Praha prosince INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST.

Rozměr: px
Začít zobrazení ze stránky:

Download "Praha - 23. prosince 2009. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST."

Transkript

1 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 51 Praha prosince 2009 Číselné INID kódy pro označování bbibliografických dat technických řešení INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST. 80) (15) (23) (28) (40) (45) (55) (57) (68) (71) (92) (93) (94) (95) číslo patentu/zápisu/osvědčení datum zápisu průmyslového vzoru číslo přihlášky/žádosti datum podání přihlášky/žádosti údaje o výstavní prioritě počet průmyslových vzorů číslo prioritní přihlášky datum podání prioritní přihlášky země priority datum zveřejnění přihlášky vynálezu datum zveřejnění zapsaného průmyslového vzoru datum zveřejnění udělení patentu a zápisu užitného vzoru, datum zápisu užitného vzoru, datum oznámení udělení evropského patentu v Evropském patentovém věstníku mezinárodní patentové třídění/locarnské třídění průmyslových vzorů název vyobrazení průmyslového vzoru anotace číslo základního patentu označení přihlašovatele/žadatele označení původce označení majitele/vlastníka označení zástupce číslo mezinárodní přihlášky číslo mezinárodního zveřejnění datum a číslo první registrace přípravku pro Českou republiku datum, číslo a země první registrace přípravku v rámci Společenství doba platnosti osvědčení označení a typ přípravku datum podání a číslo evropské patentové přihlášky datum zveřejnění a číslo zveřejnění evropské patentové přihlášky v Evropském patentovém věstníku (15) (23) (28) (40) (45) (55) (57) (68) (71) (92) (93) (94) (95) Number of the patent/registration/certification Industrial design registration date Application number Date of application filling Exhibition priority data Number of industrial designs included in the application Number of priority application Filling date of priority application Priority country Date of publication of patent application Publication date of the registered industrial design Publication date of patent granting and publication date of utility model registration, registration date of utility model, publication date of European patent granting in the European patent bulletin International Patent Classification/ Locarno Classification for Industrial Designs Title Reproduction of the industrial design Abstract Number of the basic patent Applicant Inventor Owner Attorney's name and address International application number International publication number Date and number(s) of the first authorization to market the product in the CZ Date, number(s) and country of the first authorization to market the product in the EEC Term of certification validity Name of the product and product type European patent application filling date and number European patent application publication date and publication number in the European patent bulletin Číselné INID kódy pro označování bibliografických dat ochranných známek (450) (526) (551) (554) (558) (583) (591) (811) (890) Číslo zápisu ochranné známky (registrace) Datum zápisu ochranné známky Číslo přihlášky ochranné známky (spisu) Datum podání přihlášky Datum vzniku práva přednosti Datum zveřejnění přihlášky po průzkumu Datum zveřejnění zápisu ochranné známky ve Věstníku Seznam výrobků a služeb Číslo třídy výrobků a služeb Omezení rozsahu ochrany o prvek Znění nebo vyobrazení ochranné známky Kolektivní ochranná známka Prostorová ochranná známka Ochranná známka tvořená pouze barvou nebo kombinací barev Datum právní moci rozhodnutí/výsledek rozhodnutí Údaje o barevnosti ochranné známky Přihlašovatel/vlastník ochranné známky Zástupce Mezinárodní číslo zápisu ochranné známky Kód státu ochrany mezinárodní ochranné známky INID codes and minimum required for the identification of bibliographics data relating to marks (Standard WIPO ST.60) (450) (526) (551) (554) (558) (583) (591) (811) (890) Number of registration Date of the registration Number of the application Date of filing of the application Date of the first application Date of the publication of the examined application Date of publication of the registration List of goods and/or services Number of the class of goods and/or services Disclaimer Reproduction of the mark Collective mark Three-dimensional mark Mark consisting exclusively of one or several colours Date of the legal force of the decision/ result of the decision Information concerning colour The applicant or the holder of the mark Name and address of the representative Number of the international registration INID code of the state of the international mark

2 Kódy pro kódování záhlaví oznámení publikovaných ve Věstníku (Standard WIPO ST. 17) BB9A FG1K FG4A FG4Q LD3K LD4Q MA4A MA4F MC3K MC4A MC4F MC4Q MH1K MH4A MH4F MH4Q MK1K zveřejněné přihlášky vynálezů zapsané užitné vzory udělené patenty zapsané průmyslové vzory částečný výmaz užitného vzoru částečný výmaz průmyslového vzoru zánik patentu vzdáním se zánik autorských osvědčení vzdáním se výmaz užitného vzoru zrušení patentu zrušení autorského osvědčení výmaz průmyslového vzoru zánik užitného vzoru vzdáním se částečné zrušení patentu částečné zrušení autorského osvědčení zánik průmyslového vzoru vzdáním se zánik užitného vzoru uplynutím doby platnosti MK4A MK4F MK4Q MM4A MM4F ND1K ND4Q PA4A PC9A PD1K PD4A PD4Q QA9A SB4A SB4F zánik patentů uplynutím doby platnosti zánik autorských osvědčení uplynutím doby platnosti zánik průmyslového vzoru uplynutím doby ochrany zánik patentů pro nezaplacení ročních poplatků zánik autorských osvědčení pro nezaplacení ročních poplatků prodloužení platnosti užitného vzoru obnova doby ochrany průmyslového vzoru změna autorského osvědčení na patent změna dispozičního práva k vynálezu převod práv a ostatní změny majitelů užitných vzorů převod práv a ostatní změny majitelů patentů převod práv a ostatní změny vlastníků průmyslových vzorů nabídka licence zapsané patenty do rejstříku po odtajnění zapsaná autorská osvědčení do rejstříku po odtajnění HA9A HB9A HC9A HD9A HE9A jmenování vynálezce oprava jmen změna jmen oprava adres změna adres Opravy Změny Různé Opravy u přihlášek vynálezů s žádostí o udělení patentu HF9A HG9A HH9A HK9A oprava dat oprava chyb v třídění oprava nebo změna všeobecně tiskové chyby v úřed. věstnících TA4A TB4A TC4A TD4A TE4A TF4A TG4A TH4A TK9A TA4F TB4F TC4F TD4F TE4F TF4F TG4F TH4F TK9F TA1K TB1K TC1K TD1K TE1K TF1K TG1K TH1K TK1K Opravy ochranných dokumentů patenty autorská osvědčení užitné vzory průmyslové vzory TA4Q TB4Q TC4Q TD4Q TE4Q TF4Q TG4Q TH4Q TK4Q jmenování vynálezce oprava jmen změna jmen oprava adres změna adres oprava dat oprava chyb v třídění oprava nebo změna všeobecně tiskové chyby v úřed. věstnících

3 Kódy pro označování zemí a mezinárodních organizací použité ve věstníku Kódy pro označování států USA použité ve věstníku BE BR CA CZ DE FR GB HR JP LK MY NL RU SI US VG Belgie Brazílie Kanada Česká republika Spolková republika Německo Francie Velká Británie Chorvatsko Japonsko Srí Lanka Malajsie Nizozemí Ruská federace Slovinsko Spojené státy americké Panenské ostrovy (Britské) CA DE MI NJ NY California Delaware Michigan New Jersey New York

4 (zveřejněné přihlášky vynálezů) 1 BB9A Zveřejněné přihlášky vynálezů - přehled podle čísel přihlášek Dále uvedené přihlášky vynálezů byly zveřejněny dnem, uvedeným ve Věstníku podle zákona č. 527/1990 Sb., o vynálezech a zlepšovacích návrzích, ve znění pozdějších předpisů, a jsou k dispozici v patentové knihovně Úřadu průmyslového vlastnictví, Antonína Čermáka 2a, , Praha F 03 B 13/12 E 04 G 13/06 E 04 H 1/00 F 24 F 5/00 F 26 B 19/00 B 63 B 1/12 C 12 N 11/14 C 07 K 7/08 E 06 B 3/70 E 06 B 9/42 G 01 N 1/10 A 01 K 1/02 C 12 N 15/10 G 01 N 31/22 G 09 F 3/00 B 61 L 29/16

