacco leaf discs was confirmed by use of histochemical GUS test. Key words: transformation, NcPIb, protease inhibitor, Agrobacterum tumefaciens, Nicotiana tabacum, GUS test

6 OBSAH 1 ÚVOD Cíl práce LITERÁRNÍ PŘEHLED Geneticky modifikované rostliny Legislativa GMO Rizika geneticky modifikovaných rostlin Využití geneticky modifikovaných rostlin v zemědělství Klonovací vektory pro vyšší rostliny Transformace prostřednictvím bakterií Agrobacterium tumefaciens Ti plazmid Agrobacterium tumefaciens Úsek virulence plazmidu Ti Agrobakteriální vektory Kointegrativní vektory Binární vektory Signální (reportérové) geny Selektovatelné geny Regulační sekvence Přímé metody transformace Transgenoze protoplastů Elektroporace Mikroinjekce Transgenoze pletiv a orgánů Biolistika Rezistence k hmyzím škůdcům Využití Bacillus thuringiensis v rezistenci k hmyzím škůdcům Transgenní rostliny nesoucí Bt gen Inhibitory hmyzích proteáz Inhibitor NcPIb Inhibitory hmyzích amyláz Lektiny MATERIÁL A METODY ZPRACOVÁNÍ Použitý materiál Rostlinný materiál Bakteriální kultury Použité plazmidy Použitá média, roztoky složení Kultivační média pro elektroporované buňky Escherichia coli Média použitá pro kultivaci bakterií Escherichia coli Kultivační média pro transformaci listových disků tabáku Zásobní roztoky pro přípravu histochemického GUS testu Agarózová elektroforéza Metodika práce... 29

7 3.2.1 Amplifikace genu NcPIb Klonování genu NcPIb Purifikace plazmidové DNA pomocí GeneJET TM Plasmid Miniprep Kit Připojení genu NcPIb k regulačním sekvencím rbcs Restrikce plazmidů pgem-t + NcPIb a ImpactVector Purifikace DNA fragmentů vyřezaných z agarózového gelu pomocí Invisorb Fragment CleanUp Ligace genu NcPIb do plazmidu ImpactVector Klonování plazmidu ImpactVector1.3 pomocí kompetentních buněk E. coli Vložení expresní kazety rbcs1::ncpib do plazmidu pwell02b Restrikce plazmidů pwell02b a ImpactVector Zatupování a ligace expresní kazety rbcs1::ncpib do plazmidu pwell02b Kontrolní restrikce plazmidů pwell Elektroporace plazmidu pwell16 do Agrobacterium tumefaciens Transformace listových disků Kultivace transformovaného tabáku Histochemický GUS test transformovaných rostlin VÝSLEDKY Založení pokusu Amplifikace sekvence pro NcPIb Klonování genu NcPIb Ligace NcPIb do pgem-t plazmidu Klonování plazmidu v buňkách Escherichia coli Připojení genu NcPIb k regulačním sekvencím rbcs Vložení expresní kazety rbcs1::ncpib do plazmidu pwell02b Plazmid pwell Transformace listových disků tabáku pomocí A. tumefaciens Ověření transformace regenerovaných rostlin DISKUZE ZÁVĚR SEZNAM POUŽITÉ LITERATURY SEZNAM OBRÁZKŮ SEZNAM TABULEK SEZNAM POUŽITÝCH ZKRATEK PŘÍLOHY... 62

8 1 ÚVOD Zásadní objevy v oblasti molekulární biologie a genetiky z druhé poloviny minulého století umožnily upravovat soubor dědičných vlastností organismů způsobem, který přirozenou cestou není možný. Lidstvu se otevřely zdánlivě neomezené možnosti přenosu genů mezi organismy, rostlinami a živočichy navzájem, včetně možnosti vkládání lidských genů do jiných organismů. Každá nová technologie v době svého vzniku přináší mnoho otázek, s každou jsou spojeny výhody, ale zároveň i rizika, která musíme vyhodnocovat a minimalizovat. Použití geneticky modifikovaných organismů představuje takovou technologii, kolem níž se vedou vzrušené diskuse: zatímco pro někoho je logickým vyústěním tisícileté tradice šlechtění, pro jiné znamená něco nepřirozeného, co ohrožuje naše zdraví i přírodu. Mnoho lidí není obeznámeno se skutečností, že bez geneticky modifikovaných mikroorganismů nebo laboratorních zvířat bychom neměli některé léky, vitamíny a speciální chemikálie (Doubková, 2011). V mnoha zemích, především v EU jsou geneticky modifikované plodiny vnímány jako rizikové. Názory se pohybují od jednoho extrému veškerý výzkum GM plodin má být zastaven a všechny GM potraviny zničeny až po druhý extrém GM potraviny jsou zcela bezpečné a mají úžasný potenciál zlepšit výživu člověka a jeho zdraví po celém světě (Snustad et Simmons, 2009). 1.1 Cíl práce Cílem mé bakalářské práce bylo vytvořit agrobakteriální vektorový konstrukt obsahující jako cílový gen inhibitor hmyzí proteázy pod silným promotorem pro navození rezistence rostlin vůči požerovému hmyzu a ověřit jeho funkčnost transformací tabáku jako modelové rostliny. 8

9 2 LITERÁRNÍ PŘEHLED 2.1 Geneticky modifikované rostliny Cílem tradičního šlechtění i genetického inženýrství je identifikovat žádoucí genetické vlastnosti a spojit je v rostlinné odrůdy, které lze použít v zemědělství. Žádoucí znaky lze rozdělit do dvou skupin agronomické charakteristiky, např. odolnost vůči chorobám, hmyzu a herbicidům, také schopnost prospívat za nepříznivých ekologických podmínek. Druhou skupinou znaků jsou kvalitní vlastnosti výrobku, tím rozumíme zpracování, konzervaci, množství živin a také chuť finálního produktu. Klasické šlechtění však kombinuje jen varianty stejného druhu a vybírá potomstvo na základě selekce. Zatímco genetické manipulace a nové biotechnologie umožňují přenášet geny mezi druhy z různých biologických říší a tím rozšiřují rozsah genetických variant (Nelson, 2001). Jeden z nejslavnějších dosavadních úspěchů byl vývoj Flavr Savr rajčete, u kterého bylo zpomaleno dozrávání. Bylo vyvinuto pomocí antisense technologie ke snížení enzymu, který je zodpovědný za jeden z kroků syntézy etylénu. Produkt RNA tohoto antisense genu hybridizuje mrna normálního genu a tím jeho expresi blokuje (Halford, 2003). Ve světě jsou nejpěstovanější tři GMO plodiny: Bt kukuřice a Bt bavlník odolný vůči zavíječi kukuřičnému a sója s odolností ke glyfosátu. K největším producentům patří bezesporu Spojené státy, následuje Argentina, Kanada a Čína (Nelson, 2001). V ČR se pěstuje už jen GM kukuřice MON 810, s celkovou výměrou plochy 3050 ha v roce 2012 (Faltejsek, 2012) Legislativa GMO Při posuzování rizik se bere v potaz (u nás i v EU, s níž jsou naše zákony sladěny) nejen ohrožení zdraví člověka a zvířat, ale také nepříznivé působení na životní prostředí a na snižování biologické rozmanitosti. Od poslední zásadní novelizace Zákona č. 78/2004 Sb., o nakládání s geneticky modifikovanými organismy a genetickými produkty, která vstoupila v platnost roku 2005 (Zákon č. 346/2005 Sb.), jsou již dosti přesně vymezena nejen pravidla, ale i postihy, povinnosti značení produktů vyráběných z GMO, ohlašovací povinnosti a registrace, povinnosti monitoringu i složení a fungování poradního sboru. Prováděcím předpisem k zákonu o nakládání s geneticky modifikovanými organismy a genetickými produkty je Vyhláška č. 209/2004 Sb., o bližších podmínkách nakládání s GMO, ve znění Vyhlášky 86/2006 Sb. Zmiňuje se o 9

10 technických řešeních, pomocí kterých může vzniknout GMO, o požadavcích na uzavřený prostor, o ochranných opatřeních (Vondrejs, 2010). Dále Nařízení Evropského parlamentu a Rady (ES) č. 1830/2003 o sledovatelnosti a označování GMO a Nařízení Evropského parlamentu a Rady (ES) č. 1946/2003 o přeshraničních pohybech GMO (MŽP, 2012) Rizika geneticky modifikovaných rostlin Již po tisíciletí člověk vylepšuje vlastnosti plodin pomocí selektivního šlechtění. Tato metoda je však velice zdlouhavá, náročná a především je mnoho nežádoucích genů přeneseno společně s geny našeho zájmu do genomu rostliny. Nyní můžeme identifikovat užitečné geny, izolovat je a vložit přímo do rostliny. I tato nová technologie však nese s sebou určitá rizika a úskalí (Weaver et Hedrick, 1997). Dříve než jsou GM plodiny zavedeny do praxe, projdou rozsáhlým řetězcem laboratorních studií, polních zkoušek a testů zdravotní nezávadnosti pro člověka i zvířata, např. testy toxicity a alergenity. V neposlední řadě pak dosti náročnými schvalovacími procesy v zemích původu a v zemích dalšího pěstování (Rakouský, 2003). Teoreticky lze uvažovat o nejrůznějších účincích GM plodin na životní prostředí, zatím však nebyly prokázány žádné významné vlivy těchto organismů na přírodní společenstva (Rakouský, 2003). Mezi potencionální rizika GM plodin patří především neznámé důsledky jejich zavádění do životního prostředí. A to zejména pro biologickou rozmanitost v důsledku invasního charakteru či zvýšené konkurenční schopnosti nebo přenosu insertovaného genetického materiálu na další rostliny prostřednictvím přenášeného pylu, např. u GM řepky a pšenice (Rulfová, 2005). Na základě stávajících zkušeností s geneticky modifikovanými plodinami se ukazuje, že největší obavy jsou spojovány právě s potencionálním rizikem přenosu transgenů do téže nemodifikované plodiny. Obecnými závěry studií hybridizace, jejichž údaje byly získány na základě studií přírodních populací, jsou zjištění, že křížení je běžným jevem a přestože se může vytvářet velmi početné potomstvo hybridů, pouze velmi malá část se uplatní v přírodních podmínkách, většina je málo vitální až sterilní (Rakouský, 2003). Odpůrci dále namítají, že při pěstování geneticky modifikovaných plodin, např. u bramboru Amflora s vneseným selekčním genem nptii (navozující rezistenci ke kanamycinu), se může zvýšit rezistence choroboplodných bakterií vůči antibiotikům a ztíží se tak léčba některých infekčních chorob. V gramu půdy je však půl až miliarda 10

11 bakteríí, z nichž 5-15 % je rezistentní na antibiotika. Dostávají se běžně do naší potravy, hygienická norma povoluje deset miliónů bakteríí v gramu potravy. Tudíž člověk sní denně stovky milónů takových genů. Jsou to bakteriální geny, které se snadno přenesou na jiné bakterie, naproti tomu přenos z rostlin na bakterie je velmi obtížný a řídký (Drobník, 2012). Další problém je negativní dopad na organismy, které nepatří do cílové skupiny škůdců. Ukázalo se, že pokud jsou larvy motýla monarchy vystavené pylu Bt kukuřice, pouze necelých 80 % z nich dosáhne dospělého stádia (Losey et al., 1999). Tuto studii ovšem vyvrací novější práce, metodicky správnější a komplexnější (Stanley-Horn, 2001). Uvádí, že případný účinek pylu z GM rostlin na housenky motýla přichází v úvahu, pokud se překrývá doba kvetení kukuřice s dobou stěhování motýla. Pyl v praxi nejrozšířenějších typů Bt kukuřice má minimální, případně žádný vliv na úhyn housenek monarcha. Daleko větší vliv má používaná agrotechnika, zejména pesticidy (Rakouský, 2003) Využití geneticky modifikovaných rostlin v zemědělství Transgenní rostliny nesou mnoho cenných vlastností: odolnost vůči škůdcům a patogenům, tolerance k herbicidům a suchu, kvalitní rysy (složení mastných kyselin a aminokyselin), opoždění senescence a zdravější produkty (Singh, 2003). Stále převažuje používání dvou základních typů modifikací sloužících k usnadnění agrotechniky: do rostlin je vložen gen pro toleranci k určitému herbicidu (komerční označení např. Roundup Ready) nebo gen způsobující odolnost vůči hmyzím škůdcům - Bt modifikace. Všechny Bt plodiny rezistentní ke hmyzím škůdcům mají minimálně jeden gen z Bacillus thuringiensis (Wu, 2006). Tyto geny jsou označovány jako δ-endotoxiny. Například bílkoviny Cry1A a Cry1C z Bacillus thuringiensis chrání rostliny proti larválním formám zavíječe kukuřičného (Tamarin, 2002). Napadení rostliny škůdcem nemá za následek pouze ztrátu biomasy, ale také se tím otevírá cesta pro sekundární infekce a hmyzí škůdci slouží jako aktivní přenašeči některých, např. virových onemocnění. Houba rodu Fusarium, která napadá kukuřici po napadení zavíječem kukuřičným má velký negativní dopad na celkovou kvalitu sklizně. Produkuje jako sekundární metabolity mykotoxiny, které jsou karcinogenní a toxické pro živočichy. V Bt kukuřici je hladina těchto mykotoxinů výrazně snížena. Bt plodiny přinášejí 11

