Mendelistická genetika

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "Mendelistická genetika"


1 Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových sd obou rodičovských jedinců není shodný s žádným z rodičů 2 Křížení = hybridizce Zákldní metod genetiky orgnismů Záměrné pohlvní rozmnožování dvou vybrných jedinců, při němž sledujeme výskyt určitého znku u všech jejich potomků Podle počtu sledovných znků rozlišujeme: monohybridizce (jeden znk) dihybridizce (dv znky) Cíl genetický výzkum nebo šlechtitelský záměr 3

2 Pojmy symbolik Homozygotní genotyp má jedinec, který zdědil od obou rodičů stejnou lelu téhož genu (znčíme npř.,, BB, bb) Heterozygotní genotyp má jedinec se dvěm různými lelmi téhož genu (npř., Bb) rodičovská generce = prentáln lní generce (P) přímí potomci = první filiáln lní generce (F1) dlší generce = druhá filiáln lní generce (F2, popř. F3,..) Dědičnost kvlittivních znků Dědičnost kvntittivních znků 4 1. Dědičnost kvlittivních znků Kvlittivní znk - obvykle monogenní (podmíněn jedním genem) Diploidní orgnismy mjí vždy dvě lely od jednoho genu Při vzniku gmet (při meióze) probíhá segregce párových chromozomů, tkže do kždé gmety se dostne jedn lel od kždého genu otcovská nebo mteřská 5 Vzájemný vzth mezi lelmi Úplná dominnce recesivit v heterozygotním genotypu se projeví pouze dominntní lel, nikoli recesivní př. lel určuje červenou brvu květu, lel bílou, jedinec s genotypem bude červený 6

3 Vzájemný vzth mezi lelmi Neúpln plná dominnce recesivit n vytvoření znku se podílí obě lely, zprvidl nestejnou měrou jedinec s heterozygotním genotypem se odlišuje od obou homozygotů zvláštním přípdem intermedirit (obě se projeví stejnou měrou př. lel určuje červenou brvu květu, lel bílou, jedinec s genotypem bude růžový 7 Vzájemný vzth mezi lelmi Kodominnce v heterozygotním genotypu se projeví obě lely vedle sebe, niž by se vzájemně potlčovly př. krevní skupiny systému B0 8 Kombinční čtverec Užívá se ke zjištění všech možných kombincí v jejich vzájemném poměru Pozor! Štěpný poměr je poměr sttistický, tj upltní se jen při dosttečném počtu potomků. Typy gmet vytvářené prvním rodičem Typy gmet vytvářené druhým rodičem gmety gmety 9 Možné genotypy

4 Krevní skupiny systému B0 Gen, který je určuje, se vyskytuje ve třech lelách: I, I B, i lel I určuje přítomnost ntigenu n červ. krvinkách lel I B určuje přítomnost ntigenu B n červ. krvinkách lel i nenese žádnou informci lely I, I B jsou vzájemně kodominntní vůči lele i jsou úplně dominntní 10 Krevní skupiny systému B0 Krevní skupin Možné genotypy I I, I i B I B I B I B i 0 ii B I I B 11 Systém B0 v ČR Skupin ntigen Protilátk frekvence v nší populci nti-b 42 % B B nti- 18 % nti-, nti-b 32 % B, B % 12

5 utosomální dědičnost Dědičnost znků, jejichž geny jsou umístěny n utozomech Dominntní dědičnost = dědičnost genů s úplnou dominncí Dědičnost neúpln plně dominntní (intermediární) = dědičnost genů s neúplnou dominncí 13 Dominntní dědičnost Monohybridní křížení (sledujeme jeden gen) ) křížení dvou stejných homozygotů x gmety: Potomci F 1 : 14 Dominntní dědičnost b) křížení dvou různých homozygotů x gmety: Potomci F 1 : 15 Při křížení dominntního recesivního homozygot je potomstvo uniformní. 1. Mendelův zákon