5 (zveřejněné přihlášky vynálezů) 2 Zveřejněné přihlášky vynálezů - řazené podle MPT (71) (57) A01K 1/ Výzkumný ústav živočišné výroby, v. v. i., Praha 10 - Uhříněves, CZ Miller Jan Ing., Holubice, CZ Kunc Petr Ing. Ph.D., Praha 4, CZ Knížková Ivana Ing. CSc., Praha 3, CZ Miller Jan Ing., Holubice, CZ Individuální box pro volné ustájení zvířat Řešení se týká rozebíratelného individuálního boxu pro volné ustájení zvířat, zejmén a pro odchov mláďat větších savců. Box se skládá z desek, které se rozebíratelně uchycují v rámu (5) a z výběhového hrazení (1), které je zavěšeno na teleskopických tyčích (2). Ty jsou otočným mechanizmem (3) spojeny s boční stěnou (4). Přední stěna (6 ) a střecha (7) jsou volně propojeny v jeden celek, který je otočn ě připojen k zadní stěně (8 ). Výběhové hrazení (1) je výsuvné. Box má výklopnou čelní stěnu (10). Ministerstvo zemědělství ČR, Mgr. Hana Jirkalová, Těšnov 17, Praha 1, provádění tohoto způsobu je charakteristické, že hnací prvky pohonu břevna závory, tedy hnací hřídel (1), elektromotor (10), spojka a převody (12, 13), jsou seskupeny do samostatné větve, nezávislé na brzdových okruzích s brzd ami (7, 8) a volnoběžkami (9, 9') na brzdící hřídeli (1 6). Ing. Marie Smrčková, patentový zástupce, Velflíkova 10, Praha 6, (71) (57) B61L 29/16 B61L 29/08 B61L 29/ AŽD Praha s. r. o., Praha 10, CZ Lachman Pavel, Tovačov, CZ Čermák Pavel Ing., Brno, CZ Štěpánek Josef Ing., Olomouc, CZ Finger Jiří Ing., Náměšť na Hané, CZ Filar Jan, Olomouc, CZ Višňovský Karel Ing., Šternberk, CZ Adamec Josef Ing., Kolín, CZ Způsob a zařízení pro ovládání a kontrolu mechanické výstrahy u světelných přejezdových zabezpečovacích zařízení Způsob ovládání a kontroly mechanické výstrahy u světelných přejezdových zabezpečovacích zařízení, prostřednictvím elektromechanického pohonu břevna závory, probíhá tak, že se břevno závory sklopí v nastavitelném intervalu po vydání bezpečného povelového signálu (4) ke sklopení, které se provádí, současně, dvěma rů znými na sobě nezávislými principy sklápění, a to pasivního a nuceného, přičemž pasivní sklápění je zajištěno hmotností břevna a nucené sklápění elektromotorem (10). Břevno závory se zapevní bez vydání povelového signálu (4) ke sklopení, což se zabezpečuje zapevněním břevna závory v horní koncové poloze, současně, dvěma na sobě navzájem nezávislými brzdovými ok ruhy s pravidelným a automatickým testováním jejich funkce a vyhodnocením funkčnosti, přičemž bezpečná informace (5) o reálných koncových polohách břevna závory se získává současně ze d vou na sobě nezávislých úhlových snímačů (2, 3) p oloh y břevna závory s k omparací jejich fun kce. Pro zařízení pro (71) (57) (71) B63B 1/ Biologické centrum AV ČR, v. v. i., České Budějovice, CZ Kubečka Jan Doc. RNDr. CSc., České Budějovice, CZ Čech Martin RNDr. Ph.D., Vlašim, CZ Peterka Jiří RNDr. Ph.D., České Budějovice, CZ Plavidlo pro odlov vzorků ryb na volné vodě Plavidlo je tvořené dvěma trupy (11, 12) a opatřené pohonnou jednotkou, ráhnem (9) pro vytahování sítě a navijákem (10). Druhý trup (12) je výrazně menší než hlavní trup a prostor mezi nimi je vyplněn podlážkou (4) pro odkládání. Poháněcí jednotka je připevněna k hlavnímu trupu excentricky upínákem (2) na straně bližší druhému trupu (12). Středisko společných činností AV ČR, v. v. i,, Patentové a licenční služby, Národní 1009/3, Praha 1, C07K 7/08 A61P 31/04 A61P 31/10 A61P 31/12 A61P 33/00 A61P 35/ Ústav organické chemie a biochemie, Akademie věd ČR v. v. i., Praha 6, CZ

6 (zveřejněné přihlášky vynálezů) 3 (57) (71) (57) (71) (57) Čeřovský Václav RNDr. CSc., Praha 6, CZ Slaninová Jiřina RNDr. CSc., Praha 4, CZ Fučík Vladimír RNDr. CSc., Praha 7, CZ Bednárová Lucie RNDr. CSc., Praha 6, CZ Votruba Ivan RNDr. DrSc., Praha 8, CZ Nové syntetické peptidy a jejich použití Syntetická analoga peptidů obecných vzorců I a II, v nichž R 1 znamená acyl, alkyl či volnou aminoskupinu, R 2 zn amen á amid, substitu ovaný amid, volný karboxyl či ester, Xaa znamená nezávisle na sobě aminokyselinu kódovou, aminokyselinu D-řady nebo aminokyselinu nekódovou či tyto aminokyseliny modifikované v postranních skupinách, n znamená polohu záměny v peptidovém řetězci a m znamená počet záměn v peptidovém řetězci a jejich použití jako antimikrobiálních, antivirálních, protiplísňových, antiparazitických a protirakovinných sloučenin, které jsou tedy užitečné pro výrobu léčiva pro léčení mikrobiálních, virových, parazitických a plísňových onemocnění a pro léčen í rakovin. C12N 11/ Fyzikální ústav AV ČR, v.v.i., Praha 8, CZ Fyziologický ústav AV ČR, v.v.i., Praha 4, CZ Univerzita Karlova v Praze, 1. Lékařská fakulta, Praha 2, CZ Rezek Bohuslav RNDr. Ph.D., Praha 8, CZ Michalíková Lenka Ing., Nové Mesto nad Váhom, SK Kromka Alexander Ing. Ph.D., Lehota, SK Kalbáčová Marie RNDr. Ph.D., Janov nad Nisou, CZ Kmoch Stanislav Ing. CSc., Praha 1, CZ Grausová Lubica Mgr., Bratislava, SK Bačáková Lucie MUDr. CSc., Praha 5, CZ Vaněček Milan RNDr. CSc., Praha 12, CZ Kočka Jan RNDr. DrSc., Praha 9, CZ Způsob přípravy uspořádaných buněčných struktur Způsob přípravy uspořádaných buněčných struktur je charakteristický tím, že se na povrchu diamantu vytvoří pomocí plazmového výboje vodíkem a kyslíkem zakončené plochy a diamant s takto upraveným povrchem se ponoří do živného roztoku s buňkami. Buňky, které mají schopnost vytvářet kostní nebo nervovou tkáň, selektivně kolonizují kyslíkem zakončený (hydrofilní) diamantový povrch. Klíčovým parametrem je optimální počáteční koncentrace buněk a koncentrace hovězího séra v médiu při jejich nanášení. Diamant může být navíc i morfologicky strukturován. Diamant lze použít přírodní nebo syntetický na libovolné podložce. Koncentrace příměsí v diamantu není omezena. Středisko společných činností AV ČR, v. v. i., Patentové a licenční služby, Národní 1009/3, Praha 1, C12N 15/10 C12Q 1/68 C12N 15/11 C07H 21/ Agrotest Fyto, s. r. o., Kroměříž, CZ Matušinský Pavel Mgr. PhD., Kroměříž, CZ Mikolášová Renata Ing. PhD., Kroměříž, CZ Klem Karel Ing. PhD., Koryčany, CZ Spitzer Tomáš RNDr. PhD., Kroměříž, CZ Tvarůžek Ludvík Dr. Ing., Kroměříž, CZ Primery pro detekci Cochliobolus sativus v obilovinách Primery pro detekci Cochliobolus sativus, zejména v obilovinách, metodou PCR, o složení COSA-F (SEQ ID: 1) TCAAGCTGACCAAATCACCTTC, COSA-R (SEQ ID: 2) CTTCTCACCAGCATCTGAATATATGA, které (71) (57) (71) (57) umožní amplifikaci fragmentu patogena o velikosti 570 bp. Využití primerů je jednak v rostlinolékařství při včasné diagnostice patogena, což umožní cílenou volbu účinné ochrany, a jednak ve šlechtitelských procesech při hodnocení genových zdrojů při selekci. Ministerstvo zemědělství ČR, Mgr. Hana Jirkalová, Těšnov 17, Praha 1, E04G 13/06 E04F 11/02 E04F 11/ TESO Jistebník, spol. s r.o., Jistebník, CZ Fabian Bedřich, Studénka, CZ Vavrečka Jaroslav Ing., Ostrava - Třebovice, CZ Způsob výroby prefabrikovaného schodišťového ramene Způsob výroby prefabrikovaného schodišťového ramene opatřeného teracovými profily (1) spočívá v tom, že se nejprve vyrobí teracové profily (1) v požadovaném dekoru a rozměrech, připravené teracové profily (1) se uloží do kovové formy. Pomocí standardního bednícího materiálu (2 ) se forma sch odišťového ramene dokompletuje do požadovaného tvaru, poté se do připravené formy v lo ží ocelová armatura (3) a dokončí se veškeré požadovan é detaily. Připravená forma se vyplní betonem (4) určen é pevnostní třídy a obvyklým způsobem se provede jeho zh utn ění, viditelná plocha schodišťového ramene se povrchově upraví hlazením, načež se n echá proběhnout proces tvrdnutí betonu do dosažení pevnosti minimálně 20 Mpa. Po ztvrdnutí betonu (4) se odstraní forma, načež se schodišťové rameno vyčistí od zbytků betonu. Provede se spárování a impregnace teracových stupňů. Hotový výrobek se zakryje PVC folií (5), netkanou textilií (6) a pevným dřevěným bedněním (7), které se následně připevní ke schodišťovému rameni. V závěru výstavby se dřevěné bednění (7) a krycí materiál odstraní, provedou se případné opravy poškození a impregnace teracových stupňů. Propatent, Ing. Dana Šemberová, Útulná 17, Praha 10, E04H 1/00 E04H 9/ Lhota Bohumil, Zásada, CZ Lhota Bohumil, Zásada, CZ Víceúčelový pohyblivý objekt Víceúčelový pohyblivý objekt podle vynálezu je sestaven ze dvou základních částí (3, 7), z části pevné a pohyblivé, kdy je možno pohyblivou část (7) zapustit do pevné části (3 ) a vytvořit tak jeden obytný celek. Pomocí zvedacího a otáčecího zařízení lze pohyblivou část (7) vysunout nad část (3) pevnou a otáčet podle potřeby, např. podle povětrnostních podmínek.

