Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková

Rozměr: px
Začít zobrazení ze stránky:

Download "Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková"


1 Metody detekce a identifikace MO se zaměřením na PCR a její variace Kamila Zdeňková

2 Metody detekce a identifikace MO rozdělení metod pro mikrobiologické zkoušení potravin přehled rychlých metod detekce MO metody založené na polymerásové řetězové reakci (PCR) biočipy (microarrays nebo arrays) real on time PCR digitální PCR normativní postupy zahrnující PCR

3 Metody pro mikrobiologické Klasické kultivační metody zkoušení potravin metody uvedené v Nařízení Komise (ES) č.2073/2005 v platném znění jsou metody referenční a jejich použití je nezbytné pro úřední kontrolu potravin téměř všechny vydány jako ČSN ISO, ČSN EN nebo ČSN EN ISO vydává a seznam platných norem udržuje ÚNMZ (Úřad pro normalizaci, metrologii a státní zkušebnictví) alternativní metody mohou být použity pro ostatní účely a tehdy, pokud byly validovány postupem podle EN mezinárodně uznávanými organizacemi Rozdělení metod: Kvalita Ano či ne Kvantita Kolik

4 Česká technická norma ICS Únor 2006 Mikrobiologie potravin a krmiv - Horizontální metody pro průkaz a stanovení počtu bakterií čeledi Enterobacteriaceae - Část 2: Technika počítání kolonií ČSN ISO ICS Únor 2006 Microbiology of food and animal feeding stuffs - Horizontal methods for the detection and enumeration of Enterobacteriaceae - Part 2: Colony count method Microbiologie des aliments - Méthodes horizontales pour la recherche et le dénombrement de Enterobacteriaceae - Partie 2: Méthode par la comptage des colonies Mikrobiologie von Lebensmitteln und Futtermitteln - Horizontale Verfahren für den Nachweis und für die Zählung von Enterobacteriaceae - Teil 2: Koloniezahlverfahren Tato norma je českou verzí mezinárodní normy ISO :2004. Mezinárodní norma ISO :2004 má status české technické normy. This standard is the Czech version of the International Standard ISO :2004. The International Standard ISO :2004 has the status of a Czech Standard. Nahrazení předchozích norem Touto normou spolu s ČSN ISO z února 2006 se nahrazuje ČSN ISO 8523 ( ) z října 1995 a ČSN ISO 7402 ( ) z října 1995.

5 Klasické versus rychlé metody stanovení mikroorganismů v potravinách Klasické metody stanovení závazné normy (ČSN, ISO) či standardní operační postupy (SOP) dobře charakterizované, akceptované náročné na materiál a práci zdlouhavé 2-10 dní Rychlé metody stanovení doba trvání do 24 h vhodné pro orientační rozbor většího množství vzorků náročné na přístrojové vybavení positivní nález musí být potvrzen normovanou metodou pro daný MO

6 Přehled metod používaných pro detekci MO Horizontální metody ISO normy Klasické kultivační metody, ISO normy PCR Molekulárně-biologické metody (detekce DNA, případně RNA) Detekce proteinu založené na interakci antigenu s protilátkou Ostatní metody Polymerázová řetězová reakce (PCR) a její variace (multiplex, nested apod.), reversní transkripce PCR (RT PCR), sekvenace PCR s fluorescenční detekcí v reálném čase (qpcr), digitální PCR (dpcr) Genotypizační metody (AFLP, RFLP, PCR-RFLP, PFGE atd. ELISA (Enzymová imunoanalýza na pevné fázi ) Imunochromatografická technika na membráně Imumomagnetická separace Aglutinace Imunosenzory MALDI-TOF-MS, VIDAS, impedanční metody, stanovení značeného substrátu (CO 2 ), stanovení ATP luminiscenčně, Limulův test atd.

7 I II Centrální dogma molekulární biologie popisuje cestu přenosu informace v biologických systémech DNA: nositelka dědičnosti RNA: realizace genetické informace (čili exprese genu) III I II III Replikace Transkripce Translace Literature and sources used Edited by

8 Literatura a použité zdroje Obrázky: Polymerasová řetězová reakce (angl. Polymerase Chain Reaction PCR) Navržena Kary B. Mullisem roku 1983 Nobelovou cenou udělena roku 1993

9 Polymerasová řetězová reakce (angl. Polymerase Chain Reaction PCR) in vitro reakce umožňující amplifikaci DNA katalyzována termostabilní DNA polymerasou k namnožení cílového úseku používá oligonukleotidových primerů 1. Vlastní PCR - cyklické opakování 3 kroků Fáze Prů bě h DENATURACE tepelné oddě lení vláken dvojšroubovice DNA Teplota C 2. ANNEALING př ipojení primerů úsek seků m v DNA k jejich komplementárn rním C 3. ELONGACE prodlouž ení primerů polymerasou 72 C

10 Polymerasová řetězová reakce (angl. Polymerase Chain Reaction PCR) Denaturace Nasedání primerů Prodlužování primerů Literatura a použité zdroje Obrázek: Andy Vierstraete (1999)

11 PCR. Literature and sources used Andy Vierstraete (1999)

12 PCR teoretická účinnost reakce - 100% teoreticky dochází v každém cyklu ke zdvojnásobení N; N=N0*2^n No=1 No=10 n 2^n ,43597E ,09951E+12 1,09951E+12 1,09951E+13 N = počet molekul DNA v n-tém reakčním cyklu N 0 = počet molekul DNA v 0-tém reakčním cyklu (na začátku reakce) n = počet cyklů

13 Reakční směs (mastermix, MM) složka deionizovaná voda reakční pufr Mg 2+ dntp (dctp, datp, dttp, dgtp) primer A, primer B DNA polymerasa templát DNA funkce bez DNas, RNas vhodné prostředí pro polymerasu (iontová síla, ph) vazba s nukleotidy kofaktor polymerasy, (MgCl 2, MgSO 4 ) nukleotidy - stavební kameny polymerace synteticky připravené oligonukleotidy o délce nukleotidů, ohraničení amplifikovaného úseku termostabilní DNA polymerasa, polymerace DNA izolovaná z buněk, plazmidová DNA (genomové knihovny), buněčný extrakt podrobený lýzi