12 pozitivní efekt v podobě omezení aplikace chemických insekticidů na cílového škůdce a s tím spojené úspory pohonných hmot (Wu, 2006). Biotechnologický výzkum se zaměřuje také na řešení problémů, které jsou rozhodující pro rozvojové země. Nejznámější je zlatá rýže, která obsahuje β-karoten jako zdroj vitamínu A (Doubková, 2008). U dětí v rozvojových zemích způsobuje nedostatek vitamínu A slepotu a dýchací potíže. V roce 1999 profesor Potrykus vyvinul tuto zlatou rýži, která obsahuje vitamín A nejen v listech, ale i v endospermu semen (Drobník, 2000). 2.2 Klonovací vektory pro vyšší rostliny Vývoj klonovacích vektorů pro vyšší rostliny spadá do 80. let 20. století, jejich použití vedlo k produkci geneticky modifikovaných plodin. U vyšších rostlin se uplatňují tři typy vektorových systémů: 1) Vektory založené na přirozeně se vyskytujících plazmidech bakterie Agrobacterium. 2) Přímý přenos plazmidové DNA do protoplastů elektroporací či mikroinjekcí. 3) Vektory založené na rostlinných virech (Brown, 2007) Transformace prostřednictvím bakterií Agrobacterium tumefaciens Půdní bakterie Agrobacterium tumefaciens, z čeledi Rhizobiaceae, způsobuje u dvouděložných rostlin krčkové nádory, známé jako crown galls, jež jsou způsobeny transformovanými rostlinnými buňkami (Tamarin, 2002). I další druhy půdních bakterií indukují morfologické změny rostlin, avšak pouze u rodu Agrobacterium bylo dokázáno, že vnáší své specifické geny do rostlinného genomu. Schopnost bakterie infikovat rostlinu je důsledkem přítomností velkého Ti plazmidu (tumor inducing). Část plazmidu se nazývá T-DNA (transferred DNA) a pomocí molekulárních metod se dá upravovat a vnášet tak do rostlin různé geny (Ondřej, 1992). T- DNA obohacuje rostlinný genom o dva základní typy genů: 1. Geny pro syntézu rostlinných hormonů auxinů a cytokininů, které poté působí dediferenciaci rostlinných buněk. Transformovaná pletiva rostou jako nádory. 2. Geny pro syntézu nádorově specifických látek opinů (estery bazických aminokyselin), které slouží jako zdroj uhlíku, dusíku a energie pro Agrobacterium tumefaciens. Bakterie tedy vkládají do rostlinných pletiv 12

13 genetickou informaci pro syntézu látek, které samy spotřebovávají (Ondřej et Drobník, 2002). K infekci bakterií dochází, když je rostlina poraněná. Bakterie rozpozná molekuly fenolických látek typu acetosyringonu, jež poraněné buňky vylučují, a pomocí receptorů je chemotaxí přitahována k rostlinným pletivům. Poté bakterie nasedne na buněčné stěny a dojde k aktivaci genů na úseku virulence. Tento proces je zprostředkován proteiny, které jsou kódovány geny bakteriálního chromozomu chva, chvb a psca. Následně rostlina stimuluje transkripci genů lokalizovaných na části plazmidu Ti, který má velikost kb, což představuje asi 3 % délky chromozomu A. tumefaciens. Délka přepisované části, T-DNA, činí v závislosti na typu asi 15 kb (Paolella, 1998). Rostlinné buňky začínají proliferovat a vytvářet nádor a začínají syntetizovat derivát argininu opin. V závislosti na kmenu A. tumefaciens je syntetizovaný opin buď nopalin nebo oktopin (Ondřej, 1992). Tyto opiny, jež jsou vylučovány do půdy a okolních netransformovaných pletiv, jsou degradovány a využívány infikujícími bakteriemi jako zdroj energie. Pro rostlinu nejsou žádným zřejmým přínosem, jedná se o genetický parazitismus (Snustad et Simmons, 2009) Ti plazmid Agrobacterium tumefaciens Plazmidy Ti jsou schopné indukovat tumory pouze v buňkách Agrobacterium. Aby docházelo k indukci tumorů u rostlin, musí být geny plazmidu v interakci s chromozomálními lokusy. Plazmid Ti má dva úseky nepostradatelné k indukci tumorů: T-DNA, která do rostlinných buněk vstupuje, ale sama nemá žádné geny pro vlastní integraci. Úsek virulence, který obsahuje geny nutné pro funkce podmiňující přenos T- DNA do rostlinných buněk a její náhodnou integraci v rostlinném genomu. Dále obsahuje další úseky, které jsou základem pro správnou interakci mezi rostlinnými buňkami a bakterií a pro funkci plazmidu v bakteriálních buňkách. Rozlišujeme dva typy plazmidů Ti, které se od sebe liší nopalinový a oktopinový typ. T-DNA nopalinového typu je kompaktní, zatímco T- DNA oktopinových plazmidů je rozdělena na dva úseky: levý (T L ), kde jsou přítomny geny pro dediferenciaci a nádorový růst, tudíž se vyskytuje vždy a pravý (T R ), který se může a nemusí vyskytovat (Ondřej, 1992). 13

14 Obr. 1 Schematická mapa standardního Ti plazmidu oktopinového kmene Agrobacterium tumefaciens (upraveno podle Vyskot, 1998) Úsek virulence plazmidu Ti Geny úseku virulence, který má délku 35 kb, zprostředkovávají oddělení T-DNA z plazmidu Ti a její přenos do rostlinné buňky. Úsek se skládá se z šesti operonů: vira, virb, virc, vird, vire a virg. Fenolické látky typu acetosyringonu mění konformaci proteinu buněčné stěny A. tumefaciens vira. Ten působí na protein virg, který aktivuje další geny virulence. Proteiny vird1 a vird2 vystřihnou jednovláknovou T-DNA z plazmidu Ti. Po vystřižení zůstává vird2 kovalentně připojen k 5 -konci uvolněné T- DNA. Ta je pak vnesena prostřednictvím různých proteinů virb do rostlinných buněk. Připojení vire2 po celé délce T-DNA vede teprve ke vzniku její komplexní přenosové struktury. Proteiny vird2 a vire2 zprostředkovávají vstup T-DNA do rostlinných buněk přes jaderné póry. V buněčných jádrech se T-DNA integruje do rostlinného genomu převážně v genových sekvencích, z hlediska pořadí bazí jsou to často místa bohatá na AT (Ondřej et Drobník, 2002). 14

15 2.2.2 Agrobakteriální vektory Agrobakteriální plazmidy, využívající přirozený rostlinný mechanismus transformace, jsou dnes nejčastějším způsobem pro přenos DNA do rostlin. Pro využití bakterií Agrobacterium jako vektorů transgenů je třeba z T-DNA odstranit původní geny a nahradit je jinými, což zabraňuje tvorbě nádorů (crown gall). Onkogeny a geny pro syntézu opinů, které jsou odstraněny z T-DNA, jsou nahrazeny geny našeho zájmu a dalšími geny kódujícími například selekční nebo reportérové markery. Ovšem zásadní překážkou je to, že plazmid o velikosti 200 kb zpravidla nemá unikátní restrikční místa. Proto byly vyvinuty strategie, s jejichž pomocí je možné do plazmidu vložit novou DNA. Jedná se o strategii kointegrativních a binárních vektorů (Brown, 2007). Základem strategie úprav T-DNA plazmidu Ti je využití klonovaných restrikčních štěpů T-DNA. Je možné celý plazmid Ti rozštěpit restrikční endonukleázou, tím vzniká více fragmentů. Důležité jsou ty fragmenty T-DNA, jež lze klonovat do malých vektorů a různě je spojovat. Je možné tak získat plazmid, který má jen krátký úsek s levou a pravou hraniční sekvencí, s úsekem jiné T-DNA mezi nimi, nejlépe s genem pro rezistenci k některému antibiotiku. Tento malý plazmid s úseky T-DNA se nazývá intermediární plazmid, protože je prostředníkem při modifikaci T-DNA plazmidu Ti. Do úseku T-DNA intermediárního plazmidu se vsune restrikčním štěpením a následnou ligací gen, který chceme do T-DNA plazmidu Ti vnést. Je výhodné, aby intermediární plazmid měl schopnost replikace v E. coli, ale ne v A. tumefaciens. Jestliže jsou takové intermediární plazmidy vneseny do velkého množství buněk agrobakteria, ať transformací nebo konjugací, udrží se trvale jen v těch buňkách, u kterých došlo k rekombinaci mezi homologními úseky plazmidu Ti a malého intermediárního plazmidu (Ondřej et Drobník, 2002) Kointegrativní vektory Strategie kointegrace používá plazmid odvozený z pbr322, který však nese malou část T-DNA, jež je zbavena onkogenů kódující tvorbu auxinů a cytokyninů. Nová molekula a Ti plazmid jsou homologní, to znamená, že pokud se současně vyskytují v jedné buňce A. tumefaciens, může v důsledku rekombinace dojít k integraci plazmidu pbr322 do části T-DNA. Klonovaný gen je tedy vložen do unikátního restrikčního místa na malém plazmidu pbr322, poté přenesen do buňky A. tumefaciens nesoucí plazmid Ti a nový gen je dále v rámci přirozeného rekombinačního procesu integrován 15

16 do T-DNA. Dále je pak spolu se zbytkem T-DNA v důsledku infekce integrován do rostlinného chromozomu Binární vektory Strategie binárního vektoru vychází ze zjištění, že T-DNA nemusí být nutně fyzicky spojena se zbytkem Ti plazmidu. Ukázalo se, že při transformaci rostlinných buněk je právě tak účinný systém dvou plazmidů. Jeden, který neobsahuje úsek T-DNA, ale obsahuje úsek virulence. Druhý, který obsahuje T-DNA nesenou jiným typem plazmidu, jež se replikuje v agrobakteriu a má selektovatelný gen pro rezistenci k některému antibiotiku. S plazmidem nesoucím T-DNA se pak pro menší velikost snadno manipuluje. Některé druhy A. tumefaciens mají dokonce přirozeně binární plazmidové systémy. Binární vektory se tedy skládají ze dvou plazmidů v téže buňce A. tumefaciens, z nichž jeden nese úsek virulence a druhý T-DNA (Brown, 2007). Manipulace in vitro se provádějí v Escherichia coli, proto mají plazmidy počátek replikace (ori) funkční jak v A. tumefaciens, tak v E. coli. Celý systém spočívá v tom, že do T-DNA výchozího vektorového plazmidu je včleněn gen, který má být přenesen do rostlin. Plazmid má v T-DNA zpravidla tzv. polylinkerovou sekvenci, tedy syntetickou sekvenci DNA, která se skládá z cílových míst pro více restrikčních endonukleáz uspořádaných za sebou. Gen, který se má včlenit do rostlin je vyštěpen z DNA, stejným restrikčním enzymem je rozštěpen v polylinkerovém úseku také vektorový plazmid a gen je včleněn ligací do plazmidu. Plazmid se pak transformací vpraví do buněk E. coli. Buňky s plazmidem se vyselektují a plazmid se v nich mnohonásobně klonuje. Po ověření předpokládané struktury se plazmid z buněk E. coli přenese do A. tumefaciens pomocí bakteriální konjugace nebo elektroporace. V části plazmidové DNA, která se uplatňuje v bakteriích, musí být gen pro rezistenci k některému antibiotiku. Použitím tohoto antibiotika se v bakteriálním médiu selektují ty buňky, do nichž byl plazmid úspěšně vnesen. V různých vektorech se používají geny pro rezistenci na kanamycin, tetracyklin nebo streptomycin. Zpravidla to nejsou antibiotika odvozená od penicilinu, protože některá z nich se výhodně používají v médiích pro rostlinné kultury, aby se rostlinné buňky zbavily bakterií A. tumefaciens. V T-DNA mají vektorové plazmidy selektovatelný gen, restrikční místo a reportérový gen. Jako první se do rostlin přenáší pravá hraniční sekvence, zatímco levá se přenáší jako poslední a přenos se nemusí vždy uskutečnit celý. Proto je výhodné, aby 16

17 selektovatelný gen ležel u levé hraniční sekvence. Pak je velmi pravděpodobné, že selektovatelné rostlinné buňky budou obsahovat i gen, který měl být přenesen. Optimální je, když tento gen leží mezi selekčním a reportérovým genem. Jestliže se do rostliny přenesly oba geny, je téměř jisté, že byl přenesen i prostřední gen (Ondřej et Drobník, 2002) Signální (reportérové) geny Jedná se o testovací geny, jejichž biochemický produkt můžeme kvantitativně stanovovat a snadno zjišťovat. Jsou používány k zjišťování stupně exprese transgenů s různými promotory a strukturou, v různých genotypech a pletivech a za různých podmínek. Jsou chimérické, tj. obsahují regulační sekvence pro projev v rostlinném genomu, zatímco kódující sekvence bývá živočišná či bakteriální (Bednář, 2000). Jedním z nejpoužívanějších reportérových genů je gen pro β-glukuronidázu (GUS) pocházející z E. coli. Enzym β-glukuronidáza je kyselá hydroláza, která štěpí snadno dostupné substráty na modře zbarvené nebo fluoreskující látky. Pro detekci aktivity enzymu existují dvě metody. První metoda je fluorescenční a provádí se v homogenátu se substrátem MUG (4-metyl-umbelliferylglukuronidem), který je štěpen enzymem. Poté modře fluoreskuje při ozáření dlouhovlnným zářením UV (365 nm). Druhá metoda je histochemická, využívající barvivo X-gluc (5-brom-4-chlor-3-indolylglukuronid), které po rozštěpení dává modře zbarvený reakční produkt ve vodě nerozpustný. Dalším nejvyužívanějším genem je GFP (green fluorescent protein) zeleně fluoreskující protein, který byl izolován z medúzy Aequorea victoria. Tento protein v přítomnosti iontů vápníku mění modré světlo, produkované proteinem aequorinem, na zelené světlo (Ondřej et Drobník, 2002). Je to jediný známý protein, který fluoreskuje bez dodávání substrátů nebo kofaktorů absorbuje světlo modré při nm a emituje světlo zelené při nm. GFP tak může být používán ke studiu genové exprese v živých buňkách a ke studiu lokalizace proteinů a jejich pohybu v buňkách v čase (Snustad et Simmons, 2009). Dále se využívá gen pro luciferázu světlušky Photynus pyralis nebo bakterie Vibrio harvei. K emisi viditelného záření dochází po dodání substrátu (luciferinu) k transgenním rostlinám. Toto záření lze měřit luminimetrem, scintilačním počítačem či zachycením na fotografický materiál. Tento systém je vysoce citlivý, ale luciferin 17