7 (zveřejněné přihlášky vynálezů) 4 (71) (57) E06B 3/70 E06B 3/46 E06B 3/ Flora Viktor, Ludwigshafen-Oggersheim, DE Flora Viktor, Ludwigshafen-Oggersheim, DE Kombinované dvoukřídlé dveře Kombinované dvoukříd lé d veře sestávají z čtyřstranného rámu (1), v němž je pomocí pantů otočně upevněn otočný díl (2) dveří, a z posuvného dílu (3) dveří opatřeného pojezdy (4) s kolečky. Do "U" drážky (5) zhotovené vždy po celé délce ve spodní a horní vnitřní části čtyřstranného rámu (1), mimo otočný díl dveří, je vložen posuvný díl (3) dveří s pojezdy (4) s kolečky a ve čtyřstrann ém rámu (1) je posuvně v horní "U" drážce (5) upevněn pomocí vložené zásuvné vodící lišty (6) připevněné k posuvnému dílu (3) dveří. Otočný díl (2) dveří má v horní a dolní části zapuštěna pouzdra (7) s pružnou rolnou zapadající v zavřené poloze do zarážek (8) zhotovených v horní a dolní vnitřní části čtyřstranného rámu (1). Ve svislých částech vnitřních stran čtyřstranného rámu (1) jsou zhotoveny polohovací drážky (10) pro polohování posuvného dílu (3) dveří a v obou čelních stranách horní části postranních částí čtyřstranného rámu (1) jsou zhotoveny drážky pro nasazení krycích dílů. Ing. Václav Feiferlík, Žlutická 10, Plzeň, (71) (57) F03B 13/12 F03B 7/00 F03D 3/ Kvapil Jan, Ústí nad Labem, CZ Kvapil Jan, Ústí nad Labem, CZ Mostová elektrárna Mostová elektrárna využívá síly průlivových proudů, síly přílivu-odlivu a síly příboje a vichřice. Uveden ého cíle se dosáhne vytvořením energetických sekcí (6) z betonových pilířů (1) se šikmými náběhy (2) s p ůlkruhovými profily (9), které zrychlený proud vody navádějí na lopatky (5) vertikální válcové turbíny (3) v momentě největšího záběru, když se právě nacházejí na pracovní polovině turbíny (3). Na prodlouženém hřídeli (7) je otočně upraven lopatkový větrník. (71) (57) E06B 9/42 E06B 9/40 E06B 9/ ISOTRA, a. s., Opava, CZ Blachut Bohumír Ing., Bolatice, CZ Stavař Erich Ing., Bolatice, CZ Uchycení nosného profilu stínících zařízení, zejména žaluzií, k rámu Řešením je uchycení nosného profilu stínících zařízení, zejména žaluzií, k rámu, kde pohonné ústrojí (3) stínícího zařízení je uloženo ve vnitřním prostoru podélné lišty (1) pomocí vyjímatelně uložených koncových základových dílů (2), jejichž tvarovaná tělesa jsou nasunuta v koncových částech lišty (1). Vnitřní prostor lišty (1) je vybaven úchyty (5), umístěnými v obou jejích koncových částech tak, že jejich připevňovací prvky (512) jsou uloženy s předpružením suvně ve směru její podélné osy a ve své základní poloze přesahují směrem vně její boční čela (103 ). Ing. Petr Soukup, patentový a známkový zástupce, Vídeňská 8, Olomouc, (71) (57) F24F 5/ České vysoké učení technické v Praze, Fakulta strojní. Ústav techniky prostředí, Praha 6, CZ Hemerka Jiří Doc. Ing. CSc., Praha 5, CZ Vybíral Pavel Ing. Ph.D., Praha 6, CZ Pešek Ladislav Ing., Krňany, CZ Zařízení pro rovnoměrný velkoplošný a jednosměrný přívod vzduchu do prostoru Zařízení pro rovnoměrný velkoplošný a jednosměrný přívod vzduchu do prostoru (2), sestávající z přívodu (1) vzduchu a usměrňovače proudu vzduchu. Přívod (1) vzduchu je na straně vstupu do prostoru (2) opatřen alespoň jednou sekcí (3) tvořenou perforovaným deskovým materiálem (4), za kterým jsou ve vzdálenosti, větší než je rovina spojení paralelních proudů vzduchu, umístěny paralelní tenkostěnné trubice (5) o průměru 1,5 až 3,5 mm, jejichž délka je rovna minimálně 30-ti násobku jejich průměru. Ing. Václav Kratochvíl, patentový zástupce, Táborská 758/33, Mladá Boleslav, 29301

8 (zveřejněné přihlášky vynálezů) 5 (71) (57) (71) (57) F26B 19/ Podolák Miroslav, Praha, CZ Vozka Stanislav, Praha, CZ Podolák Miroslav, Praha, CZ Vozka Stanislav, Praha, CZ Vakuové sušárny a lyofilizační zařízení, zejména pro poloprovozní aplikace Vakuová sušárna a lyofilizační aparatura s vakuovou komorou, vyrobenou z trubek z polypropylenu nebo kopolymeru polypropylen-polyetylen, případně doplněnou o části, např. víka, dveře, okénka ze skla nebo jiného transparentního plastu, který odolává vnitřnímu prostřed í komor, přičemž nejmén ě jedno čelo je opatřeno pružným těsněním a je odklopné nebo odnímatelné a je zhotoveno z desky z polypropylenu nebo kopolymeru polypropylenpolyetylen, a přičemž sušárna a komora mohou být dlouhé až několik metrů a vybaveny posuvným roštem či policí. G01N 1/ Červinka Ondřej Ing., Brno, CZ Červinka Ondřej Ing., Brno, CZ Zkušební trať k testování zařízení pro odběr vzorků emisí Zkušební trať slouží k testování vzorkovacího zařízení, které se používá při měření koncentrací škodlivin proudících v potrubí jako heterogenní směs typu aerosol. Vzorkovací zařízení pracuje s izokinetickým odběrem vzorku aerosolu, například podle technické normy ISO 9096 pro emisní měření prachu. Předmětná zkušební trať, která se k testovanému vzorkovacímu zařízení připojí pomocí hermetické spojky (13), je opatřená trubkovým nástavcem (14) obsahujícím průtokoměr (16) a dávkovač (17) škodliviny. Rychlost proudění aerosolu kolem hubice (4) vzorkovacího zařízení modeluje simulátor (20) řízený jednotkou. Na základě této rychlosti nastaví ústřed na (6 ) na čerpadle (5) žádanou intenzitu odsávání. Kvalita izokinetického odsávání je tetována porovnáním simulované rychlosti aerosolu s rychlostí vzduchu v ústí (4 ) hub ice (3), kterou naměří průtokoměr (16). Ing. Vítězslav Žák, patentový zástupce, Lidická 51, Brno, (71) (57) G01N 31/ Výzkumný ústav živočišné výroby, v. v. i., Praha 10 - Uhříněves, CZ Dolejš Jan Ing. CSc., Mirošovice, p. Senohraby, CZ Toufar Oldřich Ing., Stařeč, CZ Mašata Ondřej Ing., Benešov, CZ Knížek Josef Ing., Zvánovice, p. Ondřejov, CZ Autonomní systém pro měření a záznam koncentrace plynů Řešení se týká autonomního systému pro měření a záznam koncentrace plynů, ve kterém je akumulátor (1) připojen k elektrické síti a je opatřen diodami (13), (14), dále je spojen s paměťovým záznamníkem dat (2), konektorem (5 ) p ro p řipojení čidla (15), nabíjecím obvodem (4) s diodou (16), která je spojena rovněž i s komparátorem (12). Nabíjecí obvod (4) je tvořen akumulátorem (1), paměťovým záznamníkem (2), čidlem (3) a spínačem (6), kdy čidlo (3) senzoru (15) je přip ojeno přes konektor (9) do zásuvky (10) měřícího p řístroje (17). Ministerstvo zemědělství ČR, Mgr. Hana Jirkalová, Těšnov 17, Praha 1, (71) (57) G09F 3/ Varga Zdeněk, Praha 10, CZ Varga Zdeněk, Praha 10, CZ Nosič reklamy umístěný v interiéru veřejného dopravního prostředku Vynález se týká nosiče reklamy umístěného v interiéru veřejného dopravního prostředku, zvláště v tramvaji, autobusu, letadle nebo vozu metra, který je uspořádaný na výměnném potahu (1) sedadla pro cestující a jehož podstata spočívá v tom, že alesp oň plocha potahu (1) sedadla určená k překrytí plochy sedací části sedadla je opatřena vizuální reklamní a/nebo jí podobnou informací (1 22).

