Praha prosince INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST.

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Praha - 23. prosince 2009. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST."

Transkript

1 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 51 Praha prosince 2009 Číselné INID kódy pro označování bbibliografických dat technických řešení INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST. 80) (15) (23) (28) (40) (45) (55) (57) (68) (71) (92) (93) (94) (95) číslo patentu/zápisu/osvědčení datum zápisu průmyslového vzoru číslo přihlášky/žádosti datum podání přihlášky/žádosti údaje o výstavní prioritě počet průmyslových vzorů číslo prioritní přihlášky datum podání prioritní přihlášky země priority datum zveřejnění přihlášky vynálezu datum zveřejnění zapsaného průmyslového vzoru datum zveřejnění udělení patentu a zápisu užitného vzoru, datum zápisu užitného vzoru, datum oznámení udělení evropského patentu v Evropském patentovém věstníku mezinárodní patentové třídění/locarnské třídění průmyslových vzorů název vyobrazení průmyslového vzoru anotace číslo základního patentu označení přihlašovatele/žadatele označení původce označení majitele/vlastníka označení zástupce číslo mezinárodní přihlášky číslo mezinárodního zveřejnění datum a číslo první registrace přípravku pro Českou republiku datum, číslo a země první registrace přípravku v rámci Společenství doba platnosti osvědčení označení a typ přípravku datum podání a číslo evropské patentové přihlášky datum zveřejnění a číslo zveřejnění evropské patentové přihlášky v Evropském patentovém věstníku (15) (23) (28) (40) (45) (55) (57) (68) (71) (92) (93) (94) (95) Number of the patent/registration/certification Industrial design registration date Application number Date of application filling Exhibition priority data Number of industrial designs included in the application Number of priority application Filling date of priority application Priority country Date of publication of patent application Publication date of the registered industrial design Publication date of patent granting and publication date of utility model registration, registration date of utility model, publication date of European patent granting in the European patent bulletin International Patent Classification/ Locarno Classification for Industrial Designs Title Reproduction of the industrial design Abstract Number of the basic patent Applicant Inventor Owner Attorney's name and address International application number International publication number Date and number(s) of the first authorization to market the product in the CZ Date, number(s) and country of the first authorization to market the product in the EEC Term of certification validity Name of the product and product type European patent application filling date and number European patent application publication date and publication number in the European patent bulletin Číselné INID kódy pro označování bibliografických dat ochranných známek (450) (526) (551) (554) (558) (583) (591) (811) (890) Číslo zápisu ochranné známky (registrace) Datum zápisu ochranné známky Číslo přihlášky ochranné známky (spisu) Datum podání přihlášky Datum vzniku práva přednosti Datum zveřejnění přihlášky po průzkumu Datum zveřejnění zápisu ochranné známky ve Věstníku Seznam výrobků a služeb Číslo třídy výrobků a služeb Omezení rozsahu ochrany o prvek Znění nebo vyobrazení ochranné známky Kolektivní ochranná známka Prostorová ochranná známka Ochranná známka tvořená pouze barvou nebo kombinací barev Datum právní moci rozhodnutí/výsledek rozhodnutí Údaje o barevnosti ochranné známky Přihlašovatel/vlastník ochranné známky Zástupce Mezinárodní číslo zápisu ochranné známky Kód státu ochrany mezinárodní ochranné známky INID codes and minimum required for the identification of bibliographics data relating to marks (Standard WIPO ST.60) (450) (526) (551) (554) (558) (583) (591) (811) (890) Number of registration Date of the registration Number of the application Date of filing of the application Date of the first application Date of the publication of the examined application Date of publication of the registration List of goods and/or services Number of the class of goods and/or services Disclaimer Reproduction of the mark Collective mark Three-dimensional mark Mark consisting exclusively of one or several colours Date of the legal force of the decision/ result of the decision Information concerning colour The applicant or the holder of the mark Name and address of the representative Number of the international registration INID code of the state of the international mark

2 Kódy pro kódování záhlaví oznámení publikovaných ve Věstníku (Standard WIPO ST. 17) BB9A FG1K FG4A FG4Q LD3K LD4Q MA4A MA4F MC3K MC4A MC4F MC4Q MH1K MH4A MH4F MH4Q MK1K zveřejněné přihlášky vynálezů zapsané užitné vzory udělené patenty zapsané průmyslové vzory částečný výmaz užitného vzoru částečný výmaz průmyslového vzoru zánik patentu vzdáním se zánik autorských osvědčení vzdáním se výmaz užitného vzoru zrušení patentu zrušení autorského osvědčení výmaz průmyslového vzoru zánik užitného vzoru vzdáním se částečné zrušení patentu částečné zrušení autorského osvědčení zánik průmyslového vzoru vzdáním se zánik užitného vzoru uplynutím doby platnosti MK4A MK4F MK4Q MM4A MM4F ND1K ND4Q PA4A PC9A PD1K PD4A PD4Q QA9A SB4A SB4F zánik patentů uplynutím doby platnosti zánik autorských osvědčení uplynutím doby platnosti zánik průmyslového vzoru uplynutím doby ochrany zánik patentů pro nezaplacení ročních poplatků zánik autorských osvědčení pro nezaplacení ročních poplatků prodloužení platnosti užitného vzoru obnova doby ochrany průmyslového vzoru změna autorského osvědčení na patent změna dispozičního práva k vynálezu převod práv a ostatní změny majitelů užitných vzorů převod práv a ostatní změny majitelů patentů převod práv a ostatní změny vlastníků průmyslových vzorů nabídka licence zapsané patenty do rejstříku po odtajnění zapsaná autorská osvědčení do rejstříku po odtajnění HA9A HB9A HC9A HD9A HE9A jmenování vynálezce oprava jmen změna jmen oprava adres změna adres Opravy Změny Různé Opravy u přihlášek vynálezů s žádostí o udělení patentu HF9A HG9A HH9A HK9A oprava dat oprava chyb v třídění oprava nebo změna všeobecně tiskové chyby v úřed. věstnících TA4A TB4A TC4A TD4A TE4A TF4A TG4A TH4A TK9A TA4F TB4F TC4F TD4F TE4F TF4F TG4F TH4F TK9F TA1K TB1K TC1K TD1K TE1K TF1K TG1K TH1K TK1K Opravy ochranných dokumentů patenty autorská osvědčení užitné vzory průmyslové vzory TA4Q TB4Q TC4Q TD4Q TE4Q TF4Q TG4Q TH4Q TK4Q jmenování vynálezce oprava jmen změna jmen oprava adres změna adres oprava dat oprava chyb v třídění oprava nebo změna všeobecně tiskové chyby v úřed. věstnících

3 Kódy pro označování zemí a mezinárodních organizací použité ve věstníku Kódy pro označování států USA použité ve věstníku BE BR CA CZ DE FR GB HR JP LK MY NL RU SI US VG Belgie Brazílie Kanada Česká republika Spolková republika Německo Francie Velká Británie Chorvatsko Japonsko Srí Lanka Malajsie Nizozemí Ruská federace Slovinsko Spojené státy americké Panenské ostrovy (Britské) CA DE MI NJ NY California Delaware Michigan New Jersey New York

4 (zveřejněné přihlášky vynálezů) 1 BB9A Zveřejněné přihlášky vynálezů - přehled podle čísel přihlášek Dále uvedené přihlášky vynálezů byly zveřejněny dnem, uvedeným ve Věstníku podle zákona č. 527/1990 Sb., o vynálezech a zlepšovacích návrzích, ve znění pozdějších předpisů, a jsou k dispozici v patentové knihovně Úřadu průmyslového vlastnictví, Antonína Čermáka 2a, , Praha F 03 B 13/12 E 04 G 13/06 E 04 H 1/00 F 24 F 5/00 F 26 B 19/00 B 63 B 1/12 C 12 N 11/14 C 07 K 7/08 E 06 B 3/70 E 06 B 9/42 G 01 N 1/10 A 01 K 1/02 C 12 N 15/10 G 01 N 31/22 G 09 F 3/00 B 61 L 29/16

5 (zveřejněné přihlášky vynálezů) 2 Zveřejněné přihlášky vynálezů - řazené podle MPT (71) (57) A01K 1/ Výzkumný ústav živočišné výroby, v. v. i., Praha 10 - Uhříněves, CZ Miller Jan Ing., Holubice, CZ Kunc Petr Ing. Ph.D., Praha 4, CZ Knížková Ivana Ing. CSc., Praha 3, CZ Miller Jan Ing., Holubice, CZ Individuální box pro volné ustájení zvířat Řešení se týká rozebíratelného individuálního boxu pro volné ustájení zvířat, zejmén a pro odchov mláďat větších savců. Box se skládá z desek, které se rozebíratelně uchycují v rámu (5) a z výběhového hrazení (1), které je zavěšeno na teleskopických tyčích (2). Ty jsou otočným mechanizmem (3) spojeny s boční stěnou (4). Přední stěna (6 ) a střecha (7) jsou volně propojeny v jeden celek, který je otočn ě připojen k zadní stěně (8 ). Výběhové hrazení (1) je výsuvné. Box má výklopnou čelní stěnu (10). Ministerstvo zemědělství ČR, Mgr. Hana Jirkalová, Těšnov 17, Praha 1, provádění tohoto způsobu je charakteristické, že hnací prvky pohonu břevna závory, tedy hnací hřídel (1), elektromotor (10), spojka a převody (12, 13), jsou seskupeny do samostatné větve, nezávislé na brzdových okruzích s brzd ami (7, 8) a volnoběžkami (9, 9') na brzdící hřídeli (1 6). Ing. Marie Smrčková, patentový zástupce, Velflíkova 10, Praha 6, (71) (57) B61L 29/16 B61L 29/08 B61L 29/ AŽD Praha s. r. o., Praha 10, CZ Lachman Pavel, Tovačov, CZ Čermák Pavel Ing., Brno, CZ Štěpánek Josef Ing., Olomouc, CZ Finger Jiří Ing., Náměšť na Hané, CZ Filar Jan, Olomouc, CZ Višňovský Karel Ing., Šternberk, CZ Adamec Josef Ing., Kolín, CZ Způsob a zařízení pro ovládání a kontrolu mechanické výstrahy u světelných přejezdových zabezpečovacích zařízení Způsob ovládání a kontroly mechanické výstrahy u světelných přejezdových zabezpečovacích zařízení, prostřednictvím elektromechanického pohonu břevna závory, probíhá tak, že se břevno závory sklopí v nastavitelném intervalu po vydání bezpečného povelového signálu (4) ke sklopení, které se provádí, současně, dvěma rů znými na sobě nezávislými principy sklápění, a to pasivního a nuceného, přičemž pasivní sklápění je zajištěno hmotností břevna a nucené sklápění elektromotorem (10). Břevno závory se zapevní bez vydání povelového signálu (4) ke sklopení, což se zabezpečuje zapevněním břevna závory v horní koncové poloze, současně, dvěma na sobě navzájem nezávislými brzdovými ok ruhy s pravidelným a automatickým testováním jejich funkce a vyhodnocením funkčnosti, přičemž bezpečná informace (5) o reálných koncových polohách břevna závory se získává současně ze d vou na sobě nezávislých úhlových snímačů (2, 3) p oloh y břevna závory s k omparací jejich fun kce. Pro zařízení pro (71) (57) (71) B63B 1/ Biologické centrum AV ČR, v. v. i., České Budějovice, CZ Kubečka Jan Doc. RNDr. CSc., České Budějovice, CZ Čech Martin RNDr. Ph.D., Vlašim, CZ Peterka Jiří RNDr. Ph.D., České Budějovice, CZ Plavidlo pro odlov vzorků ryb na volné vodě Plavidlo je tvořené dvěma trupy (11, 12) a opatřené pohonnou jednotkou, ráhnem (9) pro vytahování sítě a navijákem (10). Druhý trup (12) je výrazně menší než hlavní trup a prostor mezi nimi je vyplněn podlážkou (4) pro odkládání. Poháněcí jednotka je připevněna k hlavnímu trupu excentricky upínákem (2) na straně bližší druhému trupu (12). Středisko společných činností AV ČR, v. v. i,, Patentové a licenční služby, Národní 1009/3, Praha 1, C07K 7/08 A61P 31/04 A61P 31/10 A61P 31/12 A61P 33/00 A61P 35/ Ústav organické chemie a biochemie, Akademie věd ČR v. v. i., Praha 6, CZ

