Praktický kurz. Moderní biofyzikální přístupy v experimentální biologii

Rozměr: px
Začít zobrazení ze stránky:

Download "Praktický kurz. Moderní biofyzikální přístupy v experimentální biologii"

Transkript

1 Oddělení funkční genomiky a proteomiky Ústav experimentální biologie, Přírodovědecká fakulta Masarykova univerzita Praktický kurz Moderní biofyzikální přístupy v experimentální biologii Místo konání: Brno, Univerzitní kampus Bohunice blok A2, seminární místnost 1.21 Datum: Začátek vždy v 9:00 Vedoucí kurzu: Mgr. Ctirad Hofr Ph.D Kurz je organizován v rámci projektu OP VK Moderní biofyzikální metody: pokročilé vzdělávání v experimentální biologii registrační číslo CZ.1.07/2.3.00/

2 Měření spektrálních charakteristik a stanovení koncentrace DNA a proteinů Spektroskopie v UV oblasti umožňuje stanovit koncentraci a čistotu biologických molekul. Molekuly DNA mají absorpční maximum kolem 260 nm, molekuly proteinů kolem 280 nm. Pro přímé spektrální určení koncentrace se využívá Lambert-Beerova zákona pro monochromatické světlo, který lze zapsat ve tvaru A = c.ε za předpokladu, že měříme v 1 cm kyvetě a známe extinkční koeficient ε, který má jednotku [M -1 cm -1 ] pro molární koncentraci nebo [ml.mg -1 cm -1 ] pro koncentraci v mg/ml. V případě, že neznáme extinkční koeficient, můžeme pro určení koncentrace DNA o vysoké molekulární hmotnosti použít zjednodušeného předpokladu, že roztok dvouřetězcové DNA o absorbanci 1 má koncentrací 50 µg/ml a pro převod na molární koncentraci nukleotidu DNA pak vztah 320 µg/ml = 1 mm. Pro určení koncentrace proteinů spektroskopicky lze využít absorbance proteinů při 280 nm. Jestliže známe primární sekvenci aminokyselin proteinu, lze extinkční koeficient vypočítat změřené absorbance pak určíme koncentraci proteinu. Znalost extinkčního koeficientu není nutná v případě univerzální Bradfordové metody. Bradfordové metoda je v současnosti nejrozšířenější způsob určování koncentrace proteinu. Bradfordové metoda využívá posunu absorpčního maxima Coomasie Blue po vazbě na protein. Za použití kalibrační křivky se známou koncentrací proteinu lze určit skutečnou koncentraci neznámého proteinu nebo směsi proteinů. Materiál DNA (Salmon sperm) Oligonukleotid CNF2_Bot (5 GTTATCCTTTGAGGGTTTAG) BSA (hovězí sérový albumin; = ml mg -1 cm -1, MW = 66430) TE pufr Bardford reagent (BioRad) Kyvety a spektrofotometr DNA 1. Připravte roztok DNA v TE pufru ze zásobního roztoku o přibližné koncentraci 7,5 mg/ml tak, aby bylo možno přesně určit koncentraci DNA. 2. Změřte absorpční spektrum DNA v rozsahu vlnových délek 220 až 350 nm. 3. Určete polohu absorpčního maxima. 4. Stanovte přesnou koncentraci DNA v zásobním roztoku z hodnoty absorbance naředěného roztoku při 260 nm. Koncentraci vyjádřete v mg/ml a v OD/mL. 5. Nařeďte roztok oligonukleotidu v TE pufru ze zásobního roztoku o přibližné koncentraci 0,02 mg/ml tak, aby bylo spektroskopicky možno přesně stanovit jeho koncentraci. 6. Na základě zadané sekvence oligonukleotidu stanovte extinkční koeficient 260 a spektroskopicky určete jeho koncentraci. 7. Porovnejte spektrum oligonukleotidu se spektrem fluorescenčně značeného oligonukleotidu v rozsahu vlnových délek 220 až 600 nm.

3 Protein UV spektroskopie 1. Připravte roztok BSA v TE pufru ze zásobního roztoku o přibližné koncentraci 10 mg/ml tak, aby bylo možno přesně určit koncentraci BSA. 2. Změřte absorpční spektrum BSA v rozsahu vlnových délek 240 až 350 nm. 3. Určete polohu absorpčního maxima. 4. Stanovte přesnou molární koncentraci BSA v zásobním roztoku z hodnoty absorbance naředěného roztoku při 280 nm. Bradfordové metoda 1. Připravte standardní kalibrační křivku pro měření koncentrace proteinu Bradfordové metodu. 2. Změřte koncentraci BSA pomocí této metody. 3. Vezměte roztok reakčního Bradfordové činidla z lednice a nechte jej zahřát na pokojovou teplotu a promíchejte. 4. Připravte roztoky blanku a standardů BSA o celkovém objemu 1mL do mikrozkumavek tak, že do 980 µl reakčního Bradfordové činidla přidejte vždy 20 µl TE pufru nebo 20 µl mg/ml, 0.25 mg/ml, 0.5 mg/ml, 0.75 mg/ml, 1 mg/ml a 1.5 mg/ml standardů. Současně připravte stejným způsobem roztok neznámého vzorku. 5. Všechny roztoky dobře promíchejte a nechte inkubovat 5 min při pokojové teplotě. Inkubace by neměla přesáhnout 1h. 6. Nastavení spektrofotometru Protein assay Bradford STD Curve Units: mg/ml tlačítko MORE Create table vypsat hodnoty koncentrací standardů od nejmenší Entry Done Změřte absorbanci blanku Změřte absorbanci roztoku standardů. Při měření postupujte od nejnižší koncentrace standardu k nejvyšší. Po posledním standardu se vytvoří kalibrační křivka. 7. Změnit rovnici: Next formula Entry Done 8. Změřit absorbanci blanku, jednoho standardu (pro kontrolu) a poté neznámého vzorku a pomocí kalibrační křivky určete jeho koncentraci. 9. Porovnejte hodnoty koncentrace zásobního roztoku BSA určené spektroskopicky při 280 nm a pomocí Bradfordové metody.

4 Vlastní fluorescence proteinů Vlastní fluorescenci proteinů je způsobena aromatickými aminokyselinami v nich obsaženými: tryptofanem (Trp), tyrozinem (Tyr) a fenylalaninem (Phe). Dominující je fluorescence tryptofanu, naopak prakticky vůbec se neuplatňuje fenylalanin. V této úloze jsou změřena fluorescenční excitační a emisní spektra albuminu a čistého tryptofanu, tyrozinu a fenylalaninu. Vlastnosti L-tryptofanu MW = 204,23 absorpční maximum: λ exmax = 295 nm fluorescenční emisní maximum: λ emmax = 353 nm emise Trp je vysoce závislá na polaritě a okolním prostředí Vlastnosti L-tyrozinu MW = 181,19 absorpční maximum: λ exmax = 275 nm fluorescenční emisní maximum: λ emmax = 304 nm emise Tyr je relativně málo citlivá na polaritu rozpouštědla Vlastnosti L-fenylalaninu MW = 165,19 absorpční maximum: λ exmax = 260 nm fluorescenční emisní maximum: λ emmax = 282 nm emise Phe je strukturovaná Fluorescence proteinů je obvykle excitována při 280 nm nebo při delších vlnových délkách, takže fenylalanin není ve většině experimentů excitován. Navíc je kvantový výtěžek fluorescence Phe velmi malý (kolem 0,02). Tryptofanovou fluorescenci v proteinech lze selektivně excitovat při nm. Materiál L-tryptofan (Applichem), L-tyrozin (Applichem), L-fenylalanin (Applichem) Hovězí sérový albumin (MW = 69000) pufr A (120 mmol/l NaCl, 10 mmol/l KCl, 30 mmol/l Tris HCl, ph 7,4) skleněné zkumavky, mikropipety, Postup 1. Připravte zásobní roztoky 10 mm Trp, 2 mm Tyr, 10 mm Phe a 0,25 mmol/l albuminu v pufru A. 2. Pro vlastní měření je nařeďte pufrem A na koncentrace 5 µμ Trp, 20 µm Tyr, 200 µm Phe a 0.6 µm albuminu. 3. Změřte excitační a emisní spektra vzorků za podmínek uvedených v tabulce.