14 Reakční směs (koncentrace) složka obvyklá koncentrace v reakční směsi nízká koncentrace vysoká koncentrace templát DNA 0,01 ng-1000ng (plazmid-genomová DNA) nízký výtěžek nízká specifita nasedání primerů přítomnost inhibitorů PCR reakce- EDTA, heparin, (PO 4 ) 3- primer A 0,1-1µM nízký výtěžek nízká specifita nasedání primer B 0,1-1µM primerů DNA polymerasa Mg 2+ Reakční pufr dntp (dctp, datp, dttp, dgtp) 0,01-0,05 U/µl nízký výtěžek nízká specifita 1-5mM (množství Mg 2+ je přímo úměrné množství dntp) 10mM Tris-HCl, 50mM KCl 200µM pro každý nukleotid nízký výtěžek ph<7 poškození templátu vyšší přesnost nízká přesnost DNA polymerasy stabilizace ds DNA neúplná renaturace nižší výtěžek stabilizace nespecifické vazby primerů-nespecifické chybné zařazení

15 Reakční cyklus (teplotní a časový profil) proces T ( C) t cykly Počáteční denaturace C 2-5min přerušení vodíkových vazeb (hlavně genomová DNA), denaturovaná vlákna obsazena primery (nadbytek) Denaturace 95 C 30s-1min N=25-30, max. 40 teplota dle délky produktu, typu termocycleru, zkumavek nízká teplota = při ochlazení renaturace vysoká teplota = tepelné poškození templátu, hlavně u delších produktů (chyby) Annealing C 1min optimální T a (teplota annealingu) je blízká tzv. teplotě tání primerů = teplota 50% disociace duplexu primer/templát (různé vzorce, záleží na obsahu CG a TA) oba primery by měly mít podobnou T a stejná specifita nasedání vysoká teplota = primer nenasedá nízká teplota = primer nasedá nespecificky teplota dle množství templátu: dostatek s, málo déle (musí najít svůj úsek) Elongace 72 C 45s-3min teplota optimální pro DNA polymerasu, teplota podle délky fragmentu Závěrečná elongace 72 C 5-15 min dokončení nedosyntetizovaných řetězců hybridizace komplementárních vláken

16 DNA polymerasy Taq DNA polymerasa termofilní bakterie Thermus aquaticus (nyní rekombinantně) aktivní při pokojové teplotě nutnost pracovat na ledu při teplotách nad 90 C je inaktivní, ale při ochlazení se znovu aktivuje pouze 5 exonukleasová aktivita (degradace Okazakiho fr.), nikoliv 3 exonukleasová aktivita (proofreading) 1 chyba na 10-20tisíc nukleotidů Další typy polymeras Proofreading polymerasy (3 exonukleázová aktivita) = oprava reverzní transkripce (Mn 2+ ) nebo polymerázová aktivita (Mg 2+ ) v závislosti na přítomných kofaktorech Hot start polymerasy = ovlivnění začátku reakce Platinum Taq DNA Polymerasa Proofreading polymerasy Tth Tma Deep Vent TM Tli Pfu Pwo Thermus thermophilus HB-8 Thermotoga maritima Pyrococcus sp. Thermococcus litoralis Pyrococcus furiosus Pyrococcus woesei

17 Hot-start PCR technika, která snižuje nespecifické amplifikace při přípravě mastermixu při pokojové teplotě byly vyvinuty specializované enzymatické systémy, které inhibují polymerázovou aktivitu enzymu při pokojové teplotě vazbou protilátky v přítomnosti kovalentně vázaných inhibitorů odloučí až po zahřátí enzymu Platinum Taq DNA Polymerasa je rekombinantní Taq DNA polymerasa dodávána v komplexu s protilátkou, která inhibuje polymerázovou aktivitu při pokojové teplotě. DNA polymeráza se aktivuje vysokou teplotou (při 94 C) v průběhu počáteční denaturace PCR jakmile se polymeráza oddělí od inhibitoru znovu získá svou aktivitu v plném rozsahu

18 Primery oligonukleotidy o délce nukleotidů bez intramolekulárních komplementárních sekvencí tvorba sekundárních struktur vyrovnaný poměr GC a AT 3 konce primerů - probíhá od nich syntéza neměly by být vzájemně komplementární tvorba a amplifikace dimerů na 3 konci by neměl být tymin (nízká specifita párování), degenerace kodonu na 3 konci by neměly být více jak dva G či C-vysoká stabilita (3 vodíkové vazby)-nespecifické produkty (nasednutí i při nekomplementaritě zbytku) často na 3 konci tzv. GC svorka (zakončení GC)-zvýšení účinnosti hybridizace k templátu 3 konec nutná komplementarita k templátu 5 konce primerů sekvence nemusí zcela odpovídat vložení restrikčního místa, detekce mutace, různé značky

19 Primery amplifikace ne zcela známé sekvence či sekvence s variabilními pasážemi = degenerované primery směs primerů lišící ve variabilním místě zařazení inosinu (páruje se se všemi bazemi) či tyminu (nízká specifita k A) GAYTST GHGKAG

20 amplifikace genu Primer, kterým začíná 5 -konci řetězce genu a v průběhu PCR se elonguje ve směru transkripce, se označuje jako kódující = forward primer (5 primer, upstream primer). Vznikající sekvence identická se sekvencí kodonového vlákna. 3 primer nasedá na 3 konec genu, nasedá na kodonové (+) vlákno. Vznikající sekvence identická se sekvencí antikodonového vlákna. degenerované primery: amplifikace ne zcela známé sekvence na místo neznámého nukleotidu zařazeno více možných variant = směs primerů lišící se v dosazené bázi celkový počet variant vynásobení počtu variant na jednotlivých pozicích případně lze zařadit inosin (páruje se se všemi bazemi) či tymin (nízká specifita k A)

21 Směr DNA produktů nejdostupnější metodou detekce produktů PCR je elektroforesa v agarosovém gelu interkalační barvivo Ethidium bromid či SYBR Green I Mr Detekovaný vzorek * - Nemodifikovaná plodina (negativní kontrola) 1 0,1% GM plodina 1000bp 429bp 2 0,5% GM plodina 3 1% GM plodina 4 2% GM plodina 500bp 100bp + + 5% GM plodina (pozitivní kontrola) Negativní a pozitivní kontroly se zařazují z důvodu odhalení případné kontaminace či technické chyby, která by mohla za konečné zkreslení výsledků. Z důvodu jistoty u celého průběhu se obě kontroly řadí mezi vzorky již na počátku celého testu. * Ústav pro referenční materiály a měření (Institute for Reference Materials and Measurements), organizace Evropské komise EC JRC,

22 Elektroforetická detekce Analýza délky vzniklých fragmentů princip molekulového síta koncentrace agarosy: princip molekulového síta velikost produktu se srovnává se standardem obsahujícím fragmenty DNA známé délky Doporučená koncenrace agarosového gelu % agarose DNA size range (bp) elektroforetická separace v polyakrylamidovém gelu na automatickém sekvenátoru přesné zjištění délky fragmentů v genotypizační metodě AFLP alespoň jeden primer musí být značen fluorescenční značkou

