lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické

Rozměr: px
Začít zobrazení ze stránky:

Download "lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické"


1 Gonozomáln lní dědičnost Mgr. Aleš RUDA Chromozomové určení pohlaví autozomy gonozomy člověk má 22 párůp autozomů a 1 pár p gonozomů označen ení pohlavních chromozomů: : X a Y. jsou možné celkem 3 kombinace: : : pohlaví homogametické : : pohlaví heterogametické YY: : neeistuje 3 typy chromozomového ho určen ení pohlaví: savčí typ typ Drosophila ptačí typ typ Abraas typ Protenor 2

2 Chromozóm X a Y 3 1. Savčí typ typ Drosophila tento typ má člověk, savci, hmyz (kromě motýlů) a dvoudomé rostliny. Samička je homogametická, sameček je heterogametický. P: GP: F 1 : X, X 1 50% vs X, Y 1 50% BARROVO TĚLÍSKO se chromatin důkaz ženského pohlaví jeden chromozom X je inaktivní a během interfáze barvitelný nositelem pohlaví je pouze sameček. Se stejnou pravděpodobností vznikají 2 typy spermií. Vajíčka jsou vždy pouze jednoho typu. pozn.: U člověka je chromozom Y nejmenší a má malý genetický význam. 4

3 Kombinace gonozomů při oplodnění Vypočítejte, s jakou pravděpodobností se manželům narodí ze dvou těhotenství: 2 chlapci Pohlavní chromozomy v gametách X muž Y ½. ½= ¼ žena X 2 dívky 5 ½. ½= ¼ chlapec a dívka ¼+ ¼= ½ Chlapec ½ Dívka ½ Chlapec ½ ¼ ¼ Dívka ½ ¼ ¼ 2. Ptačí typ typ Abraas vyskytuje se u ptáků, motýlů, některých ryb a obojživelníků. Samička je heterogametická, sameček je homogametický. P: vs GP: X, X X, Y F 1 : % 50% nositelem pohlaví je samička. Vzniká pouze 1 typ spermií a 2 typy vajíček. častější označení u ptačího typu: : ZZ, : ZW. 6

4 3. typ Protenor rozhoduje počet gonozomů, protože chromozom Y zcela chybí samčí pohlaví je určeno přítomností 1 chromozómu některé druhy ploštic a kobylek PARTENOGENEZE U včel a vos se z oplozených vajíček líhnou samičky a z neoplozených vajíček X se partenogeneticky líhnou samečci, kteří vytvářejí spermie s chromozomem X. Chromozom Y se zde nevyskytuje. 7 Dědičnost vázaná na pohlaví Na gonozomech rozlišujeme úseky heterologické a úseky homologické. Heterologické úseky: určují znaky úplně pohlavně vázané Homologické úseky: určují znaky neúplně pohlavně vázané, tzn. platí zde Mendelovy zákony Neúplně pohlavně vázané znaky jsou určeny geny ležícími v homologických úsecích chromozomů (např. barvoslepost, slepota). Pro tyto geny platí stejná pravidla jako pro geny autozomální. Geny ležící v heterologickém úseku chromozomu Y určují znaky holandrické, např. nadměrné ochlupení ušního boltce apod. Geny nesené chromozomem Y se předávají pouze samcům (heterogametické pohlaví). Vykazují dědičnost přímou. Geny ležící v heterologickém úseku chromozomu X vykazují tzv. X-chromozomální dědičnost 8

5 X chromozomální dědičnost a) červenooká samička + bělooký sameček Rodiče: Y gamety: X X Y 9 Potomci: X X X chromozomální dědičnost b) bělooká samička + červenooký sameček dědičnost křížem Rodiče: gamety: X Y 10 Potomci: X Y X Y

6 X chromozomální dědičnost c) červenooká samička + červenooký sameček X gamety gamety X X Y X Y 11 X chromozomální dědičnost d) červenooká samička + bělooký sameček X Y gamety gamety X Y X Y 12

7 Geny umístěné na X chromozomu hemofilie daltonismus chybění potních žlázek (anhydrotická ektodermální dyzplazie) svalová dystrofie syndrom fragilního chromozomu X 13 Otec dívky je postižen hemofilií, zatímco matka je zdráva a pochází z rodiny, ve které se tato choroba nikdy nevyskytla. Co můžeme očekávat v tomto směru u synů i dcer této dívky, jestliže se provdá za zdravého muže? 14 Y X X nebo Y nebo 1 : 1

8 15 Tvůj strýc z matčiny strany je hemofilik. Jakou pravděpodobnost vzniku hemofilie má tvůj syn? Ostatní příbuzní jsou zdraví. Ty = X ty X 3: 1 tj. 25 % X Y? Y 12,5 % Ty = ty Y 16? záleží na partnerce!

