Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno

Rozměr: px
Začít zobrazení ze stránky:

Download "Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni."

Transkript

1 Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno

2 Mutace Mutace - náhodná změna v genomu organismu - spontánní např. chyba DNA polymerázy - indukované fyzikálními či chemickými faktory (mutageny) - výhodné, nevýhodné, neutrální Mutace - genové - chromosomové - genomové

3 Genové mutace děje se odehrávají na úrovni nukleotidů v molekule DNA, jsou spolu s rekombinacemi zdrojem genetické variability mezi mechanismy patří adice, delece, inzerce, substituce jednoho nukleotidu či více nukleotidů, mutace neměnící smysl proteinu mutace měnící smysl proteinu nesmyslné mutace nefunkční protein např. srpkovitá anémie, cystická fibróza (mukoviscidóza)

4 Genové mutace záměna nukleotidů nemusí být tak škodlivá, jako delece či inzerce (vedou většinou k posunovým mutacím).

5 Chromosomové mutace porušení normální chromosomální struktury poškození způsobené fyzikálními, chemickými faktory zlomy jedné nebo obou chromatid DELECE, DUPLIKACE, INVERZE, INZERCE, TRANSLOKACE chromosomů, PRSTENCOVÉ CHROMOSOMY může být změněn počet genůči jejich orientace, nemusí nutně docházet ke změnám ve struktuře genů strukturní aberace chromosomů balancované - je zachováno původní množství genetického materiálu strukturní aberace chromosomů nebalancované -část genetického materiálu chybí či přebývá autosomy syndrom kočičího křiku delece 5p gonosomy syndrom fragilního X

6 Chromosomové mutace - Delece A B Ztráta části chromosomu A B C C D D Syndrom kočičího křiku E F centroméra fragment s centromérou E F Abnormální vývoj hrtanu Delece 5p Symptomy: microcefalie,hypotonie, mentální retardace, poruchy kardiovaskulárního systému G G H acentrický fragment H I I

7 A B C D E F G H I Chromosomové mutace - Duplikace Syndrom fragilního X A B C D E F G H I I H

8 např. 2 zlomy u nehomologických chromosomů, či výměna částí chromatid mezi oběma chromosomy A B C D E F G H I T U V W X Y Z A B C D E F Y Z T U V W X G H I Chromosomové mutace - Reciproká translokace

9 Genomové mutace abnormální počet chromosomů u somatických či pohlavních buněk či změny na úrovni celých sad chromosomů abnormality při distribuci chromosomů během mitosy a meiosy, způsobené nondisjunkcí chromosomů

10 Genomové mutace Aneuploidie - změny v počtu jednotlivých chromosomů autosomy - Downův syndrom 47, +21 (trisomie chromosomu 21), Edwardsův syndrom 47, +18 (trisomie chromozomu 18), Pataův syndrom 47, +13 (trisomie chromozomu 13) gonosomy- Turnerův syndrom (45, X0), syndrom supermale (47, XYY), Klinefelterův syndrom (47, XXY), syndrom superfemale (47, XXX) Polyploidie změny v počtu chromosomových sad, buňky mají více než dvě homologní sady chromosomů např. některé nádorové buňky, u člověka neslučitelné se životem, využívá se ve šlechtitelství rostlin

11 Downův syndrom (aneuploidie - trisomie 21 chromosomu) 47,XX,21+ or 47,XY,21+ incidence 1:800 vzhled: plochý obličej, menší šikmé oči, velký jazyk a příčná tzv. opičí rýha zdravotní problémy: poruchy ve vývoji srdce, mentální retardace zvýšené riziko u rodiček po 40.roku (1:40) 13 / 21

12 Downův syndrom - Problém otázky z přípravných textů: V důsledku chromosomové mutace (translokace) vzniklo lidské vajíčko se dvěma spojenými chromosomy 21. Po spojení s normální spermií vznikla zygota, jejíž další vývoj povede ke vzniku: a) normálního jedince se 46 chromosomy v každé buňce b) jedince s Downovým syndromem se 47 chromosomy c) jedince s Downovým syndromem se 46 chromosomy / X X