23 Analýza PCR produktů Analýza specifity fragmentu hybridizační analýza=hybridizace s fluorescenčně značenou sondou DNA (shoda sekvencí) Southern blot: přenos na membránu hybridizace se značenou sondou DNA (část sekvence shodná s produktem) přenos přímo (technika dot blot)=dna čipy štěpení restrikčními enzymy restrikční místo uprostřed sekvence sekvenace PCR produktu přímo (vše se sekvenuje, v případě polymorfismu nejednoznačné)- příprava jednovláknové DNA asymetrické PCR: různá koncentrace primerů (obvykle 50:1 až 100:1), po cyklech dojde k vyčerpání - tvoří se pouze jednovláknový produkt z primeru o vyšší koncentraci sekvence na tuhé fázi: primer značený biotinem + tuhá fáze pokrytá streptavidinem = navázání po zaklonování (jednoznačné) žádaný produkt lze též po elektroforéze vyříznout a po přečištění sekvenovat PCR produkt má svojí specifickou délku a sekvenci

24 Multiplex PCR PCR s násobným množstvím párů primerů Výhoda: + možnost analýzy více parametrů Nevýhoda: - zvýšení tvorby nespecifických produktů - diskriminace delších DNA fragmentů

25 Příklad multiplex PCR Mr Nt bp 101 bp 151 bp 100 bp Detekční limit duplex PCR s primery P35S 1-3 / P35S 1-5 a nost 2-3 / nost 2-5. Dráha 1: nemodifikovaná sója, dráha 2: 0,1% RR sója, dráha 3: 0,25% RR sója, dráha 4: 0,5% RR sója, dráha 5: 1% RR sója, dráha 6: 5% RR sója, Nt: beztemplátová kontrola. Mr: marker 100 bp DNA ladder, očekávaná velikost produktů: 101 a 151 bp.

26 Nested PCR dvě po sobě následující amplifikační reakce dva druhy oligonukleotidových primerů - vnitřní a vnější templát první reakce - DNA extrahovaná z vyšetřovaného vzorku templát druhé reakce - produkt získaný první amplifikací + zvýšení citlivosti a přesnosti 1. PCR 2. PCR vnější primery DNA templát cílový produkt 1. PCR vnitřní primery DNA templát (cílový produkt 1. PCR) Cílový produkt 2. PCR

27 Standardy a kontrola PCR procesu vhodné zařazení pozitivní, negativní či beztemplátové kontroly PCR procesu - negativní kontrola - necílová DNA Nt beztemplátová kontrola - sterilní voda + pozitivní kontrola - ověřená cílová sekvence negativní nebo beztemplátové kontrola: ověření možné kontaminace reagencií a používaných pomůcek pozitivní kontrola: ověření funkčnosti všech kroků vhodné zařazení beztemplátové kontroly celého procesu analýzy vzorku, tzn. nejprve je podrobena izolačnímu procesu společně s analyzovaným vzorkem (beztemplátová kontrola izolačního procesu) a dále je podrobena všem PCR procesům jako analyzovaný vzorek

28 PCR pro detekci a identifikaci MO pro sledovaný MO vznikl jedinečný produkt (komplementární primery), tzn. nevzniká stejný produkt pro jiné MO detekce patogenních bakterií: nejčastěji identifikace genů zodpovědných za projevy virulence. Listeria spp.: iap gen při vhodně nastavené reakci tvoří produkt jen bakterie rodu Listeria, druhová specifita určena velikostí amplifikovaných produktů E. coli O157: rfb gen - pro O157 somatický antigen stx1, stx2 - geny kódují produkci toxinů eaea gen (virulenční faktor intimin), hlya (enterohemolysin A)

29 Analytická PCR Co hledám? Co chci zjistit? Přítomnost specifické sekvence, specifického genu druhově specifická PCR (např. detekce patogenu Campylobacter, Staphylococcus aureus, Listeria monocytogenes apod.) deteguji délku fragmentu, mohu ověřit restrikčním štěpením více dvojic primerů multiplex PCR 1000bp 500bp 559bp Mr Nt Detekce tet(o) gen rezistence k tetracyklinu v bakterii Campylobacter A-100bp marker, 1-4-kmeny rezistentní k tetracyklinu 5-9 kmeny sensitivní k tetracyklinu 10-beztemplátová kontrola

30 typizace a identifikace bakterií na úrovni kmenů: důležité parametry při diagnostice i léčbě onemocnění a zároveň při monitorování epidemiologie infekcí (např. zeměpisné rozšíření, zdroj nákazy, hostitelská specifita, patogenita, virulence) dva typizační systémy: 1. Fenotypizace Biochemické testy 2. Genotypizace: Typizace MO 1. metody založené na porovnávání získaných vzorů DNA fragmentů, které využívají rozdílnosti ve velikosti fragmentů DNA získaných buď amplifikací genomové části DNA nebo jejich štěpením specifickými restrikčními endonukleasami, či kombinací obojího (např. AFLP, RFLP, PFGE, Rep-PCR) 2. metody založené na sekvenci, kdy jsou bakteriální kmeny rozlišeny na základě polymorfismů v DNA (např. SLST, MLST) 3. metody založené na hybridizaci DNA s próbami o známé sekvenci

31 Typizace MO fenotypový typizační systém spočívá v určení bakteriálního fenotypu na základě koloniální morfologie na různých růstových médiích, biochemických testů, sérologie, citlivosti ke killer toxinům, patogenitě a citlivosti k různým druhům antibiotik apod. V některých případech však není fenotypová typizace dostatečně účinná při určování blízce příbuzných bakteriálních kmenů genotypizace využívá rozlišení bakteriálních kmenů na základě zkoumání jejich genetického materiálu a získaný genetický profil je unikátní (můžeme jej přirovnat např. k otisku prstu, tzv. DNA fingerprint)

32 analyzovat rozdíly mezi různými DNA v rámci druhu = genotypizace (fingerprinting) DNA fingerprinting náhodným primerem štěpení DNA, připojení adaptérů, z kterých vedeno PCR 1517bp 1200bp 1000bp 800bp 500bp 4000bp 3000bp 2000bp 1500bp 1000bp 750bp 500bp REP PCR 38bp dlouhý úsek s 6 degenerovanými pozicemi (sekvencemi) srovnání vzniklých profilů A B B