18 špatně proniká do pletiv. Také je substrát značně drahý, proto se tato metoda již téměř nepoužívá (Ondřej et Drobník, 2002) Selektovatelné geny Dobrým selekčním markerem je takový gen, který poskytuje rezistenci vůči určité látce přidávané do kultivačního média nebo používané k postřiku rostlin, což vede k selekci transgenních buněk a pletiv transformované rostlinné pletivo je schopno růstu. Selektivní látka inhibuje růst normálních rostlinných buněk nebo je pomalu usmrcuje. Podařila se konstrukce vektorů, které umožnily v rostlinách expresi bakteriálních genů pro rezistenci k antibiotikům. Nejrozšířenějším selektivním činidlem je u rostlin antibiotikum kanamycin, který je důležitou součástí dnes používaných vektorů. Tento gen kóduje enzym neomycin-fosfotransferázu typ II (nptii), což je jeden z několika prokaryotických enzymů, které inaktivují kanamycinovou rodinu aminoglykozidových antibiotik tím, že fosforylují (Snustad et Simmons, 2009). Kanamycin umožňuje nejen detekci transformace, ale také účinnou selekci transgenních pletiv (Bednář, 2000). Další nejběžnější selekční systémy jsou založeny na rezistenci k antibiotiku hygromycin (gen aphiv) a k herbicidům, jako např. fosfinotricin (gen bar) a glyfosát Regulační sekvence Vzhledem k tomu, že u bakterií a rostlin jsou odlišné promotorové sekvence a terminační signály transkripce, nelze přirozený gen izolovaný z bakterie použít u rostlin. Kódující sekvence musí být opatřena rostlinným promotorem směřujícím k 5 konci, který označuje počátek transkripce a podílí se na regulaci její intenzity a rostlinnými terminačními a polyadenylačními signály na 3 konci, které zajišťují konec transkripce na správném místě. Výběr regulačních sekvencí je velmi důležitý pro získání adekvátní genové exprese. Pro její zvýšení lze také použít silnější promotor. Využívají se také regulační sekvence rostlinných virů, jeden široce používaný promotor je 35S viru mozaiky květáku (Snustad et Simmons, 2009). 18

19 2.3 Přímé metody transformace Transformace vektorovým systémem bakterie Agrobacterium tumefacines není možná u všech rostlinných druhů. Přenos cizorodé DNA do jádra akceptorového organismu metodou přímé transformace je založen na chemickém, fyzikálním a elektrofyzikálním principu. Přímé vnášení cizorodé DNA má některé nevýhody, ale i některé přednosti proti aplikaci vektorových systémů bakterií Agrobacterium tumefaciens. Zásadní nevýhodou je limit velikosti přenášené DNA. Zatímco prostřednictvím bakterií Agrobacterium, je možno vkládat úseky DNA o délce 40 kb i větších, přímá transformace umožňuje vnášet podstatně kratší úseky. Hlavní výhodou je rozšíření spektra objektů, které lze transformovat. To se týká především jednoděložných rostlin, jako je kukuřice, rýže nebo pšenice, u kterých je transformace pomocí agrobakteria velice problematická (Ondřej, 1992) Transgenoze protoplastů V dřívějších experimentech s přímou aplikací cizorodé DNA, které již využívaly klonovaných selektovatelných genů, se obvykle vycházelo z rostlinných protoplastů. Buněčná stěna totiž představuje významnou bariéru průniku cizorodé DNA, a proto byla odstraněna. Pro potíže s regenerací rostlin z protoplastů se dnes dává přednost transgenozi celých pletiv. Čerstvě izolované protoplasty se inkubují v tlumivém roztoku s exogenní DNA. K příjmu roztoku DNA může docházet pouze endocytózou, kterou můžeme stimulovat dodáním polyetylenglykolu, elektroporací, mikroinjekcemi nebo působením iontů vápníku a zvýšeného ph (Ondřej et Drobník, 2002) Elektroporace Podstatou této metody je aplikace krátkého elektrického pulzu o vysokém napětí, který v buněčné membráně buněk vyvolá tvorbu mikropórů, kterými proniká exogenní DNA do cytoplazmy. Účinnost metody ovlivňuje síla aplikovaného elektrického pole, délka elektrického pulzu, teplota, koncentrace DNA a iontové složení média (Tamarin, 2002). Původně byla tato metoda vyvinutá pro fúzi buněk. Výhodou této metody je její jednoduchost a možnost přesně určit okamžik, kdy byla exogenní DNA vpravena do protoplastů (Ondřej, 1992). 19

20 Mikroinjekce Transformace přes mikroinjekci spočívá v zavádění DNA do jádra pomocí skleněné kapiláry v mikroinjekční pipetě. Mikroinjekce se používá zejména pro transformaci velkých živočišných buněk. Význam pro transformaci rostlinných buněk je spíše omezený vzhledem k vlastnostem buněčné stěny, která obsahuje silnou vrstvu ligninu a celulózy a tvoří tak překážku pro skleněné mikropipety. Transformace protoplastů pomocí mikroinjekce s sebou nese riziko uvolnění hydroláz a jiných toxických látek z vakuoly do cytoplazmy, což může způsobit rychlou smrt protoplastů (Rao et al., 2009) Transgenoze pletiv a orgánů Některé metody přímé transformace jsou použitelné i pro rostlinná pletiva a orgány, ne jen na rostlinné protoplasty. Uplatnění těchto metod je stále častější. Mezi ně patří mikroinjekce do buněčných jader, makroinjekce do pletiv, kokultivace mikrospor nebo pylových láček s exogenní DNA (Ondřej et Drobník, 2002) Biolistika Tato metoda patří k jedné z nejpoužívanějších a je založena na principu navázání DNA na mikročástice, které jsou potaženy zlatem, platinou či wolframem. Tyto mikročástice neboli mikroprojektily, o velikosti 2 µm se smíchají s roztokem plazmidové DNA. Voda se při laboratorní teplotě z roztoku odpaří a kuličky se poté vstřelují do pletiv přístrojem. Ten dává impulzy pro výstřel např. rychlým vyrovnáním přetlaku hélia. Ne všechny mikroprojektily se dostanou do pletiva, bylo zjištěno, že pouze 7 z 10% pronikne alespoň do epidermis. Je však třeba, aby pronikly do mezofylu, protože buňky epidermis nejsou schopny vytvořit kalus a pak diferencovat rostlinu. Aby došlo k integraci transgenu do genomu, je třeba, aby mikroprojektil pronikl do jádra a buňka přežila tento zásah (Ondřej et Drobník, 2002). 20

21 2.4 Rezistence k hmyzím škůdcům Herbivorní hmyz je častým a vážným omezením pro rostlinnou produkci. Využití rostlin s odolností vůči hmyzu je velmi efektivní způsob jak mít hmyzí škůdce pod kontrolou. Alternativní způsoby kontroly hmyzu jsou nutné kvůli negativnímu dopadu insekticidů na životní prostředí (Broekgaarden et al., 2011). Techniky genového inženýrství a tvorba geneticky modifikovaných rostlin rezistentních vůči hmyzu umožňují vnášet do rostlin geny, které nejsou pouze rostlinného původu. To u klasického šlechtění rostlin nelze provádět Využití Bacillus thuringiensis v rezistenci k hmyzím škůdcům Základním typem transgenu, který podmiňuje odolnost rostlin k hmyzím škůdcům, je gen pro δ-endotoxin bakterií Bacillus thuringiensis označován názvem Cry. Je to krystalický protein, netoxický pro obratlovce, ale velice toxický pro některé skupiny hmyzu. Bakterie syntetizuje tuto krystalickou bílkovinu za nepříznivých podmínek, kdy tvoří spory. Krystaly δ-endotoxinu se rozpouštějí v silně alkalickém prostředí trávící trubice hmyzu, po působení specifických proteáz, které odštěpují téměř 500 aminokyselin z C terminálního konce vysokomolekulárního protoxinu a několik aminokyselin z N-konce. Tím jsou toxiny aktivovány. Poté se specificky váží na specifické receptory na apikální části kartáčovité membrány epitelu střev citlivého hmyzu (Ondřej, 1992). V membránách buněk střeva vytvářejí póry, přes které proudí ionty a dochází k bobtnání buněk, plazmoptýze až k destrukci střeva. V důsledku toho hmyz hyne. První druhy této grampozitivní bakterie žijící v půdě (B. thuringiensis s aktivitou δ- endotoxinu proti broukům) byly izolovány v r (Sekar et al., 1987). Dříve již však byl B. thuringiensis objeven v Japonsku roku 1909 v podniku, kde se choval bourec morušový a způsoboval tam úhyn motýlů. Existuje mnoho kmenů této bakterie a každý vytváří jiný sporulační protein. Již bylo izolováno přes 150 druhů těchto protoxinů neboli δ-endotoxinů. Geny kódující toxin se rozdělují na 4 typy podle jejich specifity insekticidní účinnosti. Cry geny I. typu kódují proteiny se specifickou účinností proti larvám motýlů (Lepidoptera), geny II. typu proti larvám motýlů a dvoukřídlých (Diptera), geny III. typu proti larvám brouků (Coleoptera) a geny IV. typu kódují proteiny se specifickou účinností proti larvám dvoukřídlých (Ondřej et Drobník, 2002). 21

22 Transgenní rostliny nesoucí Bt gen Transgenní rostliny s expresí genu pro δ-endotoxin se nazývají rostlinné pesticidy, protože snižují náklady na ochranu porostů (Ondřej et Drobník, 2002). Komerční odrůdy transgenních rostlin byly vyvinuty v mnoha zemích. Avšak z počátku byla exprese žádaného genu nízká v důsledku nestabilní mrna či nesprávného sestřihu. Následné úpravy genů výrazně posílily úroveň exprese (Li et al., 2003). Tento gen byl vnesen především do kukuřice, bavlníku a sóji. Problémem je vznik rezistentních škůdců vůči tomuto toxinu. Byly vypracovány různé způsoby, jak udržet hladinu rezistence hmyzu na nízké úrovni. Většina mutací hmyzu na rezistenci k insekticidům je recesivních a v heterozygotním stavu je hmyz k Bt-toxinu citlivý. Toho využívá metoda refugií jestliže se nechá v blízkosti pole s transgenními rostlinami část pole s netransgenními rostlinami (refugium), tak po následném spáření rezistentní formy hmyzu s citlivou formou vznikají heterozygotní generace, které jsou stále citlivé k Bttoxinu. Tím se oddálí nástup zcela rezistentní populace hmyzu (Ondřej et Drobník, 2002) Inhibitory hmyzích proteáz Inhibitory proteáz různého původu jsou intenzivně zkoumanou skupinou potenciálně insekticidních či antifungálních látek. Proteázy (proteolytické enzymy) jsou enzymy, které katalyzují štěpení molekuly bílkoviny na menší řetězce a posléze až na jednotlivé aminokyseliny. Rozlišují se čtyři hlavní skupiny proteáz: serinové protézy obsahující v aktivním centru aminokyselinu serin, cysteinové obsahující cystein, asparátové se začleněným zbytkem kyseliny asparátové a metaloproteázy obsahující ve svém aktivním centru kovové ionty Zn 2+, Ca 2+ či Mn 2+. Inhibitory cysteinových proteáz byly popsány v řadě rostlinných druhů, např. u bramboru, vigny, avokáda či papáji. Nejvíce prostudovaný inhibitor je tzv. oryzacystatin pocházející z rýže. Asparátové proteázy byly nalezeny spolu s cysteinovými u několika zástupců ploštic Hemiptera. Inhibitory metaloproteáz byly nalezeny u bramboru a rajčat. Inhibitory proteáz hrají klíčovou roli v rostlinných obranných mechanismech vůči hmyzím škůdcům a patogenům. Dále regulují vývoj rostliny od vyklíčení až po senescenci a rostlinnou smrt. V rostlinách se vyskytují ve vysokých koncentracích a syntéza je indukována poškozením či probíhajícím napadením rostliny. Geny kódující tyto inhibitory se dají poměrně snadno přenášet z jednoho rostlinného (či živočišného) druhu do druhého a docílit tak jejich exprese za použití regulačních mechanismů. Tímto 22

23 způsobem Hilder et al. v roce 1987 transformovali tabák genem pro inhibitor trypsinu z bobovité rostliny vigny a navodili tak jeho zvýšenou odolnost vůči hmyzím škůdcům. Doposud nebyl potvrzen negativní účinek na vyšší organismy, dokonce se někteří autoři domnívají, že inhibitory proteáz mohou zvyšovat nutriční hodnotu vykazují totiž velmi široké spektrum inhibiční aktivity vůči mnoha organismům, jako např. háďátkům. Také potlačují zrání spor a růst mycelia houbových patogenů. Přesný popis mechanismu toxického působení inhibitorů proteáz je stále předmětem intenzivního výzkumu. Podstatou je, že se inhibitor naváže na aktivní centrum enzymu a tím ho blokuje. Obecně lze říci, že sekrece proteolytických enzymů ve střevě hmyzu je ovlivňována spíše obsahem bílkovin v potravě. Inhibitory však inhibují proteázovou aktivitu trávících enzymů a snižují tak množství proteinu, které může být stráveno. Následně dojde k vyčerpání rezerv sirných aminokyselin. Výsledkem těchto pochodů je oslabení hmyzu, jeho omezený vývoj a často smrt (Hraška et al., 2006) Inhibitor NcPIb Ve slinných žlázách a slinách švába šedého (Nauphoeta cinerea) byl nalezen inhibiční účinek proti subtilisinu (mikrobiální peptidáza), proteináze K, chymotrypsinu a trypsinu. Exprese těchto genů byla potvrzena hybridizací na úrovni RNA. Tato funkce hraje u švába důležitou roli ve schopnosti využít různé organické materiály jako zdroj potravy. Živí se na rozkládajících se podkladech, které jsou vysoce kontaminovány patogeny. Jsou všežraví a riziko výskytu mikroorganismů v potravě je vysoké, proto sliny obsahují látky, které omezují jejich růst ve střevech (Taranushenko et al., 2009) Inhibitory hmyzích amyláz Jsou to inhibitory vyskytující se v semenech dvouděložných rostlin, například fazole má celou skupinu těchto inhibitorů. Hrají základní úlohu v ochraně rostlin před hmyzem a to tím, že způsobují blokaci činnosti enzymů při trávení sacharidů. Exprese tohoto genu v hrachu způsobuje rezistenci k brouku Callosobruchus maculatus a Bruchus pisorum (Shade at al., 1994) Lektiny Lektiny jsou proteiny, které vážou sacharidy. Jelikož jsou toxické pro savce a ptáky nejsou moc dobrým kandidátem pro transgenozi plodin. Většina má antinutriční charakter (Ondřej et Drobník, 2002). 23

24 3 MATERIÁL A METODY ZPRACOVÁNÍ 3.1 Použitý materiál Rostlinný materiál Jako pokusný materiál pro transformaci byly použity mladé rostliny tabáku virginského (Nicotiana tabacum) linie SR-1, kultura in vitro Bakteriální kultury Plazmidy byly namnoženy pomocí bakteriální kultury kompetentních buněk Escherichia coli kmene Top 10. Transformace rostlin tabáku byla prováděna pomocí bakterie Agrobacterium tumefaciens kmene EHA 105. Tyto bakteriální kultury byly dlouhodobě uchovávány v 10-20% roztoku glycerolu v hluboko mrazícím boxu při teplotě -72 C Použité plazmidy Gen NcPIb, který byl izolován ze slin švába Nauphoeta cinerea, byl namnožen pomocí pgem-t plazmidu (obr. 2). Tento plazmid obsahuje gen ampr pro rezistenci k ampicilinu a klonovací místo v lacz fragmentu. Obr. 2 Schematická mapa plazmidu pgem-t 24