9 (zveřejněné přihlášky vynálezů) 6 Ing. Dobroslav Musil, patentová kancelář, Ing. Dobroslav Musil, Cejl 38, Brno, 60200

10 (zveřejněné přihlášky vynálezů) 7 Zveřejněné přihlášky vynálezů - přehled podle třídících znaků Tato kapitola obsahuje zveřejněné přihlášky vynálezů uspořádané podle třídicích znaků mezinárodního patentové třídění, nacházejících se na druhém až x-tém místě zatřídění přihlášky vynálezu. Přihlášky vynálezu uspořádané podle třídicích znaků na 1. pozici zatřídění jsou uvedeny v předchozí části. A 61 P 31/04 A 61 P 31/10 A 61 P 31/12 A 61 P 33/00 A 61 P 35/00 B 61 L 29/00 B 61 L 29/08 C 07 H 21/04 C 12 N 15/11 C 12 Q 1/68 E 04 F 11/02 E 04 F 11/116 E 04 H 9/00 E 06 B 3/42 E 06 B 3/46 E 06 B 9/40 E 06 B 9/50 F 03 B 7/00 F 03 D 3/

11 (zveřejněné přihlášky vynálezů) 8 (71) Seznam přihlašovatelů zveřejněných přihlášek vynálezů (71) Agrotest Fyto, s. r. o., Kroměříž, CZ C 12 N 15/10 AŽD Praha s. r. o., Praha 10, CZ B 61 L 29/16 Biologické centrum AV ČR, v. v. i., České Budějovice, CZ B 63 B 1/12 Červinka Ondřej Ing., Brno, CZ České vysoké učení technické v Praze, Fakulta strojní. Ústav techniky prostředí, Praha 6, CZ Flora Viktor, Ludwigshafen Oggersheim, DE Fyzikální ústav AV ČR, v.v.i., Praha 8, CZ ISOTRA, a. s., Opava, CZ Kvapil Jan, Ústí nad Labem, CZ Lhota Bohumil, Zásada, CZ Podolák Miroslav, Praha, CZ TESO Jistebník, spol. s r.o., Jistebník, CZ Ústav organické chemie a biochemie, Akademie věd ČR v. v. i., Praha 6, CZ Varga Zdeněk, Praha 10, CZ Výzkumný ústav živočišné výroby, v. v. i., Praha 10 - Uhříněves, CZ Výzkumný ústav živočišné výroby, v. v. i., Praha 10 - Uhříněves, CZ G 01 N 1/10 F 24 F 5/00 E 06 B 3/70 C 12 N 11/14 E 06 B 9/42 F 03 B 13/12 E 04 H 1/00 F 26 B 19/00 E 04 G 13/06 C 07 K 7/08 G 09 F 3/00 A 01 K 1/02 G 01 N 31/22

12 (udělené patenty) 1 FG4A Udělené patenty - přehled podle čísel patentů V období uzávěrky tohoto čísla Věstníku udělil Úřad průmyslového vlastnictví tyto patenty C 09 K 3/18 A 61 K 9/14 F 02 M 37/22 C 07 D 305/06 C 07 D 215/12 C 07 D 277/60 C 07 D 205/04 G 01 B 7/004 G 09 B 25/00 B 21 K 21/00 H 04 W 76/02 A 61 K 31/135 B 65 H 63/06 H 04 L 12/14 G 07 F 7/08 E 21 D 21/00 D 06 F 75/10 A 61 K 31/21 A 61 K 31/195 C 03 C 27/04 ( )

13 (udělené patenty) 2 FG4A Udělené patenty - přehled podle MPT (40) (40) (40) A61K 31/135 A61P 39/00 A61P 1/04 A61P 1/12 A61P 11/00 A61P 13/00 A61P 25/08 A61P 25/24 A61P 25/00 A61P 25/30 A61P 29/00 A61P 37/ GRÜNENTHAL GMBH, Aachen, DE Kugelmann Heinrich, Aachen, DE Farmaceutické soli tramadolu, léčiva tyto látky obsahující a jejich použití DE PCT/EP2000/ WO 2001/ JUDr. Miloš Všetečka, Hálkova 2, Praha 2, A61K 31/195 A61K 9/16 A61K 9/20 A61P 39/ BIOSINT S. P. A., Pomezia, IT Hassen Ken, Malver, PA, US Granulát s vysokým obsahem L-karnitinu nebo alkanoyl-l-karnitinu RM99A0189 IT PCT/IT2000/ WO 2000/ BOHEMIA PATENT Patentová & známková kancelář, Ing. Jana Vandělíková, Havanská 17, Praha 7, A61K 31/21 A61K 9/16 A61K 9/20 A61K 9/00 A61P 9/ Actavis Deutschland GmbH & Co. KG, Langenfeld, DE Günther Ulrich, Mülsen St. Niclas, DE Freitag Sabine, Zwickau, DE Kuntze Ulrike, Heinsdorfergrund, DE Lehr Wilhelm Thomas, Steinpleis, DE Farmaceutický přípravek obsahující pentaerythrityltetra-, -tri-, -di- nebo -mononitrát, způsob jeho přípravy a použití DE PCT/DE1998/ WO 1999/ Čermák Hořejš Matějka a spol., JUDr. Jan Matějka, advokát, Národní 32, Praha 1, (40) (40) (40) (40) A61K 9/14 A61K 9/20 A61K 47/36 A61K 47/ R. P. SCHERER CORPORATION, Basking Ridge, NJ, US Grother Leon Paul, Swindon, GB Murray Owen James, Swindon, GB Green Richard, Canterbury, GB Kearney Patrick, Swindon, GB Rychle dispergovatelná pevná dávková forma GB PCT/US2000/ WO 2000/ PATENTSERVIS PRAHA a.s., Jivenská 1, Praha 4, B21K 21/00 B21K 21/16 B21J 5/00 G21F 5/005 G21F 5/002 G21F 5/00 G21F 9/36 G21C 19/ MITSUBISHI HEAVY INDUSTRIES, LTD., Tokyo, JP Funakoshi Yoshihiko, Kitakyusyu-shi, JP Tsunezumi Takeshi, Kitakyusyu-shi, JP Mizuno Naohiro, Kitakyusyu-shi, JP Tokuno Katsuhiko, Kitakyusyu-shi, JP Matsumoto Chikayuki, Kitakyusyu-shi, JP Taura Yoshiharu, Hiroshima, JP Shirogane Shigenori, Hiroshima, JP Ohsono Katsunari, Hyogo, JP Matsuoka Toshihiro, Hyogo, JP Kovový blok pro použití při dilatačním tvarování za horka, kontejner se dnem, vyrobený z tohoto kovového bloku, přepravník obsahující tento kontejner, zařízení pro výrobu tohoto kontejneru, způsob výroby tohoto kontejneru a způsob výroby přepravníku, obsahujícího tento kontejner , /124778, 2000/ JP, JP PCT/JP2001/ WO 2001/ JUDr. Miloš Všetečka, Hálkova 2, Praha 2, B65H 63/06 D01H 13/22 D01H 13/ GEBRÜDER LOEPFE AG, Wetzikon, CH Scherer Heinrich, Bäretswil, CH Způsob čištění příze od vadných míst EP JUDr. Jan Matějka, Národní 32, Praha, C03C 27/04 A44C 27/

14 (udělené patenty) 3 (40) (40) (40) Kozáková Jiřina, Skalice u České Lípy, CZ Voláková Kamila, Česká Lípa, CZ Kozáková Jiřina, Skalice u České Lípy, CZ Voláková Kamila, Česká Lípa, CZ Způsob zdobení povrchu skleněných, porcelánových nebo keramických výrobků prostřednictvím kovu STRNAD Patent. a známková kancelář, Ing. Václav Strnad, Rychtářská 375/31, Liberec 14, C07D 205/04 C07D 401/12 C07D 403/12 C07D 417/12 A61K 31/397 A61P 25/ AVENTIS PHARMA S. A., Antony, FR Achard Daniel, Thiais, FR Bouchard Hervé, Thiais, FR Bouquerel Jean, Drancy, FR Filoche Bruno, Créteil, FR Grisoni Serge, Creteil, FR Hittinger Augustin, Igny, FR Myers Michael, Saint Nom la Breteche, FR Farmaceutické kompozice obsahující deriváty azetidinu, nové deriváty azetidinu a jejich příprava FR PCT/FR2001/ WO 2001/ Ing. Eduard Hakr, Přístavní 24, Praha 7, C07D 215/12 C07D 215/ NISSAN CHEMICAL INDUSTRIES, LTD., Tokyo, JP Harada Katsumasa, Ube, JP Nishino Shigeyoshi, Ube, JP Okada Naoko, Ube, JP Shima Hidetaka, Ube, JP Harada Takashi, Ube, JP Způsob přípravy chinolylakrylonitrilových derivátů /14864 JP PCT/JP2001/ WO 2001/ Ing. Eduard Hakr, Přístavní 24, Praha 7, C07D 277/60 A61K 31/428 A61P 3/04 A61P 3/ Sanofi - Aventis Deutschland GmbH, Frankfurt am Main, DE Jaehne Gerhard, Frankfurt, DE Lang Hans-Jochen, Hofheim, DE Gossel Matthias, Hofheim, DE Bickel Martin, Bad Homburg, DE 8,8a-Dihydroindeno[1,2-d]thiazolové deriváty nesoucí v pozici 2 substituent se sulfonamidovou strukturou a farmaceutické prostředky, které je obsahují DE PCT/EP2001/ (40) (40) (40) (40) WO 2001/ Ing. Jan Kubát, Přístavní 24, Praha 7, C07D 305/06 C07D 305/14 A61K 31/337 A61P 35/00 A61P 35/04 A61P 9/14 A61P 9/ INDENA S. P. A., Milano, IT Bombardelli Ezio, Milano, IT Pontiroli Alessandro, Milano, IT Polosyntetické taxany s antitumorovými a antiangiogenními účinky a jejich použití pro výrobu farmaceutického prostředku MI00A IT PCT/EP2001/ WO 2001/ JUDr. Zdeňka Korejzová, Spálená 29, Praha 1, C09K 3/18 C09K 3/00 C30B 29/ Qiagen GmbH, Hilden, DE Reihs Karsten, Köln, DE Duff Daniel-Gordon, Leverkusen, DE Wiessmeier Georg, Köln, DE Voetz Matthias, Köln, DE Kijlstra Johan, Leverkusen, DE Rühle Dieter, Odenthal, DE Köhler Burkhard, Leverkusen, DE Strukturovaný ultrafobní povrch, způsob jeho přípravy a jeho použití , , , , DE, DE, DE PCT/EP1999/ WO 2000/ Společná advokátní kancelář Všetečka Zelený Švorčík Kalenský a partneři, JUDr. Petr Kalenský, Hálkova 2, Praha 2, D06F 75/10 D06F 75/ BSH BOSCH UND SIEMENS HAUSGERÄTE GMBH, München, DE Ostermaier Albert, Stein/Traun, DE Dorn Thomas, Wasserburg, DE Žehlička DE PCT/EP2001/ WO 2002/ Dr. Karel Čermák, Národní třída 32, Praha 1, E21D 21/ ANKRA, s.r.o., Petřvald u Karviné, CZ