33 PFGE (pulsed field gel electrophoresis) elektroforetická technika používaná při dělení velkých molekul DNA (10 kbp 10 Mbp) při klasické gelové elektroforese v konstantním elektrickém poli je možné účinně dělit fragmenty DNA do velikosti zhruba 20 kbp, protože nad touto hranicí fragmenty DNA vykazují stejnou pohyblivost a není možné je od sebe rozlišit aplikace střídavého elektrického pole ve třech různých směrech (posun vždy o 120 ), umožňuje účinné rozdělení i velkých fragmentů DNA principem této metody je opět štěpení genomové DNA restrikční endonukleasou (tentokrát však lyse buněk a štěpení DNA probíhá in situ v agarosových bločcích připravených smícháním bakteriální suspenze s rozpuštěnou agarosou) volena méně často štěpící RE, poskytující menší počet dlouhých fragmentů rozdělením fragmentů pomocí PFGE a obarvením gelu (např. v roztoku ethidiumbromidu) opět u jednotlivých kmenů získáme různé vzory bandů (profilů), jež mezi sebou velmi dobrá reprodukovatelnost a diskriminační schopnost = metoda považována za tzv. zlatý standard v oblasti genotypizačních metod

34 Pulsní gelová elektroforesa (Pulsed field gel electrophoresis, PFGE) mohou být rozděleny molekuly 10 Mb v agarosovém gelu gel je vystaven elektrickému poli, jehož směr se pod určitým úhlem ( ) v časových intervalech periodicky mění DNA periodicky mění svůj směr migrace (nutná reorientace molekuly) díky změnám orientace elektrického pole CHEF contour-clamped homogenous electrical field úhel 120 nebo 106, také 90 pro kb

35 Výhody a nevýhody PCR Výhody + nízká mez detekce 0,001% až 0,5% GMO či jednotky cílového MO + možnost sériových analýz + možnost analýz několika parametrů v jedné reakci (multiplex PCR) + malé reakční objemy (nižší cena stanovení) + možnost analýz potravinářských surovin i technologicky opracovaných potravin Nevýhody - nemožnost kvantifikace pomocí klasické metody PCR - některé sekvence podléhají patentovému zákonu (v běžné praxi jsou nedostupné pro návrh primerů) - poměrně vysoká cena základního vybavení - malé reakční objemy (náročné na zkušenost experimentátora a výběr vhodných podmínek reakce) - neschopnost odlišit živé a mrtvé buňky MO

36 RNA v buňce Ribosomes with ribosomal RNA Messenger RNA (mrna) Chromosomal DNA Bacterial cell Small RNAs multiple RNA copies for every one DNA copy, depending on the state of the cell Životnost mrna v buňce je velmi nízká u bakterií 1 až 6 minut, kvasinky okolo 20 minut mrna je v živé buňce neustále syntetizována a degradována

37 PCR kombinované s reverzní transkripcí (RT-PCR, Reverse transcription PCR) mrna cdna amplifikace genu (PCR) Reverzní transkripce Použitelné pro izolaci genu z mrna např. eukaryotní organismy, poté cdna (nejsou v ní obsaženy introny)

38 Literatura a použité zdroje RT-PCR reakce, která amplifikuje RNA namísto DNA zejména mrna: kontrola exprese, rozlišení živých a mrtvých buněk počátečním krokem je izolace celkové RNA nebo mrna z vzorku, pomocí nukleas jsou odstraněny zbytky DNA, následně je pomocí reverzní transkriptasy přepsána templátová mrna do cdna a ta je poté podrobena PCR

39 Fluorescence - aplikace Odlišení živých/mrtvých buňky - kity LIVE BacLight Bacterial Gram Stain Kit LIVE/DEAD BacLight Bacterial Viability Kit LIVE/DEAD Reduced Biohazard Cell Viability Kit #1 LIVE/DEAD Yeast Viability Kit Cíl Bakterie Kvasinky Výsledek Fluorescenční látky Standardní filtry Živé G+ se barví zeleně a živé G- se barví červeně Odlišné zbarvení je založeno na propustnosti membrán. Živé buňky se barví hlavně zeleně a mrvé buňky převážně červeně (proniknou obě barviva) Aktivní buněčné vakuoly se barví oranžově, živé i mrvé buněčné stěny modře SYTO 9 SYTO 9 SYTO 10 FUN 1 Hexidium iodid Promidium iodid Ethidium homodimer-2 Calcofluor White M2R FITC FITC FITC FITC Texas Red Texas Red Texas Red DAPI Ex/Em (nm) 480/ / / / Introduce.htm 480/ / / /440

40 Koncentrace a kvalita DNA Převážně spektrofotometricky [ng/ml] A260/A280 ratio: indicates pollution proteins, in pure DNA is 1.8 to 2.0 A260/A230 ratio: less than 1.8 indicates the presence of organic contaminants - (poly) phenols, thiocyanates, carbohydrates, urea, etc., in a clean DNA is in the range (-2, 2) Horizontální agarosová elektroforesa Lambda/HindIII marker

41 Detekce specifického genu 1000bp 500bp 559bp Mr Nt Detekce tet(o) gen rezistence k tetracyklinu v bakterii Campylobacter A-100bp marker, 1-4-kmeny rezistentní k tetracyklinu 5-9 kmeny sensitivní k tetracyklinu 10-beztemplátová kontrola

42 PCR detekce - reálný vzorek účinnost izolace DNA z potravinové matrice účinnost PCR detekce=citlivost (závislost signálu na výchozím množství templátu) DETEKČNÍ LIMIT!!!! L. monocytogenes 1kb Primery komplementární k Listeria spp bp 593 bp Primery komplementární k Listeria monocytogenes

43 BAX system Q7 validovaný systém pro detekci potravinových patogenů komerční kit pro izolaci DNA a PCR reakci validované schéma zkoušky (izolace DNA z malých objemů po pomnožení) detekce specifického produktu pomocí křivky tání (případně též Real-Time PCR aplikace)

44 BAX system Q7 Salmonella Listeria monocytogenes Genus Listeria Enterobacter sakazakii E. coli O157:H7 Staphylococcus aureus Real-time Campylobacter jejuni/coli/lari Real-time Vibrio cholerae/ parahaemolyticus/vulnificus Real-time Yeast and molds en_us/index.html

45 Provedení Vzorek Příprava vzorku Teplotní lyze PCR Detekce a analýza Není nutné použít izolovanou DNA Lyofilizované reagencie (tableta) DNA-Polymerase Primery Nukleotidy Pufr Barvička Pozitivní kontrola: interní

46 Kmen Výsledek Analýza křivky tání Izolát z masa - T [ C] E. coli (CCM 3954) - T [ C] Avirulentní EC 4787 O157:H7 (pasážovaná) - T [ C] Avirulentní EC 4787 O157:H7 + T [ C]