25 Regulační sekvence pro gen NcPIb byly získány z plazmidu ImpactVector1.3, který obsahuje velmi silný světlem regulovaný promotor RuBisCo rbcs1 a dále terminátor RuBisCo rbcs1. Pro tvorbu výsledného konstruktu pwell16 byl použit plazmid pgreenii, do kterého byl vložen gen NcPIb s přidanými regulačními sekvencemi. Do klonovacího místa v oblasti T-DNA byl vložen reportérový gen uida, který kóduje enzym β-glukuronidázu (GUS) s promotorem 35S. Dále byl k vnitřní straně levé hranice (LB) vložen selekční gen bar pro rezistenci rostlin k fosfinotricinu (PPT) s promotorem nos (nophalin synthase) (Hellens et al., 2000) Použitá média, roztoky složení Kultivační média pro elektroporované buňky Escherichia coli 1) SOC médium 7,5 ml SOB média 37,5 µl 2M roztoku MgCl µl 1M roztoku glukózy 2) SOB médium (objem 1 l) 20 g trypton 5 g kvasniční extrakt 0,5 g NaCl 0,186 g KCl sterilizace autokláv 30 minut při 120 C Média použitá pro kultivaci bakterií Escherichia coli 1) Pevné LB médium (objem 1 l) 10 g trypton 5 g kvasniční extrakt 5 g NaCl 1 ml 1M NaOH 15 g agar sterilizace autokláv 30 minut při 120 C 2) Tekuté LB médium (objem 1 l) 10 g trypton 25

26 5 g kvasniční extrakt 5 g NaCl 1 ml 1M NaOH sterilizace autokláv 30 minut při 120 C (Ausubel et al., 1992). V závislosti na genu rezistence byl pak k médiu sterilně přidán ampicilin (50 µg/ml) nebo kanamycin (50 µg/ml). Dále při použití reportérového genu lacz byly přidány komponenty pro modro-bílou (blue/white) selekci (X-gal - 20 µg/ml, IPTG 0,1 mm) Kultivační média pro transformaci listových disků tabáku 1) MS 0.0 médium (objem 1 l) 4,3 g Murashige and Skoog mikro a makro prvky (Duchefa) 30 g sacharóza 2 ml 5x B 1 -inositol 3 ml Miller s I 2) MS 0.1/1 médium kokultivační (objem 1 l) MS 0/0 obsahující: 6 g Phytoagar (Duchefa) 1 mg BA (1 ml zás. roztoku 1 mg/ml v KOH) 0,1 mg NAA (100 µl zás. roztoku 1 mg/ml v 70% ethanolu) ph upraveno na 5,7 (pomocí KOH), sterilizace v autoklávu 3) MS 0.1/1 médium selekční (objem 1 l) MS 0.1/1 médium - kokultivační (autoklávované) obsahující: 300 mg augmentin (rozpuštěn ve vodě) 2 mg PPT (rozpuštěn ve vodě) 500 mg timentin (rozpuštěn ve vodě) 4) Miller s I (objem 50 ml) 3 g KH 2 PO 4 rozpuštěn ve vodě 26

27 5) 5x B 1 -inositol (objem 50 ml) 0,025 g thiamin 2,5 g myo-inositol 50 µl 0.5M EDTA zmrazit -20 C sterilizace při 120 C (Dombrowski et al., 1994) 6) LB médium (objem 1 l) 10 g trypton 5 g kvasniční extrakt 5 g NaCl 7) Gamborg B5 médium (objem 1 l) 3,163 g B5 Gamborg mikro a makro prvky + vitamíny (Duchefa) 0,5 g aktivní uhlí 10 g sacharóza 8 g Phytoagar (Duchefa) ph upraveno na 5,8 300 mg/l augmentin 500 mg/l timentin Zásobní roztoky pro přípravu histochemického GUS testu 1) Roztok pro histochemický GUS test 100 mm Na 2 HPO 4 /KH 2 PO 4 10 mm Na 2 EDTA 5 mm K 4 [Fe II (CN) 6 ] 5 mm K 3 [Fe III (CN) 6 ] 0,1% Triton X-100 0,3% X-Gluc ph upraveno na

28 2) Zásobní roztoky pro přípravu roztoku pro histochemický GUS test 1M Na 2 HPO 4 /KH 2 PO 4, ph 7, uchováno při -20 C 6,4% objem 1M Na 2 HPO 4 3,6% objem KH 2 PO 4 90% objem H mm K 4 [Fe II (CN) 6 ], uchováno při -20 C 0,211 g K 4 [Fe II (CN) 6 ] rozpuštěno v 10 ml vody, přefiltrováno přes sterilní filtr 50 mm K 3 [Fe III (CN) 6 ], uchováno při -20 C 0,165 g K 3 [Fe III (CN) 6 ] rozpuštěno v 10 ml vody, přefiltrováno přes sterilní filtr 10% Triton X-100 (vodný roztok) Zásobní roztok X-Gluc 0,1 mg/µl X-Gluc, rozpuštěno v N,N-dimethylformamid Agarózová elektroforéza 1% agarózový gel 0,5 g agarózy, doplněno na objem 0,5 ml 1x TAE pufrem 1 µl ethidium bromid (zasobní vodný roztok 10 mg/ml) 50x TAE (objem 1 l) 242 g TRIS báze 57,1 ml ledové kyseliny octové 100 ml 0,5 M EDTA (ph 8) 1x TAE pufr padesátinásobné zředění 50x TAE pufru Nanášecí pufr: 20% Ficcol 0,05% bromfenolová modř TE pufr (10 mm Tris-HCl, 1mM EDTA) (Castle and Morris, 1994) 28

29 3.2 Metodika práce Amplifikace genu NcPIb Pro amplifikaci známé sekvence genu NcPIb byly navrženy primery pro specifickou PCR. Pro počátky primerů byly použity specifické sekvence pro restrikční endonukleázy BamHI a NotI, aby bylo následně vložení do plazmidu ImpactVector1.3 jednodušší. Jako templát byl použit plazmid pgem-t easy s vloženou sekvencí genu NcPIb, který byl získán z Entomologického ústavu AVČR v Českých Budějovicích. Sekvence genu NcPIb (180 bp): GAGCGTTGTTCTTCTGCTTGTACACTTGAATACAATCCTATCTGTGGAGCCG ACGCACTTAACCACTACGAGACTTTCGGAAACCCATGTGCTTTCAATTACTA CAACTGTGAACATCCTTTCTCACCTATGAGGTTGGTGAGAGCCGGTGAATGC ACCGCTGCTGAAACCGACGAAGAA Navržené primery: Forward (BamHI): GGATCCAGAGCGTTGTTCTTCTGCTTGTACACTTG Reverse (NotI): GCGGCCGCTTCTTCGTCGGTTTCAGCAGCGGTGCATTCAC Primery byly nasyntetizovány firmou IDT. Reakční směs pro PCR reakci byla namíchána podle tab. 1 a byla provedena v termocykleru. Úspěšnost amplifikace byla ověřena pomocí gelové elektroforézy. Následně byla provedena purifikace amplifikovaného fragmentu pomocí komerčního kitu Invitek-Smarter nucleic acid sample preparation. Tab. 1 Složení reakční směsi pro PCR Množství na reakci (µl) Ultračistá H 2 O 36,5 Pufr pro Green Taq (Promega) 10 dntps 0,6 Primer F 1 Primer R 1 Taq DNA-polymeráza (Promega) 0,4 Templátová DNA 0,5 Celkem 50 29

30 3.2.2 Klonování genu NcPIb Nejdříve proběhla ligace genu NcPIb do plazmidu pgem-t. Postup byl proveden dle protokolu pro ligaci pgem-t (Promega), kde je doporučen molární poměr vektor:inzert 1:3 pro úspěšnou ligaci. Reakční směsi pro ligaci byly připraveny podle tab. 2. Úspěšnost ligace byla ověřena pomocí gelové elektroforézy a plazmid s vloženým genem NcPIb byl klonován pomocí elektrokompetentních buněk Escherichia coli kmen Top 10. Elektroporace kompetentních buněk E. coli byla provedena podle Ausbela et al. (1992). Elektrokompetentní buňky E. coli byli rozmraženy na ledu a smíchány s plazmidem, který obsahuje gen NcPIb. Poté byl vzorek přemístěn do elektroporační kyvety a vložen do elektroporátoru Easyject (Equibio). Po elektroporaci byl ke vzorku přidán 1 µl SOC média a poté byl vzorek kultivován na orbitální třepačce při 60 RPM a 37 C po dobu 1 hodiny. Po kultivaci následoval výsev buněk E. coli na Petriho misky se selekčním médiem. Vzorek byl rozetřen skleněnou tyčinkou na misky s pevným LB médiem s antibiotikem a modro-bílou selekcí. Kultivace probíhala přes noc při 37 C dnem vzhůru. Následující den byly odebrány pomocí sterilního párátka narostlé pozitivní kolonie (bílé) a přeneseny do 50 µl roztoku 50 mm MgCl 2 /50 mm Tris ph 7. Vše bylo promícháno pomocí vortexu. Test rekombinantních pgem-t vektorů byl proveden pomocí PCR. Na gelové elektroforéze byly separovány produkty PCR a vizualizovány UV zářením. Vybrané kolonie s přítomností fragmentu DNA odpovídající délky byly poslány na sekvenaci, aby byla ověřena přítomnost požadovaného inzertu. Po namnožení jedné pozitivní kolonie v tekutém LB médiu následovala izolace plazmidové DNA. Tab. 2 Složení reakční směsi pro ligaci genu NcPIb do plazmidu pgem-t Množství na reakci (µl) Ultračistá H 2 0 2,5 Ligační pufr (2x koncentrovaný) 5 pgem-t vektor 0,5 Inzert gen NcPIb (PCR) 1 T4 DNA Ligáza 1 Celkem 10 30

31 Purifikace plazmidové DNA pomocí GeneJET TM Plasmid Miniprep Kit Bylo naočkováno 1,5 ml tekutého LB média s ampicilinem jednou kolonií E. coli. Tato kultura byla kultivována přes noc za stálého třepání při 37 C. Postup purifikace: 1. Suspenzní kultura buněk E. coli byla přemístěna do 1,5 ml mikrozkumavky a centrifugována 1 min. při g. 2. Pomocí pipety byl dokonale odstraněn supernatant a pelet resuspendován v 250 µl Resuspension Solution pomocí vortexu. 3. Bylo přidáno 250 µl Lysis Solution a promícháno 4-6krát převrácením zkumavky. 4. K suspenzi bylo přidáno 350 µl Neutralization Solution a promícháno 4-6krát převrácením zkumavky. 5. Proběhla centrifugace 5 min. při g. 6. Supernatant byl přemístěn do GeneJET TM spin kolony a centrifugován 1 min., poté odstraněn filtrát ze zásobní zkumavky. 7. Na kolonu bylo přidáno 500 µl Wash Solution, poté centrifugace 1 min. při g a odstraněn filtrát ze zásobní zkumavky. 8. Prázdná kolona byla centrifugována 1 min. při g. 9. Kolona byla přemístěna do nové 1,5 ml mikrozkumavky a do ní bylo aplikováno 50 µl Elution Buffer, poté inkubace po dobu 2 min. a centrifugace 2 min. při g Připojení genu NcPIb k regulačním sekvencím rbcs1 Regulační sekvence rbcs1 je obsažena v plazmidu ImpactVector1.3 (Wageningen university). Pomocí gelové elektroforézy byla změřena koncentrace plazmidů pgem-t + NcPIb a ImpactVector1.3, aby bylo připraveno správné množství DNA do restrikční směsi (poměr vektor:inzert je 1:3) Restrikce plazmidů pgem-t + NcPIb a ImpactVector1.3 Pro vyštěpení genu NcPIb z pgem-t plazmidu byly použity restrikční enzymy BamHI a NotI, stejně tak i pro rozštěpení ImpactVector1.3. Reakční směsi pro restrikci byly připraveny podle tab. 3, poté inkubovány asi 1 hodinu v termocykleru při 37 C. Následně byla provedena defosforylace vzorků přidáním 0,5 µl alkalické fosfatázy a 2,2 µl příslušného pufru a inkubovalo se dalších 30 min. Na gelové elektroforéze byly 31

32 štěpené fragmenty separovány a vizualizovány pomocí UV záření. Z agarózového gelu byl pak vyřezán gen NcPIb a rozštěpený ImpactVector1.3. Následovala purifikace obou fragmentů. Tab. 3 Reakční směsi pro restrikci plazmidů pgem-t a ImpactVector1.3 Pro pgem-t + NcPIb Pro ImpactVector1.1 Ultračistá H µl 16,2 µl Pufr M 2 µl 2 µl Enzym BamHI 0,5 µl 0,5 µl Enzym NotI 0,5 µl 0,5 µl DNA 1 µl 0,5 µl Celkem 20 µl 20 µl Purifikace DNA fragmentů vyřezaných z agarózového gelu pomocí Invisorb Fragment CleanUp 1. Skalpelem byl vyřezán DNA fragment z agarózového gelu s co nejmenším množstvím gelu, poté byl řez umístěn do zkumavky a zvážen. K řezům bylo přidáno 500 µl Gel Solubilizer S. 2. Směs byla inkubována při 50 C po dobu 10 min. a promíchávána pomocí vortexu až do úplného rozpuštění gelu. 3. K směsi bylo přidáno 500 µl pufru Binding Enhancer a promícháno pomocí pipety či vortexu. Následně byla směs nanesena na kolonu (Spin Filter), poté centrifugace 1 min. při g. Filtrát byl separován a odstraněn. 4. Následně bylo přidáno 500 µl promývacího pufru a opět centrifugováno při g 30 sekund. Filtrát byl odstraněn a krok byl ještě jednou zopakován. 5. Odstraněn filtrát a samotná kolona centrifugována při g po dobu 4 min. 6. Kolona přemístěna do nové zkumavky a promyta 30 µl deionizované vody (voda byla použita místo elučního pufru, jenž obsahuje soli, které mohou způsobit problém při elektroporaci). Poté inkubace po dobu 5 min. při laboratorní teplotě a centrifugace 1 min. při g. 7. Filtr odstraněn a vzorek promíchán pomocí vortexu. 32