13 Základní genetické pojmy z minulých hodin: haploidie, diploidie, homologní chromosomy, autosomy, heterochromosomy (gonosomy), karyotyp genetická informace obsažena v lineární sekvenci nukleotidů, v jádrech diploidních somatických buněk párové založení dědičných vlastností dědičnost: monogenní (kvalitativní znaky Mendelovská dědičnost), polygenní (kvantitativní znaky), multifaktoriální (vliv mnoha genů i prostředí) autosomální (dominantní, recesivní), gonosomální (dominantní, recesivní) mimojaderná (mitochondriální, ) odchylky od mendelových zákonů genom v přesnějším smyslu - souhrn všech genů organismu (jádro, mitochondrie, chloroplasty) gen základní jednotka genetické informace strukturní geny geny pro RNA geny ve funkci regulačních oblastí

14 Základní genetické pojmy alely různé formy téhož genu, lišící se navzájem v nukleotidové sekvenci, která rozhoduje o míře funkčnosti genu (každý gen může existovat nejméně ve dvou krajních formách funkční a nefunkční alela) je konkrétním označením funkčního stavu, v jakém se daný gen nachází - alela dominantní, recesivní vztahy alel 1 genu: úplná dominance - ve fenotypu překrývá dominantní alela účinek recesivní alely (dominantní homozygot je fenotypově shodný s heterozygotem) neúplná dominance heterozygot se fenotypově odlišuje od dominantního i recesivního homozygota kodominance (ABO systém) ve fenotypu se projeví všechny funkční alely vedle sebe, ani jedna nepřevládá, ani není potlačována mezialelické vztahy u polygenní dědičnosti genotyp soubor a sestava alel, které má daný organismus k dispozici pro zajištění svých biochemických, fyziologických, anatomických, morfologických vlastností a charakteristik svého chování fenotyp soubor všech pozorovaných znaků organismu, závisí na genotypu a vlivu podmínek prostředí; přesněji vyjádření genotypu organizmu za daných podmínek prostředí

15 Základní genetické pojmy homozygotní genotyp pojem genotyp v užším slova smyslu jako označení konkrétního párového uspořádání alel genu pro určitou fenotypovou vlastnost, podmíněn funkčně shodnými alelami (dominantní homozygot, recesivní homozygot) heterozygotní genotyp podmíněn funkčně rozdílnými alelami (heterozygot) dominantní fenotyp fenotypový projev, který je podmíněn uplatněním dominantní alely recesivní fenotyp projev homozygotního páru recesivních alel monohybrid jedinec (kříženec) heterozygotní v jediném páru alel dihybrid jedinec (kříženec) heterozygotní ve dvou párech alel vazba genů (Thomas H. Morgan, ) geny na jednom chromosomu jsou prostorově vzájemně vázané a jsou na sobě při tvorbě gamet závislé vazbová skupina soubor genů vzájemně vázaných na stejném chromosomu počet vazbových skupin každého organismu je dán počtem chromosomových párů změna v uspořádání alel vzájemně vázaných genů (genetická rekombinace) je možná náhodnou strukturní výměnou částí nesesterských chromatid mezi párovými chromosomy (crossing-over)

16 Většina lidských znaků je podmíněna polygenně na projevu znaku se podílí velký počet genů malého účinku (polygeny) znaky kvantitativní vykazují plynulou variabilitu fenotypového projevu (morfologické, metabolické znaky.) graficky lze vyjádřit normálním rozložením četností při polygenní dědičnosti nemá zjevné štěpné fenotypové poměry, hodnotí se statisticky

17 Polygenně dědičné vady a choroby vady a choroby s nízkou četností (< 1%) VVV: rozštěpy obličeje nebo nervové trubice, srdeční vady, nesprávný vývin kyčelních kloubů, zúžení jícnu (stenóza pyloru) (VVV vznikají během embryogeneze) vady a choroby se středníčetností (< 5%) schizofrenie (rozštěp osobnosti), maniodepresivita (bipolární psychóza), slabomyslnost (oligofrénie) vady a choroby s vysokou četností (> 5%) hypertenze (vysoký krevní tlak), diabetes mellitus II (cukrovka druhého typu), poruchy imunity (alergie např. astma, atopie)