6 (zveřejněné přihlášky vynálezů) 3 (57) (71) (57) (71) (57) Čeřovský Václav RNDr. CSc., Praha 6, CZ Slaninová Jiřina RNDr. CSc., Praha 4, CZ Fučík Vladimír RNDr. CSc., Praha 7, CZ Bednárová Lucie RNDr. CSc., Praha 6, CZ Votruba Ivan RNDr. DrSc., Praha 8, CZ Nové syntetické peptidy a jejich použití Syntetická analoga peptidů obecných vzorců I a II, v nichž R 1 znamená acyl, alkyl či volnou aminoskupinu, R 2 zn amen á amid, substitu ovaný amid, volný karboxyl či ester, Xaa znamená nezávisle na sobě aminokyselinu kódovou, aminokyselinu D-řady nebo aminokyselinu nekódovou či tyto aminokyseliny modifikované v postranních skupinách, n znamená polohu záměny v peptidovém řetězci a m znamená počet záměn v peptidovém řetězci a jejich použití jako antimikrobiálních, antivirálních, protiplísňových, antiparazitických a protirakovinných sloučenin, které jsou tedy užitečné pro výrobu léčiva pro léčení mikrobiálních, virových, parazitických a plísňových onemocnění a pro léčen í rakovin. C12N 11/ Fyzikální ústav AV ČR, v.v.i., Praha 8, CZ Fyziologický ústav AV ČR, v.v.i., Praha 4, CZ Univerzita Karlova v Praze, 1. Lékařská fakulta, Praha 2, CZ Rezek Bohuslav RNDr. Ph.D., Praha 8, CZ Michalíková Lenka Ing., Nové Mesto nad Váhom, SK Kromka Alexander Ing. Ph.D., Lehota, SK Kalbáčová Marie RNDr. Ph.D., Janov nad Nisou, CZ Kmoch Stanislav Ing. CSc., Praha 1, CZ Grausová Lubica Mgr., Bratislava, SK Bačáková Lucie MUDr. CSc., Praha 5, CZ Vaněček Milan RNDr. CSc., Praha 12, CZ Kočka Jan RNDr. DrSc., Praha 9, CZ Způsob přípravy uspořádaných buněčných struktur Způsob přípravy uspořádaných buněčných struktur je charakteristický tím, že se na povrchu diamantu vytvoří pomocí plazmového výboje vodíkem a kyslíkem zakončené plochy a diamant s takto upraveným povrchem se ponoří do živného roztoku s buňkami. Buňky, které mají schopnost vytvářet kostní nebo nervovou tkáň, selektivně kolonizují kyslíkem zakončený (hydrofilní) diamantový povrch. Klíčovým parametrem je optimální počáteční koncentrace buněk a koncentrace hovězího séra v médiu při jejich nanášení. Diamant může být navíc i morfologicky strukturován. Diamant lze použít přírodní nebo syntetický na libovolné podložce. Koncentrace příměsí v diamantu není omezena. Středisko společných činností AV ČR, v. v. i., Patentové a licenční služby, Národní 1009/3, Praha 1, C12N 15/10 C12Q 1/68 C12N 15/11 C07H 21/ Agrotest Fyto, s. r. o., Kroměříž, CZ Matušinský Pavel Mgr. PhD., Kroměříž, CZ Mikolášová Renata Ing. PhD., Kroměříž, CZ Klem Karel Ing. PhD., Koryčany, CZ Spitzer Tomáš RNDr. PhD., Kroměříž, CZ Tvarůžek Ludvík Dr. Ing., Kroměříž, CZ Primery pro detekci Cochliobolus sativus v obilovinách Primery pro detekci Cochliobolus sativus, zejména v obilovinách, metodou PCR, o složení COSA-F (SEQ ID: 1) TCAAGCTGACCAAATCACCTTC, COSA-R (SEQ ID: 2) CTTCTCACCAGCATCTGAATATATGA, které (71) (57) (71) (57) umožní amplifikaci fragmentu patogena o velikosti 570 bp. Využití primerů je jednak v rostlinolékařství při včasné diagnostice patogena, což umožní cílenou volbu účinné ochrany, a jednak ve šlechtitelských procesech při hodnocení genových zdrojů při selekci. Ministerstvo zemědělství ČR, Mgr. Hana Jirkalová, Těšnov 17, Praha 1, E04G 13/06 E04F 11/02 E04F 11/ TESO Jistebník, spol. s r.o., Jistebník, CZ Fabian Bedřich, Studénka, CZ Vavrečka Jaroslav Ing., Ostrava - Třebovice, CZ Způsob výroby prefabrikovaného schodišťového ramene Způsob výroby prefabrikovaného schodišťového ramene opatřeného teracovými profily (1) spočívá v tom, že se nejprve vyrobí teracové profily (1) v požadovaném dekoru a rozměrech, připravené teracové profily (1) se uloží do kovové formy. Pomocí standardního bednícího materiálu (2 ) se forma sch odišťového ramene dokompletuje do požadovaného tvaru, poté se do připravené formy v lo ží ocelová armatura (3) a dokončí se veškeré požadovan é detaily. Připravená forma se vyplní betonem (4) určen é pevnostní třídy a obvyklým způsobem se provede jeho zh utn ění, viditelná plocha schodišťového ramene se povrchově upraví hlazením, načež se n echá proběhnout proces tvrdnutí betonu do dosažení pevnosti minimálně 20 Mpa. Po ztvrdnutí betonu (4) se odstraní forma, načež se schodišťové rameno vyčistí od zbytků betonu. Provede se spárování a impregnace teracových stupňů. Hotový výrobek se zakryje PVC folií (5), netkanou textilií (6) a pevným dřevěným bedněním (7), které se následně připevní ke schodišťovému rameni. V závěru výstavby se dřevěné bednění (7) a krycí materiál odstraní, provedou se případné opravy poškození a impregnace teracových stupňů. Propatent, Ing. Dana Šemberová, Útulná 17, Praha 10, E04H 1/00 E04H 9/ Lhota Bohumil, Zásada, CZ Lhota Bohumil, Zásada, CZ Víceúčelový pohyblivý objekt Víceúčelový pohyblivý objekt podle vynálezu je sestaven ze dvou základních částí (3, 7), z části pevné a pohyblivé, kdy je možno pohyblivou část (7) zapustit do pevné části (3 ) a vytvořit tak jeden obytný celek. Pomocí zvedacího a otáčecího zařízení lze pohyblivou část (7) vysunout nad část (3) pevnou a otáčet podle potřeby, např. podle povětrnostních podmínek.

7 (zveřejněné přihlášky vynálezů) 4 (71) (57) E06B 3/70 E06B 3/46 E06B 3/ Flora Viktor, Ludwigshafen-Oggersheim, DE Flora Viktor, Ludwigshafen-Oggersheim, DE Kombinované dvoukřídlé dveře Kombinované dvoukříd lé d veře sestávají z čtyřstranného rámu (1), v němž je pomocí pantů otočně upevněn otočný díl (2) dveří, a z posuvného dílu (3) dveří opatřeného pojezdy (4) s kolečky. Do "U" drážky (5) zhotovené vždy po celé délce ve spodní a horní vnitřní části čtyřstranného rámu (1), mimo otočný díl dveří, je vložen posuvný díl (3) dveří s pojezdy (4) s kolečky a ve čtyřstrann ém rámu (1) je posuvně v horní "U" drážce (5) upevněn pomocí vložené zásuvné vodící lišty (6) připevněné k posuvnému dílu (3) dveří. Otočný díl (2) dveří má v horní a dolní části zapuštěna pouzdra (7) s pružnou rolnou zapadající v zavřené poloze do zarážek (8) zhotovených v horní a dolní vnitřní části čtyřstranného rámu (1). Ve svislých částech vnitřních stran čtyřstranného rámu (1) jsou zhotoveny polohovací drážky (10) pro polohování posuvného dílu (3) dveří a v obou čelních stranách horní části postranních částí čtyřstranného rámu (1) jsou zhotoveny drážky pro nasazení krycích dílů. Ing. Václav Feiferlík, Žlutická 10, Plzeň, (71) (57) F03B 13/12 F03B 7/00 F03D 3/ Kvapil Jan, Ústí nad Labem, CZ Kvapil Jan, Ústí nad Labem, CZ Mostová elektrárna Mostová elektrárna využívá síly průlivových proudů, síly přílivu-odlivu a síly příboje a vichřice. Uveden ého cíle se dosáhne vytvořením energetických sekcí (6) z betonových pilířů (1) se šikmými náběhy (2) s p ůlkruhovými profily (9), které zrychlený proud vody navádějí na lopatky (5) vertikální válcové turbíny (3) v momentě největšího záběru, když se právě nacházejí na pracovní polovině turbíny (3). Na prodlouženém hřídeli (7) je otočně upraven lopatkový větrník. (71) (57) E06B 9/42 E06B 9/40 E06B 9/ ISOTRA, a. s., Opava, CZ Blachut Bohumír Ing., Bolatice, CZ Stavař Erich Ing., Bolatice, CZ Uchycení nosného profilu stínících zařízení, zejména žaluzií, k rámu Řešením je uchycení nosného profilu stínících zařízení, zejména žaluzií, k rámu, kde pohonné ústrojí (3) stínícího zařízení je uloženo ve vnitřním prostoru podélné lišty (1) pomocí vyjímatelně uložených koncových základových dílů (2), jejichž tvarovaná tělesa jsou nasunuta v koncových částech lišty (1). Vnitřní prostor lišty (1) je vybaven úchyty (5), umístěnými v obou jejích koncových částech tak, že jejich připevňovací prvky (512) jsou uloženy s předpružením suvně ve směru její podélné osy a ve své základní poloze přesahují směrem vně její boční čela (103 ). Ing. Petr Soukup, patentový a známkový zástupce, Vídeňská 8, Olomouc, (71) (57) F24F 5/ České vysoké učení technické v Praze, Fakulta strojní. Ústav techniky prostředí, Praha 6, CZ Hemerka Jiří Doc. Ing. CSc., Praha 5, CZ Vybíral Pavel Ing. Ph.D., Praha 6, CZ Pešek Ladislav Ing., Krňany, CZ Zařízení pro rovnoměrný velkoplošný a jednosměrný přívod vzduchu do prostoru Zařízení pro rovnoměrný velkoplošný a jednosměrný přívod vzduchu do prostoru (2), sestávající z přívodu (1) vzduchu a usměrňovače proudu vzduchu. Přívod (1) vzduchu je na straně vstupu do prostoru (2) opatřen alespoň jednou sekcí (3) tvořenou perforovaným deskovým materiálem (4), za kterým jsou ve vzdálenosti, větší než je rovina spojení paralelních proudů vzduchu, umístěny paralelní tenkostěnné trubice (5) o průměru 1,5 až 3,5 mm, jejichž délka je rovna minimálně 30-ti násobku jejich průměru. Ing. Václav Kratochvíl, patentový zástupce, Táborská 758/33, Mladá Boleslav, 29301