33 Ligace genu NcPIb do plazmidu ImpactVector1.3 Byla namíchána reakční směs pro ligaci podle tab. 4, přičemž množství DNA (linearizovaného plazmidu ImpactVector1.3 a genu NcPIb) bylo optimalizováno dle koncentrace změřené na gelové elektroforéze. Ligační reakce probíhala při 4 C po dobu 24 hodin. Poté byla směs purifikována podle komerčního kitu Invisorb Fragment CleanUp a výsledný plazmid s genem NcPIb byl klonován pomocí kompetentních buněk E. coli kmen Top 10. Tab. 4 Složení reakční směsi pro ligaci genu NcPIb do plazmidu ImpactVector1.3 Množství na reakci (µl) Ligační pufr 2 ImpactVector1.3 3 Inzert gen NcPIb 14 T4 DNA Ligáza 1 Celkem Klonování plazmidu ImpactVector1.3 pomocí kompetentních buněk E. coli Postup elektroporace, následná kultivace a test kolonií byl proveden podle návodu, který byl již zmíněn. Poté byly vybrány kolonie, namnoženy a jejich plazmidová DNA byla purifikována Vložení expresní kazety rbcs1::ncpib do plazmidu pwell02b Nejdříve byla vyštěpena expresní kazeta (gen NcPIb spolu s regulační sekvencí rbcs1) z ImpactVector1.3 a vložena do plazmidu pwell02b, který je odvozen z binárního plazmidu pgreenii. Následně je tedy tento plazmid schopen transformovat rostliny pomocí bakterie A. tumefacines Restrikce plazmidů pwell02b a ImpactVector1.3 Pro štěpení expresní kazety z plazmidu ImpactVector1.3 byly použity restrikční enzymy PacI a AscI. Pro rozštěpení plazmidu pwell02b byl použit enzym SmaI. Reakční směsi pro štěpení byly připraveny podle tab. 5. Inkubace reakčních směsí probíhala při 37 C po dobu 1 hodiny. Následně byla přidána alkalická fosfatáza pro defosforylaci vzorků. Štěpené fragmenty byly separovány na gelové elektroforéze, vizualizovány pod UV světlem a poté vyříznuty z gelu (expresní kazeta a pwell02b). 33

34 Tyto fragmenty byly purifikovány a byla změřena jejich koncentrace pomocí gelové elektroforézy. Tab. 5 Reakční směsi pro restrikci plazmidů pwell02b a ImpactVector1.3 Množství na reakci (µl) Množství na reakci (µl) Ultračistá H 2 O 15 Ultračistá H 2 O 7 Pufr Takara 2 Pufr NEB 4 2 Enzym SmaI 1 Enzym PacI 0,5 pwell02b 2 Enzym AscI 0,5 Celkem 20 ImpactVector Celkem Zatupování a ligace expresní kazety rbcs1::ncpib do plazmidu pwell02b Štěpení obou komponent bylo provedeno rozdílnými restrikčními enzymy, proto bylo nutné provést zatupení konců expresní kazety, aby byla možná ligace s plazmidem pwell02b, jenž byl rozštěpen natupo. Zatupování a následná ligace byla provedena pomocí CloneJET TM PCR Cloning Kit, dle postupu: 1. Směs pro zatupování 5 - a 3 - přesahů: 2x Reaction Buffer 10 µl DNA (NcPIb + rbcs1) 2 µl Ultračistá voda 5 µl DNA Blunting Enzym 1 µl Celkem 18 µl 2. Směs byla promíchána pomocí vortexu a inkubována při 70 C po dobu 5 min. v termocykleru, následně zchlazena na ledu. 3. Připravena reakční směs pro ligaci k zatupovací reakční směsi bylo přidáno: Plazmid pwell02b 1 µl T4 DNA Ligáza 1 µl Celkem 20 µl 4. Směs promíchána pomocí vortexu a inkubována při 22 C po dobu 30 min. Poté byla ligační směs purifikována pomocí kitu Invisorb Fragment CleanUp. Výsledný plazmid pwell16 byl elektroporován a následně klonován pomocí 34

35 kompetentních buněk E. coli kmen Top10. Na základě výsledku gelové elektroforézy bylo vybráno 9 kolonií. Jejich plazmidová DNA byla po kultivaci v tekutém LB médiu s přidaným antibiotikem purifikována pomocí GeneJET TM Plasmid Miniprep Kit. Následně byla provedena kontrolní restrikce, aby bylo patrné, jestli se expresní kazeta začlenila do plazmidu správně Kontrolní restrikce plazmidů pwell16 Kontrolní restrikce byla prováděna pro zjištění délky fragmentů - v jakém směru se inzert v plazmidu nachází a jestli vložení expresní kazety do plazmidu proběhlo správně. Restrikční štěpení bylo provedeno s restrikčními enzymy EcoRI (jedno restrikční místo) a HindIII (3 restrikční místa). Tab. 6 Reakční směs pro kontrolní test plazmidů restrikcí Množství na reakci (µl) Ultračistá H 2 O 16 Pufr M 2 Enzym BamHI 1 Enzym NotI 1 DNA 1 Celkem Elektroporace plazmidu pwell16 do Agrobacterium tumefaciens Kompetentní buňky A. tumefaciens kmen EHA 105 byly smíchány s 1 µl plazmidu pwell16. Vzorek byl přenesen do elektroporační kyvety a elektroporován elektroporátorem Easyject (Equibio). Ke vzorku bylo přidáno 900 µl SOC média a následovala kultivace na orbitální třepačce při 28 C po dobu 30 min. Poté bylo přidáno LB médium a kanamycin a naneseno skleněnou tyčinkou na misky s pevným LB médiem a antibiotiky. Po dobu dvou dní probíhala kultivace při 28 C. Narostlé kolonie byly odebrány do LB média bez antibiotik a kultivovány při teplotě 28 C přes noc. 35

36 3.2.6 Transformace listových disků Transformace byla prováděna metodou transformace listových disků a byly použity rostliny tabáku virginského (Nicotiana tabacum). Pro transformaci listových disků bylo použito 5 ml tekuté kultury (LB médium bez antibiotik) Agrobacterium tumefaciens nesoucí plazmidový vektor pwell16. Práce probíhala se sterilními nástroji a ve flowboxu pro zajištění sterilních podmínek. Na navlhčeném sterilním papíře byly z několika dobře vyvinutých listů tabáku korkovrtem vyraženy listové disky o průměru asi 1 cm. Vyražených disků bylo asi 40. Disky byly vyráženy z míst, kudy neprocházela hrubá nervatura. Poté byly přeneseny na 1 minutu do suspenze A. tumefaciens. Následně byly vyjmuty, osušeny a pokládány vrchní stranou dolů (aby nedocházelo k jejich stočení) na médium MS 0.1/ Kultivace transformovaného tabáku Listové disky byly po transformaci ponechány 2-3 dny na kokultivačním médiu MS 0.1/1 při teplotě 28 C. Následovalo pasážování na selekční médium MS 0.1/1 s augmentinem (300 mg/l) a timentinem (500 mg/l) pro odstranění bakterií A. tumefaciens. Při pasážování byly odebrány z Petriho misky tři listové disky a byl proveden histochemický GUS test pro ověření úspěšnosti transformace. Po 3 týdnech byly pasážovány odolné kalusy na selekční médium MS 0.1/1 s augmentinem (300 mg/l), timentinem (300 mg/l) a PPT (2 mg/l). Nakonec byly narostlé prýty kultivovány na médiu pro regeneraci celistvých rostlin. Obr. 3 Listové disky tabáku po 7 dnech kultivace na médiu MS 0.1/1 s augmentinem Histochemický GUS test transformovaných rostlin Pro rozlišení transformovaných listových disků od netransformovaných byl proveden histochemický GUS test. Bylo použito 300 µl GUS roztoku na vybrané listové disky, následná inkubace probíhala při teplotě 37 C po dobu 24 hodin. 36

37 4 VÝSLEDKY 4.1 Založení pokusu Amplifikace sekvence pro NcPIb Z plazmidu pgem-t easy byl amplifikován gen NcPIb pomocí PCR reakce. Byly použity navržené primery se specifickými místy pro restrikční endonukleázy BamHI a NotI. Amplifikovaná sekvence: GGATCCAGAGCGTTGTTCTTCTGCTTGTACACTTGAATACAATCCTATCTGT GGAGCCGACGCACTTAACCACTACGAGACTTTCGGAAACCCATGTGCTTTC AATTACTACAACTGTGAACATCCTTTCTCACCTATGAGGTTGGTGAGAGCCG GTGAATGCACCGCTGCTGAAACCGACGAAGAAGCGGCCGC PCR produkt byl nanesen na agarózový gel a vizualizován ethidium bromidem. Jako negativní kontrola byl použit vzorek bez DNA. Pro porovnání velikostí byl na gel také nanesen velikostní marker 100 bp Quick load DNA Ladder (Invitrogen) (obr. 5). Na agarózovém gelu (obr. 4) je vidět v jamce 2 amplifikovaný gen NcPIb s přidanými sekvencemi pro restrikční enzymy (195 bp). V jamce 3 je kontrola bez DNA, u níž je vidět slabý produkt v důsledku kontaminace PCR směsi. Obr. 4 Amplifikovaný gen NcPIb. Jamky: bp Quick load DNA Ladder, 2. NcPIb s přidanými sekvencemi pro restrikční enzymy, 3. negativní kontrola bez DNA 37

38 Obr. 5 Velikostní marker bp Quick load DNA ladder Obr. 6 Velikostní marker - 1 kb Quick load DNA ladder 38

39 4.2 Klonování genu NcPIb Ligace NcPIb do pgem-t plazmidu Amplifikovaný gen NcPIb byl ligován do plazmidu pgem-t. Následovalo ověřění, zda ligace proběhla správně, pomocí agarózové elektroforézy. pgem-t + NCPIB 3195 bp Obr. 7 Gen NcPIb ligovaný do plazmidu pgem-t. Jamky: bp Quick load DNA Ladder, 2. pgem-t + NcPIb, 3. pgem-t + NcPIb, 5. pgem-t + NcPIb, 6. pgem-t + NcPIb Na agarózovém gelu (obr. 7) je vidět v jamkách 2, 3, 5, 6 plazmid pgem-t spolu s vneseným genem NcPIb o velikosti fragmentu přibližně 3200 bp Klonování plazmidu v buňkách Escherichia coli Po prokázání úspěšné ligace genu NcPIb do plazmidu pgem-t bylo provedeno klonování do kompetentních buněk E. coli pro namnožení plazmidu. Pozitivní (bílé) kolonie E. coli byly přeneseny do roztoku 50 mm MgCl2/50 mm Tris a následně byla provedena PCR reakce pro testování přítomnosti inzertu. PCR produkty spolu s restrikčními enzymy BamHI a NotI byly naneseny na agarózový gel a pomocí elektroforézy byl proveden test plazmidů restrikcí. 39

40 3054 bp 2036 bp 1636 bp 200 bp Obr. 8 Gen NcPIb v pgem-t test plazmidů restrikcí. Jamky: bp Quick load DNA Ladder, 2. neštěpený pgem-t+ncpib (první kolonie), 3. pgem-t + NcPIb štěpený restrikčním enzymem BamHI, 4. pgem-t + NcPIb štěpený restrikčním enzymem NotI, 5. pgem-t + NcPIb štěpený restrikčním enzymem BamHI a NotI, 6. neštěpený pgem-t+ncpib (druhá kolonie), 7. pgem-t + NcPIb štěpený restrikčním enzymem BamHI, 8. pgem-t + NcPIb štěpený restrikčním enzymem NotI, 9. pgem-t + NcPIb štěpený restrikčním enzymem BamHI a NotI, 10. 1kb DNA ladder Na agarózovém gelu (obr. 8) je vidět v jamce 2 a 6 neštěpený pgem-t+ncpib první a druhé kolonie, které odpovídají ve skutečnosti 3195 bp, ale na gelu se jeví jako menší, protože jsou cirkulární a v gelu putují snadněji. Dále je v jamce 5 a 9 štěpený pgem-t+ncpib s velikostí horního fragmentu přibližně 3000 bp (pgem-t) a spodního fragmentu 195 bp (NcPIb). U pozitivních kolonií byla ověřena přítomnost inzertu v plazmidu i sekvenováním firmou Macrogen (Jižní Korea). 40

41 4.2 Připojení genu NcPIb k regulačním sekvencím rbcs1 Nejdříve došlo k vyštěpení genu NcPIb z pgem-t plazmidu pomocí restrikčních enzymů BamHI a NotI. Následně také k rozštěpení ImpactVector1.3 stejnými restrikčními enzymy. Výsledek těchto restrikčních reakcí byl vyhodnocen pomocí agarózové elektroforézy bp 4072 bp 3054 bp 200 bp Obr. 9 Restrikce ImpactVector1.3 a pgem-t+ncpib. Jamky: 1. 1kb DNA ladder, 2. ImpactVector1.3 štěpený BamHI a NotI, 3. pgem-t + NcPIb štěpený restrikčním enzymem BamHI a NotI I, bp Quick load DNA Ladder Hodnocení agarózového gelu potvrdilo úspěšnost restrikce (obr. 9). Na gelu je vidět ve jamce 2 štěpený plazmid ImpactVector1.3, který má velikost přibližně 4630 bp. V jamce 3 je patrný vyštěpený gen NcPIb, jehož velikost odpovídá 195 bp a štěpený plazmid pgem-t, jehož velikost odpovídá 3000 bp. Štěpené fragmenty byly následně vyřezány z gelu (plazmid ImpactVector1.3 a gen NcPIb) a purifikovány. Poté byla provedena defosforylace a ligace genu NcPIb do ImpactVector1.3 pro připojení regulačních sekvencí rbcs1. 41

42 5090 bp Obr. 10 Ligace NcPIb do plazmidu ImpactVector1.3. Jamky: 1. 1kb DNA ladder, 2. směs po ligaci (NcPIb +ImpactVector1.3), 4. PCR - nulová kontrola Na agarózovém gelu (obr. 10) je vidět ve jamce 2 (fragment níže) plazmid ImpactVector1.3 s vloženým genem NcPIb, jehož velikost odpovídá přibližně 4825 bp. Tudíž lze konstatovat, že ligace byla provedena úspěšně. V jamce 4 je kontrola bez DNA, u níž je vidět slabý produkt v důsledku kontaminace PCR směsi. ImpactVector1.3 s vloženým genem NcPIb byl elektroporován do kompetentních buněk E. coli a naklonován. Bakteriální kolonie byly selektovány na médiu a následně byla provedena kontrolní restrikce plazmidů u dvou pozitivních kolonií. 42

