Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Rozměr: px
Začít zobrazení ze stránky:

Download "Základní pravidla dědičnosti - Mendelovy a Morganovy zákony"


1 Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/

2 J. G. Mendel zveřejnil zobecnění výsledků svých pokusů. Samotné zákony nezformuloval, k tomu došlo později po ověření jeho výsledků v prvních desetiletích 20. století. Počet zákonů dedičnosti se podle různých zdrojů liší od 2 do 4. Mendelova původní zobecnění výsledků pokusů s hrachem: Závěry z monohybridního křížení: Existují hmotné dědičné elementy (faktory, vlohy), později označené jako geny Znaky a vlastnosti se nedědí, přenáší (dědí) se informace o znacích (viditelných i neviditelných) pomocí elementů (alel) v gametách Hmotné elementy dědičnosti mají (doplňující pozn.: u vyšších organizmů s 2n genetickou informací) podvojné založení - jedinec je dědí od každého z rodičů. Pravidelné štěpné poměry v hybridním potomstvu homozygotních rodičů vyplývají z podvojného založení dedičných elementů, čistoty gamet a dominantně-recesivního vztahu elementů Závěry z dihybridného a třihybridního křížení: Vysvětlil štěpné poměry při křížení hybridních jedinců v 7 znacích hrachu pomocí principů segregace a volné kombinovatelnosti dědičných elementů Potvrdil tak existenci diskrétních jednotek přenosu genetické informace (elementů) které se různě kombinují

3 a) Mendelovy zákony 1) Zákon o čistotě gamet Každá gameta obsahuje z páru alel jen jednu alelu. Proto každý - homozygot je homogametický a vytváří gamety obsahující tutéž vlohu pro daný znak, kdežto - heterozygot je heterogametický a vytváří v poměru 1 : 1 pohlavní buňky obsahující buďto jednu nebo druhou alelu.

4 2) Zákon o uniformitě hybridů Všichni jedinci generace F1, kteří vznikli křížením dvou homozygotních rodičů, jsou genotypově a fenotypově stejní.

5 3) Zákon o štěpení v potomstvu hybridů F2 V generaci F2 se vždy vyštěpují fenotypové znaky matky a otce z generace rodičů (P). Objevují se dominantní a recesivní znaky a jejich poměr lze vyjádřit malými celými čísly. 3 : 1 1 : 2 : 1

6 4) Zákon o volné kombinovatelnosti alel Vlohy jednoho páru alel se kombinují u potomstva nezávisle na vlohách jiných párů alel. (To platí, je-li každý pár alel umístěn v jiném chromozomu - viz. Morganovy zákony níže).

7 Podmínky zajišťující projev pravidel štěpení: stejná pravděpodobnost vzniku všech druhů gamet u hybrida všechny gamety stejně životné stejná pravděpodobnost všech možných spojení genů u dihybridů geny by měli být lokalizovány na různých chromozomech (viz. níž Morganovy zákony) poměr štěpení se může měnit, jestliže se projev některého znaku mění pod vlivem prostředí

8 Zjednodušené shrnutí Mendelových závěrů do tří zákonů: 1. Uniformity F1 generace (1. filiální = první generace potomků). Při vzájemném křížení 2 homozygotů vznikají potomci genotypově i fenotypově jednotní. Pokud se kříží 2 různí homozygoti, jsou jejich potomci vždy heterozygotními hybridy. 2. Náhodné segregace genů do gamet (Zákon o štěpných poměrech v F2 generaci). Při křížení 2 heterozygotů může být potomkovi předána každá ze dvou alel (dominantní i recesivní) se stejnou pravděpodobností. Dochází tedy ke genotypovému a tím pádem i fenotypovému štěpení = segregaci. Po křížení různých homozygotů je podíl alel vždy 1:1 a genotypový štěpný poměr 1:2:1. Fenotypový (vnější) štěpný poměr potomstva je u kodominantních alel 1:2:1, při dominanci jedné alely 3:1). 3. Nezávislého výběru resp. nezávislé kombinovatelnosti alel dvou odlišných genů. Allely odlišných znaků se přenášejí do pohlavních buněk (a potomstva) navzájem nezávisle. Při zkoumání 2 alel současně dochází k téže pravidelné segregaci. Máme li 2 polyhybridy AaBb může každý tvořit 4 různé gamety (AB, Ab, ab, ab). Při vzájemném křížení tedy z těchto 2 gamet vzniká 16 různých zygotických kombinací. Některé kombinace se ovšem opakují, takže nakonec vzniká pouze 9 různých genotypů (poměr 1:2:1:2:4:2:1:2:1). Nabízí se nám pouze 4 možné fenotypové projevy (dominantní v obou znacích, v 1. dominantní a v 2. recesivní, v 1. recesivní a v 2. dominantní, v obou recesivní). Fenotypový štěpný poměr je 9:3:3:1.