15 (udělené patenty) 4 (40) (40) Paloncy Libor Ing., Orlová, CZ Hanzlík Česlav Ing., Orlová, CZ Pětvalský Karel, Petřvald u Karviné, CZ Šimíček Karel, Ostrava, CZ Horninový injektážní svorník a způsob jeho výroby JUDr. Helmut Prchala, Rekreační 27, Hlučín-Bobrovníky, F02M 37/22 B01D 36/00 B01D 29/00 B01D 17/ SOGEFI FILTRATION S. P. A, Mantova, IT Baracchi Paolo, Torino, IT Crovetti Claudio, Mantova, IT Tallano Sergio, Porto Mantovano, IT Filtr paliva vznětového motoru MI2000A IT PCT/EP2001/ WO 2001/ JUDr. Petr Kalenský, Hálkova 2, Praha 2, G01B 7/004 G01B 11/00 G01S 5/ VALÁŠEK Michael Prof. Ing. DrSc., Praha, CZ Valášek Michael Prof. Ing. DrSc., Praha, CZ Způsob a zařízení pro určení polohy objektu v prostoru Ing. Karel Novotný, Žufanova 2, Praha 6, (40) T-MOBILE DEUTSCHLAND GMBH, Bonn, DE Keller Walter, Ratingen, DE Způsob preventivního a/nebo aktuálního zobrazení přenosových nákladů při přenosu internetových a online dat DE PCT/DE2000/ WO 2001/ JUDr. Miloš Všetečka, Hálkova 2, Praha 2, H04W 76/02 ( ) H04W 76/00 ( ) T-MOBILE DEUTSCHLAND GMBH, Bonn, DE Keller Walter, Ratingen, DE Způsob optimalizovaného přenosu multimediálních služeb v mobilních komunikačních sítích, zejména mobilních radiotelefonních sítích DE PCT/DE1999/ WO 2000/ JUDr. Miloš Všetečka, Hálkova 2, Praha 2, (40) G07F 7/ T-MOBILE DEUTSCHLAND GMBH, Bonn, DE Langer Michael, Richmond, GB Ljungström Patrik, Königswinter, DE Michel Uwe, Bad Honnef, DE Reindl Johann, Bonn, DE Schmickler Leonhard, Bonn, DE Způsob ovládání a provozu automatu na výdej zboží DE PCT/DE2000/ WO 2001/ JUDr. Miloš Všetečka, Hálkova 2, Praha 2, (40) G09B 25/00 G09B 25/02 B60R 21/ Cadence Innovation k.s., Liberec, CZ Potěšil Antonín Ing. CSc., Liberec, CZ Ševčík Ladislav Ing. CSc., Liberec, CZ Lauryn Jan Ing., Český Dub, CZ Zařízení pro simulaci nárazu hlavy Ing. Vladimír Belfín, patentový zástupce, P.O.BOX 117, Kladno, (40) H04L 12/14 G07F 7/

16 (udělené patenty) 5 Actavis Deutschland GmbH & Co. KG, Langenfeld, DE ANKRA, s.r.o., Petřvald u Karviné, CZ AVENTIS PHARMA S. A., Antony, FR BIOSINT S. P. A., Pomezia, IT BSH BOSCH UND SIEMENS HAUSGERÄTE GMBH, München, DE Cadence Innovation k.s., Liberec, CZ GEBRÜDER LOEPFE AG, Wetzikon, CH GRÜNENTHAL GMBH, Aachen, DE INDENA S. P. A., Milano, IT Kozáková Jiřina, Skalice u České Lípy, CZ MITSUBISHI HEAVY INDUSTRIES, LTD., Tokyo, JP NISSAN CHEMICAL INDUSTRIES, LTD., Tokyo, JP Qiagen GmbH, Hilden, DE R. P. SCHERER CORPORATION, Basking Ridge, NJ, US Sanofi - Aventis Deutschland GmbH, Frankfurt am Main, DE SOGEFI FILTRATION S. P A, Mantova, IT T-MOBILE DEUTSCHLAND GMBH, Bonn, DE T-MOBILE DEUTSCHLAND GMBH, Bonn, DE T-MOBILE DEUTSCHLAND GMBH, Bonn, DE VALÁŠEK Michael Prof. Ing DrSc., Praha, CZ Voláková Kamila, Česká Lípa, CZ Seznam majitelů udělených patentů A 61 K 31/21 E 21 D 21/00 C 07 D 205/04 A 61 K 31/195 D 06 F 75/10 G 09 B 25/00 B 65 H 63/06 A 61 K 31/135 C 07 D 305/06 C 03 C 27/04 B 21 K 21/00 C 07 D 215/12 C 09 K 3/18 A 61 K 9/14 C 07 D 277/60 F 02 M 37/22 H 04 W 76/02 H 04 L 12/14 G 07 F 7/08 G 01 B 7/004 C 03 C 27/04 ( )

17 (evropské patentové přihlášky a evropské patenty) 1 Udělené evropské patenty Evropský patentový úřad udělil následující evropské patenty s účinky pro Českou republiku. Tyto patenty mohou být zrušeny nebo zachovány v pozměněném znění Evropským patentovým úřadem v řízení o odporu. K tomu, aby nabyl evropský patent účinnosti na území České republiky, je třeba, aby byl Úřadu předložen ve stanovené lhůtě překlad patentového spisu do českého jazyka ( 35c odst. 2 až 4 zákona č. 527/1990 Sb., v platném znění). EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP

18 (evropské patentové přihlášky a evropské patenty) 2 EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP

19 (evropské patentové přihlášky a evropské patenty) 3 EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP

20 (evropské patentové přihlášky a evropské patenty) 4 EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP EP

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 39 ISSN 2336-7288 Praha - 30. září 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Obsah kapitol ve věstníku č. 11-2005

Obsah kapitol ve věstníku č. 11-2005 Obsah kapitol ve věstníku č. 11-2005 Přehled číselných INID kódů pro označování bibliografických dat 2 Přehled kapitol 3 Kódy pro označování zemí 6 Zamítnuté a částečně zamítnuté přihlášky ochranných známek

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 22 ISSN 2336-7288 Praha - 1. června 2016 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Číslo 51 Praha - 17. prosince 2014

Číslo 51 Praha - 17. prosince 2014 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 51 Praha - 17. prosince 2014 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data

Více

Číslo 52 Praha - 29. prosince 2014

Číslo 52 Praha - 29. prosince 2014 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 52 Praha - 29. prosince 2014 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data

Více

Číslo 12 Praha - 25. března 2015

Číslo 12 Praha - 25. března 2015 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 12 Praha - 25. března 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 51 ISSN 2336-7288 Praha - 23. prosince 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 40 ISSN 2336-7288 Praha - 7. října 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

ÚŘEDNÍ ROZHODNUTÍ A OZNÁMENÍ

ÚŘEDNÍ ROZHODNUTÍ A OZNÁMENÍ 190 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ 2-2002 - CZ, část A ÚŘEDNÍ ROZHODNUTÍ A OZNÁMENÍ MK4A, MK4F Zánik patentů a autorských osvědčení uplynutím doby platnosti Int.Cl/ 258574 259545 260245 261496

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 23 ISSN 2336-7288 Praha - 8. června 2016 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 20 ISSN 2336-7288 Praha - 18. května 2016 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Číslo 2 Praha - 14. ledna 2015

Číslo 2 Praha - 14. ledna 2015 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 2 Praha - 14. ledna 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data of

Více

Číslo 46 Praha - 12. listopadu 2014

Číslo 46 Praha - 12. listopadu 2014 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 46 Praha - 12. listopadu 2014 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 18 ISSN 2336-7288 Praha - 4. května 2016 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 34 ISSN 2336-7288 Praha - 26. srpna 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Číslo 29 Praha - 16. července 2014

Číslo 29 Praha - 16. července 2014 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 29 Praha - 16. července 2014 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 36 ISSN 2336-7288 Praha - 9. září 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 15 ISSN 2336-7288 Praha - 13. dubna 2016 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 6 ISSN 2336-7288 Praha - 10. února 2016 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 13 ISSN 2336-7288 Praha - 30. března 2016 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Úvod do problematiky průmyslových práv Databáze patentů a užitných vzorů

Úvod do problematiky průmyslových práv Databáze patentů a užitných vzorů Úvod do problematiky průmyslových práv Databáze patentů a užitných vzorů Ing. Z. Čapková, oddělení rešerší, ÚPV Základní pojmy Duševní vlastnictví majetek nehmotné povahy, výsledek procesu lidského myšlení

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 7 ISSN 2336-7288 Praha - 17. února 2016 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Číslo 6 Praha - 11. února 2015

Číslo 6 Praha - 11. února 2015 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 6 Praha - 11. února 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data of

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 17 ISSN 2336-7288 Praha - 27. dubna 2016 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Praha - 26. října 2011. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST.