9 Vliv pohlaví znaky na pohlaví vázané znaky pohlavně ovlivněné geny leží v autozómech projev je vázán na přítomnost pohlavních chromozómů př. sekundární pohlavní znaky, alopecie PP plešatý muž i žena Pp plešatý muž Pp nikdo není plešatý 17 Mimojaderná dědičnost Mgr. Aleš RUDA

10 Mimojaderná dědičnost geny uložené mimo jádro mitochondrie chondriongeny plastidy plastogeny cytoplazma plazmogeny prokaryota - plazmidy plazmon matroklinní dědičnost př. porucha tvorby chlorofylu = panašování 19

GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních


Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto


Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u


Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi


Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním


VY_32_INOVACE_11.18 1/6 Genetika Genetika

VY_32_INOVACE_11.18 1/6 Genetika Genetika 1/6 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


Molekulární genetika: Základní stavební jednotkou nukleových kyselin jsou nukleotidy, které jsou tvořeny

Molekulární genetika: Základní stavební jednotkou nukleových kyselin jsou nukleotidy, které jsou tvořeny Otázka: Molekulární genetika, genetika buněk Předmět: Biologie Přidal(a): jeti52 Molekulární genetika: Do roku 1953 nebylo přesně známa podstata genetické informace, genů, dědičnosti,.. V roce 1953 Watson


Stavba chromozomů Lidský karyotyp

Stavba chromozomů Lidský karyotyp Přípravný kurz z biologie 5 Stavba chromozomů Lidský karyotyp 3. 12. 2011 Mgr. Kateřina Caltová Stavba chromozomů Lidský karyotyp Chromozom buněčná struktura v jádře eukaryotních buněk řec. chroma = barva,


2. provede umělé oplození vajíčka za účelem jiným, než dosažení těhotenství u ženy, od níž vajíčko pochází,

2. provede umělé oplození vajíčka za účelem jiným, než dosažení těhotenství u ženy, od níž vajíčko pochází, Spolková republika Německo Dodatek Zákon na ochranu embryí Embryonenschutzgesetz z 13. prosince 1990 1 Zneužití reprodukčních technik (1) Trestem odnětí svobody až na tři roky nebo peněžitým trestem bude


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA


Dědičnost pohlaví a znaků s pohlavím souvisejících

Dědičnost pohlaví a znaků s pohlavím souvisejících Dědičnost pohlaví a znaků s pohlavím souvisejících Rozmnožování Nepohlavní amixis, bez zvýšení genotypové proměnlivosti Pohlavní amfimixis střídání 2n a n fáze, zvýšení genotypové proměnlivosti Hermafrodité:


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


Rozmnožovací soustava

Rozmnožovací soustava Všechny živé organizmy mají schopnost se rozmnožovat. Rozmnožování umožňuje rozmnožovací soustava (též pohlavní soustava či reprodukční systém). Rozmnožovací soustavu tvoří pohlavní orgány s pohlavními


Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21

Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21 Glosář - Cestina alely aneuploidie asistovaná reprodukce autozomálně dominantní autozomálně recesivní BRCA chromozom chromozomová aberace cytogenetický laborant de novo Různé formy genu, které se nacházejí


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům

=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům Otázka: Genetika Předmět: Biologie Přidal(a): t.klodnerova REALIZACE GENETICKÉ INFORMACE, MUTACE, ZÁKLADNÍ GENETICKÉ POJMY: GEN, ZNAK, ALELA, GENOTYP, FENOTYP, HOMOZYGOT, HETEROZYGOT, HYBRIDIZACE, DOMINANCE,


REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce?