8 (zveřejněné přihlášky vynálezů) 5 (71) (57) (71) (57) F26B 19/ Podolák Miroslav, Praha, CZ Vozka Stanislav, Praha, CZ Podolák Miroslav, Praha, CZ Vozka Stanislav, Praha, CZ Vakuové sušárny a lyofilizační zařízení, zejména pro poloprovozní aplikace Vakuová sušárna a lyofilizační aparatura s vakuovou komorou, vyrobenou z trubek z polypropylenu nebo kopolymeru polypropylen-polyetylen, případně doplněnou o části, např. víka, dveře, okénka ze skla nebo jiného transparentního plastu, který odolává vnitřnímu prostřed í komor, přičemž nejmén ě jedno čelo je opatřeno pružným těsněním a je odklopné nebo odnímatelné a je zhotoveno z desky z polypropylenu nebo kopolymeru polypropylenpolyetylen, a přičemž sušárna a komora mohou být dlouhé až několik metrů a vybaveny posuvným roštem či policí. G01N 1/ Červinka Ondřej Ing., Brno, CZ Červinka Ondřej Ing., Brno, CZ Zkušební trať k testování zařízení pro odběr vzorků emisí Zkušební trať slouží k testování vzorkovacího zařízení, které se používá při měření koncentrací škodlivin proudících v potrubí jako heterogenní směs typu aerosol. Vzorkovací zařízení pracuje s izokinetickým odběrem vzorku aerosolu, například podle technické normy ISO 9096 pro emisní měření prachu. Předmětná zkušební trať, která se k testovanému vzorkovacímu zařízení připojí pomocí hermetické spojky (13), je opatřená trubkovým nástavcem (14) obsahujícím průtokoměr (16) a dávkovač (17) škodliviny. Rychlost proudění aerosolu kolem hubice (4) vzorkovacího zařízení modeluje simulátor (20) řízený jednotkou. Na základě této rychlosti nastaví ústřed na (6 ) na čerpadle (5) žádanou intenzitu odsávání. Kvalita izokinetického odsávání je tetována porovnáním simulované rychlosti aerosolu s rychlostí vzduchu v ústí (4 ) hub ice (3), kterou naměří průtokoměr (16). Ing. Vítězslav Žák, patentový zástupce, Lidická 51, Brno, (71) (57) G01N 31/ Výzkumný ústav živočišné výroby, v. v. i., Praha 10 - Uhříněves, CZ Dolejš Jan Ing. CSc., Mirošovice, p. Senohraby, CZ Toufar Oldřich Ing., Stařeč, CZ Mašata Ondřej Ing., Benešov, CZ Knížek Josef Ing., Zvánovice, p. Ondřejov, CZ Autonomní systém pro měření a záznam koncentrace plynů Řešení se týká autonomního systému pro měření a záznam koncentrace plynů, ve kterém je akumulátor (1) připojen k elektrické síti a je opatřen diodami (13), (14), dále je spojen s paměťovým záznamníkem dat (2), konektorem (5 ) p ro p řipojení čidla (15), nabíjecím obvodem (4) s diodou (16), která je spojena rovněž i s komparátorem (12). Nabíjecí obvod (4) je tvořen akumulátorem (1), paměťovým záznamníkem (2), čidlem (3) a spínačem (6), kdy čidlo (3) senzoru (15) je přip ojeno přes konektor (9) do zásuvky (10) měřícího p řístroje (17). Ministerstvo zemědělství ČR, Mgr. Hana Jirkalová, Těšnov 17, Praha 1, (71) (57) G09F 3/ Varga Zdeněk, Praha 10, CZ Varga Zdeněk, Praha 10, CZ Nosič reklamy umístěný v interiéru veřejného dopravního prostředku Vynález se týká nosiče reklamy umístěného v interiéru veřejného dopravního prostředku, zvláště v tramvaji, autobusu, letadle nebo vozu metra, který je uspořádaný na výměnném potahu (1) sedadla pro cestující a jehož podstata spočívá v tom, že alesp oň plocha potahu (1) sedadla určená k překrytí plochy sedací části sedadla je opatřena vizuální reklamní a/nebo jí podobnou informací (1 22).

9 (zveřejněné přihlášky vynálezů) 6 Ing. Dobroslav Musil, patentová kancelář, Ing. Dobroslav Musil, Cejl 38, Brno, 60200

10 (zveřejněné přihlášky vynálezů) 7 Zveřejněné přihlášky vynálezů - přehled podle třídících znaků Tato kapitola obsahuje zveřejněné přihlášky vynálezů uspořádané podle třídicích znaků mezinárodního patentové třídění, nacházejících se na druhém až x-tém místě zatřídění přihlášky vynálezu. Přihlášky vynálezu uspořádané podle třídicích znaků na 1. pozici zatřídění jsou uvedeny v předchozí části. A 61 P 31/04 A 61 P 31/10 A 61 P 31/12 A 61 P 33/00 A 61 P 35/00 B 61 L 29/00 B 61 L 29/08 C 07 H 21/04 C 12 N 15/11 C 12 Q 1/68 E 04 F 11/02 E 04 F 11/116 E 04 H 9/00 E 06 B 3/42 E 06 B 3/46 E 06 B 9/40 E 06 B 9/50 F 03 B 7/00 F 03 D 3/

11 (zveřejněné přihlášky vynálezů) 8 (71) Seznam přihlašovatelů zveřejněných přihlášek vynálezů (71) Agrotest Fyto, s. r. o., Kroměříž, CZ C 12 N 15/10 AŽD Praha s. r. o., Praha 10, CZ B 61 L 29/16 Biologické centrum AV ČR, v. v. i., České Budějovice, CZ B 63 B 1/12 Červinka Ondřej Ing., Brno, CZ České vysoké učení technické v Praze, Fakulta strojní. Ústav techniky prostředí, Praha 6, CZ Flora Viktor, Ludwigshafen Oggersheim, DE Fyzikální ústav AV ČR, v.v.i., Praha 8, CZ ISOTRA, a. s., Opava, CZ Kvapil Jan, Ústí nad Labem, CZ Lhota Bohumil, Zásada, CZ Podolák Miroslav, Praha, CZ TESO Jistebník, spol. s r.o., Jistebník, CZ Ústav organické chemie a biochemie, Akademie věd ČR v. v. i., Praha 6, CZ Varga Zdeněk, Praha 10, CZ Výzkumný ústav živočišné výroby, v. v. i., Praha 10 - Uhříněves, CZ Výzkumný ústav živočišné výroby, v. v. i., Praha 10 - Uhříněves, CZ G 01 N 1/10 F 24 F 5/00 E 06 B 3/70 C 12 N 11/14 E 06 B 9/42 F 03 B 13/12 E 04 H 1/00 F 26 B 19/00 E 04 G 13/06 C 07 K 7/08 G 09 F 3/00 A 01 K 1/02 G 01 N 31/22

12 (udělené patenty) 1 FG4A Udělené patenty - přehled podle čísel patentů V období uzávěrky tohoto čísla Věstníku udělil Úřad průmyslového vlastnictví tyto patenty C 09 K 3/18 A 61 K 9/14 F 02 M 37/22 C 07 D 305/06 C 07 D 215/12 C 07 D 277/60 C 07 D 205/04 G 01 B 7/004 G 09 B 25/00 B 21 K 21/00 H 04 W 76/02 A 61 K 31/135 B 65 H 63/06 H 04 L 12/14 G 07 F 7/08 E 21 D 21/00 D 06 F 75/10 A 61 K 31/21 A 61 K 31/195 C 03 C 27/04 ( )