5 excitační spektrum emisní spektrum λ em (nm) λ ex (nm) λ ex (nm) λ em (nm) L-tryptofan L-tyrozin L-fenylalanin albumin Výsledky Změřená excitační a emisní spektra vlastní fluorescence tryptofanu (Trp), tyrozinu (Tyr), fenylalaninu (Phe) a albuminu v pufru A jsou na Obr.1 a Obr 2. Z výsledných spekter je zřejmé, že prakticky veškerá vlastní fluorescence albuminu pochází od tryptofanu. Měření byla provedena na spektrofluorometru FluoroMax-4. Intenzita fluorescence 1.2x x x x x x PHE ALB TRP TYR λ (nm) Obr. 1 Excitační spektra 5 µm Trp (λ em = 350 nm), 20 µm Tyr (λ em = 300 nm), 200µM Phe (λ em = 280 nm) a 0.6 µm albuminu (λ em = 350 nm). 1.2x x10 6 ALB TRP Intenzita fluorescence 8.0x x x x10 5 PHE TYR λ (nm) Obr. 2 Emisní spektra 5 µm Trp (λ ex = 280 nm), 20 µm Tyr (λ ex = 270 nm), 200 µm Phe (λ ex = 250 nm) a 0.6 µm albuminu (λ ex = 280 nm).

6 Vliv ph a teploty na spektrální vlastnosti fluoroforů V tomto experimentu je ukázán vliv ph na fluorescenci a absorpci fluorescenční značky fluoresceinu rozpuštěné ve stejné koncentraci v roztocích o různém ph. Je rovněž demonstrován vliv teploty na intenzitu fluorescence. Materiál fluorescein - NIST-traceable standard - 50 µm (Molecular Probes, Invitrogen) mikrokyveta pufr 5 (20 mm MES, ph 5.0) pufr 7 (50 mm fosfát sodný, ph 7.0) pufr 9 (12.5 mm boritan sodný/kys. boritá, ph 9.0) spektrofluorometr vybavený kryostatem (chlazenou vodní lázní) Postup 1. Připravte vzorky fluoresceinu 1000x naředěním roztoku NIST standardu jeho přidáním 1,5 µl do 1499 µl roztoku pufru 5, pufru 7 a pufru Změřte excitační spektra vzorků při λ(em) = 515 nm 3. Změřte emisní spektra vzorků při λ(ex) = 488 nm 4. Změřte spektra při 20, 25 a při 37 C. F.I. (s 3/3 nm) 1,8x10 6 1,6x10 6 1,4x10 6 1,2x10 6 1,0x10 6 8,0x10 5 6,0x10 5 4,0x10 5 2,0x10 5 0, λ (nm) ph7 ph5 Obr. 1. Vliv ph na excitační a emisní spektrum fluoresceinu. Výsledky Při změně pufru z ph 7 na ph 5 a při zvýšení teploty dochází ke snížení intenzity fluorescence fluoresceinu.

7 Fluorescenční značení proteinu Fluorescenční značení proteinu bude provedeno za použití soupravy Alexa Fluor 594 Protein Labeling Kit. Proteiny značené tímto fluoroforem vykazují excitační maximum 590 nm a emisní maximum 617 nm. Alexa Fluor 594 je ve formě NHS (sukcinimidyl) esteru viz Obr. 1. Za použití následujícího postupu lze fluorescenčně naznačit 0.1 až 1 mg proteinu. Příprava proteinu Obr. 1 AlexaFluor 594 Pro optimální efektivitu značení by měl být protein ve fosfátovém pufru bez amonných inontů a primárních aminů. V případě, že protein je v jiném pufru (Trisový, glycinový), je možno dialýzou pufr změnit. Výsledná koncentrace roztoku proteinu na značení by měla být 2 mg/ml. Materiál Alexa Fluor 594 Mikrozkumavka s magnetickým míchadlem Roztok proteinu ve fosfátovém pufru (Thyroglobulin, MW = , extinkční koeficient ε = M -1 cm -1, zásobní koncentrace 10 mg/ml) 1M roztok hydrogenuhličitanu sodného (NaHCO 3, MW = 84), 1ml Fosfátový pufr (50 mm NaCl, 50 mm fosfát sodný) Kolona s náplní Sephadex G-25 Značení proteinu 1. Do mikrokyvety napipetujte 50 µl roztoku proteinu (c= 10 mg/ml). Jestliže je koncentrace proteinu vyšší než 2 mg/ml, roztok se naředí přidáním fosfátového pufru na výslednou koncentraci 2 mg/ml. 2. (Zkumavku s fluorescenční značkou nechte zahřát na laboratorní teplotu. Přidejte 100 µl 1M NaHCO 3 a promíchejte pipetováním nahoru a dolů.) Odpipetujte 50 µl roztoku fluorescenční barvičky do mikrozkumavky s proteinem a promíchejte pipetováním nahoru a dolů. 3. Vše nechte míchat v mikrozkumavce s magentickým míchadlem po dobu 30 minut při laboratorní teplotě.

8 minut před koncem inkubace připravte kolonu pro separaci proteinu a nenavázané fluorescenční značky. Purifikace proteinu Náplň kolony Sephadex G-25 umožňuje gelovou filtrací oddělit nenavázanou fluorescenční značku od proteinu podle rozdílné velikosti a molekulové hmotnosti. 1. Kolonu umístěte do stojánku, odstraňte víčko a zátku a nechte obsah kolony vykapat. 2. Promyjte kolonu 5 ml fofátového pufru. 3. Opatrně naneste reakční směs proteinu a značky pipetou do středu kolony. Použijte 100 µl fosfátového pufru k vypláchnutí mikrozkumavky s reakční směsí a opět naneste na kolonu. Roztok nechte zaputovat do kolony. 4. Po 1 ml přidávejte fosfátový pufr. Postupně jímejte frakce vytékající z kolony do mikrozkumavek po 1 ml. Po cca 2-3 ml začíná vytékat značený protein. Zachyťte značený protein do jedné frakce. 5. Vzorek (frakci se zachyceným značeným proteinem) proměřte na spektrofotometru. Na základě absorpčního spektra určete, jaké množství proteinu bylo naznačeno a jaký je stupeň značení. Nastavení spektrofotometrů: NanoDrop: Functions Wave scan interval vlnových délek ( nm) vložte kyvetu s blankem Blank vložte kyvetu se vzorkem Sample Options Graph scale upravit rozsah osy y, aby byly píky viditelné Helios: Scan Start (260 nm) Stop (600 nm) Bandwidth (2 nm) Blank vložte kyvetu s blankem Zero base vložte kyvetu se vzorkem Run Manipulate Track molární množství značky ku molárnímu množství proteinu = A 590 ředění Cm kde je molární extinkční koeficient značky Alexa Fluor 594 při 590 nm a Cm molární koncentrace proteinu

9 Fluorescenční stanovení koncentrace DNA Určení koncentrace DNA je často základním krokem při analýze biologického materiálu a je součástí mnoha laboratorních protokolů. Znalost přesné koncentrace DNA je důležitá pro celou řadu technik (např. sekvenování, klonování cdna, transkripce RNA). Koncentrace DNA je nejčastěji měřena UV spektroskopií, určením hodnoty absorbance při 260 nm (Abs 260 = 1 pro dvouřetězcovou DNA o koncentraci 50 µg/ml; v 1 cm kyvetě). Ke kvantifikaci nižších koncentrací DNA, než jsou detekovatelné za použití UV spektroskopie lze použít fluorescenční sondy, které se vážou na dvouřetězcovou DNA a vykazují několikanásobný nárust intenzity fluorescence po navázání. K sondám, které lze použít ke stanovení koncentrace DNA patří GelStar. Tato fluorescenční sonda má excitační maximum kolem 493 nm a emituje v oblasti 530 nm. Materiál Spektrofluorometr Mikrokyveta (2 ml) Roztok DNA (Salmon sperm) GelStar (10000x) 1X TE pufr Destilovaná voda Příprava roztoků 1 X TE: 10 mm Tris-HCl 1 mm EDTA ph 8,0 100x GelStar 2 µl zásobního x koncentrovaného roztoku GelStar naředit na objem 200 µl 1x TE pufrem Standardní roztok DNA Abs 260 = 0,378 koncentrace =? Vytvoření standardní křivky 1. Připravit následná ředění roztoku DNA v 1X TE s koncentrací: 5 ng/µl, 2,5 ng/µl, 1,25 ng/µl, 0,625 ng/µl, 0,3125 ng/µl po 1mL)