9 Příklad zobecnění Mendelových závěrů do dvou zákonů 1. Zákon o štěpení znaků (hybridů F2) - the Law of Segregation 2. Zákon nezávislé kombinovatelnosti alel (alel 2 genů na různých chromozomech) - the Law of Independent Assortment of Alleles

10 Příklad zobecnění Mendelových závěrů do dvou zákonů (zdroj Philip Mc Lean) Mendel's First Law - the law of segregation; during gamete formation each member of the allelic pair separates from the other member to form the genetic constitution of the gamete 1) The hereditary determinants are of a particulate nature. These determinants are called genes. 2) Each parent has a gene pair in each cell for each trait studied. The F 1 from a cross of two pure lines contains one allele for the dominant phenotype and one for the recessive phenotype. These two alleles comprise the gene pair. 3) One member of the gene pair segregates into a gamete, thus each gamete only carries one member of the gene pair. 4) Gametes unite at random and irrespective of the other gene pairs involved. Mendel's Second Law - the law of independent assortment; during gamete formation the segregation of the alleles of one allelic pair is independent of the segregation of the alleles of another allelic pair 5) Regular phenotypic ratios can be explained by the independent segregation of alleles in the F 2. The dominance relationship between alleles for each trait was already known to Mendel when he made this cross. The purpose of the dihybrid cross was to determine if any relationship existed between different allelic pairs.. * With the monohybrid and dihybrid crosses, Mendel confirmed the results of his second law by performing a backcross - F 1 dihybrid x recessive parent.

11 b) Morganovy zákony 1) Geny jsou lokalizovány na chromozomech a jsou na nich uspořádány lineárně. 2)Geny jednoho chromozomu tvoří vazbovou skupinu. Organizmus má tolik vazbových skupin, kolik má párů homologních chromozomů (chromozomů s lokusy stejných genů). 3) Mezi geny homologních párů chromozomů může proběhnout výměna genetického materiálu (crossing-over), jejíž frekvence je přímo úměrná vzdálenosti lokusů jednotlivých genů.

12 Síla vazby = pravděpodobnost, že mezi dvěma geny téhož chromosomu proběhne crossing-over. Vyjadřuje se pomocí rekombinačního zlomku θ (theta) Morganovo číslo θ : p = počet rekombinovaných jedinců / počet všech jedinců měrná jednotka = cm (centimorgan) = tzv. mapová jednotka = 1 % (1/100) rekombinací v chromosomové oblasti, vymezené 2 danými geny 100 cm: Je-li vzdálenost mezi geny dostatečně velká, dochází ke crossing-overu mezi sledovanými geny vždy = stejný podíl gamet bez rekombinace a s rekombinací θ = 0,5 Cis-pozice (coupling): na 1 z homologických chromosomů jsou lokalizovány dominantní (resp. recesivní) alely obou genů (AB/ab) Trans-pozice (repulsion): na 1 z homologických chromosomu je dominantní alela jednoho genu a recesivní alela genu druhého (Ab/aB)

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat


Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského


12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865


Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák MENDELISMUS Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák 1822-1884 In the ten years G. Mendel worked on his plants in the garden of the monastery, he made the greatest discovery in biology that


Genová vazba. Obr. č. 1: Thomas Hunt Morgan

Genová vazba. Obr. č. 1: Thomas Hunt Morgan Genová vazba Jednou ze základních podmínek platnosti Mendelových zákonů je lokalizace genů, které podmiňují různé vlastnosti na různých chromozómech. Toto pravidlo umožňuje volnou kombinovatelnost genů


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA


Druhová a mezidruhová hybridizace

Druhová a mezidruhová hybridizace Druhová a mezidruhová hybridizace Obsah Druhová a mezidruhová hybridizace... 1 Obsah... 1 Monohybridní křížení... 1 Dihybridní křížení... 2 Polyhybridní křížení... 3 Souhrn Mendelismus v dědičnosti kvalitativních


Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.cz Mutace Mutace - náhodná změna v genomu organismu - spontánní


Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským


13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu


Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém


Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií

Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Obecná genetika Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Ing. Roman Longauer, CSc. Ústav zakládání a pěstění lesů, LDF MENDELU Brno Tento projekt je spolufinancován Evropským


Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním



GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou



GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci


Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto


Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým


Gymnázium, Brno, Slovanské nám. 7, WORKBOOK - Biology WORKBOOK. http://agb.gymnaslo.cz. Student:

Gymnázium, Brno, Slovanské nám. 7, WORKBOOK - Biology WORKBOOK. http://agb.gymnaslo.cz. Student: WORKBOOK http://agb.gymnaslo.cz Subject: Teacher: Student: Biology Iva Kubištová.. School year:../ This material was prepared with using Topics: 1. 2. 3. 4. 5. 6. 7. 8. Mendelian Inheritance, Population


GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních


Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého


Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje


Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová



PRAKTIKUM Z OBECNÉ GENETIKY RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie lizal@sci.muni.cz 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin


Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


RURGenetika zápočtový program Programování II

RURGenetika zápočtový program Programování II RURGenetika zápočtový program Programování II Rudolf Rosa cvičící: Doc. RNDr. Pavel Töpfer, CSc. Obsah Specifikace...1 Původní specifikace...1 Upravená specifikace...2 Program...3 třída Populace...4 Datové


Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.


Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace


GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D.

GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D. GENETIKA Mendelistická dědičnost 2014 Doc. MVDr. Eva Bártová, Ph.D. Nauka o DĚDIČNOSTI (HEREDITA) a PROMĚNLIVOSTI (VARIABILITA) termín genetika poprvé použil v r. 1905 W. BATESON název genetika odvozen


"Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT ". Základy Genetiky

Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT . Základy Genetiky "Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT ". Základy Genetiky ROSTLINNÁ BUŇKA aaaaaaaa jádro mitochondrie chromatin (DNA) aaaaaaaa aaaaaaa aaaaaaaa aaaaaaaa plastid


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace Pojmy k zpmtování Gen -část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN Gen je různě dlouhá sekvence nukleotidů Gen je jednotk funkce


Proč jsme podobní rodičům? A jak k tomu vlastně může dojít?

Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Základy genetiky Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Johann Gregor Mendel (1822 1884) O jeho životě byl mnich, zakladatel genetiky a opat augustiniánského kláštera v Brně studium


1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,


=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům

=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům Otázka: Genetika Předmět: Biologie Přidal(a): t.klodnerova REALIZACE GENETICKÉ INFORMACE, MUTACE, ZÁKLADNÍ GENETICKÉ POJMY: GEN, ZNAK, ALELA, GENOTYP, FENOTYP, HOMOZYGOT, HETEROZYGOT, HYBRIDIZACE, DOMINANCE,


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef


Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Tradice šlechtění šlechtění zlepšování pěstitelsky, technologicky a spotřebitelsky významných vlastností


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)


Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):


Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika



GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností


Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická


-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě Otázka: Genetika I Předmět: Biologie Přidal(a): Paris -věda, která se zabývá dědičností a proměnlivostí -zakladatelem je Johan Gregor Mendel (1822 1884), který se narodil v Hynčicích na Moravě 1. MOLEKULÁRNÍ


GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných


Genetická kartografie

Genetická kartografie Genetická kartografie Vazba U klasického dihybridismu podle Johanna Gregora Mendela segregují různé alely dvou genů nezávisle. Rekapitulace dihybridismu je na obrázku 8.1. Toto schéma platí jen pro lokusy


Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák

Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák KVANTITATIVNÍ GENETIKA dědičnost kvantitativních znaků ZNAKY KVALITATIVNÍ: gen znak barva hrachu: žlutá zelená (i komplikovaněji penetrace, epresivita,


Mendelistická genetika

Mendelistická genetika Mendelova práce Se svými hybridizačními pokusy s hrachem (Pisum L.) začal Mendel v roce 1856 v klášterní zahradě na Starém Brně. Experimenty prováděl do roku 1868, když byl zvolen za opata kláštera. V


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI


GENETIKA. zkoumá dědičnost a proměnlivost organismů

GENETIKA. zkoumá dědičnost a proměnlivost organismů GENETIKA zkoumá dědičnost a proměnlivost organismů Dědičnost: schopnost organismů uchovávat informace o své struktuře a funkčních schopnostech a předávat je svým potomkům Proměnlivost (variabilita) je


Genetické mapování. v přírodních populacích i v laboratoři

Genetické mapování. v přírodních populacích i v laboratoři Genetické mapování v přírodních populacích i v laboratoři Funkční genetika Cílem je propojit konkrétní mutace/geny s fenotypem Vzniklý v laboratoři pomocí mutageneze či vyskytující se v přírodě. Forward


Využití algebraických hyperstruktur při určování dědičnosti krevních skupin

Využití algebraických hyperstruktur při určování dědičnosti krevních skupin PWSZ Nowy SĄcz Zeszyty Naukowe PWSZ NS, Nowy SĄcz 2013 Využití algebraických hyperstruktur při určování dědičnosti krevních skupin Eva Bártková 1, David Nocar 2, Květoslav Bártek 3 1 Katedra matematiky