13 (udělené patenty) 2 FG4A Udělené patenty - přehled podle MPT (40) (40) (40) A61K 31/135 A61P 39/00 A61P 1/04 A61P 1/12 A61P 11/00 A61P 13/00 A61P 25/08 A61P 25/24 A61P 25/00 A61P 25/30 A61P 29/00 A61P 37/ GRÜNENTHAL GMBH, Aachen, DE Kugelmann Heinrich, Aachen, DE Farmaceutické soli tramadolu, léčiva tyto látky obsahující a jejich použití DE PCT/EP2000/ WO 2001/ JUDr. Miloš Všetečka, Hálkova 2, Praha 2, A61K 31/195 A61K 9/16 A61K 9/20 A61P 39/ BIOSINT S. P. A., Pomezia, IT Hassen Ken, Malver, PA, US Granulát s vysokým obsahem L-karnitinu nebo alkanoyl-l-karnitinu RM99A0189 IT PCT/IT2000/ WO 2000/ BOHEMIA PATENT Patentová & známková kancelář, Ing. Jana Vandělíková, Havanská 17, Praha 7, A61K 31/21 A61K 9/16 A61K 9/20 A61K 9/00 A61P 9/ Actavis Deutschland GmbH & Co. KG, Langenfeld, DE Günther Ulrich, Mülsen St. Niclas, DE Freitag Sabine, Zwickau, DE Kuntze Ulrike, Heinsdorfergrund, DE Lehr Wilhelm Thomas, Steinpleis, DE Farmaceutický přípravek obsahující pentaerythrityltetra-, -tri-, -di- nebo -mononitrát, způsob jeho přípravy a použití DE PCT/DE1998/ WO 1999/ Čermák Hořejš Matějka a spol., JUDr. Jan Matějka, advokát, Národní 32, Praha 1, (40) (40) (40) (40) A61K 9/14 A61K 9/20 A61K 47/36 A61K 47/ R. P. SCHERER CORPORATION, Basking Ridge, NJ, US Grother Leon Paul, Swindon, GB Murray Owen James, Swindon, GB Green Richard, Canterbury, GB Kearney Patrick, Swindon, GB Rychle dispergovatelná pevná dávková forma GB PCT/US2000/ WO 2000/ PATENTSERVIS PRAHA a.s., Jivenská 1, Praha 4, B21K 21/00 B21K 21/16 B21J 5/00 G21F 5/005 G21F 5/002 G21F 5/00 G21F 9/36 G21C 19/ MITSUBISHI HEAVY INDUSTRIES, LTD., Tokyo, JP Funakoshi Yoshihiko, Kitakyusyu-shi, JP Tsunezumi Takeshi, Kitakyusyu-shi, JP Mizuno Naohiro, Kitakyusyu-shi, JP Tokuno Katsuhiko, Kitakyusyu-shi, JP Matsumoto Chikayuki, Kitakyusyu-shi, JP Taura Yoshiharu, Hiroshima, JP Shirogane Shigenori, Hiroshima, JP Ohsono Katsunari, Hyogo, JP Matsuoka Toshihiro, Hyogo, JP Kovový blok pro použití při dilatačním tvarování za horka, kontejner se dnem, vyrobený z tohoto kovového bloku, přepravník obsahující tento kontejner, zařízení pro výrobu tohoto kontejneru, způsob výroby tohoto kontejneru a způsob výroby přepravníku, obsahujícího tento kontejner , /124778, 2000/ JP, JP PCT/JP2001/ WO 2001/ JUDr. Miloš Všetečka, Hálkova 2, Praha 2, B65H 63/06 D01H 13/22 D01H 13/ GEBRÜDER LOEPFE AG, Wetzikon, CH Scherer Heinrich, Bäretswil, CH Způsob čištění příze od vadných míst EP JUDr. Jan Matějka, Národní 32, Praha, C03C 27/04 A44C 27/

14 (udělené patenty) 3 (40) (40) (40) Kozáková Jiřina, Skalice u České Lípy, CZ Voláková Kamila, Česká Lípa, CZ Kozáková Jiřina, Skalice u České Lípy, CZ Voláková Kamila, Česká Lípa, CZ Způsob zdobení povrchu skleněných, porcelánových nebo keramických výrobků prostřednictvím kovu STRNAD Patent. a známková kancelář, Ing. Václav Strnad, Rychtářská 375/31, Liberec 14, C07D 205/04 C07D 401/12 C07D 403/12 C07D 417/12 A61K 31/397 A61P 25/ AVENTIS PHARMA S. A., Antony, FR Achard Daniel, Thiais, FR Bouchard Hervé, Thiais, FR Bouquerel Jean, Drancy, FR Filoche Bruno, Créteil, FR Grisoni Serge, Creteil, FR Hittinger Augustin, Igny, FR Myers Michael, Saint Nom la Breteche, FR Farmaceutické kompozice obsahující deriváty azetidinu, nové deriváty azetidinu a jejich příprava FR PCT/FR2001/ WO 2001/ Ing. Eduard Hakr, Přístavní 24, Praha 7, C07D 215/12 C07D 215/ NISSAN CHEMICAL INDUSTRIES, LTD., Tokyo, JP Harada Katsumasa, Ube, JP Nishino Shigeyoshi, Ube, JP Okada Naoko, Ube, JP Shima Hidetaka, Ube, JP Harada Takashi, Ube, JP Způsob přípravy chinolylakrylonitrilových derivátů /14864 JP PCT/JP2001/ WO 2001/ Ing. Eduard Hakr, Přístavní 24, Praha 7, C07D 277/60 A61K 31/428 A61P 3/04 A61P 3/ Sanofi - Aventis Deutschland GmbH, Frankfurt am Main, DE Jaehne Gerhard, Frankfurt, DE Lang Hans-Jochen, Hofheim, DE Gossel Matthias, Hofheim, DE Bickel Martin, Bad Homburg, DE 8,8a-Dihydroindeno[1,2-d]thiazolové deriváty nesoucí v pozici 2 substituent se sulfonamidovou strukturou a farmaceutické prostředky, které je obsahují DE PCT/EP2001/ (40) (40) (40) (40) WO 2001/ Ing. Jan Kubát, Přístavní 24, Praha 7, C07D 305/06 C07D 305/14 A61K 31/337 A61P 35/00 A61P 35/04 A61P 9/14 A61P 9/ INDENA S. P. A., Milano, IT Bombardelli Ezio, Milano, IT Pontiroli Alessandro, Milano, IT Polosyntetické taxany s antitumorovými a antiangiogenními účinky a jejich použití pro výrobu farmaceutického prostředku MI00A IT PCT/EP2001/ WO 2001/ JUDr. Zdeňka Korejzová, Spálená 29, Praha 1, C09K 3/18 C09K 3/00 C30B 29/ Qiagen GmbH, Hilden, DE Reihs Karsten, Köln, DE Duff Daniel-Gordon, Leverkusen, DE Wiessmeier Georg, Köln, DE Voetz Matthias, Köln, DE Kijlstra Johan, Leverkusen, DE Rühle Dieter, Odenthal, DE Köhler Burkhard, Leverkusen, DE Strukturovaný ultrafobní povrch, způsob jeho přípravy a jeho použití , , , , DE, DE, DE PCT/EP1999/ WO 2000/ Společná advokátní kancelář Všetečka Zelený Švorčík Kalenský a partneři, JUDr. Petr Kalenský, Hálkova 2, Praha 2, D06F 75/10 D06F 75/ BSH BOSCH UND SIEMENS HAUSGERÄTE GMBH, München, DE Ostermaier Albert, Stein/Traun, DE Dorn Thomas, Wasserburg, DE Žehlička DE PCT/EP2001/ WO 2002/ Dr. Karel Čermák, Národní třída 32, Praha 1, E21D 21/ ANKRA, s.r.o., Petřvald u Karviné, CZ

15 (udělené patenty) 4 (40) (40) Paloncy Libor Ing., Orlová, CZ Hanzlík Česlav Ing., Orlová, CZ Pětvalský Karel, Petřvald u Karviné, CZ Šimíček Karel, Ostrava, CZ Horninový injektážní svorník a způsob jeho výroby JUDr. Helmut Prchala, Rekreační 27, Hlučín-Bobrovníky, F02M 37/22 B01D 36/00 B01D 29/00 B01D 17/ SOGEFI FILTRATION S. P. A, Mantova, IT Baracchi Paolo, Torino, IT Crovetti Claudio, Mantova, IT Tallano Sergio, Porto Mantovano, IT Filtr paliva vznětového motoru MI2000A IT PCT/EP2001/ WO 2001/ JUDr. Petr Kalenský, Hálkova 2, Praha 2, G01B 7/004 G01B 11/00 G01S 5/ VALÁŠEK Michael Prof. Ing. DrSc., Praha, CZ Valášek Michael Prof. Ing. DrSc., Praha, CZ Způsob a zařízení pro určení polohy objektu v prostoru Ing. Karel Novotný, Žufanova 2, Praha 6, (40) T-MOBILE DEUTSCHLAND GMBH, Bonn, DE Keller Walter, Ratingen, DE Způsob preventivního a/nebo aktuálního zobrazení přenosových nákladů při přenosu internetových a online dat DE PCT/DE2000/ WO 2001/ JUDr. Miloš Všetečka, Hálkova 2, Praha 2, H04W 76/02 ( ) H04W 76/00 ( ) T-MOBILE DEUTSCHLAND GMBH, Bonn, DE Keller Walter, Ratingen, DE Způsob optimalizovaného přenosu multimediálních služeb v mobilních komunikačních sítích, zejména mobilních radiotelefonních sítích DE PCT/DE1999/ WO 2000/ JUDr. Miloš Všetečka, Hálkova 2, Praha 2, (40) G07F 7/ T-MOBILE DEUTSCHLAND GMBH, Bonn, DE Langer Michael, Richmond, GB Ljungström Patrik, Königswinter, DE Michel Uwe, Bad Honnef, DE Reindl Johann, Bonn, DE Schmickler Leonhard, Bonn, DE Způsob ovládání a provozu automatu na výdej zboží DE PCT/DE2000/ WO 2001/ JUDr. Miloš Všetečka, Hálkova 2, Praha 2, (40) G09B 25/00 G09B 25/02 B60R 21/ Cadence Innovation k.s., Liberec, CZ Potěšil Antonín Ing. CSc., Liberec, CZ Ševčík Ladislav Ing. CSc., Liberec, CZ Lauryn Jan Ing., Český Dub, CZ Zařízení pro simulaci nárazu hlavy Ing. Vladimír Belfín, patentový zástupce, P.O.BOX 117, Kladno, (40) H04L 12/14 G07F 7/

16 (udělené patenty) 5 Actavis Deutschland GmbH & Co. KG, Langenfeld, DE ANKRA, s.r.o., Petřvald u Karviné, CZ AVENTIS PHARMA S. A., Antony, FR BIOSINT S. P. A., Pomezia, IT BSH BOSCH UND SIEMENS HAUSGERÄTE GMBH, München, DE Cadence Innovation k.s., Liberec, CZ GEBRÜDER LOEPFE AG, Wetzikon, CH GRÜNENTHAL GMBH, Aachen, DE INDENA S. P. A., Milano, IT Kozáková Jiřina, Skalice u České Lípy, CZ MITSUBISHI HEAVY INDUSTRIES, LTD., Tokyo, JP NISSAN CHEMICAL INDUSTRIES, LTD., Tokyo, JP Qiagen GmbH, Hilden, DE R. P. SCHERER CORPORATION, Basking Ridge, NJ, US Sanofi - Aventis Deutschland GmbH, Frankfurt am Main, DE SOGEFI FILTRATION S. P A, Mantova, IT T-MOBILE DEUTSCHLAND GMBH, Bonn, DE T-MOBILE DEUTSCHLAND GMBH, Bonn, DE T-MOBILE DEUTSCHLAND GMBH, Bonn, DE VALÁŠEK Michael Prof. Ing DrSc., Praha, CZ Voláková Kamila, Česká Lípa, CZ Seznam majitelů udělených patentů A 61 K 31/21 E 21 D 21/00 C 07 D 205/04 A 61 K 31/195 D 06 F 75/10 G 09 B 25/00 B 65 H 63/06 A 61 K 31/135 C 07 D 305/06 C 03 C 27/04 B 21 K 21/00 C 07 D 215/12 C 09 K 3/18 A 61 K 9/14 C 07 D 277/60 F 02 M 37/22 H 04 W 76/02 H 04 L 12/14 G 07 F 7/08 G 01 B 7/004 C 03 C 27/04 ( )