Praha - 26. října 2011. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST. VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 43 Praha - 26. října 2011 Číselné INID kódy pro označování bbibliografických dat technických řešení INID Codes for the identification of bibliographic data

Více

Číslo 42 Praha - 15. října 2014

Číslo 42 Praha - 15. října 2014 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 42 Praha - 15. října 2014 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data of

Více

Číslo 17 Praha - 23. dubna 2014

Číslo 17 Praha - 23. dubna 2014 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 17 Praha - 23. dubna 2014 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data of

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 12 ISSN 2336-7288 Praha - 23. března 2016 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Úřední rozhodnutí a oznámení

Úřední rozhodnutí a oznámení VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ 12-2006 - CZ, část A (úřední rozhodnutí a oznámení) 101 Úřední rozhodnutí a oznámení MK4A, MK4F Zánik patentů a autorských osvědčení uplynutím doby platnosti Int.Cl/

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 23 ISSN 2336-7288 Praha - 10. června 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 16 ISSN 2336-7288 Praha - 20. dubna 2016 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Kyvné pohony Série 6400. Miniaturní kompaktní suporty Série 6700. Tlumiče nárazu Série 6900

Kyvné pohony Série 6400. Miniaturní kompaktní suporty Série 6700. Tlumiče nárazu Série 6900 Manipulace Série 000 SpA 4050 LURANO (BG) - Italia Via Cascina Barbellina, 0 Tel. 035/49777 Fax 035/49740 035/4974 http://www.pneumaxspa.com CAP. SOC...700.000 I.V. R.E.A. BERGAMO N. 0798 R.E.A. MILANO

Více

ÚŘEDNÍ ROZHODNUTÍ A OZNÁMENÍ

ÚŘEDNÍ ROZHODNUTÍ A OZNÁMENÍ VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ 9-2001 - CZ, část A 193 ÚŘEDNÍ ROZHODNUTÍ A OZNÁMENÍ MK4A, MK4F Zánik patentů a autorských osvědčení uplynutím doby platnosti Int.Cl/ 255616 255878 257289 257291

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 26 ISSN 2336-7288 Praha - 29. června 2016 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Právní ochrana technických řešení

Právní ochrana technických řešení Právní ochrana technických řešení Ing. Jarmila Avratová Praha, 4.4.2014 Předmětem duševního vlastnictví jsou nehmotné statky, které člověk vytvořil svou duševní činností. Pojem duševního vlastnictví podle

Více

14/10/2015 Z Á K L A D N Í C E N Í K Z B O Ž Í Strana: 1

14/10/2015 Z Á K L A D N Í C E N Í K Z B O Ž Í Strana: 1 14/10/2015 Z Á K L A D N Í C E N Í K Z B O Ž Í Strana: 1 S Á ČK Y NA PS Í E XK RE ME N TY SÁ ČK Y e xk re m en t. p o ti sk P ES C Sá čk y P ES C č er né,/ p ot is k/ 12 m y, 20 x2 7 +3 c m 8.8 10 bl ok

Více

Seznámení se s právy z duševního vlastnictví a jejich přínosem Právní ochrana technických řešení

Seznámení se s právy z duševního vlastnictví a jejich přínosem Právní ochrana technických řešení Úřad průmyslového vlastnictví www.upv.cz Seznámení se s právy z duševního vlastnictví a jejich přínosem Právní ochrana technických řešení Zuzana Čapková, oddělení rešerší ÚPV, 2015 Duševní vlastnictví

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 48 ISSN 2336-7288 Praha - 2. prosince 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Přístroje na měření tlaku SITRANS P Snímače relativního, absolutního a diferenčního tlaku

Přístroje na měření tlaku SITRANS P Snímače relativního, absolutního a diferenčního tlaku Přehled Snímače tlaku SITRANS P, série Z pro relativní tlak (7MF156- ) Snímač tlaku SITRANS P, série Z (7MF156- ) měří relativní tlak agresivních a neagresivních plynů, kapalin a par. Výhody Vysoká přesnost

Více

Manometry, Teploměry, Manopříslušenství

Manometry, Teploměry, Manopříslušenství Manometry, Teploměry, Manopříslušenství Ceník 2006 Přesné měření, spoíehllvá regulace Obsah Manometry Strana Trubicové manometry pr. 40-80 3 Trubicové manometry pr. 100, Termomanometr 4 Trubicové manometry

Více

Praha - 2. května 2013. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST.

Praha - 2. května 2013. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST. VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 18 Praha - 2. května 2013 Číselné INID kódy pro označování bbibliografických dat technických řešení INID Codes for the identification of bibliographic data

Více

Ověřená technologie montáže motokáry INDOOR 08

Ověřená technologie montáže motokáry INDOOR 08 VYSOKÁ ŠKOLA BÁŇSKÁ TECHNICKÁ UNIVERZITA OSTRAVA FAKULTA METALURGIE A MATERIÁLOVÉHO INŽENÝRSTVÍ Ústav progresivních technologií pro automobilový průmysl Ověřená technologie montáže motokáry INDOOR 08 Petr

Více

Tlaková čidla SPAW, s displejem

Tlaková čidla SPAW, s displejem Všeobecné údaje 9 rozsahů tlaku 1 +1 bar až 0 +100 barů 4místný displej LED, dobře čitelný, robustní stupeň krytí IP67 displej otočný o 360 přesnost 1 %, opakovatelná přesnost 0,15 % teplota média 20 85

Více

http://www.workshopdata.com/printmaintenance.do

http://www.workshopdata.com/printmaintenance.do Stránka č. 1 z 5 Údaje o zákazníkovi: Jméno: Poštovní Kód: : : SPZ: Stav najetých kilometrů: Vysvětlující ikony: Kód OE Dodatečná Práce OK Dokončeno Potřebuje výměnu/opravu * Mohou být potřebné náhradní

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 21 ISSN 2336-7288 Praha - 25. května 2016 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Z a p s a n é p r ů m y s l o v é v z o r y

Z a p s a n é p r ů m y s l o v é v z o r y VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ 7-2003 - CZ, část A (zapsané průmyslové vzory) 3 FG4Q Z a p s a n é p r ů m y s l o v é v z o r y 3484 3485 3486 3487 3488 3489 3490 349 3492 3493 3494 3495 3496

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 8 ISSN 2336-7288 Praha - 24. února 2016 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Nápověda k pokročilému vyhledávání

Nápověda k pokročilému vyhledávání Nápověda k pokročilému vyhledávání Nový rešeršní systém zpřístupněný Úřadem jako systém s rozšířeným vyhledáváním obsahuje proti původnímu sytému mnohem více vyhledávacích možností. Nicméně základní možnosti

Více

Technologie montáže elektrokáry

Technologie montáže elektrokáry VYSOKÁ ŠKOLA BÁŇSKÁ TECHNICKÁ UNIVERZITA OSTRAVA FAKULTA METALURGIE A MATERIÁLOVÉHO INŽENÝRSTVÍ Ústav progresivních technologií pro automobilový průmysl Technologie montáže elektrokáry Petr Tomčík Radim

Více

Praha - 4. září 2013. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST.