18 Johann Gregor Mendel Mendel použil 34 variet Pisum sativum (poddruhy a konvariety hrachu setého).

19 Výsledky z monohybridního křížení sledovaných sedmi vlastností (fenotypy kříženců jsou v poměru malých celých čísel) P křížení F 1 fenotyp F 2 počet fenotypů F 2 poměr kulatá x svrasklá semena kulatá 5474 kulatá a 1850 svrasklá 2,96 : 1 žlutá x zelená semena žlutá 6022 žlutá a 2001 zelená 3,01 : 1 květy fialové x bílé fialové 705 fialové a 224 bílé 3,15 : 1 vysoké x zakrslé rostliny vysoké 787 vysoké a 227 zakrslé 3,84 : 1 lusky jednoduše klenuté x zaškrcené jednoduše klenuté 882 jednoduše klenuté a 299 zaškrcené 2,95 : 1 zelené x žluté lusky zelené 428 zelené a 152 žluté 2,82 : 1 květy podél osy x na konci osy květy podél osy 651 podél a 207 na konci osy 3,14 : 1 3 : 1

20 1. M.zákon o jednotnosti (uniformitě) první generace kříženců Je-li jeden z rodičů dominantní homozygot (značíme AA) a druhý recesivní homozygot (značíme aa), jsou jejich potomci vždy heterozygotní (značíme Aa) a fenotypově stejní (uniformní). Důkaz: zpětné křížení

21 Zpětné křížení jako metoda stanovení heterozygotů v botanice

22 2. M.zákon o náhodné segregaci alel do gamet a jejich kombinaci ve druhé generaci kříženců genotypový poměr 1AA:2Aa :1aa fenotypový poměr - při úplné dominanci 3:1 - při neúplné dominanci či kodominanci odpovídá fenotyp jednotlivým genotypům

23 Dědičnost s neúplnou dominancí Nocenka barva květů: červená dominantní homozygot růžová - heterozygot bílá recesivní homozygot fenotypový a genotypový poměr v F 2 je shodný (1:2:1) heterozygoti vykazují jinou formu znaku než dominantní i recesivní homozygoti

24 3. M. zákon o volné kombinovatelnosti alel různých alelových párů možných fenotypů: 4 fenotypový poměr 9:3:3:1 možných genotypů: 9 genotypový štěpný poměr 1:2:1:2:4:2:1:2:1

25 Mendelovy zákony První M.zákon o jednotnosti (uniformitě) první generace kříženců (první filiální generace (F1-generace): Při vzájemném křížení homozygotů (dominantních a recesivních) vzniká potomstvo, které je svým genotypem i fenotypem jednotné (heterozygoti). Druhý M.zákon o náhodné segregaci alel do gamet a jejich kombinaci ve druhé generaci kříženců (monohybridů): Při vzájemném křížení heterozygotů vzniká potomstvo (druhá filiální generace F2), které je genotypově i fenotypově různorodé, přičemž zastoupení homozygotů a heterozygotů je pravidelné a stálé. Dochází ke genotypovému a fenotypovému štěpení (segregaci). Genotypový poměr 1AA:2Aa :1aa, fenotypový poměr při úplné dominanci 3:1, při neúplné dominanci či kodominanci odpovídá fenotyp jednotlivým genotypům. Třetí M. zákon o volné kombinovatelnosti alel různých alelových párů: Při vzájemném křížení vícenásobných heterozygotů (polyhybridů) vzniká genotypově a fenotypově různorodé potomstvo, v němž je pravidelné a stálé poměrné zastoupení genotypů a fenotypů, odpovídající všem teoreticky možným kombinacím mezi dominantními a recesivními alelami všech sledovaných heterozygotních alelových párů. Křížení dihybridů - každý rodič 4 možné gamety - 16 zygotických genotypových kombinací, genotypový štěpný poměr 1:2:1:2:4:2:1:2:1, při úplné dominanci fenotypový projev 9:3:3:1. Platnost tohoto zákona je omezena pouze na alely těch genů, které jsou neseny různými páry homologních chromozomů (geny nejsou ve vazbové skupině). Volná kombinovatelnost alel je přímým důsledkem náhodného rozchodu homologických chromosomů z bivalentů do haploidních jader gamet při meióze.