17 (evropské patentové přihlášky a evropské patenty) 1 Udělené evropské patenty Evropský patentový úřad udělil následující evropské patenty s účinky pro Českou republiku. Tyto patenty mohou být zrušeny nebo zachovány v pozměněném znění Evropským patentovým úřadem v řízení o odporu. K tomu, aby nabyl evropský patent účinnosti na území České republiky, je třeba, aby byl Úřadu předložen ve stanovené lhůtě překlad patentového spisu do českého jazyka ( 35c odst. 2 až 4 zákona č. 527/1990 Sb., v platném znění). EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP

18 (evropské patentové přihlášky a evropské patenty) 2 EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP

19 (evropské patentové přihlášky a evropské patenty) 3 EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP

20 (evropské patentové přihlášky a evropské patenty) 4 EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP

Číslo 2 Praha - 14. ledna 2015

Číslo 2 Praha - 14. ledna 2015 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 2 Praha - 14. ledna 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data of

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 36 ISSN 2336-7288 Praha - 9. září 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 23 ISSN 2336-7288 Praha - 10. června 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Číslo 10 Praha - 11. března 2015

Číslo 10 Praha - 11. března 2015 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 10 Praha - 11. března 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data

Více

Číslo 5 Praha - 29. ledna 2014

Číslo 5 Praha - 29. ledna 2014 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 5 Praha - 29. ledna 2014 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data of

Více

Úřad pro harmonizaci ve vnitřním trhu (OHIM) francouzština angličtina španělština

Úřad pro harmonizaci ve vnitřním trhu (OHIM) francouzština angličtina španělština Úřad pro harmonizaci ve vnitřním trhu (OHIM) Vyhrazeno pro OHIM: Přijato dne Počet stran Žádost o mezinárodní zápis ochranné známky 0 (nutno ) podle Madridského protokolu Údaje pro řízení u OHIM 0.1 Jazyk,

Více

Nápověda k pokročilému vyhledávání

Nápověda k pokročilému vyhledávání Nápověda k pokročilému vyhledávání Nový rešeršní systém zpřístupněný Úřadem jako systém s rozšířeným vyhledáváním obsahuje proti původnímu sytému mnohem více vyhledávacích možností. Nicméně základní možnosti

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 24 ISSN 2336-7288 Praha - 17. června 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Příslušenství L200 DOUBLE CAB PRODLOUŽENÁ VERZE

Příslušenství L200 DOUBLE CAB PRODLOUŽENÁ VERZE Příslušenství L200 DOUBLE CAB PRODLOUŽENÁ VERZE Hard top, Utility Top Plus Nízká verze, s předním posuvným oknem, zatmavenými bočními vyklápěcími okny a zatmaveným zadním oknem. Zadní dveře se stylovým

Více

Číslo 2 Praha - 8. ledna 2014

Číslo 2 Praha - 8. ledna 2014 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 2 Praha - 8. ledna 2014 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data of

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 38 ISSN 2336-7288 Praha - 23. září 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

STARKON Nová Říše s.r.o. Army program - polní vybavení a skříně

STARKON Nová Říše s.r.o. Army program - polní vybavení a skříně STARKON Nová Říše s.r.o. Army program - polní vybavení a skříně Výrobní program naší firmy, která na českém trhu působí již od roku 1994, je zaměřen na výrobu nábytku, stavební truhlářství a komplexní

Více

Systém LINCOLN ORSCO pro nanášení tenkého olejového filmu na plochy

Systém LINCOLN ORSCO pro nanášení tenkého olejového filmu na plochy Systém LINCOLN ORSCO pro nanášení tenkého olejového filmu na plochy Tuto problematiku lze řešit několika více či méně vhodnými způsoby od kontaktního nanášení až po stříkaní olejovou mlhou. Všechny tyto

Více

REGÁLY A REGÁLOVÉ SYSTÉMY 2015. www.bauhaus.cz

REGÁLY A REGÁLOVÉ SYSTÉMY 2015. www.bauhaus.cz www.bauhaus.cz REGÁLY A REGÁLOVÉ SYSTÉMY 05 Dřevěné regály I Kovové regály a regálové stavebnicové systémy I Plastové regály a skříně I Regálové kostky I Drátěný program I Nábytkové a kancelářské dřevěné

Více

DODATEČNÉ INFORMACE Č. 4

DODATEČNÉ INFORMACE Č. 4 DODATEČNÉ INFORMACE Č. 4 V Praze dne 31. března 214 k veřejné zakázce malého rozsahu na dodávky s názvem: Dodávka a montáž laboratorního nábytku a vybavení k akci Rekonstrukce laboratoře pro organickou

Více

Otevírač nadsvětlíků GEZE OL90 N

Otevírač nadsvětlíků GEZE OL90 N - Tisk č.: 0 0 CZ - Otevírač nadsvětlíků GEZE OL0 N - Nahoře uložený otevírač oken a nadsvětlíků pro svisle osazovaná okna pravoúhlého tvaru s šířkou otevření 0 mm - velká šířka otevření 0 mm - plná šířka

Více

ŠKODA Octavia Combi RS

ŠKODA Octavia Combi RS zážehový, přeplňovaný turbodmychadlem, řadový, chlazený kapalinou, 2 OHC, uložený vpředu napříč vznětový, přeplňovaný turbodmychadlem s nastavitelnou geometrií lopatek, řadový, chlazený kapalinou, 2 OHC,

Více

KOVOVÝ NÁBYTEK. Základní barevné provedení : barva šedá RAL 7035. Skříně. Příloha č 2 k RS kovový nábytek č.j. MV-86810-65/VZ-2013 39113600-3

KOVOVÝ NÁBYTEK. Základní barevné provedení : barva šedá RAL 7035. Skříně. Příloha č 2 k RS kovový nábytek č.j. MV-86810-65/VZ-2013 39113600-3 KOVOVÝ NÁBYTEK Příloha č 2 k RS kovový nábytek Základní barevné provedení : barva šedá RAL 7035 NÁZEV POPIS MATERIÁL NIPEZ KÓD Lavice šatní lavička, 150 cm konstrukce nohou z ocelových trubek, sedák -

Více

SVĚTELNÉ INFORMAČNÍ TABULE

SVĚTELNÉ INFORMAČNÍ TABULE SVĚTELNÉ INFORMAČNÍ TABULE Světelné tabule Securit nabízí možnost výrazné a atraktivní prezentace, která zaujme kolemjdoucí. Jsou vhodné do venkovních prostor, odolné povětrnostním podmínkám. V případě

Více

Patent. Roman Šebesta 6.12.2011

Patent. Roman Šebesta 6.12.2011 Patent Roman Šebesta 6.12.2011 Bližší specifikace Patentem je vynález, kterému je vydáno osvědčení o vynálezu, které uděluje: u českého patentu Úřad průmyslového vlastnictví za podmínek stanovených zákonem

Více

Přepravníky lodí. 14-20 stop 22-26 stop Přepravníky pro lodě s pevným kýlem Lodní vozíky

Přepravníky lodí. 14-20 stop 22-26 stop Přepravníky pro lodě s pevným kýlem Lodní vozíky Přepravníky lodí 14-20 stop 22-26 stop Přepravníky pro lodě s pevným kýlem Lodní vozíky 14-20 stop... Přepravníky lodí značky Thule zajišťují maxim Voděodolná ložiska za používání přívěs Podpory bez brzd

Více

TECHNICKÝ MANUÁL ROLETOVÉ SYSTÉMY REFLEXOL, VERANDA

TECHNICKÝ MANUÁL ROLETOVÉ SYSTÉMY REFLEXOL, VERANDA TECHNICKÝ MANUÁL ROLETOVÉ SYSTÉMY REFLEXOL, VERANDA Reflexol 76 Základní specifikace produktu Reflexol 76 Řezy KAZETA VEDENÍ A SPODNÍ PROFIL Vedení lanka Spodní profil Ø 42 Spodní profil Ø 35 Spodní profil

Více

Databáze Madrid Express (WIPO)

Databáze Madrid Express (WIPO) Databáze Madrid Express (WIPO) Databázi Madrid Express obsahující mezinárodní ochranné známky, přihlášené na základě Madridské dohody nebo Madridského protokolu, zpřístupňuje Světová organizace duševního

Více

Ford Ranger - příslušenství

Ford Ranger - příslušenství Ford Ranger - příslušenství Změny vyhrazeny, 19.10.2012, ceny příslušenství platné od 1.1.2013 Pevná střecha - charakteristika vyrobeno z dvojitého tvrzeného plastu (ABS) vlastní šedá barvy uvnitř / stříbrně

Více

Výukové texty. pro předmět. Automatické řízení výrobní techniky (KKS/ARVT) na téma

Výukové texty. pro předmět. Automatické řízení výrobní techniky (KKS/ARVT) na téma Výukové texty pro předmět Automatické řízení výrobní techniky (KKS/ARVT) na téma Tvorba grafické vizualizace principu zástavby jednotlivých prvků technického zařízení Autor: Doc. Ing. Josef Formánek, Ph.D.

Více

14. JEŘÁBY 14. CRANES

14. JEŘÁBY 14. CRANES 14. JEŘÁBY 14. CRANES slouží k svislé a vodorovné přepravě břemen a jejich držení v požadované výšce Hlavní parametry jeřábů: 1. jmenovitá nosnost největší hmotnost dovoleného břemene (zkušební břemeno

Více

JEŘÁBY. Dílenský mobilní hydraulický jeřábek. Sloupový otočný jeřáb. Konzolové jeřáby otočné a pojízdné

JEŘÁBY. Dílenský mobilní hydraulický jeřábek. Sloupový otočný jeřáb. Konzolové jeřáby otočné a pojízdné JEŘÁBY Dílenský mobilní hydraulický jeřábek Pro dílny a opravárenské provozy. Rameno zvedáno hydraulicky ručním čerpáním hydraulické kapaliny. Sloupový otočný jeřáb OTOČNÉ RAMENO SLOUP Sloupový jeřáb je

Více

Elektronický tlakový spínač s procesním připojením. - Heslo - Paměť maximální a minimální hodnoty Na přání polní pouzdro s průhledem displeje

Elektronický tlakový spínač s procesním připojením. - Heslo - Paměť maximální a minimální hodnoty Na přání polní pouzdro s průhledem displeje s procesním připojením Polovodičový tenzometr Různá procesní připojení Pro potravinářský, chemický a farmaceutický průmysl Teplota média do 00 C Jmenovité rozsahy od 0... 00 mbar do 0... 0 bar DS 00 P

Více

» vestavné elektrické trouby

» vestavné elektrické trouby » vestavné elektrické trouby Tekavestavné spotřebiče Energetická třída Rozmrazování Protiotisková úprava nerezových ploch horní a spodní Program Pizza Rychloohřev Gril Gril a spodní Gril a spodní Gril

Více

Tabulka nepotřebných zásob autoúdržby k 23. 2. 2015

Tabulka nepotřebných zásob autoúdržby k 23. 2. 2015 Tabulka nepotřebných zásob autoúdržby k 23. 2. 2015 č. artiklu artikl počet kusů cena Kč / ks bez DPH 301069 Ventilátor alternátoru avie 2 36,89 73,78 301076 Relé alternátoru s uhlíkem 28V 1 286,63 286,63

Více

Rozměry vozidla... 11 Hmotnosti vozidla... 14 Motor a jeho parametry... 15 Spojka... 19. Technika jízdy... 27

Rozměry vozidla... 11 Hmotnosti vozidla... 14 Motor a jeho parametry... 15 Spojka... 19. Technika jízdy... 27 Obsah Úvodem............................................................ 9 Seznámení s vozidlem........................................... 10 Technický popis Škody Fabia..........................................