Praha - 4. září 2013. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST. VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 36 Praha - 4. září 2013 Číselné INID kódy pro označování bbibliografických dat technických řešení INID Codes for the identification of bibliographic data of

Více

Číslo 48 Praha - 26. listopadu 2014

Číslo 48 Praha - 26. listopadu 2014 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 48 Praha - 26. listopadu 2014 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 45 ISSN 2336-7288 Praha - 11. listopadu 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Číslo 26 Praha - 25. června 2014

Číslo 26 Praha - 25. června 2014 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 26 Praha - 25. června 2014 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data

Více

Zásuvný systém - montážní návod

Zásuvný systém - montážní návod Zásuvný systém montážní návod - rozšíření pro FS Varianta s 2-řadou výstavbou se zásuvnými profily pro rychlou montáž. OBSAH STRANA 1 Obecně 1 2 Nosník modulů - výstavba systému 2/3 3 Montáž nosníkového

Více

Návrh. VYHLÁŠKA ze dne 2004, kterou se stanoví rozsah údajů, které musí obsahovat žádost o udělení oprávnění k využívání rádiových kmitočtů

Návrh. VYHLÁŠKA ze dne 2004, kterou se stanoví rozsah údajů, které musí obsahovat žádost o udělení oprávnění k využívání rádiových kmitočtů Návrh VYHLÁŠKA ze dne 2004, kterou se stanoví rozsah údajů, které musí obsahovat žádost o udělení oprávnění k využívání rádiových kmitočtů Český telekomunikační úřad stanoví podle 149 odst. 5 zákona č..../2004

Více

M/146000, M/146100, M/146200 LINTRA PLUS

M/146000, M/146100, M/146200 LINTRA PLUS M/46000, M/4600, M/4600 LINTRA PLUS Bezpístnicové válce Dvojčinné, magnetický a nemagnetický píst - Ø 6 až 80 mm Nové odlehčené provedení výlisku s univerzálními montážními drážkami Osvědčený a patentovaný

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 37 ISSN 2336-7288 Praha - 16. září 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Patent. Roman Šebesta 6.12.2011

Patent. Roman Šebesta 6.12.2011 Patent Roman Šebesta 6.12.2011 Bližší specifikace Patentem je vynález, kterému je vydáno osvědčení o vynálezu, které uděluje: u českého patentu Úřad průmyslového vlastnictví za podmínek stanovených zákonem

Více

Montáž v Brně. Válec. 32 100 mm. Katalogový list 2.29.001-1CZ 67. Veličiny podle VDI 3294. Údaje o tlaku přetlak. Značka Jednotka Poznámka.

Montáž v Brně. Válec. 32 100 mm. Katalogový list 2.29.001-1CZ 67. Veličiny podle VDI 3294. Údaje o tlaku přetlak. Značka Jednotka Poznámka. Technické změny vyhrazeny A1P507D00LW00X Veličiny podle VDI 3294 Veličina Všeobecně Název Řada Druh konstrukce Způsob upevnění Druh připojení Značka Jednotka Poznámka Válec s pístnicí AZ5 dvojčinný s tlumením

Více

CENÍK KOVÁNÍ na posuvné dveře LAGUNA Změna cen vyhrazena!

CENÍK KOVÁNÍ na posuvné dveře LAGUNA Změna cen vyhrazena! Platný od 1.2. 2013 41 CENÍK KOVÁNÍ na posuvné dveře LAGUNA Změna cen vyhrazena! Uvedené ceny jsou za ks, příp. bm(u lišt). kód MOC vč.dph Truhl. II. Truhl. III. Truhl. IV. Truhl. V. OMEGA 50kg hliníkové

Více

Terénní užitkové vozidlo

Terénní užitkové vozidlo Terénní užitkové vozidlo Společník pro práci a volný čas Mechron Je jedno, zda chcete pracovat na farmě nebo v lese, Kioti Mechron 4 4 se hodí pro všechny práce. Se čtyřmi nezávisle zavěšenými koly zadní

Více

Praha - 3. října 2012. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST.

Praha - 3. října 2012. INID Codes for the identification of bibliographic data of technical solutions (Standard WIPO ST. 9 a ST. VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 40 Praha - 3. října 2012 Číselné INID kódy pro označování bbibliografických dat technických řešení INID Codes for the identification of bibliographic data of

Více

Otázky k závěrečným zkouškám

Otázky k závěrečným zkouškám Otázky k závěrečným zkouškám v Institutu průmyslově právní výchovy školní rok 2010/2011 Patentové právo (PP) 1. Podmínky patentovatelnosti vynálezu. 2. Podnikový vynález, zaměstnanecký průmyslový vzor.

Více

STABILNÍ PARTNER VE VÝROBĚ.

STABILNÍ PARTNER VE VÝROBĚ. STABILNÍ PARTNER VE VÝROBĚ. MARSTAND Nejaktuálnější informace k produktům MARSTAND naleznete na našich webových stránkách: www.tm-technik.cz Měřicí stojany, stoly a zařízení na kontrolu obvodového házení

Více

Roth plochý kolektor Heliostar 218... hightech s

Roth plochý kolektor Heliostar 218... hightech s Roth Heliostar nyní též s menší plochou... pro každé použití správná velikost Po úspěšném uvedení na trh kolektoru Roth Heliostar s inovovanou polykarbonátovou vanou je nyní k dodání nově ve dvou různých

Více

VITO 110CDI/K EXPRES. 2257 x 1650 x 1353 890

VITO 110CDI/K EXPRES. 2257 x 1650 x 1353 890 VITO 110CDI EXPRES Cena základního modelu VITO 110CDI/K EXPRES Cena s DPH (Kč) 478 800,- Cena bez DPH (Kč) 399 000,- Základní technická specifikace vozu Označení motoru 110CDI Typ Vznětový Počet válců

Více

Technická specifikace

Technická specifikace Technická specifikace Tato příloha zadávací dokumentace stanoví minimální technické, materiálové a funkční požadavky na předmět plnění veřejné zakázky pod označením Dodávka zdravotnických potřeb a nábytku.

Více

(Standard WIPO ST.60)

(Standard WIPO ST.60) VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 5 ISSN 2336-7288 Praha - 3. února 2016 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic

Více

Z a p s a n é p r ů m y s l o v é v z o r y

Z a p s a n é p r ů m y s l o v é v z o r y VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ 12-2003 - CZ, část A (zapsané průmyslové vzory) 135 FG4Q Z a p s a n é p r ů m y s l o v é v z o r y 31764 31765 31766 31767 31768 31769 31770 31771 31772 31773 31774

Více

Úřední rozhodnutí a oznámení

Úřední rozhodnutí a oznámení VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ 1-2006 -, část A (úřední rozhodnutí a oznámení) 93 Úřední rozhodnutí a oznámení MK4A, MK4F Zánik patentů a autorských osvědčení uplynutím doby platnosti Int.Cl/ 277404

Více

Číslo 5 Praha - 29. ledna 2014

Číslo 5 Praha - 29. ledna 2014 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 5 Praha - 29. ledna 2014 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data of

Více

STABILNÍ PARTNER VE VÝROBĚ. MARSTAND

STABILNÍ PARTNER VE VÝROBĚ. MARSTAND - STABILNÍ PARTNER VE VÝROBĚ. MARSTAND Nejaktuálnější informace k produktům MARSTAND naleznete na našich webových stránkách: www.mahr.cz, WebCode 210 Měřicí stojany, stoly a zařízení pro kontrolu obvodového

Více

2 POLICOVÉ O REGÁLY REGÁL

2 POLICOVÉ O REGÁLY REGÁL POLICOVÉ REGÁLY 2 POLICOVÉ REGÁLY 3 POLICOVÉ REGÁLY Všeobecně slouží konstrukce policového regálu k ukládání různých druhů zboží a materiálů přímo na police (drobné zboží, krabice, plastové přepravky,

Více

POPIS VYNALEZU K AUTORSKÉMU OSVĚDČENÍ ( 19 ) ČESKOSLOVENSKA SOCIALISTICKÁ G 21 F 7/02. (22) Přihlášeno 15 03 86 (21) PV 1813-86.W

POPIS VYNALEZU K AUTORSKÉMU OSVĚDČENÍ ( 19 ) ČESKOSLOVENSKA SOCIALISTICKÁ G 21 F 7/02. (22) Přihlášeno 15 03 86 (21) PV 1813-86.W ČESKOSLOVENSKA SOCIALISTICKÁ R E P U B L I K A ( 19 ) POPIS VYNALEZU K AUTORSKÉMU OSVĚDČENÍ 255449 (II) (Bl) (22) Přihlášeno 15 03 86 (21) PV 1813-86.W (51) Int. Cl. 4 G 21 F 7/02 ÚÄAD PRO VYNÁLEZY A OBJEVY

Více

Zařízení s ohřevem. Tepelný most elektrický. Popis: www.ruml-gastrotech.eu kontaktní informace +420 602 336 872 Strana 87

Zařízení s ohřevem. Tepelný most elektrický. Popis: www.ruml-gastrotech.eu kontaktní informace +420 602 336 872 Strana 87 Zařízení s ohřevem Kapitola 19 Tepelný most elektrický Podtyp RЕ 19.1-1 patrový Podtyp RЕ 19.2-2 patrový Podtyp RЕ 19.3-2 patrový s regulací výkonu RЕ 19.1 RЕ 19.2 - šířka 300 mm, výška 600 mm - vyška

Více

Vývoz - datum propuštění = 01. 02. 2013 až 28. 02. 2013

Vývoz - datum propuštění = 01. 02. 2013 až 28. 02. 2013 Vývoz - datum propuštění = 01. 02. 2013 až 28. 02. 2013 Celní deklarace Země Datum výstupu zboží do Datum propuštění Statistická hodnota Zboží Krátký popis zbožového kódu KN určení zahraničí Výstup kompletně

Více

FORT-PLASTY s.r.o., Hulínská 2193/2a, 767 01 Kroměříž, CZ tel.: +420 575 755 711, e-mail: info@fort-plasty.cz, www.fort-plasty.cz