6 Dominntní dědičnost c) křížení dvou heterozygotů x gmety: Potomci F 1 : Potomstvo se štěpí v poměru 3 : 1 ve fenotypu. Genotypový štěpný poměr : : je 1 : 2 : 1 16 Dominntní dědičnost d) křížení homozygot s heterozygotem x gmety: Potomci F 1 : 17 Potomstvo se štěpí n obě rodičovské formy v poměru 1 : 1. Toto tzv. zpětné křížení se užívá ke zjištění genotypu u jedince s dominntní formou znku. Dědičnost neúpln plně dominntní Monohybridní křížení křížení dvou různých homozygotů x gmety: Potomci F 1 : 18

7 Dědičnost neúpln plně dominntní křížení dvou heterozygotů x gmety gmety 19 Potomstvo se štěpí n tři fenotypové formy v poměru 1 : 2 : 1 Vyzkoušejte si Modrooký muž, jehož ob rodiče měli oči hnědé, se oženil s dívkou, která má hnědé oči jejíž otec byl modrooký, ztímco mtk hnědooká. Jejich ztím jediné dítě má oči hnědé.jké jsou genotypy dítěte, rodičů i všech prrodičů, víme-li, že tmvá (hnědá) brv očí je dominntní nd modrou brvou? 20 Dominntní dědičnost Dihybridní křížení (sledujeme dv geny) B b BB gmety: B B 21

8 Dominntní dědičnost Dihybridní křížení (sledujeme dv geny) ) křížení dvou homozygotů B b BB x bb gmety: B B b b Potomci F 1 : Bb Bb Bb Bb 22 Kombince lel různých chromozomových párů v gmetách dihybrid Diploidní buňk B b Kždý pár lel se chová smosttně dochází k segregci nezávisle n jiném páru lel volná kombince lel Gmety 23 B b B b F 2 generce Šlechtitelské novinky Počet Fenotypový fenotypových štěpný poměr kombincí r 9 : 3 2: n 3 : 1 n počet hybridizovných Počet genotypových kombincí 3 n genů gmety B b B b B BB Bb BB Bb b B Bb bb Bb bb BB Bb BB Bb b 24 Bb bb Bb bb

9 O čem Mendel nevěděl Genové interkce Polygenní dědičnost Vzb genů 25 Genové interkce jeden znk = jeden gen????? znk vzniká spolupůsobením většího počtu genů komplementrit epistáze duplicitní interkce kumultivní duplicitní interkce mnohotný lelismus - kodominnce 26 Genové interkce KOMPLEMENTRIT interkce dvou nelelních genů Křížením dvou bělokvětých odrůd hrchoru zhrdního vznikly v F1 generci rostliny s růžovými květy. Po smoopylení rostlin F1 generce byl v F2 generci teoretický pomě rostlin s růžovými květy rostlin s bílými květy 9 : 7 Určete genotyp prentální generce Jký genotyp podmiňuje růžovou brvu květu? 27 Prentální generce BB x bb bílé květy x bílé květy B F1: Bb (růžové květy) b F2: 9 (růžové květy) : 7 (bílé květy) B Genová interkce n úrovni metbolismu ntokynů b B b B b BB Bb BB Bb Bb bb Bb bb BB Bb BB Bb Bb bb Bb bb

10 28 Genové interkce EPISTÁZE - recesivní určitá lel jednoho genu potlčuje projev jiného genu Tvorb pigmentu potkn je podmíněn chromogenem C, episttická. > hyposttická. determinujícím enzym tyrosinsu CCBB CCBb CcBB CcBb Recesivní homozygoti (cc) netvoří melnin (lbíni) je ndřzený Brvu srsti podmiňuje gen B; černou lel B, hnědou b V prentální generci jsme křížili potkny s černou srstí s lbíny Stnovte fenotyp F1 generce fenotypové štěpné poměry F2 CCBb CCbb CcBb Ccbb generce CcBB CcBb ccbb ccbb F1 CcBb (černí) CcBb Ccbb ccbb ccbb F2 9:3:4 Genové interkce EPISTÁZE - recesivní 29 Geonové interkce DUPLICITNÍ INTERKCE jeden znk může být podmíněn různými geny k projevu stčí zprvidl 1 dominntní lel někdy se účinek sčítá kumultivní duplicitní interkce Kočárek, str