43 4072 bp 3054 bp 2036 bp Obr. 11 Kontrolní restrikce plazmidů ImpactVector1.3 s vloženým genem NcPIb z kolonií 1 a 2. Jamky: 1. 1kb DNA ladder, 2. neštěpený plazmid z kolonie 1, 3. plazmid z kolonie 1 štěpený restrikčními enzymy AscI a PacI, 4. neštěpený plazmin kolonie 2, 5. plazmid z kolonie 2 štěpený restrikčními enzymy AscI a PacI Na fotografii gelu (obr. 11) můžeme pozorovat v jamce 3 a 5 plazmid ImpactVector1.3 s vloženým genem NcPIb štěpený restrikčními enzymy AscI a PacI, vznikly tedy dva fragmenty. Fragment výše odpovídá velikosti přibližně 2650 bp a fragment níže 2150 bp (NcPIb + rbcs1). 43

44 4.3 Vložení expresní kazety rbcs1::ncpib do plazmidu pwell02b Z ImpactVector1.3 byla vyštěpena pomocí restrikčních endonukleáz AscI a PacI expresní kazeta, která obsahuje promotor a terminátor rbcs1 a mezi nimi gen NcPIb. Dále byl štěpen plazmid pwell02b restrikční endonukleázou SmaI. Následně proběhla defosforylace štěpených fragmentů a pro vizualizaci UV zářením byly tyto fragmenty naneseny na agarózový gel bp 3054 bp 2036 bp Obr. 12 Vyštěpení expresní kazety rbcs1::ncpib z ImpactVector1.3 a restrikce plazmidu pwell02b. Jamky: 1. 1kb DNA ladder, 2. štěpený plazmid pwell02b, 3. štěpený plazmid ImpactVector1.3 + NcPIb Z výsledku elektroforézy (obr. 12) je vidět, že restrikce proběhla správně. V jamce 2 můžeme vidět linearizovaný plazmid pwell02b, který má velikost přibližně 6950 bp. V jamce 3 je vidět vyštěpená expresní kazeta NcPIb + rbcs1 (spodní fragment), která odpovídá 2150 bp. Dále vidíme ve třetí jamce zbytek štěpeného fragmentu ImpactVector1.3 o velikosti přibližně 2650 bp. Expresní kazeta rbcs1::ncpib a štěpený plazmid pwell02b byly vyřezány z gelu, purifikovány a připraveny pro ligaci. Jelikož restrikční enzymy AscI a PacI vytváří tzv. lepivé konce a enzym SmaI vytváří tupé konce, nejsou tyto fragmenty kompatibilní pro ligační reakci. Bylo potřeba použít zatupovací enzym pro konce expresní kazety rbcs1::ncpib. Následně proběhla ligace a purifikace. Poté elektroporace výsledného 44

45 plazmidu, nazvaného pwell16, do kompetentních buněk E. coli. Tyto buňky byly kultivovány na selekčním LB médiu a narostlé kolonie následně testovány pomocí restrikční reakce pro ověření, zda byla expresní kazeta správně vložena do plazmidu a v jakém směru. Bylo odebráno 9 kolonií a použity restrikční endonukleázy EcoRI a HindIII. Enzym EcoRI štěpí plazmid pwell16 na jednom místě. Enzym HindIII štěpí na třech místech na počátku a konci genu 35S::uidA, vznikající fragment odpovídá přibližně velikosti 2500 bp. Třetí restrikční místo se nachází v oblasti terminátoru genu NcPIb, což může vytvářet fragment o velikosti přibližně 920 bp nebo 1400 bp, podle směru vložení expresní kazety. Zbytek vytváří fragment o velikosti 5360 bp nebo 5850 bp. Po restrikční reakci byly štěpené fragmenty naneseny na agarózovou elektroforézu pro separaci jednotlivých fragmentů. Následně vizualizovány pod UV zářením. 45

46 10180 bp 6108 bp 3054 bp 1636 bp 1018 bp 8144 bp 4072 bp 1636 bp Obr. 13 Kontrolní restrikce plazmidů pwell16. Jamky: 1. 1kb DNA ladder, 2. plazmid č. 1 štěpený EcoRI, 3. plazmid č. 1 štěpený HindIII, 4. plazmid č. 2 štěpený EcoRI, 5. plazmid č. 2 štěpený HindIII, 6. plazmid č. 3 štěpený EcoRI, 7. plazmid č. 3 štěpený HindIII, 8. plazmid č. 4 štěpený EcoRI, 9. plazmid č. 4 štěpený HindIII, 10. plazmid č. 5 štěpený EcoRI, 11. 1kb DNA ladder, 12. plazmid č. 5 štěpený HindIII, 13. plazmid č. 6 štěpený EcoRI, 14. plazmid č. 6 štěpený HindIII, 15. plazmid č. 7 štěpený EcoRI, 16. plazmid č. 7 štěpený HindIII, 17. plazmid č. 8 štěpený EcoRI, 18. plazmid č. 8 štěpený HindIII, 19. plazmid č. 9 štěpený EcoRI, 20. plazmid č. 9 štěpený HindIII. Na výsledné fotografii (obr. 13) můžeme vidět, že kontrolní restrikce plazmidů pwell16 dokázala, že expresní kazeta rbcs1::ncpib byla správně vložena a v plazmidech se nachází ve směru čtení zprava doleva v těchto vzorcích: 1, 2, 3, 4 a 7. 46

47 Ve směru čtení zleva doprava se expresní kazeta rbcs1::ncpib nachází ve vzorku 9. Ostatní plazmidy jsou pravděpodobně směs kazet vložených v obou směrech nebo neproběhla správně restrikční reakce. Plazmid s expresní kazetou rbcs1::ncpib vloženou ve směru čtení zprava doleva byl označen pwell16a a plazmid s kazetou začleněnou zleva doprava pwell16b. 47

48 4.4 Plazmid pwell16 Plazmid pwell16 obsahující gen NcPIb má dvě varianty směru čtení rozlišené A a B (obr. 14). Součástí plazmidu je počátek replikace ColEl ori pro replikaci v E. coli a další počátek psa ori pro replikaci v A. tumefaciens. Dále se mimo oblast T-DNA nachází gen npti s bakteriální rezistencí ke kanamycinu. V oblasti T-DNA je reportérový gen uida, kódující enzym β-glukuronidázu, kterým lze provádět histochemický GUS test pro rychlé ověření transformace. Dále je přítomen gen bar navozující toleranci k fosfinotricinu, který je součástí herbicidů. Obr. 14 Mapa plazmidu pwell16a,b 48

49 4.5 Transformace listových disků tabáku pomocí A. tumefaciens Transformace byla provedena podle metody Dombrowského et al. (1994) na listových discích modelové rostliny tabáku virginského Nicotiana tabacum L., kultura kultivovaná v aseptickém prostředí in vitro. Po třech dnech kultivace listových disků na kokultivačním médiu byl proveden GUS test pro ověření transformace podle Fütterera et al. (1995). Náhodně vybrané listové disky byly ponořeny do roztoku GUS s barvivem X-gluc. Po několika hodinách došlo k zabarvení disků do modra (obr. 15), což způsobila přítomnost reportérového genu uida v plazmiu pwell16, který exprimuje enzym β-glukuronidázu. Tento enzym štěpí barvivo X-gluc na substráty s modrým zbarvením. Listové disky byly nejvýrazněji zbarveny v místech poranění, tedy na okrajích po vyřezání korkovrtem. Je tomu tak z důvodu nasedání bakterie A. tumafaciens právě v těchto poškozených místech na buněčné stěny rostlin. Zde poté předává svoji genetickou informaci, tedy úsek T-DNA. Tímto pozitivním GUS testem byla prokázána úspěšnost transformace. Obr. 15 Pozitivní histochemický GUS test 49

50 4.6 Ověření transformace regenerovaných rostlin Pro ověření, zda- li proběhla transgenoze správně byla provedena po izolaci DNA z transformovaných tabáků PCR reakce pro identifikaci vnesených oblastí promotoruterminátoru RbcS1 ImpactVector a reportérového genu uida s primery A (I.V. F/R), B (GUS). Obr. 16 Testování transgenních tabáků pwell16. Jamky: bp Quick load DNA Ladder, 2. vzorek č. 3 po amplifikaci s primerem A, 3. vzorek č. 4 po amplifikaci s primerem A, 4. vzorek č. 7 po amplifikaci s primerem A, 5. vzorek č. 8 po amplifikaci s primerem A, 6. vzorek č. 11 po amplifikaci s primerem A, 7. netransformovaný tabák s primerem A, 8. kontrola bez DNA s primerem A, 9. vzorek č. 3 po amplifikaci s primerem B, 10. vzorek č. 4 po amplifikaci s primerem B, 11. vzorek č. 7 po amplifikaci s primerem B, 12. vzorek č. 8 po amplifikaci s primerem B, 13. vzorek č. 11 po amplifikaci s primerem B, 14. netransformovaný tabák s primerem B, 15 kontrola bez DNA s primerem B Na výsledné fotografii agarózového gelu (obr. 16) můžeme vidět amplifikované fragmenty jak v případě promotoru-terminátoru ImpactVector1.3, tak v případě reportérového genu uida. V obou případech vyšly obě kontroly negativně (kontrola netransformovaný tabák a kontrola bez DNA), zatímco u všech pěti rostlin tabáků, jejichž úspěšná transformace byla prokázána histochemickou GUS reakcí, byla pozitivní i PCR. 50

51 Dále byla provedena optimalizace annealingu primerů pro oblast promotoruterminátoru ImpactVector1.3 pomocí gradientové PCR reakce, protože reakční podmínky pro PCR s primery I.V. F/R se nejevili optimální. Obr. 17 Amplifikované fragmenty vzorku č. 4 s primerem I.V. F/R. Jamky: bp Quick load DNA Ladder, 2. vzorek č. 4 - teplota nasedání primeru I.V. F/R 50 C, 3. vzorek č. 4 při 50,5 C, 4. vzorek č. 4 při 51,4 C, 5. vzorek č. 4 při 53 C, 6. vzorek č. 4 při 54,8 C, 7. vzorek č. 4 při 56,6 C, 8. vzorek č. 4 při 58,4 C, 9. vzorek č. 4 při 60,2 C, 10. vzorek č. 4 při 62,0 C Bylo zjištěno, že optimální teplota pro nasedání primerů je 59 C (obr. 17), na fotografii je vidět nejsilnější PCR produkt v jamce 8 a 9. Na druhé straně se ukázalo, že tento pár primerů nepracuje zcela optimálně při žádné teplotě výsledný PCR produkt není optimálně robustní. 51

Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/28.0018

Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/28.0018 Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/28.0018 2.4 GENETICKÉ MANIPULACE in vitro - nekonvenční techniky, kterými lze modifikovat rostlinný

Více

ÚLOHA C Klonování PCR produktu do plasmidu

ÚLOHA C Klonování PCR produktu do plasmidu Jméno a učo: Datum: ÚLOHA C Klonování PCR produktu do plasmidu TEORETICKÝ ÚVOD Při klonování PCR produktů do plasmidů se využívá vlastnosti Taq polymerasy, a jiných non-proofreading polymeras, přidávat

Více

Organizace a kontrola pěstování GM plodin v ČR. Ing. Jana Trnková MZe, odbor rostlinných komodit

Organizace a kontrola pěstování GM plodin v ČR. Ing. Jana Trnková MZe, odbor rostlinných komodit Organizace a kontrola pěstování GM plodin v ČR Ing. Jana Trnková MZe, odbor rostlinných komodit Geneticky modifikované plodiny GM plodiny, transgenní rostliny změněn dědičný materiál (DNA) pomocí genových

Více

1. Metodika. Protokol č. F1-4 Metodika: Srovnávací analýza efektivity přípravy rekombinantního proteinu ve fermentoru

1. Metodika. Protokol č. F1-4 Metodika: Srovnávací analýza efektivity přípravy rekombinantního proteinu ve fermentoru Protokol č.: F1-4 Datum: 20.12.2010 Metodika: analýza efektivity přípravy výběr z výsledků ze zkušebních provozů výroby antigenů. Vypracoval: Ing. Václav Filištein, Mgr. Tereza Chrudimská, Spolupracující

Více

BAKTERIÁLNÍ REZISTENCE

BAKTERIÁLNÍ REZISTENCE BAKTERIÁLNÍ REZISTENCE Petr Zouhar, Fyziologický ústav AV ČR, v. v. i.; UK v Praze, PřF, Katedra fyziologie V této úloze se v hrubých rysech seznámíte s některými metodami používanými v běžné molekulárně

Více

GENETICKY MODIFIKOVANÉ

GENETICKY MODIFIKOVANÉ GENETICKY MODIFIKOVANÉ ROSTLINY (GMR) Lukáš Fischer Katedra experimentální biologie rostlin PřF UK Geny základ vlastností organismů Změny genetické informace rostlin a definice genetické modifikace dle

Více

analýza dat a interpretace výsledků

analýza dat a interpretace výsledků Genetická transformace bakterií III analýza dat a interpretace výsledků Předmět: Biologie ŠVP: Prokaryotní organismy, genetika Doporučený věk žáků: 16-18 let Doba trvání: 45 minut Specifické cíle: analyzovat

Více

MIKROBIOLOGIE V BIOTECHNOLOGII

MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Využití živých organismů pro uskutečňování definovaných chemických procesů pro průmyslové nebo komerční aplikace Organismus je geneticky upraven metodami genetického

Více

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky.

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální

Více

GENETICKY MODIFIKOVANÉ ORGANISMY. Prof. Jaroslav DROBNÍK Přírodovědecká fakulta Karlovy Univerzity Sdružení BIOTRIN

GENETICKY MODIFIKOVANÉ ORGANISMY. Prof. Jaroslav DROBNÍK Přírodovědecká fakulta Karlovy Univerzity Sdružení BIOTRIN GENETICKY MODIFIKOVANÉ ORGANISMY Prof. Jaroslav DROBNÍK Přírodovědecká fakulta Karlovy Univerzity Sdružení BIOTRIN VERTIKÁLNÍ PŘENOS VLASTNOSTÍ DĚDIČNOST považoval člověk za samozřejmou zákonitost Evoluce

Více

Nové směry v rostlinných biotechnologiích

Nové směry v rostlinných biotechnologiích Nové směry v rostlinných biotechnologiích Tomáš Moravec Ústav Experimentální Botaniky AV ČR Praha 2015-05-07 Praha Prvních 30. let transgenních rostlin * V roce 2014 byly GM plodiny pěstovány na ploše

Více

MIKROBIOLOGIE V BIOTECHNOLOGII

MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Termín biotechnologie byl poprvé použit v roce 1917 Procesy, při kterých se na tvorbě výsledného produktu podílejí živé organismy Širší definice: biotechnologie

Více

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží

Více

Molekulární biotechnologie č.8. Produkce heterologního proteinu v eukaryontních buňkách

Molekulární biotechnologie č.8. Produkce heterologního proteinu v eukaryontních buňkách Molekulární biotechnologie č.8 Produkce heterologního proteinu v eukaryontních buňkách Eukaryontní buňky se využívají v případě, když Eukaryontní proteiny syntetizované v baktériích postrádají biologickou

Více

BAKTERIÁLNÍ GENETIKA. Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc.