47 Biočipy (microarrays nebo arrays) kolekce mikroskopických spotů DNA navázaných k pevnému povrchu (např. sklo, plast nebo křemíkový čip) až tisíce krátkých DNA sond komplementárních k hledaným sekvencím založeno na klasické technologii hybridizace DNA imobilizované DNA fragmenty (sondy) mohou být kratší oligonukleotidy (20-30 bp), PCR produkty, genomová DNA, umělé bakteriální chromosomy (BAC), plazmidy nebo i dlouhé oligonukleotidy DNA biočipy jsou nejčastěji využívány k měření exprese velkého množství genů současně NK bývají izolovány z buněk, RNA je převedena na cdna nebo crna, a jsou amplifikovány pomocí PCR technik řetězec NK hybridizuje se sondou imobilizovanou na povrchu pevného nosiče, detekce je prováděna buď stříbrem, chemiluminiscenčně (pro DIG značku) nebo přímo fluorescenčně

48 Biočipy (microarrays nebo arrays) Navázaný cílový fragment Imobilizovaný DNA fragment Pevný povrch Literatura a použité zdroje Počítačový model prost. uspořádání na DNA biočipu. Převzato z

49 Kvantifikace NK pomocí PCR PCR s fluorescenční detekcí v reálném čase (qpcr, angl. Real on Time PCR) monitorování vznikajícího produktu v průběhu celého amplifikačního procesu qrt PCR je nejpřesnější a nejvýhodnější v současné době dostupná kvantitativní metoda vysoká pořizovací cena nástrojů interkalační barviva - (např. SYBR green I, Ethidium bromid) = levnější fluorescenčně značené sondy - přesnější

50 Prahový detekční cyklus C T (threshold cycle) nejnižší cyklus ve kterém hodnota fluorescence měřeného vzorku vzroste nad hodnotu fluorescence pozadí C T

51 Fluorescence reportéru ( Rn) Vzorek beztemplátová kontrola Ct Amplifikační křivka Vzorek 1: 10 6 kopií cílového úseku vzorek 2: 10 5 kopií cílového úseku vzorek 3: 10 4 kopií cílového úseku vzorek 4: 10 3 kopií cílového úseku vzorek 5: 10 2 kopií cílového úseku zelená přímka znázorňuje mezní hodnotu pozadí Počet cyklů

52 PCR teoretická účinnost reakce - 100% teoreticky dochází v každém cyklu ke zdvojnásobení N; N=N0*2^n No=1 No=10 n 2^n ,43597E ,09951E+12 1,09951E+12 1,09951E+13 N = N 0 (2) n N = počet molekul DNA v n-tém reakčním cyklu N 0 = počet molekul DNA v 0-tém reakčním cyklu (na začátku reakce) n = počet cyklů

53 Skutečná amplifikační účinnost reakce N = N 0 (1+E) n N = počet molekul DNA v n-tém reakčním cyklu N 0 = počet molekul DNA v 0-tém reakčním cyklu (na začátku reakce) E = amplifikační účinnost reakce <0,1> n = počet cyklů

54 SYBR Green I Systém SYBR Green I (SG I) interkaluje do malého žlábku dsdna fluorescence SG I se po navázání do dsdna zvýší až 1000-krát delší amplikony = vyšší fluorescenční signál detekce veškeré dsdna = nižší specifičnost systému nutnost pečlivého výběru reakčních podmínek nutná analysa křivek tání cenově dostupnější než detekce pomocí fluorescenčně značených sond

55 SYBR Green I a) b) c) a) prostředí reakce po teplotní denaturaci b) nasednutí primerů a vazba barviva c) prodlužování primerů upraveno dle

56 Křivka tání Nahoře: Křivky tání. Dole: Záporná derivace fluorescence dělená derivací teploty

57 Kalibrační a disociační křivka

58 Fluorescenční rezonanční přenos energie (FRET, angl. Fluorescence Resonance Energy Transfer) Zdroj < 2 fluorofor je excitován pomocí vhodné vlnové délky energie z dárce (donoru) je přenesena na druhý fluorofor (akceptor) excitovaný akceptor emituje světlo s vyšší vlnovou délkou

59 Real on Time PCR přesná, rychlá, univerzální metoda vhodná pro sériové analýzy vysoké pořizovací náklady

60 Digitální PCR (dpcr) Rozdělení analyzovaného vzorku do velkého počtu separátních reakčních komor Literatura a použité zdroje

61 Digitální PCR (dpcr) dosažené pomocí 1) čipu (dynamické čipy (mikrofluidika), OpenArray ) teplotní protokol jako u klasického PCR 2) maličkých kapiček nanolitrové velikosti (ang. doplet) fluorescenční detekce umožněna použitím Taqman hydrolyzačních sond (endpoint PCR, nárůst fluorescence) kvantifikace je provedena odečtem fluorescence velkého počtu individuálních reakcí (komor) na konci amplifikační reakce počítají se jednotlivé komůrky + positivní (detekce fluorescence, tzn. obsahuje cílový úsek) - negativní (nedetekuje se fluorescence, tzn. neobsahuje cílový úsek) používá se statistické vyhodnocení pomocí Poissonovo rozdělení (zákon vzácných jevů) počet cílových úseků průměrně připadající na jednu reakční komoru = - ln (1 počet pozitivních komůrek/ celkový počet analyzovaných komůrek)

62 Digitální PCR (dpcr) absolutní kvantifikace přítomnost cílového úseku je měřena přímo (není potřeba porovnání se standardní křivkou) jednoduché porovnání výsledků získaných z jednotlivých PCR běhů (dpcr počítá přímo cílové úseky, není ovlivněno různými použitými přístroji, standardní křivkou či zkušenostmi experimentátora). relativní kvantifikace provedena poměrem absolutních kvantifikací dvou cílových úseků vhodné i pro kvantifikaci nízké koncentrace cílového úseku ve vysokém množství doprovodné nukleové kyseliny citlivější než real on time PCR

63 Digitální PCR (dpcr) Rozdělení vzorku do komůrek zmenšuje (odstraňuje?) efekt přítomnosti inhibitorů amplifikační reakce. Vzorek, který by nemusel být vhodný pro kvantifikaci pomocí qpcr může být spolehlivě kvantifikován pomocí dpcr. Sestavy (angl. Arrays) 1. Dynamické čipy pro genotypování a genovou expresi (Fluidigm BioMark TM ) 2. OpenArray Real-Time PCR Systém (Life Technologie, Applied Biosystems) Droplet digital PCR (ddpcr) 1. Biorad QX100

64 Díly A-E představují sérii ředění analyzovaného vzorku cdna (1:1) Díl F je negativní kontrola Každý díl obsahuje 765 komůrek (individuální PCR reakce) Černá políčka negativní signál Červená políčka pozitivní signál (detekce fluorescence) Sloupec označený Estimated : odhad kopií cílového úseku určený pomocí qpcr Sloupec označený Biomark : odhad kopií cílového úseku pomocí dpcr Literatura a použité zdroje