Více

Technická specifika zboží

Technická specifika zboží Technická specifika zboží Příloha č. 2 zadávací dokumentace 1 ks automobilu ve specifikaci: Model: typ: provedení: automobil osobní silniční vyšší střední třída; sedan; počet dveří: minimálně 4; počet

Více

Fréza se 2 noži není vhodná k volnému frézování s motorem horní frézy OFE 738 a frézovacím a brusným motorem FME 737. Využitelná délka mm

Fréza se 2 noži není vhodná k volnému frézování s motorem horní frézy OFE 738 a frézovacím a brusným motorem FME 737. Využitelná délka mm Příslušenství pro horní frézy a přímé brusky Kleštiny Pro OFE 738, Of E 1229 Signal, FME 737 a přímé brusky Upínací otvor 3 6.31947* 1/8" (3,18 ) 6.31948* 6 6.31945* 8 6.31946* 1/4" (6,35 ) 6.31949* Pro

Více

Ceník 2011. aktualizace 1/2011

Ceník 2011. aktualizace 1/2011 Strana 1 MBA-15 Palet.vidle, samovyvažovací, výška 130 cm 1500 kg 15500 MBA-20 Palet.vidle, samovyvažovací, výška 130 cm 2000 kg 17300 MBA-15-160 Palet.vidle, samovyvažovací, výška 160 cm 1500 kg 17500

Více

Záruční doklady, které obdržíte při uzavření prodloužené záruky CarGarantie, mají skutečné výhody:

Záruční doklady, které obdržíte při uzavření prodloužené záruky CarGarantie, mají skutečné výhody: BEZSTAROSTNÁ JÍZDA Profitujte z dlouhodobé záruky. Váš prodejce Opel Vám nabízí optimální jistotu. Díky prodloužené záruce pro nové vozy Opel budete jezdit i po uplynutí dvouleté výrobní záruky i nadále

Více

h a n d b o o k A L F A 5 0 0

h a n d b o o k A L F A 5 0 0 handbook A LFA 500 úvod Variabilní Alfa 500 s velmi funkčním designem má široké uplatnění. Je vhodný pro vybavení referentských pracovišť, kanceláří mana ge mentu, jednacích místností, aj. Výškové moduly

Více

Direct emailing na míru Emailing podle kategorií Traffic pro váš web Databáze firem SMS kampaně Propagace přes slevový portál Facebook marketing

Direct emailing na míru Emailing podle kategorií Traffic pro váš web Databáze firem SMS kampaně Propagace přes slevový portál Facebook marketing I N T E R N E T O V Ý M A R K E T I N G e f e k t i v n í a c í l e n ý m a r k e t i n g p r o f e s i o n á l n í e m a i l i n g š p i č k o v é t e c h n i c k é z á z e m í p r o p r a c o v a n é

Více

Praha - 26. června 2013. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST.

Praha - 26. června 2013. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST. VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 26 Praha - 26. června 2013 Číselné INID kódy pro označování bbibliografických dat technických řešení INID Codes for the identification of bibliographic data

Více

Posuvné kování pro interiérové dveře

Posuvné kování pro interiérové dveře Posuvné kování pro interiérové dveře Standard 100 kg O4206 Kování STANDARD100, 100kg-1křídlo 354 Kč O4240 Lišta K-075 horní 4m, Al 404 Kč O4209 Tlumení 1680 STANDARD na 1 křídlo 293 Kč O4241 Lišta K-075

Více

Popis. Použití. Výhody

Popis. Použití. Výhody str. 1/6 Popis Zepalog je mikroprocesorový záznamník určený pro registraci teplot, relativní vlhkosti a dalších měřených veličin převedených na elektrický signál 0-20 ma (resp. 4-20 ma) a jejich zobrazení

Více

Tento dokument je součástí systému TP online. Byl vytvořen zpracovatelem v elektronické podobě shodné se schváleným zněním MD.

Tento dokument je součástí systému TP online. Byl vytvořen zpracovatelem v elektronické podobě shodné se schváleným zněním MD. TP 142 Ministerstvo dopravy, Odbor pozemních komunikací PARKOVACÍ ZAŘÍZENÍ parkovací sloupky, parkovací zábrany, parkovací závory, pollery TECHNICKÉ PODMÍNKY Schváleno MD ČR č.j. 539/2013-120-STSP/1 ze

Více

KATALOG SOUČÁSTÍ ŽELEZNIČNÍCH KOLEJOVÝCH VOZIDEL A ŽELEZNIČNÍHO ZAŘÍZENÍ ČD

KATALOG SOUČÁSTÍ ŽELEZNIČNÍCH KOLEJOVÝCH VOZIDEL A ŽELEZNIČNÍHO ZAŘÍZENÍ ČD KATALOG SOUČÁSTÍ ŽELEZNIČNÍCH KOLEJOVÝCH VOZIDEL A ŽELEZNIČNÍHO ZAŘÍZENÍ ČD Katalog součástí ČD je obrazovou dokumentací součástí železničních kolejových vozidel Českých drah a železničního zařízení. Tyto

Více

Záznamy vozidla. Popis počet cena/ks cena nakup vozu cena 169 tis. (viz smlouva) 0:00 300,00 0,00

Záznamy vozidla. Popis počet cena/ks cena nakup vozu cena 169 tis. (viz smlouva) 0:00 300,00 0,00 Záznamy vozidla Str. 1 26.6.2013 22:21:54 Záznamy vozidla SPZ: 2B6 8788 Jméno: Sobek, Martin Značka, typ: Volkswagen Passat Variant B5 3BGAVBXOS...Adresa: Na lánech 22 Motor: AVB 1,9 TDI PD 74/4000 BOLATICE

Více

HYDRAULICKÝ DVOUSLOUPOVÝ ZVEDÁK

HYDRAULICKÝ DVOUSLOUPOVÝ ZVEDÁK WWW.AUTOMOTIVE.CZ HYDRAULICKÝ DVOUSLOUPOVÝ ZVEDÁK Ekonomický hydraulický pohon. Elektro-magnetické tlačítkové ovládání. Nástavce na ramena 50 mm a 100 mm. - NOSNOST 2500 kg/3000 kg - ASYMETRICKÁ KONSTRUKCE

Více

OPTICKÉ KOMUNIKACE 2013

OPTICKÉ KOMUNIKACE 2013 1. informace a pozvánka k aktivní účasti Česká a Slovenská společnost pro fotoniku ČVUT v Praze, fakulta elektrotechnická Československá sekce IEEE Agentura Action M Vás zvou na konferenci a výstavu OPTICKÉ

Více

Ceník. LineMiss. LineMicro PLATNÝ OD: 10-2012

Ceník. LineMiss. LineMicro PLATNÝ OD: 10-2012 LineMicro Ceník PLATNÝ OD: 10-2012 LineMiss LineMiss 2 LineMiss Funkce Standard PEČÍCÍ REŽIMY Nelze Dynamic Matic Classic Manual Hum. Konvekční pečení 30 C - 260 C Kombinovaný režim páry a konvekčního

Více

KATALOG VYSAVAČE. CLEANFIX, s.r.o., Šumavská 3 602 00 BRNO tel.+fax: 541 235 012, 541 249 445 www.cleanfix.cz cleanfix@cleanfix.cz.

KATALOG VYSAVAČE. CLEANFIX, s.r.o., Šumavská 3 602 00 BRNO tel.+fax: 541 235 012, 541 249 445 www.cleanfix.cz cleanfix@cleanfix.cz. S 10 Kč 4.180,- Silné vysavače pro úklid v domácnostech i komerční využití. Díky umístění na 5 otočných kolečkách mají vysavače vynikající stabilitu a velmi snadno se s nimi manipuluje. Kompaktní robustní

Více

Ceník kancelářského nábytku: Kompakt - Almont - Final - Demont - Manager. Kořan nábytek

Ceník kancelářského nábytku: Kompakt - Almont - Final - Demont - Manager. Kořan nábytek Ceník kancelářského nábytku: Kompakt - Almont - Final - Demont - Manager Kořan nábytek kompakt Stolové prvky KOMPAKT stolová deska - kompaktní deska tl. 12 mm 450 450 podnož Fedra - konstrukce podnože

Více

REDOMA s.r.o., 17. listopadu 338, Děčín, Telefon 412 513 460, www.redoma.cz, redoma@redoma.cz KOMPLETNÍ MALOOBCHODNÍ CENÍK (bez DPH), LEDEN 2013

REDOMA s.r.o., 17. listopadu 338, Děčín, Telefon 412 513 460, www.redoma.cz, redoma@redoma.cz KOMPLETNÍ MALOOBCHODNÍ CENÍK (bez DPH), LEDEN 2013 REDOMA s.r.o., 17. listopadu 338, Děčín, Telefon 412 513 460, www.redoma.cz, redoma@redoma.cz KOMPLETNÍ MALOOBCHODNÍ CENÍK (bez DPH), LEDEN 2013 # Obj.číslo Název zboží Cena MJ Sortiment LTD 1 D408215

Více

KATALOG A CENÍK ROLETY

KATALOG A CENÍK ROLETY KATALOG A CENÍK ROLETY 01 OBSAH ŘETÍZKOVÁ ROLETA mm STANDARD 1 ŘETÍZKOVÁ ROLETA mm LUX ŘETÍZKOVÁ ROLETA mm LUX - AL ŘETÍZKOVÁ ROLETA mm KOMPAKT ŘETÍZKOVÁ ROLETA 8 mm LUX ŘETÍZKOVÁ ROLETA 8 mm LUX - AL

Více

Schémata elektrických obvodů

Schémata elektrických obvodů Schémata elektrických obvodů Schémata elektrických obvodů Číslo linie napájení Elektrický obvod 30 Propojení s kladným pólem akumulátorové baterie 31 Kostra 15, 15a Propojení s kladným pólem akumulátorové

Více

PŘÍLOHA Č.4 - SEZNAM PRO ZHOTOVENÍ VZORKŮ. HOLEČKOVA 106/8, PRAHA 5 - VYBAVENÍ INTERIÉRU Holečkova 106/8, 150 00 Praha 5 Smíchov