10 2. Připravit blank: 1 ml 1x TE pufru 3. Přidat vždy 20 µl 100x GelStar roztoku a 980 µl 1xTE pufru ke každé koncentraci 1mL standardního roztoku DNA a blanku. Promíchat a pipetovat do mikrokyvety. Celková koncentrace DNA standardu v kyvetě je nyní poloviční (2,50, 1,25,... ng/ µl) 4. Všechny standardy a vzorky s GelStar uchovejte v temnu až do měření. 5. Zapněte spektrofluorometr podle návodu. 6. Spusťte program Logger Pro Změřte intenzitu fluorescence Experiment Change units Spectrometer Fluorescence excitační vlnová délka 8. Změřte nejdříve intenzitu fluorescence blanku, následně standardy: Vložte kyvetu, měření spustíte tlačítkem Collect a zastavíte Stop 9. Hodnoty intenzity zapište do tabulky a vyneste do grafu hodnoty intenzity fluorescence standardů na koncentraci vzorku. Měření neznámého vzorku 1. Nařeďte neznámý vzorek v 1x TE na celkový objem 1mL. 2. Přidejte 20 µl 100x GelStar a 980 µl 1xTE pufru. 3. Změřte intenzitu fluorescence neznámého vzorku. 4. Určete podle standardní křivky koncentraci DNA v neznámém vzorku. Výsledky Stanovení koncentrace DNA v neznámém vzorku.

11 Stanovení koncentrace DNA a RNA pomocí mikrofluorometru Materiál: Quant-iT dsdna BR Assay Kit, Quant-iT ssdna BR Assay Kit, Quant-iT RNA Assay Kit Standardy dsdna, ssdna a RNA Vzorek dsdna, ssdna a RNA o neznámé koncentraci Real-time PCR mikrozkumavky Mikrofluorometr Qubit (Invitrogen) Postup: 1. Připravte si cca 1 ml Working solution smícháním Quant-iT reagent a Quant-iT buffer v poměru 1:200 zvlášť pro ssdna, dsdna a RNA 2. Připravte standardy smícháním 190 µl Working solution + 10 µl příslušného standardu #1 a #2 3. Připravte vzorek o neznámé koncentraci ve dvou mikrozkumavkách smícháním 195 µl Working solution + 5 µl vzorku 4. Standardy i vzorky krátce promíchat na vortexu (2-3 sec), opatrně - ve vzorku nesmí být bublinky!! 5. Inkubace 5-10 minut při laboratorní teplotě 6. Zapnout Qbit fluorometr, vybrat příslušnou metodu, nová kalibrace (standardy), poté změřit neznámý vzorek (2 x 3 měření) 7. Jaké jsou koncentrace neznámých vzorků? Pozn.: Měření by mělo probíhat za laboratorní teploty (22-28 C). Teplota vzorků by měla být stejná, proto nedržte zkumavku se vzorkem před měřením dlouho v ruce, po každém měření zkumavku ihned vytáhněte z přístroje a mezi jednotlivými měřeními ji ponechte inkubovat alespoň 30 sec při laboratorní teplotě.

12 Vizualizace makromolekul při elektroforetické separaci Fluorescenční značení lze využít při sledování elektroforetické migrace makromolekul. V případě, že jsou protein a DNA naznačeny rozdílnou fluorescenční značkou, lze nezávisle detekovat polohu DNA a proteinů a sledovat jejich vzájemnou interakci. Materiál DNA fragment s navázanou fluorescenční značkou Rhodamin Red X (excitace 572 nm, emise 595 nm) protein s navázanou fluorescenční značkou Alexa Fluor 488 (excitace 496 nm, emise 519 nm) roztok akrylamidu 30% (akrylamid : bisakrylamid ~ 37:1) Upozornění: Akrylamid je neurotoxin. Je nutno pracovat v rukavicích! 5X TBE (450 mm Tris, 450 mm kys. boritá, 10 mm EDTA) 30% APS (ammonium persulfate) TEMED (N, N, N -tetramethylethylendiamin) Fosfátový pufr (50 mm NaCl, 50 mm fosfát sodný) ddh 2 O n-butanol nasycený vodou (45 ml n-butanolu smíchaný s 5 ml ddh 2 O) mikrozkumavky 6x nanášecí pufr (0.15% orange G, 60% glycerol, 10 mm Tris-HCl ph 7.6, 60 mm EDTA) aparatura pro horizontální elektroforézu fluorescenční scanner FLA-7000 Postup 1. Připravte směs pro horizontální akrylamidový gel tak, že smícháte odpovídající množství zásobního roztoku akrylamidu (neurotoxin!), 5X TBE a ddh2o, aby výsledná koncentrace akrylamidu byla 5 % v 0.25X TBE a celkový objem směsi byl 80 ml. Jednotlivé složky přidávejte v pořadí: ddh 2 O, 5x TBE, dále 400 µl 30% APS a 26,4 µl TEMED a až nakonec 30% akrylamid. Dobře promíchejte, nalijte do formy a nasaďte hřebínek na 10 jamek. Směs se po nalití do formy přelije vrstvou n-butanolu, aby mohlo dojít k polymeraci bez přístupu vzduchu. Nechte 1 hodinu polymerizovat na stole. 2. Připravte roztok fluorescenčně značené DNA ve fosfátovém pufru tak, aby byla jeho výsledná koncentrace 1,5 pmol/µl (zásobní DNA: vysušených 30 pmol) 3. Ze zásobního roztoku protein o koncentraci 3,6 pmol/µl odeberte 10 µl (do mikrozkumavky číslo 9). Připravte roztok fluorescenčně značeného proteinu ve fosfátovém pufru tak, aby byla jeho koncentrace 3 pmol/µl. 4. Připravte vzorky do mikrozkumavek podle následující tabulky bez přídavku nanášecího pufru:

13 zkumavka číslo: pouze DNA DNA : protein 1:2 1:4 1:6 1:8 1:12 1:16 1:20 1:24 DNA (1,5 pmol/μl) protein (3 pmol/μl) * 1 pouze protein fosfátový pufr x nanášecí pufr * ze zásobního roztoku proteinu o koncentraci 3,6 pmol/μl 5. Nechte 10 minut inkubovat za laboratorní teploty. 6. Sestavte aparaturu pro horizontální elektroforézu a naplňte ji 0.25X TBE pufrem (cca 1,5 l). 7. Ke každému vzorku přidejte 6x nanášecí pufr podle tabulky. 8. Vložte gel do elektroforetické vany. 9. Naneste vzorky na gel v pořadí jako je v tabulce. 10. Spusťte elektroforézu při napětí 40 V. Po 30 minutách zvyšte napětí na 80 V a nechte pokračovat dalších 60 minut. 11. Detekujte fluorescenci značené DNA na fluorescenčním scanneru s nastavením budícího záření a detekčního filtru na Rhodamin red-x [ROX]. 12. Detekujte fluorescenci značeného proteinu na fluorescenčním scanneru s nastavením budícího záření a detekčního filtru na Alexa fluor [FITC]. 13. Porovnejte obě výsledná zobrazení a určete oblasti, ve kterých se vyskytují komplexy vzniklé vazbou proteinu na DNA. Obr. 1 Příklad překryvu zobrazení při různém fluorescenčním značení DNA a proteinu