11 31 Polygenní dědičnost výsledný fenotyp je spolu se souhrou účinku několik genů modifikován vlivy vnějšího prostředí multifktoriální podmíněnost geny se nemusí ncházet n jednom chromosomu kvntittivně měřitelné znky jsou n příkld výšk váh člověk, brv kůže, hodnot IQ modely polygenní dědičnosti využívjí sttistické metody Gussovské rozložení shodný genotyp nemusí podmiňovt shodný fenotypový projev Heritbilit dědivost hodnocení podílu genetického podkldu n celkovém fenotypovém projevu h 2 = V g / V f V g - rozptyl genetický V f - rozptyl fenotypový rozptyl fenotypový je součet rozptylu genetického rozptylu, který vyvoljí vlivy prostředí hodnoty 0 h 2 1 studie n MZ dvojčtech Co bude indikovt nízká h 2? 32 Vzb genů B b b B Všechny geny, umístěné n jednom chromozomu tvoří vzbovou skupinu Počet vzbových skupin = počtu chromozomových párů Při tvorbě gmet lely jsou přenášené společně B b b B Nové kombince jen jko důsledek rekombinčního procesu 33

12 Vzb genů 34 Vzb genů 35 Vzb genů vznik rekombinovných gmet mlá prvděpodobnost čím jsou geny od sebe vzdálenější, tím je vyšší prvděpodobnost, že dojde k náhodnému zlomu mezi nimi čím jsou blíže, tím se prvděpodobnost snižuje podle četnosti gmet s rekombinovnou sestvou můžeme usuzovt n sílu vzby podle síly vzby pk lze zpětně sestvit chromozomovou mpu R p = x 100 (cm) N + R 36 p Morgnovo číslo = procento potomků s rekombinovnou sestvou lel R počet rekombinntních potomků N počet potomků s původní rodičovskou setvou lel

13 Morgnovo číslo Vypočítejte mpovou vzdálenost dvou genů B. Křížením dvojnásobného heterozygot (Bb) s dvojnásobným recesivním homozygotem (bb) bylo získáno potomstvo o následujícím rozložení: 80 jedinců mělo ob dominntní znky ( B ) 20 jedinců mělo dominntní znk recesivní znk b 20 jedinců mělo recesivní znk dominntní znk B 80 jedinců mělo ob recesivní znky ( b ) 1. K jednotlivým fenotypům potomků doplníme genotypy vyplývjící z genotypů rodičů: fenotyp B b B b genotyp Bb bb Bb bb počet jedinců celkem 200 jedinců 37 Morgnovo číslo Vypočítejte mpovou vzdálenost dvou genů B. Křížením dvojnásobného heterozygot (Bb) s dvojnásobným recesivním homozygotem (bb) bylo získáno potomstvo o následujícím rozložení: 80 jedinců mělo ob dominntní znky ( B ) 20 jedinců mělo dominntní znk recesivní znk b 20 jedinců mělo recesivní znk dominntní znk B 80 jedinců mělo ob recesivní znky ( b ) 2. Údje dosdíme do vzorce vypočteme Morgnovo číslo: R p = x 100 = x 100 = x 100 = 20 cm N + R Morgnovo číslo Vypočítejte mpovou vzdálenost dvou genů B. Křížením dvojnásobného heterozygot (Bb) s dvojnásobným recesivním homozygotem (bb) bylo získáno potomstvo o následujícím rozložení: 20 jedinců mělo ob dominntní znky ( B ) 80 jedinců mělo dominntní znk recesivní znk b 80 jedinců mělo recesivní znk dominntní znk B 20 jedinců mělo ob recesivní znky ( b ) 39