65 OpenArray Real-Time PCR Systém Kombinace OpenArray Real-Time PCR Instrument a OpenArray AccuFill Systém (Applied Biosystems life technologies) Literatura a použité zdroje

66 Kapkový digitální systém PCR (ddpcr) Kapkový digitální systém PCR angl. Droplet digital PCR (ddpcr) vzorek a olej vytvoří emulzi až kapiček ( komůrek ) v analyzovaném vzorku 1. Přístroj 2. přístroj 3. přístroj emulgátor PCR termální cycler angl. droplet reader Literatura a použité zdroje a Ředění analyzovaného vzorku

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje











MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční



DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit



ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce



DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby



POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek


Hybridizace nukleových kyselin

Hybridizace nukleových kyselin Hybridizace nukleových kyselin Tvorba dvouřetězcových hybridů za dvou jednořetězcových a komplementárních molekul Založena na schopnosti denaturace a renaturace DNA. Denaturace DNA oddělení komplementárních


Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární


Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Zavedení PCR v roce 1983 (Kary B. Mullis) Nobelova cena 1993 Metodika


Molekulární genetika

Molekulární genetika Molekulární genetika Genetické inženýrství Technologie rekombinantní DNA Vektor Genomová DNA Štěpení RE Rozštěpení stejnou RE, lepivé konce Ligace Transformace Bakteriální chromozóm Rekombinantní vektor


Pokročilé biofyzikální metody v experimentální biologii

Pokročilé biofyzikální metody v experimentální biologii Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 1/1 Proč biofyzikální metody? Biofyzikální metody využívají fyzikální principy ke studiu biologických systémů Poskytují kvantitativní


Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Kamila Zdeňková Transgenní rostliny, tj. takové rostliny, do jejichž dědičného základu byly metodami genového inženýrství


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi


2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné:

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné: Výběrové otázky: 1. Součástí všech prokaryotických buněk je: a) DNA, plazmidy b) plazmidy, mitochondrie c) plazmidy, ribozomy d) mitochondrie, endoplazmatické retikulum 2. Z následujících tvrzení, týkajících


Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování


TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Přehled Molekulárně-biologický úvod, DNA struktura, replikace, DNA polymerasa Princip procesu PCR Optimalizace PCR Typy PCR Aplikace


Metody studia exprese mrna. jádro a genová exprese 2007

Metody studia exprese mrna. jádro a genová exprese 2007 Metody studia exprese mrna Buněčné jádro a genová exprese 2007 Aktivita genu je primárn ě vyjád ř ena jeho transkripcí-prvním krokem vedoucím k syntéze kódovaného proteinu. Cíle metod Ur č ení mno ž ství


J09 Průkaz nukleové kyseliny

J09 Průkaz nukleové kyseliny J09 Průkaz nukleové kyseliny VLLM0421c (jaro 2016) Osnova využití a metody průkazu NK PCR a její modifikace proces prokazování specifické sekvence NK 2/55 Přímé vs. nepřímé metody přímé hledáme mikroba,


Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 4. Metody molekulární biologie I Izolace DNA a RNA Specifické postupy pro baktérie, kvasinky, rostlinné a živočišné tkáně U RNA nutno zabránit kontaminaci


Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace


Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin


Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,


Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8


OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14 OBSAH DNA polymerázy pro PCR a pufry.................. 3 Taq DNA polymeráza 4 Taq DNA polymeráza Unis 5 TaqPurple DNA polymeráza 6 Taq DNA polymeráza 1.1 7 Combi Taq DNA polymeráza 8 LA DNA Polymerases


Izolace RNA. doc. RNDr. Jan Vondráček, PhD..

Izolace RNA. doc. RNDr. Jan Vondráček, PhD.. Izolace RNA doc. RNDr. Jan Vondráček, PhD.. Metodiky izolace RNA celková buněčná RNA ( total RNA) zahrnuje řadu typů RNA, které se mohou lišit svými fyzikálněchemickými vlastnostmi a tedy i nároky na jejich



MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Využití živých organismů pro uskutečňování definovaných chemických procesů pro průmyslové nebo komerční aplikace Organismus je geneticky upraven metodami genetického


Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2


Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie

Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie Leona Leišová Přírodovědecká fakulta UK, Praha 2009 Metody kvantifikace: Nepřímé metody odhad míry



ČESKÁ TECHNICKÁ NORMA ČESKÁ TECHNICKÁ NORMA ICS 07.100.30 Duben 2014 Mikrobiologie potravinového řetězce Horizontální metoda pro stanovení počtu mikroorganismů Část 1: Technika přelivem a počítání kolonií vykultivovaných při


Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD

Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD Dana Vejmelková, Milan Šída, Kateřina Jarošová, Jana Říhová Ambrožová VODÁRENSKÁ BIOLOGIE, 1. 2. 2017 ÚVOD Sledované parametry,


Hybridizace. doc. RNDr. Milan Bartoš, Ph.D.

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. Hybridizace doc. RNDr. Milan Bartoš, Ph.D. Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace


Bakteriologická analýza potravin

Bakteriologická analýza potravin Bakteriologická analýza potravin a. Souhrn Ve studii zaměřené na bakteriologickou analýzu potravin jsme sledovali výskyt vybraných patogenních agens v potravinách z tržní sítě. Výběr vyšetřovaných komodit


Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Modifikace PCR, sekvenování Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Multiplex PCR Reakční směs obsahuje ne jeden, ale několik párů primerů rozpoznávajících různé cílové sekvence


Mikročipy v mikrobiologii

Mikročipy v mikrobiologii Mikročipy v mikrobiologii doc. RNDr. Milan Bartoš, Ph.D. Přírodovědecká fakulta MU, 2014 Obsah přednášky 1) Charakteristika biočipů, DNA microarrays a DNA chip 2) Výroba čipů, charakteristika


1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.


Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip


Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní


4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie.