14 Studium vazby molekul za použití anizotropie fluorescence Změna anizotropie fluorescence je používána při popisu vzájemné interakce molekul. V případě, že se fragment DNA s fluorescenční značkou volně pohybuje (rotuje) v roztoku, je pozorovaná anizotropie relativně nízká. V případě, že dojde ke vzniku komplexu DNA a proteinu, dochází k výraznému snížení pohyblivosti DNA s fluorescenční značkou, což má za následek zvýšení anizotropie fluorescence. Při titrování roztoku fluorescenčně značené DNA roztokem DNA-vazebného proteinu dochází k postupné vazbě molekul proteinu na vazebná místa jednotlivých molekul DNA a tedy k postupnému zvyšování anizotropie fluorescence. Protein se na vazebná místa na DNA váže až do okamžiku, kdy je koncentrace proteinu tak vysoká, že jsou všechny molekuly DNA obsazeny. V tomto momentě anizotropie fluorescence dosáhne maximální hodnoty a přestane se dále zvyšovat. Koncetrace proteinu, při které hodnota anizotropie fluorescence tvoří 50 % maximální hodnoty, se nazývá disociační konstanta (Kd). Ta reprezentuje afinitu (sílu vazby) konkrétního proteinu k DNA. Studium změn Kd v závislosti např. na iontové síle či teplotě umožňuje získat cenné poznatky o povaze komplexu protein-dna a o mechanismu, jakým spolu obě makromolekuly interagují. Materiál 30 pmol vysušeného fragmentu DNA (GTTAGG) 4 značeného Rhodaminem Red X (λ ex = 572, λ em = 591 nm) Roztoky proteinu (lidský telomer-vazebný protein TRF1, MW = 110 kda) o koncentracích 1µM a 20µM Pufr P (20mM HEPES, 180mM KCl, 0,1mM EDTA, 3mM MgCl 2, ph 8.0) 1M DTT Spektrofluorometr vybavený polarizátory pro měření anizotropie fluorescence Mikrokyveta s magnetickým míchadlem

15 Postup 1) Resuspendovat vysušenou DNA v 1,5 ml pufru P a důkladně vortexovat. Výsledná koncentrace DNA bude 20nM. 2) Pufrem P naředit resuspendovanou DNA na 2nM, resp. 10nM roztok o objemu 1,5 ml. Přidat 1.5 µl 1M DTT. Roztok přenést do kyvety. Kyvetu při manipulaci odzátkovávat jen na nezbytně dlouhou dobu, aby bylo zamezeno vnášení částic prachu do vzorku. 3) Na fluorimetru 5x změřit anizotropii fluorescence pomocí funkce batch experiment a nastavení uloženém v souboru./redx_titrator/p0.xml (λ ex = 572 nm, λ em = 591 nm, šířka štěrbin 8/8 nm). Hodnoty anizotropie zaznamenat do tabulky v software SigmaPlot. 4) Postupně přidávat 1µM roztok proteinu tak, aby celkový objem přidaného roztoku byl 3, 5, 10, 20 a 50 µl. Po každém přídavku 5x změřit hodnotu anizotropie fluorescence a zaznamenat do tabulky v software SigmaPlot. 5) Postupně přidávat 20 µm roztok proteinu tak, aby celkový objem přidaného roztoku byl 3, 5, 10 a 20 µl. Po každém přídavku 5x změřit hodnotu anizotropie fluorescence a zaznamenat v software SigmaPlot. 6) V software SigmaPlot provést úpravu hodnot anizotropie na změnu objemu po přídavku roztoků proteinu. 7) Pomocí software SigmaPlot vynést do grafu závislost korigovaných hodnot anizotropie fluorescence na koncentraci přidaného proteinu. 8) Pomocí software SigmaPlot analyzovat křivku vazby proteinu a stanovit disociační konstantu Kd. Kd = 17 ± 1 nm Obr. 1. Závislost anizotropie fluorescence značeného fragmentu DNA na koncentraci proteinu.

Pokročilé biofyzikální přístupy v experimentální biologii

Pokročilé biofyzikální přístupy v experimentální biologii Molekulální komplexy chromatinu CEITEC, Masarykova univerzita Praktický kurz Pokročilé biofyzikální přístupy v experimentální biologii Místo konání: Brno, Univerzitní kampus Bohunice blok A2, seminární

Více

Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách

Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách Teorie Stanovení celkových proteinů Celkové množství proteinů lze stanovit pomocí několika metod; například: Hartree-Lowryho

Více

Obsah Protein Gel Electrophoresis Kitu a jeho skladování

Obsah Protein Gel Electrophoresis Kitu a jeho skladování Obsah Protein Gel Electrophoresis Kitu a jeho skladování Protein Gel Electrophoresis Kit obsahuje veškerý potřebný materiál provádění vertikální polyakrilamidové gelové elektroforézy. Experiment provádějí

Více

1. Příloha 1 Návod úlohy pro Pokročilé praktikum z biochemie I

1. Příloha 1 Návod úlohy pro Pokročilé praktikum z biochemie I 1. Příloha 1 Návod úlohy pro Pokročilé praktikum z biochemie I Vazba bromfenolové modři na sérový albumin Princip úlohy Albumin má unikátní vlastnost vázat menší molekuly mnoha typů. Díky struktuře, tvořené

Více

Praktický kurz Pokročilé biofyzikální přístupy v genomice a proteomice. 12.-13. května 2010

Praktický kurz Pokročilé biofyzikální přístupy v genomice a proteomice. 12.-13. května 2010 www.modernibiofyzika.cz Oddělení funkční genomiky a proteomiky Ústav experimentální biologie, Přírodovědecká fakulta Masarykova univerzita Praktický kurz Pokročilé biofyzikální přístupy v genomice a proteomice

Více

Pokročilé biofyzikální metody v experimentální biologii

Pokročilé biofyzikální metody v experimentální biologii Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 1/1 Proč biofyzikální metody? Biofyzikální metody využívají fyzikální principy ke studiu biologických systémů Poskytují kvantitativní

Více

Absorpční spektroskopie při biologické analýze molekul

Absorpční spektroskopie při biologické analýze molekul Absorpční spektroskopie při biologické analýze molekul Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 8.11.2007 7 1 UV spektroskopie DNA a proteinů Všechny atomy absorbují v UV oblasti

Více

2) Připravte si 3 sady po šesti zkumavkách. Do všech zkumavek pipetujte 0.2 ml roztoku BAPNA o různé koncentraci podle tabulky.

2) Připravte si 3 sady po šesti zkumavkách. Do všech zkumavek pipetujte 0.2 ml roztoku BAPNA o různé koncentraci podle tabulky. CVIČENÍ Z ENZYMOLOGIE 1) Stanovení Michaelisovy konstanty trypsinu pomocí chromogenního substrátu. Aktivita trypsinu se určí změřením rychlosti hydrolýzy chromogenního substrátu BAPNA (Nα-benzoyl-L-arginin-p-nitroanilid)

Více

Tkáňový homogenizátor MagNA Lyser od společnosti Roche

Tkáňový homogenizátor MagNA Lyser od společnosti Roche Izolace RNA Pracovní postup Homogenizace: Pozn. Postup homogenizace platí pouze pro izolaci RNA z nativní tkáně, v případě izolace z buněčné suspenze je tento krok vynechán a začíná se přídavkem homogenizačního

Více

SDS polyakrylamidová gelová elektroforéza (SDS PAGE)

SDS polyakrylamidová gelová elektroforéza (SDS PAGE) SDS polyakrylamidová gelová elektroforéza (SDS PAGE) Princip SDS polyakrylamidová gelová elektroforéza slouží k separaci proteinů na základě jejich velikosti (molekulové hmotnosti). Zahřátím vzorku za

Více

IZOLACE, SEPARACE A DETEKCE PROTEINŮ I. Vlasta Němcová, Michael Jelínek, Jan Šrámek

IZOLACE, SEPARACE A DETEKCE PROTEINŮ I. Vlasta Němcová, Michael Jelínek, Jan Šrámek IZOLACE, SEPARACE A DETEKCE PROTEINŮ I Vlasta Němcová, Michael Jelínek, Jan Šrámek Studium aktinu, mikrofilamentární složky cytoskeletu pomocí dvou metod: detekce přímo v buňkách - fluorescenční barvení

Více

SDS-PAGE elektroforéza

SDS-PAGE elektroforéza SDS-PAGE elektroforéza Příprava gelu... 1 Recept na 0.75 mm gel (1 gel/2 gely)... 2 Recept na 1.5 mm gel (1 gel/2 gely)... 2 Příprava vzorku... 3 Elektroforéza... 3 Barvení gelů Blue Silver... 4 Chemikálie

Více

Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie

Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie IZOLACE GENOMOVÉ DNA Deoxyribonukleová kyselina (DNA) představuje základní genetický materiál většiny

Více

Stanovení koncentrace (kvantifikace) proteinů

Stanovení koncentrace (kvantifikace) proteinů Stanovení koncentrace (kvantifikace) proteinů Bioanalytické metody Prof. RNDr. Pavel Peč, CSc. Úvod Kritéria výběru metod stanovení koncentrace proteinů jsou založena na možnostech pro vlastní analýzu,