BAKTERIÁLNÍ GENETIKA. Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. BAKTERIÁLNÍ GENETIKA Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. -dědičnost u baktérií principiálně stejná jako u komplexnějších organismů -genom haploidní a značně menší Bakteriální genom

Více

Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202)

Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Popis Column DNA Lego Kit je základ moderní stavebnicové (Lego) soupravy pro izolaci čisté DNA různého

Více

Izolace nukleových kyselin

Izolace nukleových kyselin Izolace nukleových kyselin Požadavky na izolaci nukleových kyselin V nativním stavu z přirozeného materiálu v dostatečném množství požadované čistotě. Nukleové kyseliny je třeba zbavit všech látek, které

Více

STUDIE GENOMON VÝSKYT GENETICKY MODIFIKOVANÝCH POTRAVIN V TRŽNÍ SÍTI V ČR V ROCE 2010. M. Mendlová, V. Ostrý, J. Ruprich

STUDIE GENOMON VÝSKYT GENETICKY MODIFIKOVANÝCH POTRAVIN V TRŽNÍ SÍTI V ČR V ROCE 2010. M. Mendlová, V. Ostrý, J. Ruprich STUDIE GENOMON VÝSKYT GENETICKY MODIFIKOVANÝCH POTRAVIN V TRŽNÍ SÍTI V ČR V ROCE 2010 M. Mendlová, V. Ostrý, J. Ruprich Státní zdravotní ústav v Praze Centrum zdraví, výživy a potravin Oddělení analýzy

Více

Zdrojem je mrna. mrna. zpětná transkriptáza. jednořetězcová DNA. DNA polymeráza. cdna

Zdrojem je mrna. mrna. zpětná transkriptáza. jednořetězcová DNA. DNA polymeráza. cdna Obsah přednášky 1) Klonování složených eukaryotických genů 2) Úprava rekombinantních genů 3) Produkce rekombinantních proteinů v expresních systémech 4) Promotory 5) Vektory 6) Reportérové geny Zdrojem

Více

Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav biologie rostlin Geneticky modifikované rostliny v zemědělské praxi - přínosy a rizika Bakalářská práce Vedoucí práce: Ing. Tomáš

Více

MENDELOVA UNIVERZITA V BRNĚ AGRONOMICKÁ FAKULTA DIPLOMOVÁ PRÁCE

MENDELOVA UNIVERZITA V BRNĚ AGRONOMICKÁ FAKULTA DIPLOMOVÁ PRÁCE MENDELOVA UNIVERZITA V BRNĚ AGRONOMICKÁ FAKULTA DIPLOMOVÁ PRÁCE BRNO 2011 HELENA BŘUSKOVÁ Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Tvorba vektorových konstruktů pro indukci

Více

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné:

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné: Výběrové otázky: 1. Součástí všech prokaryotických buněk je: a) DNA, plazmidy b) plazmidy, mitochondrie c) plazmidy, ribozomy d) mitochondrie, endoplazmatické retikulum 2. Z následujících tvrzení, týkajících

Více

Geneticky modifikované potraviny a krmiva

Geneticky modifikované potraviny a krmiva Geneticky modifikované potraviny a krmiva Co je to geneticky modifikovaný organismus (GMO)? Za GMO je považován organismus, s výjimkou člověka, jehož dědičná informace uložená v DNA byla změněna pomocí

Více

Geneticky modifikované rostliny - proč je potřebujeme a jak je získáváme

Geneticky modifikované rostliny - proč je potřebujeme a jak je získáváme Geneticky modifikované rostliny - proč je potřebujeme a jak je získáváme Doc. RNDr. Jindřich Bříza, CSc. ÚMBR BC AV ČR,v.v.i. & katedra genetiky PřF JU Branišovská 31, 370 05 České Budějovice GM crops

Více

TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně

Více

Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie

Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie IZOLACE GENOMOVÉ DNA Deoxyribonukleová kyselina (DNA) představuje základní genetický materiál většiny

Více

Projekt realizovaný na SPŠ Nové Město nad Metují

Projekt realizovaný na SPŠ Nové Město nad Metují Projekt realizovaný na SPŠ Nové Město nad Metují s finanční podporou v Operačním programu Vzdělávání pro konkurenceschopnost Královéhradeckého kraje Modul 02 Přírodovědné předměty Hana Gajdušková 1 Viry

Více

Exprese rekombinantních proteinů

Exprese rekombinantních proteinů Exprese rekombinantních proteinů Exprese rekombinantních proteinů je proces, při kterém můžeme pomocí různých expresních systémů vytvořit protein odvozený od konkrétního genu, nebo části genu. Tento protein

Více

MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ AGRONOMICKÁ FAKULTA BAKALÁŘSKÁ PRÁCE

MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ AGRONOMICKÁ FAKULTA BAKALÁŘSKÁ PRÁCE MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ AGRONOMICKÁ FAKULTA BAKALÁŘSKÁ PRÁCE BRNO 2007 MICHAL ROHRER Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Více

Geneticky modifikované potraviny: současný stav v ČR a legislativa. (Co nám hrozí od geneticky upravených potravin? Mj. vzestup alergií?

Geneticky modifikované potraviny: současný stav v ČR a legislativa. (Co nám hrozí od geneticky upravených potravin? Mj. vzestup alergií? Geneticky modifikované potraviny: současný stav v ČR a legislativa. (Co nám hrozí od geneticky upravených potravin? Mj. vzestup alergií?) Jaroslav Drobník Přírodovědecká fakulta UK Sdružení BIOTRIN Politické,

Více

Obsah přednášky. 1) Zákon č. 78/2004 2) GMO ve světě 3) GMO v EU 4) Situace s nakládáním v ČR 5) Reakce zájmových skupin

Obsah přednášky. 1) Zákon č. 78/2004 2) GMO ve světě 3) GMO v EU 4) Situace s nakládáním v ČR 5) Reakce zájmových skupin Obsah přednášky 1) Zákon č. 78/2004 2) GMO ve světě 3) GMO v EU 4) Situace s nakládáním v ČR 5) Reakce zájmových skupin 2 Zákon č. 78/2004 Sb. Směrnice Evropského parlamentu a Rady 2001/18/ES ze dne 12.3.

Více

Izolace RNA. doc. RNDr. Jan Vondráček, PhD..

Izolace RNA. doc. RNDr. Jan Vondráček, PhD.. Izolace RNA doc. RNDr. Jan Vondráček, PhD.. Metodiky izolace RNA celková buněčná RNA ( total RNA) zahrnuje řadu typů RNA, které se mohou lišit svými fyzikálněchemickými vlastnostmi a tedy i nároky na jejich

Více

Hodnocení rizik geneticky modifikovaných rostlin pro životní prostředí

Hodnocení rizik geneticky modifikovaných rostlin pro životní prostředí Klasifikace: Draft Pro vnitřní potřebu VVF Oponovaný draft Pro vnitřní potřebu VVF Finální dokument Pro oficiální použití Deklasifikovaný dokument Pro veřejné použití Název dokumentu: Hodnocení rizik geneticky

Více

Bi8240 GENETIKA ROSTLIN

Bi8240 GENETIKA ROSTLIN Bi8240 GENETIKA ROSTLIN Prezentace 09 Genetické modifikace pro zlepšení výţivy člověka doc. RNDr. Jana Řepková, CSc. repkova@sci.muni.cz Nový trend zlepšení výţivy lidí Výţiva a zdraví člověka Prevence

Více

Mendělejevova tabulka prvků

Mendělejevova tabulka prvků Mendělejevova tabulka prvků V sušině rostlin je obsaženo přibližně 45% uhlíku, 42% kyslíku, 6,5% vodíku, 1,5% dusíku a 5% minerálních prvků. Tzv. organogenní prvky (C, O, H, N) představují tedy 95% veškerých

Více

Transformace ptdna tabáku genem E7/GUS a eliminace selekčního genu za využití homologní rekombinace

Transformace ptdna tabáku genem E7/GUS a eliminace selekčního genu za využití homologní rekombinace Transformace ptdna tabáku fúzním genem E7/GUS a eliminace selekčního genu za využití homologní rekombinace Jiřich ich BřízaB 1,, Josef Vlasák 1, Štěpán n Ryba, Viera Ludvíkov ková 3, Hana Niedermeierová

Více

Praktické cvičení: Izolace a purifikace rekombinantního proteinu

Praktické cvičení: Izolace a purifikace rekombinantního proteinu Praktické cvičení: Izolace a purifikace rekombinantního proteinu Toto blokové praktické cvičení spočívá v teoretickém i praktickém seznámení s rekombinantními proteiny, jejich izolací, purifikací a využitím.

Více

Geneticky modifikované organismy

Geneticky modifikované organismy Geneticky modifikované organismy Ivo Frébort KBC/BAM Klonování a genetické modifikace Sci-fi Skutečnost Dolly the Sheep Genetické modifikace a baktérií a kvasinek - Běžná praxe Nadexprese proteinů Velkoobjemové

Více

Rezistence patogenů vůči antimikrobialním látkám. Martin Hruška Jan Dlouhý

Rezistence patogenů vůči antimikrobialním látkám. Martin Hruška Jan Dlouhý Rezistence patogenů vůči antimikrobialním látkám Martin Hruška Jan Dlouhý Pojmy Patogen (patogenní agens, choroboplodný zárodek nebo původce nemoci) je biologický faktor (organismus), který může zapřičinit

Více

THE CONTROL OF TRANSFORMATION EFFICIENCY IN PEA (PISUM SATIVUM L.) KONTROLA ÚČINNOSTI TRANSFORMACE U HRACHU SETÉHO (PISUM SATIVUM L.

THE CONTROL OF TRANSFORMATION EFFICIENCY IN PEA (PISUM SATIVUM L.) KONTROLA ÚČINNOSTI TRANSFORMACE U HRACHU SETÉHO (PISUM SATIVUM L. THE CONTROL OF TRANSFORMATION EFFICIENCY IN PEA (PISUM SATIVUM L.) KONTROLA ÚČINNOSTI TRANSFORMACE U HRACHU SETÉHO (PISUM SATIVUM L.) Matušková P., Hanáček P., Krejčí P., Reinöhl V., Procházka S. Ústav

Více

ZÁKLADY BAKTERIÁLNÍ GENETIKY

ZÁKLADY BAKTERIÁLNÍ GENETIKY Zdroj rozmanitosti mikrorganismů ZÁKLADY BAKTERIÁLNÍ GENETIKY Různé sekvence nukleotidů v DNA kódují různé proteiny Různé proteiny vedou k různým organismům s různými vlastnostmi Exprese genetické informace

Více

Transformace listových disků tabáku bakteriemi Agrobacterium tumefaciens. Transformation of leaf-discs of tobacco with Agrobacterium tumefaciens

Transformace listových disků tabáku bakteriemi Agrobacterium tumefaciens. Transformation of leaf-discs of tobacco with Agrobacterium tumefaciens STŘEDOŠKOLSKÁ ODBORNÁ ČINNOST Obor SOČ: 4. Biologie Transformace listových disků tabáku bakteriemi Agrobacterium tumefaciens Transformation of leaf-discs of tobacco with Agrobacterium tumefaciens Autor:

Více

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.

Více

BUŇKA ZÁKLADNÍ JEDNOTKA ORGANISMŮ

BUŇKA ZÁKLADNÍ JEDNOTKA ORGANISMŮ BUŇKA ZÁKLADNÍ JEDNOTKA ORGANISMŮ SPOLEČNÉ ZNAKY ŽIVÉHO - schopnost získávat energii z živin pro své životní potřeby - síla aktivně odpovídat na změny prostředí - možnost růstu, diferenciace a reprodukce

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2 http://www.paternityexperts.com/basicgenetics.html

Více

Havarijní plán PřF UP

Havarijní plán PřF UP Havarijní plán PřF UP v němž se nakládá s geneticky modifikovanými organismy (GMO), zpracovaný podle 20, odst. 4 zákona č. 78/2004 Sb. pro pracoviště kateder Buněčné biologie a genetiky a Oddělení molekulární

Více

VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ

VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ Lucie Vištejnová 2, Jan Hodek 1, Patrik Sekerka 2, Jaroslava Ovesná 1, Kateřina Demnerová 2 1. Výzkumný ústav rostlinné výroby, Drnovská 507,

Více

Protokoly Transformace plasmidu do elektrokompetentních buněk BL21 Pracovní postup:

Protokoly Transformace plasmidu do elektrokompetentních buněk BL21 Pracovní postup: Protokoly Pracovní potřeby, pufry a chemikálie jsou uvedeny na konci protokolu. Pracovní postupy jsou odvozeny od těchto kitů: Champion pet160 Directional TOPO Expression Kit with Lumio Technology (Invitrogen)

Více

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)

Více

DIGITÁLNÍ UČEBNÍ MATERIÁL

DIGITÁLNÍ UČEBNÍ MATERIÁL DIGITÁLNÍ UČEBNÍ MATERIÁL Číslo projektu CZ.1.07/1.5.00/34.0763 Název školy SOUpotravinářské, Jílové u Prahy, Šenflukova 220 Název materiálu INOVACE_32_Sur. 3/01/01/13 Autor Ing. Eva Hrušková Obor; předmět,

Více

Jméno: Martin Dočkal Datum: 26. 9. 2010 Referát na téma: GMO Geneticky modifikované organismy Geneticky modifikované organismy Člověk je od přírody pohodlný a má velkou dávku fantazie. Aby nemusel měnit

Více

GM kukuřice. 0,0004% DNA kukuřice

GM kukuřice. 0,0004% DNA kukuřice Kolik je DNA v krmivech a potravinách? 0,005 až 0,02 % sušiny GM kukuřice cizí gen 4000 písmen 0,0004% DNA kukuřice Hypotetický příklad: brojler Krmná dávka - jen kukuřice Veškerá kukuřice jen GMO Brojler

Více

Klonování gen a genové inženýrství

Klonování gen a genové inženýrství Klonování gen a genové inženýrství Genové inženýrství užite né termíny Rekombinantní DNA = DNA, ve které se nachází geny nejmén ze dvou zdroj, asto ze dvou zných druh organism Biotechnologie = manipulace

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI INDUKOVANÉ PŮSOBENÍM ORGANICKÝCH LÁTEK Z PRACHOVÝCH ČÁSTIC V OVZDUŠÍ Kateřina Hanzalová Oddělení genetické ekotoxikologie Ústav experimentální medicíny AV ČR v.v.i.