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. 4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. Od genu k proteinu - centrální dogma biologie Geny jsou zakódovány v DNA - Jakým způsobem? - Jak se projevují? Již v roce 1902


Enterotoxiny Staphylococcus aureus. Jana Kotschwarová Andrea Koťová

Enterotoxiny Staphylococcus aureus. Jana Kotschwarová Andrea Koťová Enterotoxiny Staphylococcus aureus Jana Kotschwarová Andrea Koťová Obsah Charakteristika Staphylococcus aureus Vlastnosti Faktory virulence Enterotoxiny Patogeneze Výskyt Metody stanovení Prevence výskytu


Izolace nukleových kyselin

Izolace nukleových kyselin Izolace nukleových kyselin Požadavky na izolaci nukleových kyselin V nativním stavu z přirozeného materiálu v dostatečném množství požadované čistotě. Nukleové kyseliny je třeba zbavit všech látek, které


DY D NE N X Hana Vlastníková

DY D NE N X Hana Vlastníková DYNEX Hana Vlastníková Molekulární biologie: Vybavení laboratoře na klíč Přístrojová technika Kompatibilní diagnostické soupravy Profesionální přístup SOP Technická podpora Servis Přístrojové vybavení:


Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014

Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014 Molekulárně biologické metody v mikrobiologii Mgr. Martina Sittová Jaro 2014 Harmonogram 1. den Izolace DNA 2. den Měření koncentrace DNA spektrofotometricky, real-time PCR 3. den Elektroforéza Molekulární


Aplikace molekulárně biologických postupů v časné detekci sepse

Aplikace molekulárně biologických postupů v časné detekci sepse Aplikace molekulárně biologických postupů v časné detekci sepse Mgr. Jana Ždychová, Ph.D. IKEM PLM - LLG Sepse je častou příčinou úmrtí během hospitalizace. Včasné nasazení odpovídající ATB terapie je


Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Inovace laboratorních úloh genetických předmětů metodikami pracujícími s ribonukleovými kyselinami pšenice Metodické návody pro laboratorní


Vizualizace DNA ETHIDIUM BROMID. fluorescenční barva interkalační činidlo. do gelu do pufru barvení po elfu SYBR GREEN

Vizualizace DNA ETHIDIUM BROMID. fluorescenční barva interkalační činidlo. do gelu do pufru barvení po elfu SYBR GREEN ETHIDIUM BROMID fluorescenční barva interkalační činidlo do gelu do pufru barvení po elfu Vizualizace DNA SYBR GREEN Barvení proteinů Coommassie Brilliant Blue Coomassie Blue x barvení stříbrem Porovnání


Globální pohled na průběh replikace dsdna

Globální pohled na průběh replikace dsdna Globální pohled na průběh replikace dsdna 3' 5 3 vedoucí řetězec 5 3 prodlužování vedoucího řetězce (polymerace ) DNA-ligáza směr pohybu enzymů DNA-polymeráza I DNA-polymeráza III primozom 5' 3, 5, hotový



MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Termín biotechnologie byl poprvé použit v roce 1917 Procesy, při kterých se na tvorbě výsledného produktu podílejí živé organismy Širší definice: biotechnologie


Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY ELEKTROFORÉZA K čemu to je? kritérium čistoty preparátu stanovení molekulové hmotnosti makromolekul stanovení izoelektrického


Pulzní gelová elektroforéza Při konvenční gelové elektroforéze je rozdělení molekul je podmíněno rychlejším průchodem menších molekul pórovitou

Pulzní gelová elektroforéza Při konvenční gelové elektroforéze je rozdělení molekul je podmíněno rychlejším průchodem menších molekul pórovitou Pulzní gelová elektroforéza Při konvenční gelové elektroforéze je rozdělení molekul je podmíněno rychlejším průchodem menších molekul pórovitou strukturou gelové matrice. Tento princip separace se uplatňuje


Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka


Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.:

Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.: Yi TPMT Diagnostická souprava Návod k použití Výrobce: YBUX s.r.o. Haasova 27 Brno 616 00 Česká republika IČ 63487951 tel.: +420 541 423 710 e-mail: Název: Yi TPMT Popis: Diagnostická souprava



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,


Principy a využit. ití qpcr. KBC/BAM Pokročil. rní biologie

Principy a využit. ití qpcr. KBC/BAM Pokročil. rní biologie Principy a využit ití qpcr KBC/BAM Pokročil ilé biochemické a biotechnologické metody Mgr. Mária M Šmehilová, Ph.D. UP PŘF CRH Oddělen lení molekulárn rní biologie Úvod do PCR PCR - 1984 Kary Mullis (Nobelova



Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální


STAFYLOKOKOVÉ ENTEROTOXINY. Zdravotní nezávadnost potravin. Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336

STAFYLOKOKOVÉ ENTEROTOXINY. Zdravotní nezávadnost potravin. Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336 STAFYLOKOKOVÉ ENTEROTOXINY Zdravotní nezávadnost potravin Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336 OBSAH: Základní charakteristika Staphylococcus aureus Stafylokokové enterotoxiny



ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů



ČESKÁ TECHNICKÁ NORMA ČESKÁ TECHNICKÁ NORMA ICS 07.100.30 2005 Mikrobiologie potravin a krmiv - Horizontální metoda stanovení počtu presumptivního Bacillus cereus - Technika počítání kolonií vykultivovaných při 30 C ČSN EN


TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Komponenty nukleových kyselin Nukleotid DNA deoxyguanosid monofosfát (dgmp) Koncept párování bazí je striktně konzervativní Cytosine


cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)



KVANTIFIKACE ZMĚN GENOVÉ EXPRESE KVANTIFIKACE ZMĚN GENOVÉ EXPRESE Northern bloty pracné a zdlouhavé Genové čipy nákladné; Semikvantitativní RT-PCR qpcr nepřesné metodiky real-time PCR vysoké dynamické rozpětí


TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně


Příprava rekombinantních molekul pro diagnostické účely

Příprava rekombinantních molekul pro diagnostické účely 1 Příprava rekombinantních molekul pro diagnostické účely doc. RNDr. Milan Bartoš, Ph.D. Přírodovědecká fakulta MU, 2014 2 Obsah přednášky 1) Pojem rekombinantní DNA 2) Historické milníky


Diagnostické metody v lékařské mikrobiologii

Diagnostické metody v lékařské mikrobiologii Diagnostické metody v lékařské mikrobiologii Výuková prezentace z: Lékařské mikrobiologie Jan Smíšek ÚLM 3. LF UK 2009 Princip identifikace Soubor znaků s rozdílnou diskriminační hodnotou Základní problémy


Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková Diagnostika retrovirů Lentiviry - HIV Vladislava Růžičková VI. Třída RNA-viry se zpětnou transkriptázou RT Čeleď: Retroviridae (hostitelé: Obratlovci) Rody: Alpharetrovirus Betaretrovirus Gammaretrovirus



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Environmentální aplikace molekulární biologie

Environmentální aplikace molekulární biologie Environmentální aplikace molekulární biologie Petra Jančová, Kristýna Maršálková, Jana Šerá, Hana Pištěková Ústav Inženýrství Ochrany Životního Prostředí, Fakulta Technologická, Univerzita Tomáše Bati


Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést



KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR) KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR) Metoda Real-time PCR slouží pro kvantifikaci DNA a transkripce. Metoda je založena na klasické PCR, ovšem s využitím speciálního cycleru, který v průběhu PCR