14 Síl vzby Btesonovo číslo c 1 udává, kolikrát čstěji jsou v souboru zstoupeny gmety s původními genotypy proti rekombinovným Morgnovo číslo p 2 určuje poměr zstoupení rekombinovných gmet k celému gmetickému souboru 40 Johnn Gregor Mendel ( ) byl mnich, zkldtel genetiky opt ugustiniánského klášter v Brně studium n Filozofické fkultě v Olomouci, Vídeňské univerzitě věnovl křížení hrchu sledování potomstv formulce prvidel Mendelovy zákony dědičnosti. 41 Mendelovy zákony dědičnosti 1) O uniformitě první filiální generce identitě recipročních křížení Při křížení dominntního recesivního homozygot jsou jedinci 1.filiální generce jednotní (uniformní) Reciproční křížení mjí stejný výsledek (nezáleží, který znk předává otec který mtk). 2) Při vzájemném křížení heterozygotů vzniká potomstvo genotypově různorodé, přičemž poměrné zstoupení homozygotů heterozygotů je prvidelné stálé. 42 3) O volné kombinovtelnosti lel různých lelových párů Při zrání gmet se kombinují lely jednotlivých genů vzájemně nezávisle, tj. podle prvidel počtu prvděpodobnosti.

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace Pojmy k zpmtování Gen -část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN Gen je různě dlouhá sekvence nukleotidů Gen je jednotk funkce



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků


genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat


Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat


Virtuální svět genetiky 1

Virtuální svět genetiky 1 Chromozomy obshují mnoho genů pokud nejsou rozděleny crossing-overem, pk lely přítomné n mnoh lokusech kždého homologního chromozomu segregují jko jednotk během gmetogeneze. Rekombinntní gmety jsou důsledkem


- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


žádný c.o. NCO ABC dva c.o. DCO AbC dva c.o. DCO abc žádný c.o. NCO abc žádný c.o. NCO ABC jeden c.o. SCO Abc jeden c.o. SCO abc žádný c.o.

žádný c.o. NCO ABC dva c.o. DCO AbC dva c.o. DCO abc žádný c.o. NCO abc žádný c.o. NCO ABC jeden c.o. SCO Abc jeden c.o. SCO abc žádný c.o. Rekominční mpování B C B C c c gmety žádný c.o. NCO BC dv c.o. DCO C dv c.o. DCO Bc žádný c.o. NCO c B C B C c c žádný c.o. NCO BC jeden c.o. SCO c jeden c.o. SCO BC žádný c.o. NCO c Tříodové mpování u


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865


Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus


Druhová a mezidruhová hybridizace

Druhová a mezidruhová hybridizace Druhová a mezidruhová hybridizace Obsah Druhová a mezidruhová hybridizace... 1 Obsah... 1 Monohybridní křížení... 1 Dihybridní křížení... 2 Polyhybridní křížení... 3 Souhrn Mendelismus v dědičnosti kvalitativních


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém


Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


Genetická determinace zbarvení vlasů u člověka. Genetická determinace zbarvení očí u člověka

Genetická determinace zbarvení vlasů u člověka. Genetická determinace zbarvení očí u člověka Genetická determinace zbarvení vlasů u člověka Genetická determinace zbarvení očí u člověka znaky polygenní, které však při studiu dědičnosti v rodinách vykazují zdánlivě jednoduchou dědičnost výzkumem


Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické



GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto


13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu


Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA



MENDELOVSKÁ DĚDIČNOST MENDELVSKÁ DĚDIČNST Mendelovská dědičnost - pojmy k zpmtování Gen část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN různě dlouhá sekvence


Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.


Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 Mutace Mutace - náhodná změna v genomu organismu - spontánní


Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci


Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že


Genová vazba. Obr. č. 1: Thomas Hunt Morgan

Genová vazba. Obr. č. 1: Thomas Hunt Morgan Genová vazba Jednou ze základních podmínek platnosti Mendelových zákonů je lokalizace genů, které podmiňují různé vlastnosti na různých chromozómech. Toto pravidlo umožňuje volnou kombinovatelnost genů


Příbuznost a inbreeding

Příbuznost a inbreeding Příbuznost a inbreeding Příbuznost Přímá (z předka na potomka). Souběžná (mezi libovolnými jedinci). Inbreeding Inbrední koeficient je pravděpodobnost, že dva geny přítomné v lokuse daného jedince jsou