26 Autosomální dědičnost znak je podmíněn monogenně, platí Mendelovy zákony gen je lokalizován na autosomu Autosomálně dominantní typ dědičnosti: postižení se vyskytuje stejnoměrně u mužů i u žen postižení se vyskytuje v každé generaci např. achondroplasie Autosomálně recesivní typ dědičnosti: postižení se vyskytuje stejnoměrně u mužů i u žen postižení se vyskytuje mezi sourozenci, jejichž rodiče postižení nejsou např. cystická fibróza, fenylketonurie, srpkovitá anémie

27 Příkladem na monogenně podmíněnou autosomální dědičnost dle Mendlových zákonů bývá dědičnost antigenního systému AB0 krevně skupinový antigen na povrchu erytrocytů krevní skupiny A, B, O, AB gen na chromosomu 9q mnohotná alelie: v populaci se vyskytují tři možné alely pro daný lokus jen 2 alely se však mohou u diploidního organismu uplatnit alely A a B jsou kodominantní alely A a B jsou vůči alele 0 dominantní

28 0, A, B B0 00, A0, B0 00 AB A0 AB Krevní skupina A je podmíněna genotypem AA nebo A0 Skupina B: BB nebo B0 Skupina AB: genotyp AB kodominance Skupina 0: genotyp 00

29 Dědičnost krevních skupin: Rh faktor Rh faktor krevně skupinový antigen na povrchu erytrocytů komplex lokusů DCE uložených na p-raménku 1.chromosomu v praxi se sleduje hlavně antigen označený jako D, k němuž recesivní alela je označována jako d positivní Rh (Rh+) - antigen je podmíněn genotypovou konstitucí DD nebo Dd negativní Rh (Rh-) - genotyp konstitucí dd

30 Dědičnost krevních skupin : Rh- recesivní homozygot tvoří protilátky proti Rh+ (Dd nebo DD) Rh- dd Rh+ Dd

31 Dědičnost krevních skupin Jedinec Rh+ je buď genotypu DD nebo Dd. Pro krevní skupinu systém AB0 se v populaci vyskytují alely A,B a 0. Alelické páry pro oba znaky jsou volně kombinovatelné. Tři manželské páry mají následující krevní skupiny: 1. pár: AB Rh- x 0 Rh+ 2. pár: B Rh+ x AB Rh- 3. pár: A Rh- x B Rh+ Který z párů jsou rodiče dítěte s krevní skupinou 0 Rh-? a) pár 1 b) pár 2 c) pár 3 d) páry 1 a 3 e) žádná odpověď nevyhovuje

32 Gonosomální dědičnost rozumíme přenos vlastností vázaných na gonosomy heterochromosomy X a Y jsou jen v některých částech strukturně shodné homologníčást a převážně strukturně odlišné heterologníčást, dále rozdíly ve velikosti chromosomů, počtu a zastoupení genů u člověka převažuje heterologníčást X nad Y většinou se jedná o X-vázanou dědičnost přenos z otce na syny není možný, muž přenáší vlohy vázané na X chromosomu zásadně na dcery fenotypový projev záleží na pohlaví (jiné štěpné poměry pro samčí a samičí organismy)

33 Gonosomální dědičnost X-vázaná dominantní dědičnost: lokalizace patologického genu na chromozomu X přenos z otce na syna není možný mezi postiženými převažují ženy při postižení matky (heterozygot) riziko pro dcery i pro syny 0,5 při postižení otce (hemizygot) postižené všechny dcery, synové jsou zdraví XD onemocnění: hypofosfatémie, hypoplazie zubní skloviny X-vázaná recesivní dědičnost: lokalizace patologického genu na chromozomu X přenos z otce na syna není možný mezi postiženými převažují muži (pro manifestaci stačí 1 alela) v klasickém případě se patologická alela přenáší od heterozygotní matky na syna od postiženého otce získají patologickou alelu všechny dcery XR onemocnění: hemofilie A, B daltonismus (barvoslepost) muskulární dystrofie (Duchennova, Beckerova)