Stavba chromozomů Lidský karyotyp

Stavba chromozomů Lidský karyotyp Přípravný kurz z biologie 5 Stavba chromozomů Lidský karyotyp 3. 12. 2011 Mgr. Kateřina Caltová Stavba chromozomů Lidský karyotyp Chromozom buněčná struktura v jádře eukaryotních buněk řec. chroma = barva,


Úvod do populační genetiky

Úvod do populační genetiky Úvod do populační genetiky 1 Termíny Gene Locus (loci) Allele alternative forms of a gene Genome single copy of all of the genes Diploid - 2 alely pro každý gen (výjimka Chr Y, cpdna a mtdna) 2 genomy


Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina

Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina Přehled GMH Seminář z biologie GENETIKA Molekulární genetika Základní dogma molekulární biologie Základním nosičem genetické informace je molekula DNA. Tato molekula se může replikovat (kopírovat). Informace


OBECNÁ GENETIKA 2006. - jeho dílo (Versuche über Pflanzen Hybriden - Pokusy s rostlinnými hybridy )

OBECNÁ GENETIKA 2006. - jeho dílo (Versuche über Pflanzen Hybriden - Pokusy s rostlinnými hybridy ) OBECNÁ GENETIKA 2006 - přesné datum narození Mendela (20.7.1822) - kdy uveřejnil Mendel výsledky své práce (8. 2. a 8. 3. 1865) - kdy byl Mendel pokřtěn (22. 7. 1822 v Dolním Vražném) - kde se narodil


Genetika populací. Doposud genetika na úrovni buňky, organizmu

Genetika populací. Doposud genetika na úrovni buňky, organizmu Doposud genetika na úrovni buňky, organizmu - jedinec nás nezajímá - pouze jeho gamety a to jako jedny z mnoha = genofond = soubor všech gamet skupiny jedinců Populace mnoho různých definic - skupina organizmů



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Příbuznost a inbreeding

Příbuznost a inbreeding Příbuznost a inbreeding Příbuznost Přímá (z předka na potomka). Souběžná (mezi libovolnými jedinci). Inbreeding Inbrední koeficient je pravděpodobnost, že dva geny přítomné v lokuse daného jedince jsou


Hodnocení plemenných + chovných + užitkových prasat

Hodnocení plemenných + chovných + užitkových prasat Hodnocení plemenných + chovných + užitkových prasat Metodické pokyny SCHP Hodnocení plemenných prasat Cíl hodnocení stanovit předpoklad využití zvířat v plemenitbě k dalšímu šlechtění populace k masovému


Pojem plemeno je používán pro rasy, které vznikly záměrnou činností člověka, např. plemena hospodářských zvířat.

Pojem plemeno je používán pro rasy, které vznikly záměrnou činností člověka, např. plemena hospodářských zvířat. POPULAČNÍ GENETIKA Populační genetika se zabývá genetickými zákonitostmi v definovaných souborech jedinců téhož druhu. Genetické vztahy uvnitř populace jsou komplikované, a proto se v populační genetice


DĚDIČNOST Monogenní dědičnost Multifaktoriální dědičnost Expresivita Penetrance Gen (strukturní gen

DĚDIČNOST Monogenní dědičnost Multifaktoriální dědičnost Expresivita Penetrance Gen (strukturní gen DĚDIČNOST Předtím než se začneme věnovat jednotlivým typům genetické determinace a přenosu genetické informace z rodičovské generace na potomky, objasníme si některé termíny. Monogenní dědičnost znamená


9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů

9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů 9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou


Ekologické a evoluční aspekty genetiky

Ekologické a evoluční aspekty genetiky Ekologické a evoluční aspekty genetiky Teoretická populační genetika popisuje na základě matematických modelů, jak se pod vlivem různých evolučních faktorů mění genové frekvence v populacích. Formuluje


J. G. Mendel, jeho hybridizační objevy a jejich význam 9. 1 Úvod

J. G. Mendel, jeho hybridizační objevy a jejich význam 9. 1 Úvod J. G. Mendel, jeho hybridizační objevy a jejich význam 9 1 Úvod Popis významu hybridizační výzkumné práce, kterou provedl Johann Gregor Mendel, bude vždy do určité míry obsahovat subjektivní názor autora,


Populační genetika Radka Reifová

Populační genetika Radka Reifová Populační genetika Radka Reifová Prezentace ke stažení: http://web.natur.cuni.cz/~radkas v záložce Courses Literatura An Introduction to Population Genetics. Rasmus Nielsen and Montgomery Slatkin. 2013.