PŘÍLOHA Č.4 - SEZNAM PRO ZHOTOVENÍ VZORKŮ. HOLEČKOVA 106/8, PRAHA 5 - VYBAVENÍ INTERIÉRU Holečkova 106/8, 150 00 Praha 5 Smíchov PŘÍLOHA Č.4 - SEZNAM PRO ZHOTOVENÍ VZORKŮ název projektu: HOLEČKOVA 106/8, PRAHA 5 - VYBAVENÍ INTERIÉRU Holečkova 106/8, 150 00 Praha 5 Smíchov hlavní projektant: AP STUDIO s.r.o. Na Kopečku 2, 180 00

Více

Ochrana průmyslového vlastnictví v ČR Aktuální informace

Ochrana průmyslového vlastnictví v ČR Aktuální informace Ochrana průmyslového vlastnictví v ČR Aktuální informace WWW.UPV.CZ ÚŘAD PRŮMYSLOVÉHO VLASTNICTVÍ 4. 6. 2008 Národní přihlášky vynálezů / National invention applications 1998 1999 2000 2001 2002 2003 2004

Více

Mezinárodní přehled cen mléka v jednotlivých mlékařských společnostech za prosinec 2008. Cena ( /100 Kg)

Mezinárodní přehled cen mléka v jednotlivých mlékařských společnostech za prosinec 2008. Cena ( /100 Kg) za prosinec 2008 BE 27,46 33,03 DE 28,82 35,16 DE 25,85 31,39 DK 32,36 37,13 FI 46,49 45,40 FR 32,52 35,47 FR 35,13 36,95 FR 32,62 35,27 FR 29,51 35,00 GB 31,85 32,73 GB 28,60 31,03 IE 30,28 33,54 IE 28,85

Více

1/9 Číslo protokolu: csob cr 2178

1/9 Číslo protokolu: csob cr 2178 1/9 DEKRA CZ a.s. Türkova 1001, 149 00 Praha 4 IČ: 49240188, Zapsaná u Městského soudu v Praze, Oddíl B, vložka 1967 ČSOB Leasing, a.s. Na Pankráci 310/60 140 00 Praha 4 INFORMACE O PROHLÍDCE ÚDAJE O VOZIDLE

Více

REFERENCE BOHEMIAFLEX CS PROTISLUNEČNÍZAŘ ÍZENÍ KATALOG INTERIÉROVÉHO STÍNĚNÍ

REFERENCE BOHEMIAFLEX CS PROTISLUNEČNÍZAŘ ÍZENÍ KATALOG INTERIÉROVÉHO STÍNĚNÍ PROTISLUNEČNÍZAŘ ÍZENÍ BOHEMIAFLEX CS REFERENCE KATALOG INTERIÉROVÉHO STÍNĚNÍ JAPONSKÁ POSUVNÁ STĚNA INTERIÉROVÉ STÍNĚNÍ Interiérové designové stíněníje inspirováno Orientem. Umožňuje flexibilnístíněnírůznými

Více

Praha - 3. prosince 2008. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST.

Praha - 3. prosince 2008. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST. VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 49 Praha - 3. prosince 2008 Číselné INID kódy pro označování bbibliografických dat technických řešení INID Codes for the identification of bibliographic data

Více

ZŠ Na Líše 936/16, P4, k.ú. Michle -

ZŠ Na Líše 936/16, P4, k.ú. Michle - DESIGN BY ing.arch. Stojan D. PROJEKT - SERVIS Ing.Stojan STAVEBNÍ PROJEKCE INVESTOR MČ Praha 4 Táborská 350/32, Praha 4 KONTROLOVAL ODP.PROJEKTANT Ing. Stojan Z. Ing. Stojan Z. MÍSTO STAVBY Na Líše 936/16,

Více

Kompaktní teplovzdušné jednotky

Kompaktní teplovzdušné jednotky Účinnost přes 91,5 %! Kompaktní velikost - ideální do omezených prostorů Pro instalace v uzavřených i větraných prostorech Automaticky zapalované hořáky s dálkovým zavíráním a spouštěním u všech modelů

Více

www.datex.com DATEX - ochranné potahy pro ALFA ROMEO s jistotou chrání - šetří náklady - zlepšují image

www.datex.com DATEX - ochranné potahy pro ALFA ROMEO s jistotou chrání - šetří náklady - zlepšují image www.datex.com DATEX - ochranné potahy pro ALFA ROMEO s jistotou chrání - šetří náklady - zlepšují image Postranní ochranné potahy pro ALFA ROMEO obj. č. D-AR 95 Postranní ochranné potahy chrání přední

Více

IBAN a BIC Přeshraniční převody

IBAN a BIC Přeshraniční převody IBAN a BIC Přeshraniční převody Účinné od 7. 11. 2013 IBAN A BIC Co je IBAN IBAN (International Bank Account Number) je mezinárodní formát čísla bankovního účtu. Slouží k jednoznačné identifikaci účtu

Více

Praha - 1. února 2012. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST.

Praha - 1. února 2012. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST. VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 5 Praha - 1. února 2012 Číselné INID kódy pro označování bbibliografických dat technických řešení INID Codes for the identification of bibliographic data of

Více

Základní technický popis...10. Homologace a identifikace vozidla...12 Identifikace podle čísla motoru...13

Základní technický popis...10. Homologace a identifikace vozidla...12 Identifikace podle čísla motoru...13 Obsah Úvodem...9 Základní technický popis...10 Škoda Felicia se představuje...10 Homologace a identifikace vozidla...12 Identifikace podle čísla motoru...13 Údržba a kontrola technického stavu...14 Pravidelná

Více

Komponenty pro dřevěné rolety

Komponenty pro dřevěné rolety Komponenty pro dřevěné rolety Materiál Barva Cena za j. Jednotka Nosič čelní kov 105,- 1513 Nosič boční kov 59,- 1514 Hruška dřevo dub 19,- 142 Brzda kov + + 93,- 1519 Dvoukladka kov + + 45,- 1511 Jednokladka

Více

Systémové komponenty Zobrazení a nastavení

Systémové komponenty Zobrazení a nastavení Systémové komponenty Zobrazení a nastavení Přehled 216 VEGADIS 218 Nastavovací a vizualizační software 221 Rozměry 223 AL-CS - 215 Systémové komponenty Zobrazení a nastavení Vyhodnocení a nastavení Zobrazovací

Více

Pro velké výzvy v malém provedení. EMCOMAT 14S/14D 17S/17D 20D

Pro velké výzvy v malém provedení. EMCOMAT 14S/14D 17S/17D 20D [ E[M]CONOMY ] znamená: Pro velké výzvy v malém provedení. EMCOMAT 14S/14D 17S/17D 20D Univerzální soustruhy s nástrojářskou přesností pro průmyslové aplikace EMCOMAT 14S/14D [ Digitální displej] - Barevný

Více

Vysoká škola technická a ekonomická v Českých Budějovicích. Institute of Technology And Business In České Budějovice

Vysoká škola technická a ekonomická v Českých Budějovicích. Institute of Technology And Business In České Budějovice 10. OTVOROVÉ VÝPLNĚ II. Vysoká škola technická a ekonomická v Českých Budějovicích Institute of Technology And Business In České Budějovice Tento učební materiál vznikl v rámci projektu "Integrace a podpora

Více

automatické dveře www.trido.cz

automatické dveře www.trido.cz automatické dveře www.trido.cz 03 / 2012 07/ 2014 Automatické dveře TRIDO systém TINA - splňuje normu ČSN EN 16005 Automatické lineárně posuvné dveře nachází uplatnění jako vstupní i jako interiérové dveře

Více

Praha - 28. února 2007. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST.

Praha - 28. února 2007. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST. VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 9 Praha - 28. února 2007 Číselné INID kódy pro označování bbibliografických dat technických řešení INID Codes for the identification of bibliographic data of

Více

KAPSOVÉ FILTRY KS PAK

KAPSOVÉ FILTRY KS PAK KAPSOÉ FILTRY KS PAK Třída filtrace G2 - F9 F8 dle EN 779 pro záchyt hrubého a jemného prachu elká filtrační plocha dlouhá životnost, nízké tlakové ztráty Filtrační médium ze syntetických nebo skelných

Více

Dokumenty. Profesoři jmenovaní s účinností od 20. května 2008

Dokumenty. Profesoři jmenovaní s účinností od 20. května 2008 Dokumenty Profesoři jmenovaní s účinností od 20. května 2008 1. doc. Ing. Pavol B a u e r, Dr., pro obor silnoproudá elektrotechnika a elektroenergetika, na návrh Vědecké rady Vysokého učení technického

Více

Karoserie a rámy motorových vozidel

Karoserie a rámy motorových vozidel Karoserie a rámy motorových vozidel Karoserie je část vozidla, která slouží k umístění přepravovaných osob nebo nákladu. Karoserie = kabina + ložné prostory plní funkci vozidla Podvozek = rám + zavěšení

Více

TEST. OCHRANA DUŠEVNÍHO VLASTNICTVÍ stupeň základní

TEST. OCHRANA DUŠEVNÍHO VLASTNICTVÍ stupeň základní Jihočeská univerzita v Českých Budějovicích, Fakulta rybářství a ochrany vod Vodňany, 15.5.2012 Jméno a příjmení... TEST OCHRANA DUŠEVNÍHO VLASTNICTVÍ stupeň základní Zakroužkujte jednu či více správných

Více

Uzavírací klapky PN 63-160 DN 80/80-300/250. Oblasti použití. Varianty standardního provedení. Provozní data. Materiály. Instrukce.