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce? REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince Co bylo dřív? Slepice nebo vejce? Rozmnožování Rozmnožování (reprodukce) může být nepohlavní (vegetativní, asexuální) pohlavní (sexuální;


A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům Karlova univerzita, Lékařská fakulta Hradec Králové Obor: všeobecné lékařství - test z biologie Vyberte tu z nabídnutých odpovědí (1-5), která je nejúplnější. Otázka Odpověď 1. Mezi organely membránového


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


Otázka: Genetika. Předmět: Biologie. Přidal(a): - GENETIKA

Otázka: Genetika. Předmět: Biologie. Přidal(a): - GENETIKA Otázka: Genetika Předmět: Biologie Přidal(a): - GENETIKA = nauka o dědičnosti a proměnlivosti organismů Dědičnost Schopnost organismů předávat určité znaky potomkům Zabezpečuje stálost druhu Způsobuje



GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým


Základy molekulární a buněčné biologie. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy molekulární a buněčné biologie. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy molekulární a buněčné biologie Přípravný kurz Komb.forma studia oboru Všeobecná sestra Genetický aparát buňky DNA = nositelka genetické informace - dvouvláknová RNA: jednovláknová mrna = messenger


http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků


Projekt realizovaný na SPŠ Nové Město nad Metují

Projekt realizovaný na SPŠ Nové Město nad Metují Projekt realizovaný na SPŠ Nové Město nad Metují s finanční podporou v Operačním programu Vzdělávání pro konkurenceschopnost Královéhradeckého kraje Modul 02 Přírodovědné předměty Hana Gajdušková 1 Viry


Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných


Sylabus kurzu: Biologie

Sylabus kurzu: Biologie Sylabus kurzu: Biologie Výchozí úroveň studentů: Vědomosti z biologie na gymnaziální úrovni Cílová úroveň studentů: Cílem je zopakovat a prohloubit vědomosti v oblasti biologie nabyté na gymnáziu, případně



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě Otázka: Genetika I Předmět: Biologie Přidal(a): Paris -věda, která se zabývá dědičností a proměnlivostí -zakladatelem je Johan Gregor Mendel (1822 1884), který se narodil v Hynčicích na Moravě 1. MOLEKULÁRNÍ


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni

Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Hemofilie Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Definice hemofilie Nevyléčitelná vrozená krvácivá choroba s nedostatkem plazmatických faktorů FVIII hemofile A FIX hemofile


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI


Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci


DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 3 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 02.06.2014 Ročník: 6AF, 6BF Anotace DUMu: chromatin - stavba, organizace a struktura



GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou


Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením


CZ.1.07/1.5.00/ Zefektivnění výuky prostřednictvím ICT technologií III/2 - Inovace a zkvalitnění výuky prostřednictvím ICT

CZ.1.07/1.5.00/ Zefektivnění výuky prostřednictvím ICT technologií III/2 - Inovace a zkvalitnění výuky prostřednictvím ICT Autor: Mgr. Barbora Blažková Tematický celek: Základy ekologie Cílová skupina: 1. ročník SŠ Anotace Kontrolní test navazuje na prezentaci, která seznámila žáky se základy buněčné teorie, s druhy buněk,



http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;



ROZMNOŽOVÁNÍ A VÝVIN MNOHOBUNĚČNÝCH, TKÁNĚ ROZMNOŽOVÁNÍ A VÝVIN MNOHOBUNĚČNÝCH, TKÁNĚ 1. Doplň následující věty. Pohlavní buňky u fylogeneticky nižších živočichů vznikají z nediferenciovaných buněk. Přeměna těchto buněk v buňky pohlavní je určována


Rozmnožování a vývoj živočichů

Rozmnožování a vývoj živočichů Rozmnožování a vývoj živočichů Rozmnožování živočichů Rozmnožování - jeden z charakteristických znaků organizmů. Uskutečňuje se pohlavně nebo nepohlavně. Nepohlavní rozmnožování - nevytvářejí se specializované


Genetika člověka - reprodukce

Genetika člověka - reprodukce Gymnázium Václava Hraběte Školní rok 2015/2016 Genetika člověka - reprodukce Seminární práce z biologie autor práce: Andrea Jirásková; 8.A vedoucí práce: RNDr. Roman Slušný Prohlášení Prohlašuji tímto,


Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol 20.5.2015 Popis klinických příznaků, možnosti léčby Muži: střední až těžká mentální



TYPY DĚDIČNOSTI GONOSOMÁLNÍ DĚDIČNOST TYPY DĚDIČNOSTI GONOSOMÁLNÍ DĚDIČNOST DĚDIČNOST POHLAVNĚ VÁZANÁ geny lokalizované na pohlavních chromozomech X nebo Y řídí vznik nejen primárních pohlavních znaků přenos genů na potomky je vázán na přenos