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák MENDELISMUS Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák 1822-1884 In the ten years G. Mendel worked on his plants in the garden of the monastery, he made the greatest discovery in biology that


GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních


Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetik Ústv biologie lékřské genetiky.lf UK VFN, Prh Polymorfismy lidské DN vyu ívné ve vzebné nlýze, p ímé nep ímé dignostice Mikrostelity (syn. krátké tndemové repetice) STR short tndem


Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika


Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje



GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky


Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií

Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Obecná genetika Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Ing. Roman Longauer, CSc. Ústav zakládání a pěstění lesů, LDF MENDELU Brno Tento projekt je spolufinancován Evropským


Souhrn základních výpočetních postupů v Excelu probíraných v AVT 04-05 listopad 2004. r r. . b = A

Souhrn základních výpočetních postupů v Excelu probíraných v AVT 04-05 listopad 2004. r r. . b = A Souhrn zákldních výpočetních postupů v Ecelu probírných v AVT 04-05 listopd 2004. Řešení soustv lineárních rovnic Soustv lineárních rovnic ve tvru r r A. = b tj. npř. pro 3 rovnice o 3 neznámých 2 3 Hodnoty


Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním


GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných


Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010


Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým


Imunologie krevní skupiny 109.3059

Imunologie krevní skupiny 109.3059 Imunologie krevní skupiny 109.3059 Strana 1 z 22 SIMULAČNÍ SOUPRAVA PRO AB0 & Rh TYPIZACI KRVE Strana 2 z 22 SOMERSET educational (Pty) LTD SIMULOVANÉ SOUPRAVY PRO STANOVENÍ KREVNÍ SKUPINY AB0 a Rh FAKTORU



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,


-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě Otázka: Genetika I Předmět: Biologie Přidal(a): Paris -věda, která se zabývá dědičností a proměnlivostí -zakladatelem je Johan Gregor Mendel (1822 1884), který se narodil v Hynčicích na Moravě 1. MOLEKULÁRNÍ


S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef



MENDELOVY A MORGANOVY ZÁKONY AUTOSOMÁLNÍ DĚDIČNOST MENDELOVY MORGNOVY ZÁKONY UTOSOMÁLNÍ DĚDIČNOST Přenos rodičovskýh lel n potomky nutné odlišovt pojmy dominne reesivit (jde o vzth mezi lelmi v rámi lelového párů) od pojmů dominntní, resp. reesivní dědičnost


Základy teorie matic

Základy teorie matic Zákldy teorie mtic 1. Pojem mtice nd číselným tělesem In: Otkr Borůvk (uthor): Zákldy teorie mtic. (Czech). Prh: Acdemi, 1971. pp. 9--12. Persistent URL: Terms of use: Akdemie


Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)


Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho



GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností


9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů

9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů 9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou


VY_32_INOVACE_11.18 1/6 Genetika Genetika

VY_32_INOVACE_11.18 1/6 Genetika Genetika 1/6 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


Zvyšování kvality výuky technických oborů

Zvyšování kvality výuky technických oborů Zvyšování kvality výuky technických oborů Klíčová aktivita V.2 Inovace a zkvalitnění výuky směřující k rozvoji odborných kompetencí žáků středních škol Téma V.2.18 Dřeviny Kapitola 2 Rozmnožování rostlin


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


3.2.11 Obvody a obsahy obrazců I

3.2.11 Obvody a obsahy obrazců I ..11 Obvody obshy obrzců I Předpokldy: S pomocí vzorců v uvedených v tbulkách řeš následující příkldy Př. 1: Urči výšku lichoběžníku o obshu 54cm zákldnách 7cm 5cm. + c Obsh lichoběžníku: S v Výšk lichoběžníku



21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským


=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům

=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům Otázka: Genetika Předmět: Biologie Přidal(a): t.klodnerova REALIZACE GENETICKÉ INFORMACE, MUTACE, ZÁKLADNÍ GENETICKÉ POJMY: GEN, ZNAK, ALELA, GENOTYP, FENOTYP, HOMOZYGOT, HETEROZYGOT, HYBRIDIZACE, DOMINANCE,