FORT-PLASTY s.r.o., Hulínská 2193/2a, 767 01 Kroměříž, CZ tel.: +420 575 755 711, e-mail: info@fort-plasty.cz, www.fort-plasty.cz FORT-PSTY s.r.o., Hulínská 2193/2a, 767 01 Kroměříž, CZ NQ ISO 9001 0 8. umožňují vložení ačních vložek (ů) do potrubních rozvodů. Konstrukce plastových boxů jsou uzpůsobeny pro vložení všech běžných typů

Více

ZÁVĚSNÉ SEDAČKY DO VANY

ZÁVĚSNÉ SEDAČKY DO VANY dma_katalog_2012_dma_katalog_2012 4.5.12 17:34 Stránka 19 ZÁVĚSNÉ SEDAČKY DO VANY 534 provedení chrom 530 P 12/0023904 PLNĚ HRAZENO plastové sedátko 534 E 12/0023910 PLNĚ HRAZENO 534 12/0023909 PLNĚ HRAZENO

Více

STÍNÍCÍ TECHNIKA NA VAŠE PŘÁNÍ

STÍNÍCÍ TECHNIKA NA VAŠE PŘÁNÍ René Býma Ostrava, Frýdek-Místek gsm:725 119 045 Nový Jičín, Přerov, e-mail: byma@renesun.cz Olomouc, Prostějov, Brno web: www.renesun.cz Opava, Havířov, Karviná Showroom: Cihelní 35, Ostrava,702 00 STÍNÍCÍ

Více

Příslušenství L200 DOUBLE CAB PRODLOUŽENÁ VERZE

Příslušenství L200 DOUBLE CAB PRODLOUŽENÁ VERZE Příslušenství L200 DOUBLE CAB PRODLOUŽENÁ VERZE Hard top, Utility Top Plus Nízká verze, s předním posuvným oknem, zatmavenými bočními vyklápěcími okny a zatmaveným zadním oknem. Zadní dveře se stylovým

Více

Číslo 10 Praha - 11. března 2015

Číslo 10 Praha - 11. března 2015 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 10 Praha - 11. března 2015 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data

Více

12/04 N/CZ 1.5.084.01

12/04 N/CZ 1.5.084.01 Kompaktní válce ISO 21287 Magnetický píst, dvojčinné Ø 20 až 125 mm Odpovídá ISO 21287 M/50 Spínače při upevnění nepřesahují roviny profilu Magnetický píst jako standard Těsnění zabezpečuje malé tření

Více

Zlatuše Braunšteinová odbor OZ, oddělení mezinárodních OZ Úřad průmyslového vlastnictví (www.upv.cz)

Zlatuše Braunšteinová odbor OZ, oddělení mezinárodních OZ Úřad průmyslového vlastnictví (www.upv.cz) Zlatuše Braunšteinová odbor OZ, oddělení mezinárodních OZ Úřad průmyslového vlastnictví (www.upv.cz) přihlašovatel MOZ z ČR do jedné/několika zemí prostřednictvím WIPO Podmínky pro přihlášení mezinárodní

Více

Zkušební komise pro státní závěrečné zkoušky 2013/14 č. 75

Zkušební komise pro státní závěrečné zkoušky 2013/14 č. 75 č. 75 Datum: 16.06.2014 09:00 Místnost: Technická 2 - A3/613 prof. Ing. František Bauer, CSc. doc. Ing. Zdeněk Kaplan, CSc. Ing. Ondřej Čavoj Ing. Jiří Koláček Ing. David Kollhammer, Ph.D. 09:00 Kučera

Více

KATALOGOVÝ LIST. VENTILÁTORY AXIÁLNÍ PŘETLAKOVÉ APMB 1600 a 2400 pro mikrochladiče

KATALOGOVÝ LIST. VENTILÁTORY AXIÁLNÍ PŘETLAKOVÉ APMB 1600 a 2400 pro mikrochladiče KATALOGOVÝ LIST VENTILÁTORY AXIÁLNÍ PŘETLAKOVÉ APMB 1600 a 2400 pro mikrochladiče KM 12 2521 Vydání: 12/10 Strana: 1 Stran: 6 Ventilátory axiální přetlakové APMB 1600 a 2400 pro mikrochladiče (dále jen

Více

Číslo 43 Praha - 22. října 2014

Číslo 43 Praha - 22. října 2014 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ Číslo 43 Praha - 22. října 2014 Číselné INID kódy pro označování bibliografických dat technických řešení INID Codes for the identification of bibliographic data of

Více

Databáze Madrid Express (WIPO)

Databáze Madrid Express (WIPO) Databáze Madrid Express (WIPO) Databázi Madrid Express obsahující mezinárodní ochranné známky, přihlášené na základě Madridské dohody nebo Madridského protokolu, zpřístupňuje Světová organizace duševního

Více

Úřední rozhodnutí a oznámení

Úřední rozhodnutí a oznámení VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ 6-2006 - CZ, část A (úřední rozhodnutí a oznámení) 97 Úřední rozhodnutí a oznámení MK4A, MK4F Zánik patentů a autorských osvědčení uplynutím doby platnosti Int.Cl/

Více

VITO 116CDI KB SPORT

VITO 116CDI KB SPORT VITO 116CDI KB SPORT Cena základního modelu VITO 116CDI/K KB SPORT Cena s DPH (Kč) 774 000,- Cena bez DPH (Kč) 645 000,- Základní technická specifikace vozu Označení motoru 116CDI Typ Vznětový Počet válců

Více

Dovoz za rok 2014 Celní deklarace CÚ dovozu Země určení Země odeslání Název země odeslání Datum propuštění Kód měny Fakturovaná částka Směnný kurz

Dovoz za rok 2014 Celní deklarace CÚ dovozu Země určení Země odeslání Název země odeslání Datum propuštění Kód měny Fakturovaná částka Směnný kurz Dovoz za rok 2014 Celní deklarace CÚ dovozu Země určení Země odeslání Název země odeslání Datum propuštění Kód měny Fakturovaná částka Směnný kurz Preference Země původu zboží Země původu zboží Režim Základ

Více

Ochranné známky prohlášené za proslulé

Ochranné známky prohlášené za proslulé Ochranné známky prohlášené za proslulé datum zpracování: 26.08.2002 abecední řazení podle majitele č.spisu č.zápisu priorita datum prohlášení za proslulou stav obrázek znění majitel - název sídlo stát

Více

Úvod Proč polohovadla?

Úvod Proč polohovadla? Svařovac ovací stroje 4 Svařovac ovací přípravky, pravky, polohovadla a manipulátory doc. Ing. Ivo Hlavatý, Ph.D. http://fs1.vsb vsb.cz/~hla80 ivo.hlavaty@vsb.cz Úvod Proč polohovadla? Svařovac ovací přípravky,

Více

ŘADOVÉ SKŘÍNĚ QA. Rozváděčové skříně

ŘADOVÉ SKŘÍNĚ QA. Rozváděčové skříně Základní provedení skříně obsahuje: skelet odnímatelný horní kryt odnímatelný zadní kryt otvor ve dně 2 boční lišty dveře výklopná klika vložka DB5 šroubovaná perforovaná výztuha po celém obvodu dveří

Více

VITO 110 CDI EXPRES VITO 110CDI/K EXPRES. Cena základního modelu. Cena bez DPH (Kč) 404 000,- Základní technická specifikace vozu Označení motoru

VITO 110 CDI EXPRES VITO 110CDI/K EXPRES. Cena základního modelu. Cena bez DPH (Kč) 404 000,- Základní technická specifikace vozu Označení motoru VITO 110 CDI EXPRES Cena základního modelu VITO 110CDI/K EXPRES Cena s DPH (Kč) 484 800,- Cena bez DPH (Kč) 404 000,- Základní technická specifikace vozu Označení motoru 110CDI Typ Vznětový Počet válců

Více

Ruční aparáty pro vázání plastovou páskou

Ruční aparáty pro vázání plastovou páskou Ruční aparáty pro vázání plastovou páskou Aparáty s akumulátorovým pohonem Kombinované aparáty Kombinace utahovací/uzavírací aparát Výhody Strapex aparátů Aparát, vázací páska a servis systémové řešení

Více

DistriBox D12 ROZVÁDĚČOVÉ SKŘÍNĚ QA. Tabulka výběru skříní. Rozváděčové skříně

DistriBox D12 ROZVÁDĚČOVÉ SKŘÍNĚ QA. Tabulka výběru skříní. Rozváděčové skříně DistriBox Rozváděčové skříně Tabulka výběru skříní hloubka 300 400 500 D12 Rozměry skeletu Skříň IP40 Boční kryty IP40 Skříň IP55 Boční kryty IP55 Podstavce Montážní panely šířka výška 1 QA40-180603 35462

Více

Zapsané užitné vzory. VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ 1-2004 - CZ, část A (zapsané užitné vzory) 119

Zapsané užitné vzory. VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ 1-2004 - CZ, část A (zapsané užitné vzory) 119 VĚSTNÍK ÚŘADU PRŮMYSLOVÉHO VLASTNICTVÍ 1-2004 - CZ, část A (zapsané užitné vzory) 119 FG1K Zapsané užitné vzory V období uzávěrky tohoto čísla Věstníku zapsal Úřad průmyslového vlastnictví tyto užitné

Více