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Chromozomová teorie dědičnosti KBI / GENE Mgr. Zbyněk Houdek Proč octomilka a T.H. Morgan? Drosophila melanogaster ideální objekt pro genetický výzkum : Rychlý reprodukční cyklus a snadný chov v laboratorních


NUKLEOVÉ KYSELINY. Složení nukleových kyselin. Typy nukleových kyselin:

NUKLEOVÉ KYSELINY. Složení nukleových kyselin. Typy nukleových kyselin: NUKLEOVÉ KYSELINY Deoxyribonukleová kyselina (DNA, odvozeno z anglického názvu deoxyribonucleic acid) Ribonukleová kyselina (RNA, odvozeno z anglického názvu ribonucleic acid) Definice a zařazení: Nukleové



http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


- vytvoření speciálních buněk (gamety), vznikají meiózou (redukční dělení) v pohlavních orgánech

- vytvoření speciálních buněk (gamety), vznikají meiózou (redukční dělení) v pohlavních orgánech Otázka: Pohlavní rozmnožování Předmět: Biologie Přidal(a): Pípi - většina živočichů - vytvoření speciálních buněk (gamety), vznikají meiózou (redukční dělení) v pohlavních orgánech 1) Prvoci k obohacení


Variace Vývoj dítěte

Variace Vývoj dítěte Variace 1 Vývoj dítěte 21.7.2014 16:25:04 Powered by EduBase BIOLOGIE ČLOVĚKA VÝVOJ DÍTĚTE OPLOZENÍ A VÝVOJ PLACENTY Oplození K oplození dochází ve vejcovodu. Pohyb spermií: 3-6 mm za minutu. Životnost


Chromosomové změny. Informace pro pacienty a rodiny

Chromosomové změny. Informace pro pacienty a rodiny 12 Databáze pracovišť poskytujících molekulárně genetická vyšetření velmi častých genetických onemocnění v České republice (CZDDNAL) www.uhkt.cz/nrl/db Chromosomové změny Unique - Britská svépomocná skupina


Číslo a název projektu Číslo a název šablony

Číslo a název projektu Číslo a název šablony Číslo a název projektu Číslo a název šablony DUM číslo a název CZ.1.07/1.5.00/34.0378 Zefektivnění výuky prostřednictvím ICT technologií III/2 - Inovace a zkvalitnění výuky prostřednictvím ICT SSOS_ZE_1.05


Rozmnožování živočichů

Rozmnožování živočichů Biologie I 13. přednáška Rozmnožování živočichů Rozmnožování v živočišné říši 13/2 Rozmnožování v živočišné říši Nepohlavní (asexuální) nový jedinec shodný s genotypem 1 rodiče (klony) Pohlavní (sexuální)


Chromozomální aberace nalezené u párů s poruchou reprodukce v letech

Chromozomální aberace nalezené u párů s poruchou reprodukce v letech Chromozomální aberace nalezené u párů s poruchou reprodukce v letech 2000-2005 Jak přistupovat k nálezům minoritních gonozomálních mozaik? Šantavá A., Adamová, K.,Čapková P., Hyjánek J. Ústav lékařské


MUTACE mutageny: typy mutací:

MUTACE mutageny: typy mutací: MUTACE charakteristika: náhodné změny v genotypu organismu oproti normálu jsou poměrně vzácné z hlediska klinické genetiky, jsou to právě mutace, které způsobují genetické choroby nebo nádorové bujení


MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák MENDELISMUS Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák 1822-1884 In the ten years G. Mendel worked on his plants in the garden of the monastery, he made the greatest discovery in biology that


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat


Dedičnosť a pohlavie 45

Dedičnosť a pohlavie 45 Dedičnosť a pohlavie 45 5. DEDIČNOSŤ A POHLAVIE Kľúčové slová: autozómy, Barrovo teliesko, gonozómy, gynandromorfizmus, heterogametické pohlavie, heterochromozómy, holandrická dedičnosť, homogametické


Střední průmyslová škola a Vyšší odborná škola technická Brno, Sokolská 1

Střední průmyslová škola a Vyšší odborná škola technická Brno, Sokolská 1 Střední průmyslová škola a Vyšší odborná škola technická Brno, Sokolská 1 Šablona: Název: Téma: Autor: Číslo: Anotace: Inovace a zkvalitnění výuky prostřednictvím ICT Soustavy člověka Orgány pohlavní soustavy