Více

Sure-MeDIP I. with magnetic beads and MNase. www.krd.cz

Sure-MeDIP I. with magnetic beads and MNase. www.krd.cz Sure-MeDIP I with magnetic beads and MNase www.krd.cz 1 Obsah soupravy a skladování MeDIP souprava obsahuje reagencie na provedení 25 reakcí. Souprava je rozdělen do dvou částí, jedna je distribuována

Více

Barevné principy absorpce a fluorescence

Barevné principy absorpce a fluorescence Barevné principy absorpce a fluorescence Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr Světlo je elektromagnetické vlnění Skládá se z elektrické složky a magnetické složky, které

Více

fenanthrolinem Příprava

fenanthrolinem Příprava 1 ÚLOHA 9: Spektrofotometrické fenanthrolinem studium komplexu Fe(II) s 1,10- Příprava 2. 3. 4. 5. 6. Zopakujte si základní pojmy z optiky - elektromagnetické záření a jeho šíření absorbujícím prostředím,

Více

ÚSTAV ORGANICKÉ TECHNOLOGIE

ÚSTAV ORGANICKÉ TECHNOLOGIE LABORATOŘ OBORU I ÚSTAV ORGANICKÉ TECHNOLOGIE (111) F Imobilizace na alumosilikátové materiály Vedoucí práce: Ing. Eliška Leitmannová, Ph.D. Umístění práce: laboratoř F07, F08 1 Úvod Imobilizace aktivních

Více

FLUORIMETRICKÉ STANOVENÍ FLUORESCEINU

FLUORIMETRICKÉ STANOVENÍ FLUORESCEINU FLUORIMETRICKÉ STANOVENÍ FLUORESCEINU návod vznikl jako součást bakalářské práce Martiny Vidrmanové Fluorimetrie s využitím spektrofotometru SpectroVis Plus firmy Vernier (http://is.muni.cz/th/268973/prif_b/bakalarska_prace.pdf)

Více

Sbohem, paní Bradfordová

Sbohem, paní Bradfordová Sbohem, paní Bradfordová aneb IČ spektroskopie ve službách kvantifikace proteinů Mgr. Stanislav Kukla Merck spol. s r. o. Agenda 1 Zhodnocení současných možností kvantifikace proteinů Bradfordové metoda

Více

Barevné principy absorpce a fluorescence

Barevné principy absorpce a fluorescence Barevné principy absorpce a fluorescence Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 27.9.2007 2 1 Světlo je elektromagnetické vlnění Skládá se z elektrické složky a magnetické

Více

Western blotting. 10% APS 20,28 µl 40,56 µl 81,12 µl 20,28 µl 40,56 µl 81,12 µl

Western blotting. 10% APS 20,28 µl 40,56 µl 81,12 µl 20,28 µl 40,56 µl 81,12 µl Western blotting 1. Příprava gelu složení aparatury hustotu gelu volit podle velikosti proteinů příprava rozdělovacího gelu: 10% 12% počet gelů 1 2 4 1 2 4 objem 6 ml 12 ml 24 ml 6 ml 12 ml 24 ml 40% akrylamid

Více

Elektroforéza v přítomnosti SDS SDS PAGE

Elektroforéza v přítomnosti SDS SDS PAGE Elektroforéza v přítomnosti SDS SDS PAGE Elektroforéza v přítomnosti SDS SDS PAGE je jednoduchá, rychlá a reprodukovatelná metoda pro kvalifikovanou charakterizaci a srovnání bílkovin.tato metoda separuje

Více

Laboratorní analytické metody. Petr Tůma

Laboratorní analytické metody. Petr Tůma Laboratorní analytické metody Petr Tůma Rozdělení analytických metod Metody separační Chromatografie kapalinová plynová Elektroforéza Metody spektrální absorpční spektrometrie v UV/VIS Metody elektrochemické

Více

Polymorfismus délky restrikčních fragmentů

Polymorfismus délky restrikčních fragmentů Polymorfismus délky restrikčních fragmentů Princip: Chemikálie: PCR produkt z předchozího praktického cvičení Endonukleáza KpnI 10 U μl -1 Pufr pro KpnI 10 koncentrovaný (Tris-HCl 100 mmol l -1 ph 7,5,

Více

Kurz 1 Úvod k biochemickému praktiku

Kurz 1 Úvod k biochemickému praktiku Kurz 1 Úvod k biochemickému praktiku Pavla Balínová http://vyuka.lf3.cuni.cz/ Důležité informace Kroužkový asistent: RNDr. Pavla Balínová e-mailová adresa: pavla.balinova@lf3.cuni.cz místnost: 410 studijní

Více

Identifikace mikroorganismů pomocí sekvence jejich genu pro 16S rrna

Identifikace mikroorganismů pomocí sekvence jejich genu pro 16S rrna Praktická úloha Identifikace mikroorganismů pomocí sekvence jejich genu pro 16S rrna Pro spolehlivou identifikaci mikroorganismů pomocí genetických metod se velmi často využívá stanovení nukleotidové sekvence

Více

S filtračními papíry a membránou je nutno manipulovat pinzetou s tupým koncem.

S filtračními papíry a membránou je nutno manipulovat pinzetou s tupým koncem. Western Blotting Příprava blotovacího sendviče... 1 Blotování... 2 Kontrola přenesení proteinů na membránu... 2 Blokování membrány... 2 Aplikace protilátek... 2 Vizualizace... 3 Vyvolání filmu... 4 Chemikálie

Více

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)

Více

Úloha č. 1 Odměřování objemů, ředění roztoků Strana 1. Úkol 1. Ředění roztoků. Teoretický úvod - viz návod

Úloha č. 1 Odměřování objemů, ředění roztoků Strana 1. Úkol 1. Ředění roztoků. Teoretický úvod - viz návod Úloha č. 1 Odměřování objemů, ředění roztoků Strana 1 Teoretický úvod Uveďte vzorec pro: výpočet směrodatné odchylky výpočet relativní chyby měření [%] Použitý materiál, pomůcky a přístroje Úkol 1. Ředění

Více

Úvod. Náplň práce. Úkoly

Úvod. Náplň práce. Úkoly Název práce: Zkouška disoluce pevných lékových forem Vedoucí práce: Doc. Ing. Petr Zámostný, Ph.D. Jméno zástupce: Ing. Jan Patera Umístění práce: S25b Úvod Uvolňování léčiva z tuhých perorálních lékových

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

Anizotropie fluorescence

Anizotropie fluorescence Anizotropie fluorescence Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 6 1 Jev anizotropie Jestliže dochází k excitaci světlem kmitajícím v jedné rovině, emise fluorescence se často

Více

ELEKTROFORETICKÉ METODY

ELEKTROFORETICKÉ METODY ELEKTROFORETICKÉ METODY ELEKTROFORETICKÁ SEPARACE AMINOKYSELIN NA PAPÍROVÉM NOSIČI Aminokyseliny lze rozdělit elektroforézou na papíře. Protože molekulová hmotnost jednotlivých aminokyselin není příliš

Více

Braf V600E StripAssay

Braf V600E StripAssay Braf V600E StripAssay Kat. číslo 5-570 20 testů 2-8 C Popis stripu: Pracovní postup 1. Izolace DNA Pro izolaci čerstvých nebo mražených biopsií použijte soupravy Qiagen QIAmp DNA Mini nebo Micro. Pro izolaci

Více

Cvičení ke kurzu Obecná ekotoxikologie. Úloha A - Stanovení ekotoxicity v testu klíčení rostlin

Cvičení ke kurzu Obecná ekotoxikologie. Úloha A - Stanovení ekotoxicity v testu klíčení rostlin Cvičení ke kurzu Obecná ekotoxikologie Nutné potřeby, které studenti přinesou s sebou do cvičení: - Tento návod - Poznámkový sešit, psací potřeby - Nůžky - Pravítko (s milimetrovým rozlišením) - Přezůvky

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Oborový workshop pro SŠ CHEMIE

Oborový workshop pro SŠ CHEMIE PRAKTICKÁ VÝUKA PŘÍRODOVĚDNÝCH PŘEDMĚTŮ NA ZŠ A SŠ CZ.1.07/1.1.30/02.0024 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Oborový workshop pro SŠ CHEMIE

Více

PLANÁRNÍ (PLOŠNÁ) CHROMATOGRAFIE

PLANÁRNÍ (PLOŠNÁ) CHROMATOGRAFIE PLANÁRNÍ (PLOŠNÁ) CHROMATOGRAFIE Tenkovrstvá chromatografie je technika pro identifikaci a separaci směsi organických látek Identifikace složek směsi (nutné použít standard) analysa frakcí sbíraných během