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní


Microbiology of food and animal feeding stuffs - General rules for microbiological examinations

Microbiology of food and animal feeding stuffs - General rules for microbiological examinations ČESKÁ TECHNICKÁ NORMA ICS 07.100.30 Červenec 1998 Mikrobiologie potravin a krmiv - Všeobecné pokyny pro mikrobiologické zkoušení ČSN ISO 7218 56 0103 Microbiology of food and animal feeding stuffs - General


Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží


Metody testování humorální imunity

Metody testování humorální imunity Metody testování humorální imunity Co je to humorální imunita? Humorální = látková Buněčné produkty Nespecifická imunita příklady:» Lysozym v slinách, slzách» Sérové proteiny (proteiny akutní fáze)» Komplementový



ČESKÁ TECHNICKÁ NORMA ČESKÁ TECHNICKÁ NORMA ICS 67.100.99, 07.100.30 2004 Jogurt - Identifikace charakteristických mikroorganismů - (Lactobacillus delbrueckii subsp. bulgaricus a Streptococcus thermophilus) ČSN ISO 9232 57





Detekce Leidenské mutace

Detekce Leidenské mutace Detekce Leidenské mutace MOLEKULÁRNÍ BIOLOGIE 3. Restrikční štěpení, elektroforéza + interpretace výsledků Restrikční endonukleasy(restriktasy) bakteriální enzymy štěpící cizorodou dsdna na kratší úseky


Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,



ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN Fragmenty nukleových kyselin lze dle jejich velikosti rozdělit elektroforézou. Elektroforéza využívá rozdílné pohyblivosti jednotlivých fragmentů, danou právě


Metody studia genové exprese

Metody studia genové exprese Metody studia genové exprese Ing. Lucie Němcová, Ph.D. Laboratoř vývojové biologie Transkriptom Genová exprese: Geny jsou exprimovány tehdy, jsou-li přepsány do RNA (mrna). Rozdílná


Bakteriologická analýza potravin

Bakteriologická analýza potravin a. Souhrn Bakteriologická analýza potravin Ve studii zaměřené na bakteriologickou analýzu potravin jsme sledovali výskyt vybraných patogenních agens v potravinách z tržní sítě. Výběr vyšetřovaných komodit


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Analýza transkriptomu Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s moderními metodami komplexní


Nukleové kyseliny. Nukleové kyseliny. Genetická informace. Gen a genom. Složení nukleových kyselin. Centrální dogma molekulární biologie

Nukleové kyseliny. Nukleové kyseliny. Genetická informace. Gen a genom. Složení nukleových kyselin. Centrální dogma molekulární biologie Centrální dogma molekulární biologie ukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Transkripce D R Translace rotein Mendel) Replikace 1869 objev nukleových kyselin (Miescher) 1944 nukleové kyseliny


Mikrobiologické diagnostické metody. MUDr. Pavel Čermák, CSc.

Mikrobiologické diagnostické metody. MUDr. Pavel Čermák, CSc. Mikrobiologické diagnostické metody MUDr. Pavel Čermák, CSc. Princip identifikace soubor ZNAKŮ s rozdílnou separační hodnotou S HODNOTA S: S 1 S 2 S 3 Základní problémy Minimum morfologických znaků Podobná


Centrální dogma molekulární biologie

Centrální dogma molekulární biologie řípravný kurz LF MU 2011/12 Centrální dogma molekulární biologie Nukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Mendel) 1869 objev nukleových kyselin (Miescher) 1944 genetická informace v nukleových


Elektroforéza nukleových kyselin

Elektroforéza nukleových kyselin Elektroforéza nukleových kyselin Elektroforéza nukleových kyselin je založena na tom, že NK jsou v neutrálním nebo zásaditém prostředí polyanionty. Protože se zvyšujícím se počtem nukleotidů v molekule


Struktura a funkce nukleových kyselin

Struktura a funkce nukleových kyselin Struktura a funkce nukleových kyselin ukleové kyseliny Deoxyribonukleová kyselina - DA - uchovává genetickou informaci Ribonukleová kyselina RA - genová exprese a biosyntéza proteinů Složení A stavební


Enzymy používané v molekulární biologii

Enzymy používané v molekulární biologii Enzymy používané v molekulární biologii Rozdělení enzymů 1. Podle substrátové specifity: většina metod molekulární biologie je závislá na použití enzymů, jejichž substrátem jsou nukleové kyseliny. Tyto


Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin





PP Master Mixy... 13 PPP Master Mix 14 Plain PP Master Mix 15 Combi PPP Master Mix 16 new Plain Combi PP Master Mix 17

PP Master Mixy... 13 PPP Master Mix 14 Plain PP Master Mix 15 Combi PPP Master Mix 16 new Plain Combi PP Master Mix 17 Obsah DNA polymerázy pro PCR a pufry............................... 5 Taq DNA polymeráza 6 Taq DNA polymeráza Unis 7 TaqPurple DNA polymeráza 8 Taq DNA polymeráza 1.1 9 Combi Taq DNA polymeráza 10 LA DNA


In vitro testování scaffoldů pro tkáňové inženýrství. Mgr. Jana Horáková

In vitro testování scaffoldů pro tkáňové inženýrství. Mgr. Jana Horáková In vitro testování scaffoldů pro tkáňové inženýrství Mgr. Jana Horáková 9.12.2015 Proces tkáňového inženýrství 1. Návrh nosiče Seznámení se s problematikou dané tkáně/orgánu Návrh nosiče pro danou aplikaci


Polymorfizmy detekované. polymorfizmů (Single Nucleotide

Polymorfizmy detekované. polymorfizmů (Single Nucleotide Polymorfizmy detekované speciálními metodami s vysokou rozlišovací schopností Stanovení jednonukleotidových polymorfizmů (Single Nucleotide Polymorphisms - SNPs) Příklad jednonukleotidových polymorfizmů


Bakteriologická analýza potravin

Bakteriologická analýza potravin Bakteriologická analýza potravin a. Souhrn Ve studii zaměřené na bakteriologickou analýzu potravin jsme sledovali výskyt vybraných patogenních agens v potravinách z tržní sítě. Výběr vyšetřovaných komodit


Elektroforéza Sekvenování

Elektroforéza Sekvenování Elektroforéza Sekvenování Výsledek PCR Elektroforéza V molekulární biologii se používá k separaci nukleových kyselin a bílkovin Principem je pohyb nabitých molekul v elektrickém poli Gelová, polyakrylamidová


Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 5. Metody molekulární biologie II DNA footprinting hledání interakcí DNA s proteiny Polymerázová řetězová reakce (Polymerase chain reaction PCR) Malé