Uzavírací klapky PN 63-160 DN 80/80-300/250. Oblasti použití. Varianty standardního provedení. Provozní data. Materiály. Instrukce. Typový list 7338.1/10-64 AKG-A/AKGS-A Uzavírací klapky se samotěsnícím závěrem krytu spřírubami event. s přivařovacími konci PN 63-160 DN 80/80-300/250 Oblasti použití Průmyslová zařízení, elektrárny,

Více

KATALOG A CENÍK ROLETY

KATALOG A CENÍK ROLETY KATALOG A CENÍK ROLETY 0 ROLETA STANDARD - ŘETÍZKOVÁ Standardní řetízková roleta pro menší rozměry, vyznačuje se pevnými ocelovými držáky pro stěnovou nebo stropní montáž, jako závaží je použit žaluziový

Více

Zpětné klapky s dvojitým diskem. Těleso z uhlíkové oceli a z nerez oceli Velikosti 50 až 300 mm (2 až 12") PN 20/třída 150 a PN 50/třída 300

Zpětné klapky s dvojitým diskem. Těleso z uhlíkové oceli a z nerez oceli Velikosti 50 až 300 mm (2 až 12) PN 20/třída 150 a PN 50/třída 300 Katalogový list 8485.1/3--64 Zpětné klapky MODEL 2000 Zpětné klapky s dvojitým diskem Těleso z uhlíkové oceli a z i i 50 až 300 mm (2 až 12") PN 20/třída 150 a PN 50/třída 300 Použití Průmyslové procesy,

Více

VÝPIS MATERIÁLU 07 DOSTAVBA SEKCE OPTIKY - SLOVANKA. Atelier EGIS spol.s.r.o. Projektování a p íprava staveb Na Boti i5, Praha 10 106 00

VÝPIS MATERIÁLU 07 DOSTAVBA SEKCE OPTIKY - SLOVANKA. Atelier EGIS spol.s.r.o. Projektování a p íprava staveb Na Boti i5, Praha 10 106 00 Atelier EGIS spol.s.r.o. Projektování a p íprava staveb Na Boti i5, Praha 10 106 00 I O: 28375327 Tel.: Fax: e-mail: 272 769 786 272 773 116 info@egis.cz Investor: Místo stavby: Stavba: Profese: 0bsah

Více

hliníkový PaNEL A PŘÍSLUŠENSTVÍ

hliníkový PaNEL A PŘÍSLUŠENSTVÍ hliníkový PaNEL A PŘÍSLUŠENSTVÍ Díky profesionálnímu a elegantnímu řešení hliníkového panelového systému můžete využít prostor ve Vašem vozidle a vybavit se příslušenstvím. Perforované plechy nabízí široké

Více

Zahraniční obchodní rejstříky

Zahraniční obchodní rejstříky Stát Austrálie Adresa http://www.abr.business.gov.au zdarma název, status, sídlo, identifikační čísla za poplatek u některých firem rozšířené informace (Search ASIC) poplatky 25-60 AUD (výpisy z rejstříku

Více

Montované technologie. Technologie staveb Jan Kotšmíd,3.S

Montované technologie. Technologie staveb Jan Kotšmíd,3.S Montované technologie Technologie staveb Jan Kotšmíd,3.S Montované železobetonové stavby U montovaného skeletu je rozdělena nosná část sloupy, průvlaky a stropní panely) a výplňová část (stěny): Podle

Více

Sídlo firmy: Mekra Lang International ČR, spol. s r.o. Skupova 37, 301 00 Plzeň E-mail: mekra@mekra.cz http://www.mekra.cz

Sídlo firmy: Mekra Lang International ČR, spol. s r.o. Skupova 37, 301 00 Plzeň E-mail: mekra@mekra.cz http://www.mekra.cz Sídlo firmy: ekra Lang International ČR, spol. s r.o. Skupova 7, 0 00 Plzeň E-mail: mekra@mekra.cz http://www.mekra.cz Prodejní sklad ZRUČ: Družstevní 8 0 08 Zruč Tel./fax: 0040/778489 obil: 0040/767660

Více

ConeFit TM nabízí maximální flexibilitu.

ConeFit TM nabízí maximální flexibilitu. Výrobní kompetence _KOMPETENCE V OBRÁBĚNÍ Frézování ConeFit TM nabízí maximální flexibilitu. WALTER PROTOTYP ConeFit modulární systém pro frézování NÁSTROJOVÝ SYSTÉM modulární frézovací systém ze slinutého

Více

Číslo 23 Praha - 4. června 2014

Číslo 23 Praha - 4. června 2014 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 23 Praha - 4. června 2014 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data of

Více

-V- novinka. Jednotky motoru MTR-DCI 2.2. motor s integrovaným ovladačem, převodovkou a řízením. kompaktní konstrukce

-V- novinka. Jednotky motoru MTR-DCI 2.2. motor s integrovaným ovladačem, převodovkou a řízením. kompaktní konstrukce Jednotky motoru MTR-DCI motor s integrovaným ovladačem, převodovkou a řízením kompaktní konstrukce ovládání prostřednictvím vstupů/výstupů stupeň krytí IP54 2006/10 změny vyhrazeny výrobky 2007 5/-1 hlavní

Více

Vždy perfektní výsledek.

Vždy perfektní výsledek. LineMiss Česky LineMiss Vždy perfektní výsledek. REJSTŘÍK Technologie 4-7 AIR.Plus - STEAM.Plus DRY.Plus - Baking Essentials Integrované technologie 8-9 Ovládací panel - MAXI.Link Elektrické pece 600x400

Více

Praha - 9. ledna 2008. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST.

Praha - 9. ledna 2008. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST. VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 2 Praha - 9. ledna 2008 Číselné INID kódy pro označování bbibliografických dat technických řešení INID Codes for the identification of bibliographic data of

Více

Technické podmínky. pro veřejnou zakázku s názvem Centrální nákup automobilů pro resort Ministerstva životního prostředí v roce 2015

Technické podmínky. pro veřejnou zakázku s názvem Centrální nákup automobilů pro resort Ministerstva životního prostředí v roce 2015 Příloha č. 1 zadávací dokumentace Technické podmínky pro veřejnou zakázku s názvem Centrální nákup automobilů pro resort Ministerstva životního prostředí v roce 2015 Automobily musí splňovat následující

Více

Návod na instalaci. Softstartery PS S 18/30 142/245. 1SFC 388002-cz 1999-10-26 PS S85/147-500...142/245-500 PS S85/147-690...

Návod na instalaci. Softstartery PS S 18/30 142/245. 1SFC 388002-cz 1999-10-26 PS S85/147-500...142/245-500 PS S85/147-690... Návod na instalaci a údržbu Softstartery PS S 18/30 142/245 1SFC 388002-cz 1999-10-26 PS S18/30-500...44/76-500 PS S50/85-500...72/124-500 PS S18/30-690...32/124-690 PS S85/147-500...142/245-500 PS S85/147-690...142/245-690

Více

Van Hool třístranná shrnovací nástavba na podvozek Volvo

Van Hool třístranná shrnovací nástavba na podvozek Volvo www.vanhool.be Van Hool třístranná shrnovací nástavba na podvozek Volvo ROZMĚRY : Výška šasi podvozku (nezatíženého) cca. mm Pneu podvozku max. Vnitřní délka cca. 7760 mm (dle Vašeho výběru) Vnitřní výška

Více

Praha - 6. října 2010. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST.

Praha - 6. října 2010. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST. VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 40 Praha - 6. října 2010 Číselné INID kódy pro označování bbibliografických dat technických řešení INID Codes for the identification of bibliographic data of

Více

Osnovy IPPV od 1. ročníku šk. roku 2015/16

Osnovy IPPV od 1. ročníku šk. roku 2015/16 Osnovy IPPV od 1. ročníku šk. roku 2015/16 ŘP Patent/užitný vzor Václav Převrátil 2. semestr (16+4/ zkouška) - Náležitosti přihlášky - Průzkum přihlášky vynálezu - Průzkum přihlášky užitného vzoru - Specifika

Více

Vířivé anemostaty. doporučené použití v místnostech s výškou od cca 2,60... 4,00 m

Vířivé anemostaty. doporučené použití v místnostech s výškou od cca 2,60... 4,00 m 2/4/TCH/8 Vířivé anemostaty Série RFD doporučené použití v místnostech s výškou od cca 2,60... 4,00 m TROX GmbH Telefon +420 2 83 880 380 organizační složka Telefax +420 2 86 881 870 Ďáblická 2 e-mail

Více

MTM Bezuchov s.r.o. Puškinova 26, 785 01 Šternberk

MTM Bezuchov s.r.o. Puškinova 26, 785 01 Šternberk MTM Bezuchov s.r.o. Puškinova 26, 785 01 Šternberk Elektrické a mechanické systémy otevírání oken Technika větrání včetně detektorů a signalizace Požární odvětrání chráněných únikových cest Prodej a montáž:

Více

ROZPOČET - REKAPITULACE

ROZPOČET - REKAPITULACE Osvětlení víceúčelového hřiště v Nikolčicích ROZPOČET - REKAPITULACE NOSNÝ MATERIÁL VČ. MONTÁŽE SVÍTIDLA VČ. MONTÁŽE DODÁVKA ZEMNÍ PRÁCE HZS CELKEM BEZ DPH Rozpočet nezahrnuje případné zadláždění a konečnou

Více

Frézování. Hlavní řezný pohyb nástroj - rotační pohyb Přísuv obrobek - v podélném, příčném a svislém směru. Nástroje - frézy.

Frézování. Hlavní řezný pohyb nástroj - rotační pohyb Přísuv obrobek - v podélném, příčném a svislém směru. Nástroje - frézy. Tento materiál vznikl jako součást projektu, který je spolufinancován Evropským sociálním fondem a státním rozpočtem ČR. Základní konvenční technologie obrábění FRÉZOVÁNÍ Technická univerzita v Liberci

Více

Hänel Rotomat a Hänel Lean-Lift Automatizované skladové systémy a výdejny nářadí a měřidel

Hänel Rotomat a Hänel Lean-Lift Automatizované skladové systémy a výdejny nářadí a měřidel Hänel Rotomat a Hänel Lean-Lift Automatizované skladové systémy a výdejny nářadí a měřidel Ideas that move the world... Automatizované skladové systémy Úspora prostoru, času a nákladů Automatizované skladové

Více

PATENTSERVIS V EVROPĚ

PATENTSERVIS V EVROPĚ PATENTSERVIS V EVROPĚ Praha Bratislava Alicante Mnichov -------------------- 1 -------------------- HISTORIE SPOLEČNOSTI - Začátek 90. let realizujeme myšlenku na vznik nezávislé patentové a známkové agentury

Více

RECA DRŽÍ.PŮSOBÍ.HÝBE. RECA regálové řešení. www.reca.cz

RECA DRŽÍ.PŮSOBÍ.HÝBE. RECA regálové řešení. www.reca.cz RECA DRŽÍ.PŮSOBÍ.HÝBE. RECA regálové řešení www.reca.cz Zásuvný systém pro sklad, dílny, provozy jednostranně použitelné, nastavitelné díky příčnému vyztužení Závěsné konzole pro rohové řešení zástrčný

Více

solární systémy Brilon SUNPUR Trubicové solární kolektory www.brilon.cz

solární systémy Brilon SUNPUR Trubicové solární kolektory www.brilon.cz solární systémy Brilon SUNPUR Trubicové solární kolektory www.brilon.cz Proč zvolit vakuové solární kolektory Sunpur? Vakuové kolektory SUNPUR jsou při srovnání s tradičními plochými kolektory mnohem účinnější,

Více

KATALOG 2004 MOBILNÍ VYSOKOTLAKÉ STROJE

KATALOG 2004 MOBILNÍ VYSOKOTLAKÉ STROJE MOBILNÍ VYSOKOTLAKÉ STROJE Společnost S. U. P. spol. s r. o. je výhradním distributorem mobilních vysokotlakých zařízení dánského výrobce Aquila pro Českou a Slovenskou republiku. Tyto speciální stroje

Více