Více

Molekulová spektroskopie 1. Chemická vazba, UV/VIS

Molekulová spektroskopie 1. Chemická vazba, UV/VIS Molekulová spektroskopie 1 Chemická vazba, UV/VIS 1 Chemická vazba Silová interakce mezi dvěma atomy. Chemické vazby jsou soudržné síly působící mezi jednotlivými atomy nebo ionty v molekulách. Chemická

Více

EGFR XL StripAssay. Kat. číslo 5-630. 20 testů 2-8 C

EGFR XL StripAssay. Kat. číslo 5-630. 20 testů 2-8 C EGFR XL StripAssay Kat. číslo 5-630 20 testů 2-8 C Popis stripu Pracovní postup 1. Izolace DNA Pro izolaci DNA použijte vhodný izolační kit. Doporučené kity jsou následující: Pro izolaci čerstvých nebo

Více

Mikrokalorimetrie. Izotermální titrační mikrokalorimetrie

Mikrokalorimetrie. Izotermální titrační mikrokalorimetrie Labolatoř molekulárních komplexů chromatinu CEITEC a Přírodovědecká fakulta, Masarykova univerzita www.modernibiofyzika.cz Praktický kurz Pokročilé biofyzikální přístupy v genomice a proteomice 30. května

Více

Moderní nástroje pro zobrazování biologicky významných molekul pro zajištění zdraví. René Kizek

Moderní nástroje pro zobrazování biologicky významných molekul pro zajištění zdraví. René Kizek Moderní nástroje pro zobrazování biologicky významných molekul pro zajištění zdraví René Kizek 12.04.2013 Fluorescence je fyzikálně chemický děj, který je typem luminiscence. Luminiscence se dále dělí

Více

Izolace nukleových kyselin

Izolace nukleových kyselin Izolace nukleových kyselin Požadavky na izolaci nukleových kyselin V nativním stavu z přirozeného materiálu v dostatečném množství požadované čistotě. Nukleové kyseliny je třeba zbavit všech látek, které

Více

(Návod k praktiku) Produkty. I.typ II.typ. X 1 Σ + g. 1926 nm. 1269 nm. Kyslík

(Návod k praktiku) Produkty. I.typ II.typ. X 1 Σ + g. 1926 nm. 1269 nm. Kyslík Laserová kinetická spektroskopie aneb laserová zábleská fotolýza (Návod k praktiku) Úvod Jedním ze způsobů diagnostiky a léčení rakoviny je fotodynamická terapie [1]. Využívá vlastností některých sloučenin

Více

Měření koncentrace roztoku absorpčním spektrofotometrem

Měření koncentrace roztoku absorpčním spektrofotometrem Měření koncentrace roztoku absorpčním spektrofotometrem Teoretický úvod Absorpční spektrofotometrie je metoda stanovení koncentrace disperzního podílu analytické disperze, založená na měření absorpce světla.

Více

Pufry, pufrační kapacita. Oxidoredukce, elektrodové děje.

Pufry, pufrační kapacita. Oxidoredukce, elektrodové děje. ÚSTAV LÉKAŘSKÉ BIOCHEMIE A LABORATORNÍ DIAGNOSTIKY 1. LF UK Pufry, pufrační kapacita. Oxidoredukce, elektrodové děje. Praktické cvičení z lékařské biochemie Všeobecné lékařství Martin Vejražka, Tomáš Navrátil

Více

METODY STUDIA PROTEINŮ

METODY STUDIA PROTEINŮ METODY STUDIA PROTEINŮ Mgr. Vlasta Němcová vlasta.furstova@tiscali.cz OBSAH PŘEDNÁŠKY 1) Stanovení koncentrace proteinu 2) Stanovení AMK sekvence proteinu Hmotnostní spektrometrie Edmanovo odbourávání

Více

Uživatelská příručka

Uživatelská příručka PGM Barcoding Set 1-8 Navrženo pro PGM ION-TORRENT KÓD PRODUKTU: 2001 (1-8) BALEN9: 32 testů Uživatelská příručka Rev02.2015 Str. 1 Rejstřík 1. POUŽITÍ VÝROBKU 3 2. OBSAH KITU 4 3. SKLADOVÁNÍ 4 4. STABILITA

Více

NRAS StripAssay. Kat. číslo 5-610. 20 testů 2-8 C

NRAS StripAssay. Kat. číslo 5-610. 20 testů 2-8 C NRAS StripAssay Kat. číslo 5-610 20 testů 2-8 C Popis stripu: Pracovní postup 1. Izolace DNA Pro izolaci DNA musí být použita vhodná metoda vzhledem k typu tkáně vzorku. Pro doporučení vhodné metody kontaktujte

Více

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MYKOTOXINŮ METODOU LC-MS - FUMONISIN B 1 A B 2

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MYKOTOXINŮ METODOU LC-MS - FUMONISIN B 1 A B 2 Národní referenční laboratoř Strana 1 STANOVENÍ OBSAHU MYKOTOXINŮ METODOU LC-MS - FUMONISIN B 1 A B 2 1 Rozsah a účel Metoda je vhodná pro stanovení fumonisinů B 1 a B 2 v krmivech. 2 Princip Fumonisiny

Více

CS Úřední věstník Evropské unie L 54/89

CS Úřední věstník Evropské unie L 54/89 26.2.2009 CS Úřední věstník Evropské unie L 54/89 c) při vlnové délce mezi 230 a 320 nm se nesmí spektrum vzestupné části, vrcholu a sestupné části píku zkoušeného vzorku lišit od ostatních částí spektra

Více

TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně

Více

Spektroskopie v UV-VIS oblasti. UV-VIS spektroskopie. Roztok KMnO 4. pracuje nejčastěji v oblasti 200-800 nm

Spektroskopie v UV-VIS oblasti. UV-VIS spektroskopie. Roztok KMnO 4. pracuje nejčastěji v oblasti 200-800 nm Spektroskopie v UV-VIS oblasti UV-VIS spektroskopie pracuje nejčastěji v oblasti 2-8 nm lze měřit i < 2 nm či > 8 nm UV VIS IR Ultra Violet VISible Infra Red Roztok KMnO 4 roztok KMnO 4 je červenofialový

Více

Základy analýzy potravin Přednáška 8. Důvody pro analýzu bílkovin v potravinách. určování původu suroviny, autenticita výrobku

Základy analýzy potravin Přednáška 8. Důvody pro analýzu bílkovin v potravinách. určování původu suroviny, autenticita výrobku BÍLKOVINY Důvody pro analýzu bílkovin v potravinách posuzování nutriční hodnoty celkový obsah bílkovin aminokyselinové složení bílkoviny, volné aminokyseliny obsah cizorodých nebo neplnohodnotných bílkovin

Více

pracovní list studenta Komplexní sloučeniny Stanovení koncentrace kationtů přechodných kovů

pracovní list studenta Komplexní sloučeniny Stanovení koncentrace kationtů přechodných kovů Výstup RVP: Klíčová slova: pracovní list studenta Komplexní sloučeniny Stanovení koncentrace kationtů přechodných kovů Aleš Mareček žák se seznámí s moderními metodami kvantitativní analýzy (práce propojuje

Více

Stanovení cholesterolu ve vaječném žloutku a mléce kapilární elektroforézou

Stanovení cholesterolu ve vaječném žloutku a mléce kapilární elektroforézou Stanovení cholesterolu ve vaječném žloutku a mléce kapilární elektroforézou Úkol Stanovte obsah cholesterolu ve vaječném žloutku a mléce pomocí kapilární elektroforézy. Teoretická část Cholesterol je steroidní

Více

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction

Více

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU SEMDURAMICINU METODOU HPLC

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU SEMDURAMICINU METODOU HPLC Strana 1 STANOVENÍ OBSAHU SEMDURAMICINU METODOU HPLC 1 Rozsah a účel Postup specifikuje podmínky pro stanovení obsahu semduramicinu v krmivech metodou vysokoúčinné kapalinové chromatografie (HPLC) v koncentračním

Více

Praktický kurz Pokročilé biofyzikální přístupy v genomice a proteomice května 2011

Praktický kurz Pokročilé biofyzikální přístupy v genomice a proteomice května 2011 www.modernibiofyzika.cz Oddělení funkční genomiky a proteomiky Ústav experimentální biologie, Přírodovědecká fakulta Masarykova univerzita Praktický kurz Pokročilé biofyzikální přístupy v genomice a proteomice

Více

Úloha 1 Stanovení katalytické koncentrace aspartátaminotransferázy (AST)

Úloha 1 Stanovení katalytické koncentrace aspartátaminotransferázy (AST) Datum... Jméno... Kroužek... Návod a protokol z praktického cvičení z biochemie Téma: Vyšetření jater a pankreatu Úloha 1 Stanovení katalytické koncentrace aspartátaminotransferázy (AST) Pro stanovení

Více

Praktické cvičení: Izolace a purifikace rekombinantního proteinu

Praktické cvičení: Izolace a purifikace rekombinantního proteinu Praktické cvičení: Izolace a purifikace rekombinantního proteinu Toto blokové praktické cvičení spočívá v teoretickém i praktickém seznámení s rekombinantními proteiny, jejich izolací, purifikací a využitím.