Proč je dobré studovat genetické procesy na úrovni buňky? Například proto, že odchylky počtu nebo struktury chromozomů mohou způsobit:

Proč je dobré studovat genetické procesy na úrovni buňky? Například proto, že odchylky počtu nebo struktury chromozomů mohou způsobit: Cytogenetika Proč je dobré studovat genetické procesy na úrovni buňky? Například proto, že odchylky počtu nebo struktury chromozomů mohou způsobit: mentální nebo psychomotorickou retardaci, poruchy vývoje


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Jméno autora: Mgr. Hana Vlková Datum: 5. 3. 2012 Ročník: 6. A Vzdělávací oblast: Člověk a příroda Vzdělávací obor: Přírodopis Tematický okruh:

Jméno autora: Mgr. Hana Vlková Datum: 5. 3. 2012 Ročník: 6. A Vzdělávací oblast: Člověk a příroda Vzdělávací obor: Přírodopis Tematický okruh: Jméno autora: Mgr. Hana Vlková Datum: 5. 3. 2012 Ročník: 6. A Vzdělávací oblast: Člověk a příroda Vzdělávací obor: Přírodopis Tematický okruh: Třídění bezobratlých živočichů Téma: Šestinozí Metodický list/anotace:


Determinace pohlaví a evoluce pohlavních chromosomů

Determinace pohlaví a evoluce pohlavních chromosomů Determinace pohlaví a evoluce pohlavních chromosomů Radka Reifová Katedra zoologie Prezentaci naleznete na: http://web.natur.cuni.cz/~radkas/ v záložce Courses Jak vznikají dvě pohlaví Mechanismy determinace


GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D.

GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D. GENETIKA Mendelistická dědičnost 2014 Doc. MVDr. Eva Bártová, Ph.D. Nauka o DĚDIČNOSTI (HEREDITA) a PROMĚNLIVOSTI (VARIABILITA) termín genetika poprvé použil v r. 1905 W. BATESON název genetika odvozen


Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina

Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina Přehled GMH Seminář z biologie GENETIKA Molekulární genetika Základní dogma molekulární biologie Základním nosičem genetické informace je molekula DNA. Tato molekula se může replikovat (kopírovat). Informace


Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským


Inovace studia molekulární. a buněčné biologie

Inovace studia molekulární. a buněčné biologie Inovace studia molekulární I n v e s t i c e d o r o z v o j e v z d ě l á v á n í a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním



TERATOGENEZA ONTOGENEZA TERATOGENEZA ONTOGENEZA Vrozené vývojové vady (VVV) Jsou defekty orgánů, ke kterým došlo během prenatálního vývoje plodu a jsou přítomny při narození jedince. Postihují v různém rozsahu okolo 3-5 % novorozenců.


Dědičnost kvantitativních znaků. Proměnlivost a dědivost. Mutace

Dědičnost kvantitativních znaků. Proměnlivost a dědivost. Mutace Přehled GMH Seminář z biologie Genetika 3 Dědičnost kvantitativních znaků Kvantitativní znaky mají kontinuální proměnlivost a jsou polygenní. Za velikost znaku je většinou zodpovědný systém několika genů


Z testu bylo získáno -1,98 z maximálních 50 b., tj. dle nastavení přepočtená úspěšnost 0,00 %.

Z testu bylo získáno -1,98 z maximálních 50 b., tj. dle nastavení přepočtená úspěšnost 0,00 %. 1 z 5 Náhled testu Biologie LDF ZS 2010/2011 V náhledu testu vidíte test tak, jak jej uvidí studenti. Z testu bylo získáno -1,98 z maximálních 50 b., tj. dle nastavení přepočtená úspěšnost 0,00 %. číslo


VÝVOJ POHLAVNÍHO ÚSTROJÍ Určení pohlaví obecně Určení pohlaví u člověka Stadium indiferentní (gonáda, vývody, zevní pohlavní orgány) Diferenciace v po

VÝVOJ POHLAVNÍHO ÚSTROJÍ Určení pohlaví obecně Určení pohlaví u člověka Stadium indiferentní (gonáda, vývody, zevní pohlavní orgány) Diferenciace v po VÝVOJ POHLAVNÍHO ÚSTROJÍ Určení pohlaví obecně Určení pohlaví u člověka Stadium indiferentní (gonáda, vývody, zevní pohlavní orgány) Diferenciace v pohlaví mužské či ženské Určení pohlaví obecně Genetické


Buňka. základní stavební jednotka organismů

Buňka. základní stavební jednotka organismů Buňka základní stavební jednotka organismů Buňka Buňka je základní stavební a funkční jednotka těl organizmů. Toto se netýká virů (z lat. virus jed, je drobný vnitrobuněčný cizopasník nacházející se na


Genetické příčiny sterility a infertility v ambulantní gynekologické praxi. Šantavý J., Čapková P., Šantavá A., Kolářová J., Adamová K., Vrtěl R.