Více

Kyselina hyaluronová. Kyselina hyaluronová. Streptococcus equi subsp. produkovaná kyselina hyaluronová a. Autor prezentace: Mgr.

Kyselina hyaluronová. Kyselina hyaluronová. Streptococcus equi subsp. produkovaná kyselina hyaluronová a. Autor prezentace: Mgr. Kyselina hyaluronová Streptococcus equi subsp. zooepidemicus a jím produkovaná kyselina hyaluronová a glukuronidáza Marcela Tlustá Biotechnologická laborato Meyer a Palmer, 1934 Extracelulární matrix,

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

PROBLÉMY ŽIVOTNÍHO PROSTŘEDÍ ORGANISMY

PROBLÉMY ŽIVOTNÍHO PROSTŘEDÍ ORGANISMY PROBLÉMY ŽIVOTNÍHO PROSTŘEDÍ ORGANISMY 2010 Ing. Andrea Sikorová, Ph.D. 1 Problémy životního prostředí - organismy V této kapitole se dozvíte: Co je to organismus. Z čeho se organismus skládá. Jak se dělí

Více

FYZIOLOGIE ROSTLIN. Přednášející: Doc. Ing. Václav Hejnák, Ph.D. Tel.: 224382514 E-mail: hejnak @af.czu.cz

FYZIOLOGIE ROSTLIN. Přednášející: Doc. Ing. Václav Hejnák, Ph.D. Tel.: 224382514 E-mail: hejnak @af.czu.cz FYZIOLOGIE ROSTLIN Přednášející: Doc. Ing. Václav Hejnák, Ph.D. Tel.: 224382514 E-mail: hejnak @af.czu.cz Studijní literatura: Hejnák,V., Zámečníková,B., Zámečník, J., Hnilička, F.: Fyziologie rostlin.

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza

Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza Exprese genetického kódu Centrální dogma molekulární biologie - genetická informace v DNA -> RNA -> primárního řetězce proteinu 1) transkripce - přepis z DNA do mrna 2) translace - přeložení z kódu nukleových

Více

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/28.0032

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/28.0032 Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Seminář Rostlinné biotechnologie kolem nás Božena Navrátilová LS 2014/2015 Seminář

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Tradice šlechtění šlechtění zlepšování pěstitelsky, technologicky a spotřebitelsky významných vlastností

Více

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Ekologie a aplikovaná biotechnologie rostlin BOT/EABR Garant: Božena Navrátilová

Více

Speciace neboli vznik druhů. KBI/GENE Mgr. Zbyněk Houdek

Speciace neboli vznik druhů. KBI/GENE Mgr. Zbyněk Houdek Speciace neboli vznik druhů KBI/GENE Mgr. Zbyněk Houdek Co je to druh? Druh skupina org., které mají společné určité znaky. V klasické taxonomii se jedná pouze o fenotypové znaky. V evoluční g. je druh

Více

Kultivační metody stanovení mikroorganismů

Kultivační metody stanovení mikroorganismů Kultivační metody stanovení mikroorganismů Základní rozdělení půd Syntetická, definovaná media, jednoduché sloučeniny, známé sloţení Komplexní media, vycházejí z ţivočišných nebo rostlinných tkání a pletiv,

Více

Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti

Více

5. Bioreaktory. Schematicky jsou jednotlivé typy bioreaktorů znázorněny na obr. 5.1. Nejpoužívanějšími bioreaktory jsou míchací tanky.

5. Bioreaktory. Schematicky jsou jednotlivé typy bioreaktorů znázorněny na obr. 5.1. Nejpoužívanějšími bioreaktory jsou míchací tanky. 5. Bioreaktory Bioreaktor (fermentor) je nejdůležitější částí výrobní linky biotechnologického procesu. Jde o nádobu různého objemu, ve které probíhá biologický proces. Dochází zde k růstu buněk a tvorbě

Více

Úvod do mikrobiologie

Úvod do mikrobiologie Úvod do mikrobiologie 1. Lidské infekční patogeny Subcelulární Prokaryotické o. Eukaryotické o. Živočichové Priony Chlamydie Houby Červi Viry Rickettsie Protozoa Členovci Mykoplasmata Klasické bakterie

Více

Laboratoř růstových regulátorů Miroslav Strnad. ové kultury. Olomouc. Univerzita Palackého & Ústav experimentální botaniky AV CR

Laboratoř růstových regulátorů Miroslav Strnad. ové kultury. Olomouc. Univerzita Palackého & Ústav experimentální botaniky AV CR Laboratoř růstových regulátorů Miroslav Strnad Tkáňov ové kultury Olomouc Univerzita Palackého & Ústav experimentální botaniky AV CR DEFINICE - růst a vývoj rostlinných buněk, pletiv a orgánů lze účinně

Více

Abiotický stres - sucho

Abiotický stres - sucho FYZIOLOGIE STRESU Typy stresů Abiotický (vliv vnějších podmínek) sucho, zamokření, zasolení půd, kontaminace prostředí toxickými látkami, chlad, mráz, vysoké teploty... Biotický (způsobený jiným druhem

Více

Minerální výživa na extrémních půdách. Půdy silně kyselé, alkalické, zasolené a s vysokou koncentrací těžkých kovů

Minerální výživa na extrémních půdách. Půdy silně kyselé, alkalické, zasolené a s vysokou koncentrací těžkých kovů Minerální výživa na extrémních půdách Půdy silně kyselé, alkalické, zasolené a s vysokou koncentrací těžkých kovů Procesy vedoucí k acidifikaci půd Zvětrávání hornin s následným vymýváním kationtů (draslík,

Více

Mnohobuněčné kvasinky

Mnohobuněčné kvasinky Laboratoř buněčné biologie PROJEKT Mnohobuněčné kvasinky Libuše Váchová ve spolupráci s laboratoří Prof. Palkové (PřFUK) Do laboratoře přijímáme studenty se zájmem o vědeckou práci Kontakt: vachova@biomed.cas.cz

Více

Transgenoze a reverzní genetika. Metody transformace rostlinných buněk Rekombinace

Transgenoze a reverzní genetika. Metody transformace rostlinných buněk Rekombinace Transgenoze a reverzní genetika Metody transformace rostlinných buněk Rekombinace Využití transgenoze 2 Mutageneze (ztráta funkce) Využití transgenoze 3 Charakterizace promotoru na základě exprese reportérového

Více

rostlin a její využit ití pro produkci nových odrůd

rostlin a její využit ití pro produkci nových odrůd Základní principy transgenoze rostlin a její využit ití pro produkci nových odrůd Doc. RNDr. Jindřich ich Bříza, B CSc. BC AV ČR, v.v.i. a PřF JU České Budějovice Šlechtění rostlin v neolitu umělý výběr

Více

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu

Více

Vakcíny z nádorových buněk

Vakcíny z nádorových buněk Protinádorové terapeutické vakcíny Vakcíny z nádorových buněk V. Vonka, ÚHKT, Praha Výhody vakcín z nádorových buněk 1.Nabízejí imunitnímu systému pacienta celé spektrum nádorových antigenů. 2. Jejich

Více

GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných

Více

Transformace rostlin. úvod metody

Transformace rostlin. úvod metody Transformace rostlin úvod metody Biotechnologie metody využívající různé organismy ve prospěch člověka a současně pozměňující jejich vlastnosti tak, aby byly co nejlépe využitelné výrobní postupy: získávání

Více

Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k

Více

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Níže uvedené komentáře by měly pomoci soutěžícím z kategorie B ke snazší orientaci

Více

Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 4. Metody molekulární biologie I Izolace DNA a RNA Specifické postupy pro baktérie, kvasinky, rostlinné a živočišné tkáně U RNA nutno zabránit kontaminaci

Více

BUNĚČNÁ TRANSFORMACE A NÁDOROVÉ BUŇKY

BUNĚČNÁ TRANSFORMACE A NÁDOROVÉ BUŇKY BUNĚČNÁ TRANSFORMACE A NÁDOROVÉ BUŇKY 1 VÝZNAM BUNĚČNÉ TRANSFORMACE V MEDICÍNĚ Příklad: Buněčná transformace: postupná kumulace genetických změn Nádorové onemocnění: kolorektální karcinom 2 3 BUNĚČNÁ TRANSFORMACE

Více

Bílkoviny a rostlinná buňka

Bílkoviny a rostlinná buňka Bílkoviny a rostlinná buňka Bílkoviny Rostliny --- kontinuální diferenciace vytváření orgánů: - mitotická dělení -zvětšování buněk a tvorba buněčné stěny syntéza bílkovin --- fotosyntéza syntéza bílkovin

Více

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Inovace praktických cvičení molekulárně-biologických předmětů o sekvenční úlohy PRACOVNÍ PROTOKOL PRO PŘEDMĚT GENETCKÁ DIVERZITA Vypracováno

Více

STAFYLOKOKOVÉ ENTEROTOXINY. Zdravotní nezávadnost potravin. Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336

STAFYLOKOKOVÉ ENTEROTOXINY. Zdravotní nezávadnost potravin. Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336 STAFYLOKOKOVÉ ENTEROTOXINY Zdravotní nezávadnost potravin Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336 OBSAH: Základní charakteristika Staphylococcus aureus Stafylokokové enterotoxiny

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby

Více

SSOS_ZE_2.14 Ekologické zemědělství

SSOS_ZE_2.14 Ekologické zemědělství Číslo a název projektu Číslo a název šablony CZ.1.07/1.5.00/34.0378 Zefektivnění výuky prostřednictvím ICT technologií III/2 - Inovace a zkvalitnění výuky prostřednictvím ICT DUM číslo a název SSOS_ZE_2.14

Více

Nutriční aspekty konzumace mléčných výrobků

Nutriční aspekty konzumace mléčných výrobků Nutriční aspekty konzumace mléčných výrobků Prof. MVDr. Lenka VORLOVÁ, Ph.D. a kolektiv FVHE VFU Brno Zlín, 2012 Mléčné výrobky mají excelentní postavení mezi výrobky živočišného původu - vyšší biologická

Více

Transgenní řepka olejka (Brassica napus L.) její monitoring, molekulární detekce a vliv agrotechniky na eliminaci výdrolu

Transgenní řepka olejka (Brassica napus L.) její monitoring, molekulární detekce a vliv agrotechniky na eliminaci výdrolu Transgenní řepka olejka (Brassica napus L.) její monitoring, molekulární detekce a vliv agrotechniky na eliminaci výdrolu Genové inženýrství umožňuje vnesení hospodářsky významných znaků do zájmových plodin

Více

RNA Blue REAGENS PRO RYCHLOU PŘÍPRAVU ČISTÉ A NEDEGRADOVANÉ RNA (katalogové číslo R011, R012, R013)

RNA Blue REAGENS PRO RYCHLOU PŘÍPRAVU ČISTÉ A NEDEGRADOVANÉ RNA (katalogové číslo R011, R012, R013) RNA Blue REAGENS PRO RYCHLOU PŘÍPRAVU ČISTÉ A NEDEGRADOVANÉ RNA (katalogové číslo R011, R012, R013) Upozornění: RNA Blue obsahuje fenol a další toxické komponenty. Při kontaktu s kůží je nutné omytí velkým

Více

Buňka. Autor: Mgr. Jitka Mašková Datum: Gymnázium, Třeboň, Na Sadech 308

Buňka. Autor: Mgr. Jitka Mašková Datum: Gymnázium, Třeboň, Na Sadech 308 Buňka Autor: Mgr. Jitka Mašková Datum: 27. 10. 2012 Gymnázium, Třeboň, Na Sadech 308 Číslo projektu Číslo materiálu CZ.1.07/1.5.00/34.0702 VY_32_INOVACE_BIO.prima.02_buňka Škola Gymnázium, Třeboň, Na Sadech

Více

Transgenní rostliny využitelné ve fytoremediacích

Transgenní rostliny využitelné ve fytoremediacích Vysoká škola chemicko-technologická v Praze Transgenní rostliny využitelné ve fytoremediacích Ing. Jitka Viktorová, Ph.D. Ing. Martina Nováková, Ph.D. Prof. Ing. Tomáš Macek, CSc. Ing. Neumannová, Ing.

Více

FLUORESCENČNÍ MIKROSKOP

FLUORESCENČNÍ MIKROSKOP FLUORESCENČNÍ MIKROSKOP na gymnáziu Pierra de Coubertina v Táboře Pavla Trčková, kabinet Biologie, GPdC Tábor Co je fluorescence Fluorescence je jev spočívající v tom, že některé látky (fluorofory) po

Více

IZOLACE, SEPARACE A DETEKCE PROTEINŮ I. Vlasta Němcová, Michael Jelínek, Jan Šrámek

IZOLACE, SEPARACE A DETEKCE PROTEINŮ I. Vlasta Němcová, Michael Jelínek, Jan Šrámek IZOLACE, SEPARACE A DETEKCE PROTEINŮ I Vlasta Němcová, Michael Jelínek, Jan Šrámek Studium aktinu, mikrofilamentární složky cytoskeletu pomocí dvou metod: detekce přímo v buňkách - fluorescenční barvení

Více

Číslo a název projektu Číslo a název šablony

Číslo a název projektu Číslo a název šablony Číslo a název projektu Číslo a název šablony DUM číslo a název CZ.1.07/1.5.00/34.0378 Zefektivnění výuky prostřednictvím ICT technologií III/2 - Inovace a zkvalitnění výuky prostřednictvím ICT SSOS_ZE_1.05

Více

Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip

Více

Errata: Respektujte varovné věty a symboly uvedené v označení Přípravek je ke dni 25.9.2014 povolen pouze pro profesionální uživatele

Errata: Respektujte varovné věty a symboly uvedené v označení Přípravek je ke dni 25.9.2014 povolen pouze pro profesionální uživatele Errata: Respektujte varovné věty a symboly uvedené v označení Přípravek je ke dni 25.9.2014 povolen pouze pro profesionální uživatele Dokonalá ochrana proti botrytidě a sekundárním chorobám Popis přípravku

Více