Více

PROTOKOL WESTERN BLOT

PROTOKOL WESTERN BLOT WESTERN BLOT 1. PŘÍPRAVA ELEKTROFORETICKÉ APARATURY Saponátem a vodou se důkladně umyjí skla, plastové vložky a hřebínek, poté se důkladně opláchnou deionizovanou/destilovanou vodou a etanolem a nechají

Více

HbA1c. Axis - Shield. Společnost je zapsána v obchodním rejstříku Městského soudu v Praze, odd. C vložka 1299

HbA1c. Axis - Shield. Společnost je zapsána v obchodním rejstříku Městského soudu v Praze, odd. C vložka 1299 Lékařská technika a speciální zdravotní materiál Společnost je zapsána v obchodním rejstříku Městského soudu v Praze, odd. C vložka 1299 Obchodní 110, 251 70 Praha Čestlice Tel. +420 296 328 300 Fax. +420

Více

STANOVENÍ ANTIOXIDAČNÍ KAPACITY METODOU FOTOCHEMILUMINISCENCE NA PŘÍSTROJI PHOTOCHEM

STANOVENÍ ANTIOXIDAČNÍ KAPACITY METODOU FOTOCHEMILUMINISCENCE NA PŘÍSTROJI PHOTOCHEM STANOVENÍ ANTIOXIDAČNÍ KAPACITY METODOU FOTOCHEMILUMINISCENCE NA PŘÍSTROJI PHOTOCHEM ANTIOXIDAČNÍ KAPACITA ČAJŮ Princip metodiky: Analyzátor Photochem je určen pro stanovení antioxidační kapacity vybraných

Více

Derivační spektrofotometrie a rozklad absorpčního spektra

Derivační spektrofotometrie a rozklad absorpčního spektra Derivační spektrofotometrie a rozklad absorpčního spektra Teorie: Derivační spektrofotometrie, využívající derivace absorpční křivky, je obecně používanou metodou pro zvýraznění detailů průběhu záznamu,

Více

Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202)

Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Popis Column DNA Lego Kit je základ moderní stavebnicové (Lego) soupravy pro izolaci čisté DNA různého

Více

Sure-MeDIP II. with agarose beads and Mse I. www.krd.cz

Sure-MeDIP II. with agarose beads and Mse I. www.krd.cz Sure-MeDIP II with agarose beads and Mse I www.krd.cz 1 Obsah soupravy a skladování MeDIP souprava obsahuje reagencie na provedení 25 reakcí. Souprava je rozdělen do dvou částí, jedna je distribuována

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby

Více

Spektrofotometrické stanovení fosforečnanů ve vodách

Spektrofotometrické stanovení fosforečnanů ve vodách Spektrofotometrické stanovení fosforečnanů ve vodách Úkol: Spektrofotometricky stanovte obsah fosforečnanů ve vodě Chemikálie: 0,07165 g dihydrogenfosforečnan draselný KH 2 PO 4 75 ml kyselina sírová H

Více

Adsorpce barviva na aktivním uhlí

Adsorpce barviva na aktivním uhlí Adsorpce barviva na aktivním uhlí TEORIE ABSORBANCE Prochází-li světelný tok monochromatických paprsků o intenzitě I 0 určitým prostředím dojde k pohlcení jisté části záření a intenzita záření se sníží

Více

ULTRAFIALOVÁ A VIDITELNÁ SPEKTROMETRIE

ULTRAFIALOVÁ A VIDITELNÁ SPEKTROMETRIE Pracovní úkol 1. Vytvořte kalibrační řadu roztoků pro stanovení orthofosforečnanů (viz část 1), stanovte vhodnou vlnovou délku pro kalibraci a proveďte kalibraci přístroje pro toto stanovení. 2. Na základě

Více

PROTEINOVÁ DENATURUJÍCÍ ELEKTROFORÉZA (SDS PAGE)

PROTEINOVÁ DENATURUJÍCÍ ELEKTROFORÉZA (SDS PAGE) PROTEINOVÁ DENATURUJÍCÍ ELEKTROFORÉZA (SDS PAGE) Denaturující proteinová elektroforéza (SDS PAGE - SDS Protein Acrylamide Gel Electrophoresis) je metoda, která se používá k separaci proteinů podle velikosti,

Více

Hmotnostní detekce biologicky významných sloučenin pro biotechnologie část 3 - Provedení štěpení proteinů a následné analýzy,

Hmotnostní detekce biologicky významných sloučenin pro biotechnologie část 3 - Provedení štěpení proteinů a následné analýzy, Laboratoř Metalomiky a Nanotechnologií Hmotnostní detekce biologicky významných sloučenin pro biotechnologie část 3 - Provedení štěpení proteinů a následné analýzy, vyhodnocení výsledků, diskuse Anotace

Více

Zápis o rozboru. E skleněné ISE závislé na ph roztoku, lze pomocí kombinované skleněné ISE sestrojit závislost ph na přidávaném

Zápis o rozboru. E skleněné ISE závislé na ph roztoku, lze pomocí kombinované skleněné ISE sestrojit závislost ph na přidávaném 1 Princip metody Zápis o rozboru Tato laboratorní práce byla rozdělena na tři části.v první bylo úkolem stanovit s pomocí potenciometrické titrace hmotnost kyseliny fosforečné a dihydrogenfosforečnanu

Více

Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů CZ.1.07/1.1.00/14.

Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů CZ.1.07/1.1.00/14. Praktické cvičení z chemie 1) Stanovení lipofilních listových barviv pomocí adsorpční chromatografie. 2) Stanovení proteinů v roztoku. 3) Homogenizace rostlinného materiálu pomocí tekutého dusíku a stanovení

Více

Šance pro mladé výzkumníky na Univerzitě J. E. Purkyně, CZ.1.07/2.3.00/30.0062. Autoři: Dr. Dominika Wróbel, Mgr. Jan Malý, Ph.D.

Šance pro mladé výzkumníky na Univerzitě J. E. Purkyně, CZ.1.07/2.3.00/30.0062. Autoři: Dr. Dominika Wróbel, Mgr. Jan Malý, Ph.D. BIOANALYTICKÉ METODY SOUBOR LABORATORNÍCH ÚLOH PRO PŘEDMĚT KBI/P320, KBI/N301 A KBI/N031 Autoři: Dr. Dominika Wróbel, Mgr. Jan Malý, Ph.D. Katedra biologie PřF UJEP Září 2014 Tato publikace vnikla v rámci

Více

Braf 600/601 StripAssay

Braf 600/601 StripAssay Braf 600/601 StripAssay Kat. číslo 5-560 20 testů 2-8 C Popis stripu: Pracovní postup Kit umožňuje detekci 9 mutací v genu BRAF (kodón 600 a 601) Další informace najdete v OMIM Online Mendelian Inheritance

Více

SPEKTROFOTOMETR (NÁVOD K OBSLUZE)

SPEKTROFOTOMETR (NÁVOD K OBSLUZE) SPEKTROFOTOMETR (NÁVOD K OBSLUZE) 1. Obecná charakteristika spektrofotometru Spektrofotometr umožňuje stanovovat vlastnosti vzorku, např. koncentrace určité látky v roztoku, na základě pohlcování světla