Genetické příčiny sterility a infertility v ambulantní gynekologické praxi. Šantavý J., Čapková P., Šantavá A., Kolářová J., Adamová K., Vrtěl R. Genetické příčiny sterility a infertility v ambulantní gynekologické praxi Šantavý J., Čapková P., Šantavá A., Kolářová J., Adamová K., Vrtěl R. Infertilita Definice: Neschopnost otěhotnět v průběhu jednoho


Hemofilie dnes. Investice do rozvoje a vzdělávání Operační program Vzdělávání pro konkurenceschopnost

Hemofilie dnes. Investice do rozvoje a vzdělávání Operační program Vzdělávání pro konkurenceschopnost Hemofilie dnes Investice do rozvoje a vzdělávání Operační program Vzdělávání pro konkurenceschopnost Zdroje: Evropský sociální fond v ČR Evropská unie Ministerstvo školství, mládeže a tělovýchovy OPVK


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


Šablona: III/2. Pořadové číslo: 13

Šablona: III/2. Pořadové číslo: 13 Registrační číslo projektu: CZ.1.07/1.4.00/21.3075 Šablona: III/2 Sada: VY_32_INOVACE_9IS Pořadové číslo: 13 Ověření ve výuce Třída: 7.A Datum: 19.11.2013 1 Obojživelníci rozmnožování, vývin Předmět: Ročník:


rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu Genealogie Monogenní dědičnost rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu onemocnění v rodině Genealogické


Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):


Klinefelterův syndrom

Klinefelterův syndrom Klinefelterův syndrom Vypracovali: Nikola Hrdá, Jakub Mušuka, Tereza Navrátilová, Peter Slodička, Eva Štefániková, Štefan Šuška, Nikola Tkáčová, Vojtěch Svízela Klinefelterův syndróm genetické onemocnění,


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém


1. Virus je: a) buněčný organismus b) složený z nukleové kyseliny a kapsidu c) infekční bílkovina d) bakteriální organismus

1. Virus je: a) buněčný organismus b) složený z nukleové kyseliny a kapsidu c) infekční bílkovina d) bakteriální organismus 1. Virus je: a) buněčný organismus b) složený z nukleové kyseliny a kapsidu c) infekční bílkovina d) bakteriální organismus 2. Ukládání organických látek do buněčné stěny rostlinné buňky označujeme jako:


7. Rozmnožování a vývoj živočichů: osemenění, oplození a embryogeneze

7. Rozmnožování a vývoj živočichů: osemenění, oplození a embryogeneze 7. Rozmnožování a vývoj živočichů: osemenění, oplození a embryogeneze Morfologie, histologie a ontogeneze rostlin a živočichů: Část 2: histologie a vývoj živočichů Osemenění (inseminace) = uvedení spermií


Základy buněčné biologie

Základy buněčné biologie Maturitní otázka č. 8 Základy buněčné biologie vypracovalo přírodozpytné sympózium LP, AM & DK na konferenci v Praze, 1. Máje 2014 Buňka (cellula) je nejmenší známý útvar, který je schopný všech životních


Výchova ke zdraví poučení. o lidském těle. A-Z kviz finále T U V W X Z Ž

Výchova ke zdraví poučení. o lidském těle. A-Z kviz finále T U V W X Z Ž Výchova ke zdraví poučení A o lidském těle B C A-Z kviz finále D E F G H Ch I J K L M N O P R Ř S Š T U V W X Z Ž Trvalé osvojení dítěte se nazývá A adopce správná odpověď náhradní otázka Porucha stravování,


Význam genetického vyšetření u pacientů s mentální retardací

Význam genetického vyšetření u pacientů s mentální retardací Význam genetického vyšetření u pacientů s mentální retardací Šantavá, A., Hyjánek, J., Čapková, P., Adamová, K., Vrtěl, R. Ústav lékařské genetiky a fetální medicíny FN a LF UP Olomouc Mentální retardace





Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.