5.1.5 Základní vztahy mezi body přímkami a rovinami

5.1.5 Základní vztahy mezi body přímkami a rovinami 5.1.5 Zákldní vzthy mezi body přímkmi rovinmi Předpokldy: 510 Prostor má tři rozměry, skládá se z bodů. Přímk - jednorozměrná podmnožin prostoru (množin bodů) Rovin - dvojrozměrná podmnožin prostoru (množin


Využití algebraických hyperstruktur při určování dědičnosti krevních skupin

Využití algebraických hyperstruktur při určování dědičnosti krevních skupin PWSZ Nowy SĄcz Zeszyty Naukowe PWSZ NS, Nowy SĄcz 2013 Využití algebraických hyperstruktur při určování dědičnosti krevních skupin Eva Bártková 1, David Nocar 2, Květoslav Bártek 3 1 Katedra matematiky


RURGenetika zápočtový program Programování II

RURGenetika zápočtový program Programování II RURGenetika zápočtový program Programování II Rudolf Rosa cvičící: Doc. RNDr. Pavel Töpfer, CSc. Obsah Specifikace...1 Původní specifikace...1 Upravená specifikace...2 Program...3 třída Populace...4 Datové


Psychologická metodologie. NMgr. obor Psychologie

Psychologická metodologie. NMgr. obor Psychologie Pržská vysoká škol psychosociálních studií, s.r.o. Temtické okruhy ke státní mgisterské zkoušce Psychologická metodologie NMgr. oor Psychologie 1 Vědecká teorie vědecká metod Vědecké vysvětlení, vědecký


Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická


Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21

Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21 Glosář - Cestina alely aneuploidie asistovaná reprodukce autozomálně dominantní autozomálně recesivní BRCA chromozom chromozomová aberace cytogenetický laborant de novo Různé formy genu, které se nacházejí


GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu


KBI/GENE Mgr. Zbyněk Houdek

KBI/GENE Mgr. Zbyněk Houdek Genealogie KBI/GENE Mgr. Zbyněk Houdek Rodokmenové schéma Shromáždění informací o rodině je 1. důležitým krokem v genetickém poradenství. Rodokmenové schéma musí být srozumitelné a jednoznačné. Poskytuje


Heritabilita. Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability

Heritabilita. Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability Heritabilita Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability h 2 = V A / V P Výpočet genetické determinance znaku h 2 = V G / V P Heritabilita závisí


Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů

Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů Imunogenetika Vědní odvětví zabývající se imunitním systémem obratlovců, který je výrazně odlišuje od nižších organizmů se nazývá imunologie. Její náplní je zejména studium imunity mechanizmů stálosti



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Zkoumání přírody. Myšlení a způsob života lidí vyšší nervová činnost odlišnosti člověka od ostatních organismů

Zkoumání přírody. Myšlení a způsob života lidí vyšší nervová činnost odlišnosti člověka od ostatních organismů Předmět: PŘÍRODOPIS Ročník: 9. Časová dotace: 1 hodina týdně Výstup předmětu Rozpracované očekávané výstupy Učivo předmětu Přesahy, poznámky Konkretizované tématické okruhy realizovaného průřezového tématu


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání


METODICKÉ LISTY Z MATEMATIKY pro gymnázia a základní vzdělávání

METODICKÉ LISTY Z MATEMATIKY pro gymnázia a základní vzdělávání METODICKÉ LISTY Z MATEMATIKY pro gymnázi zákldní vzdělávání Jroslv Švrček kolektiv Rámcový vzdělávcí progrm pro zákldní vzdělávání Vzdělávcí oblst: Mtemtik její plikce Temtický okruh: Nestndrdní plikční


GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D.

GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D. GENETIKA Mendelistická dědičnost 2014 Doc. MVDr. Eva Bártová, Ph.D. Nauka o DĚDIČNOSTI (HEREDITA) a PROMĚNLIVOSTI (VARIABILITA) termín genetika poprvé použil v r. 1905 W. BATESON název genetika odvozen