Více

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MELAMINU A KYSELINY KYANUROVÉ METODOU LC-MS

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MELAMINU A KYSELINY KYANUROVÉ METODOU LC-MS Národní referenční laboratoř Strana 1 STANOVENÍ OBSAHU MELAMINU A KYSELINY KYANUROVÉ METODOU LC-MS 1 Rozsah a účel Postup je určen pro stanovení obsahu melaminu a kyseliny kyanurové v krmivech. 2 Princip

Více

Příprava roztoků, absorpční spektrofotometrie

Příprava roztoků, absorpční spektrofotometrie Příprava roztoků, absorpční spektrofotometrie Příprava roztoků Roztoky jsou homogenní soustavy složené ze dvou či více složek. Složení roztoků (tedy údaje o kvantitativním zastoupení jednotlivých složek)

Více

chemie Stanovení isosbestického bodu bromkresolové zeleně (BKZ) Cíle Podrobnější rozbor cílů Zařazení do výuky Časová náročnost Návaznost experimentů

chemie Stanovení isosbestického bodu bromkresolové zeleně (BKZ) Cíle Podrobnější rozbor cílů Zařazení do výuky Časová náročnost Návaznost experimentů Stanovení isosbestického bodu bromkresolové zeleně (BKZ) pracovní návod s metodickým komentářem pro učitele připravil M. Škavrada chemie 20 úloha číslo Cíle Cílem této laboratorní úlohy je stanovení isosbestického

Více

Inkubace enzymů se substráty

Inkubace enzymů se substráty Inkubace enzymů se substráty Inkubace redukčních enzymů... 1 Inkubace oxidačních enzymů... 2 Extrakce látek z inkubační směsi... 2 Příprava vzorků k HPLC/UHPLC detekci... 3 Chemikálie a roztoky... 4 Substráty...

Více

Stanovení koncentrace složky v roztoku potenciometrickým měřením

Stanovení koncentrace složky v roztoku potenciometrickým měřením Laboratorní úloha B/1 Stanovení koncentrace složky v roztoku potenciometrickým měřením Úkol: A. Stanovte potenciometrickým měřením koncentraci HCl v dodaném vzorku roztoku. Zjistěte potenciometrickým měřením

Více

Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.:

Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.: Yi TPMT Diagnostická souprava Návod k použití Výrobce: YBUX s.r.o. Haasova 27 Brno 616 00 Česká republika IČ 63487951 tel.: +420 541 423 710 e-mail: ybux@ybux.eu Název: Yi TPMT Popis: Diagnostická souprava

Více

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MYKOTOXINŮ METODOU LC-MS - aflatoxin B1, B2, G1 a G2

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MYKOTOXINŮ METODOU LC-MS - aflatoxin B1, B2, G1 a G2 Národní referenční laboratoř Strana 1 STANOVENÍ OBSAHU MYKOTOXINŮ METODOU LC-MS - aflatoxin B1, B2, G1 a G2 1 Rozsah a účel Metoda je vhodná pro stanovení aflatoxinů B1, B2, G1 a G2 v krmivech. 2 Princip

Více

Obr. 1. Struktura glukosaminu.

Obr. 1. Struktura glukosaminu. 3. Stanovení glukosaminu ve výživových doplňcích pomocí kapilární elektroforézy Glukosamin (2-amino-2-deoxyglukózamonosacharid je široce distribuován ve tkáních lidského organismu jako složka je klíčovou

Více

ANALYTICKÝ SYSTÉM PHOTOCHEM

ANALYTICKÝ SYSTÉM PHOTOCHEM ANALYTICKÝ SYSTÉM PHOTOCHEM Analytický systém Photochem (firmy Analytik Jena, Německo) je vhodný pro stanovení celkové antioxidační kapacity (tj. celkové schopnosti vzorku vychytávat volné radikály) různých

Více

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MYKOTOXINŮ METODOU HPLC - OCHRATOXIN A

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MYKOTOXINŮ METODOU HPLC - OCHRATOXIN A Národní referenční laboratoř Strana 1 STANOVENÍ OBSAHU MYKOTOXINŮ METODOU HPLC - OCHRATOXIN A 1 Rozsah a účel Metoda specifikuje podmínky pro stanovení ochratoxinu A v krmivech. 1 Ochratoxin A patří mezi

Více

Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014

Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014 Molekulárně biologické metody v mikrobiologii Mgr. Martina Sittová Jaro 2014 Harmonogram 1. den Izolace DNA 2. den Měření koncentrace DNA spektrofotometricky, real-time PCR 3. den Elektroforéza Molekulární

Více

Kras XL StripAssay. Kat. číslo 5-680. 20 testů 2-8 C

Kras XL StripAssay. Kat. číslo 5-680. 20 testů 2-8 C Kras XL StripAssay Kat. číslo 5-680 20 testů 2-8 C Popis stripu: Pracovní postup 1. Izolace DNA Musí být použity vhodné metody extrakce DNA, v závislosti na typu vzorku, který má být vyšetřován. Doporučení

Více

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ AKTIVITY FYTÁZY

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ AKTIVITY FYTÁZY Národní referenční laboratoř Strana 1 STANOVENÍ AKTIVITY FYTÁZY 1 Rozsah a účel Postup specifikuje stanovení fytázové aktivity ve vzorcích krmiva. Tímto postupem se nestanoví rozdíl mezi fytázou přidanou

Více

Protokoly Transformace plasmidu do elektrokompetentních buněk BL21 Pracovní postup:

Protokoly Transformace plasmidu do elektrokompetentních buněk BL21 Pracovní postup: Protokoly Pracovní potřeby, pufry a chemikálie jsou uvedeny na konci protokolu. Pracovní postupy jsou odvozeny od těchto kitů: Champion pet160 Directional TOPO Expression Kit with Lumio Technology (Invitrogen)

Více

Využití a princip fluorescenční mikroskopie

Využití a princip fluorescenční mikroskopie Využití a princip fluorescenční mikroskopie fyzikálně chemický děj Fluorescence typem luminiscence (elektroluminiscence, fotoluminiscence, radioluminiscence a chemiluminiscenci) patří mezi fotoluminiscenční

Více

Spektroskopické metody. převážně ve viditelné, ultrafialové a blízké infračervené oblasti

Spektroskopické metody. převážně ve viditelné, ultrafialové a blízké infračervené oblasti Spektroskopické metody převážně ve viditelné, ultrafialové a blízké infračervené oblasti Elektromagnetické záření Elektromagnetické záření je postupné vlnění elektromagnetického pole složeného z kombinace

Více

Chemické výpočty II. Vladimíra Kvasnicová

Chemické výpočty II. Vladimíra Kvasnicová Chemické výpočty II Vladimíra Kvasnicová Převod jednotek pmol/l nmol/l µmol/l mmol/l mol/l 10-12 10-9 10-6 10-3 mol/l µg mg g 10-6 10-3 g µl ml dl L 10-6 10-3 10-1 L Cvičení 12) cholesterol (MW=386,7g/mol):

Více

Úloha č. 8 POTENCIOMETRICKÁ TITRACE. Stanovení silných kyselin alkalimetrickou titrací s potenciometrickou indikací bodu ekvivalence

Úloha č. 8 POTENCIOMETRICKÁ TITRACE. Stanovení silných kyselin alkalimetrickou titrací s potenciometrickou indikací bodu ekvivalence 1 Princip Úloha č. 8 POTENCIOMETRICKÁ TITRACE Stanovení silných kyselin alkalimetrickou titrací s potenciometrickou indikací bodu ekvivalence Nepřímá potenciometrie potenciometrická titrace se využívá

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

CVD-T StripAssay. Kat. číslo 4-360. 20 testů 2-8 C

CVD-T StripAssay. Kat. číslo 4-360. 20 testů 2-8 C CVD-T StripAssay Kat. číslo 4-360 20 testů 2-8 C Popis stripu Pracovní postup Izolace DNA Použijte čerstvou nebo zmraženou krev s EDTA nebo citrátem, jako antikoagulans, vyhněte se krvi s obsahem heparinu.

Více

Stanovení paracetamolu, kofeinu a propyfenazonu v tabletách Valetol

Stanovení paracetamolu, kofeinu a propyfenazonu v tabletách Valetol Úkol: Stanovení paracetamolu, kofeinu a propyfenazonu v tabletách Valetol pomocí CE-LIF Proveďte separaci a následné stanovení účinných látek (paracetamol, propyfenazon, kofein) v přípravku Valetol pomocí

Více