34 Gonosomální recesivní dědičnost matka je zdravá, je nositelkou recesivní alely, otec zdráv

35 Gonosomální recesivní dědičnost otec nemocen recesivní chorobou, matka zdravá

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly

Více

MENDELOVSKÁ DĚDIČNOST

MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp

Více

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela

Více

Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků

Více

genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace

Více

BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou

Více

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních

Více

Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho

Více

Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny

Více

Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil

Více

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace

Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace Mutace Klasifikace mutací Z hlediska lokalizace mutací v genotypu Genové mutace Chromozomální mutace Genomové mutace Vznik genových mutací Tranzice pyrim. za pyrim. C na T T na C purin za purin A na G

Více

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová

Více

Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým

Více

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením

Více

21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST

21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka

Více

Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského

Více

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace Pojmy k zpmtování Gen -část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN Gen je různě dlouhá sekvence nukleotidů Gen je jednotk funkce

Více

Mutační změny genotypu

Mutační změny genotypu Mutační změny genotypu - změny genotypu: segregace, kombinace + MUTACE - náhodné změny Mutace - genové - spontánní - chromozómové - indukované (uměle vyvolané) - genomové A) Genové mutace - změna (ztráta)

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI

Více

NUMERICKÉ ABERACE ÚBLG 1.LF UK

NUMERICKÉ ABERACE ÚBLG 1.LF UK NUMERICKÉ ABERACE ÚBLG 1.LF UK CHROMOSOMÁLN LNÍ ABERACE NUMERICKÉ ANEUPLOIDIE POLYPLOIDIE MONOSOMIE TRISOMIE TRIPLOIDIE TETRAPLOIDIE STRUKTURÁLN LNÍ MIXOPLOIDIE MOZAICISMUS CHIMÉRISMUS ZÁKLADNÍ SYNDROMY

Více

Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém

Více

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním

Více

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v

Více

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto

Více

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák MENDELISMUS Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák 1822-1884 In the ten years G. Mendel worked on his plants in the garden of the monastery, he made the greatest discovery in biology that

Více

Vrozené vývojové vady. David Hepnar

Vrozené vývojové vady. David Hepnar Vrozené vývojové vady David Hepnar Vrozené vývojové vady (VVV) jsou defekty orgánů, ke kterým došlo během prenatálního vývoje plodu a jsou přítomny při narození jedince. Postihují v různém rozsahu okolo

Více

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010

Více

GENETIKA A JEJÍ ZÁKLADY

GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat

Více

Typy chromosomů. A telocentrický B akrocentrický C submetacentrický D metacentrický. Člověk nemá typ telocentrický!

Typy chromosomů. A telocentrický B akrocentrický C submetacentrický D metacentrický. Člověk nemá typ telocentrický! Karyologie Typy chromosomů A telocentrický B akrocentrický C submetacentrický D metacentrický Člověk nemá typ telocentrický! Chromosom chromosom telomera jádro centomera telomera buňka histony dvoušroubovice

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár

Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár schopen spontánní koncepce, ale žena není schopna donosit

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

NUMERICKÉ ABERACE ÚBLG 1.LF UK

NUMERICKÉ ABERACE ÚBLG 1.LF UK NUMERICKÉ ABERACE ÚBLG 1.LF UK CHROMOSOMÁLNÍ ABERACE NUMERICKÉ ANEUPLOIDIE POLYPLOIDIE MONOSOMIE TRISOMIE TRIPLOIDIE TETRAPLOIDIE STRUKTURÁLNÍ MIXOPLOIDIE MOZAICISMUS CHIMÉRISMUS ZÁKLADNÍ SYNDROMY ODCHYLKA

Více

Genová vazba. Obr. č. 1: Thomas Hunt Morgan

Genová vazba. Obr. č. 1: Thomas Hunt Morgan Genová vazba Jednou ze základních podmínek platnosti Mendelových zákonů je lokalizace genů, které podmiňují různé vlastnosti na různých chromozómech. Toto pravidlo umožňuje volnou kombinovatelnost genů

Více

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu Genealogie Monogenní dědičnost rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu onemocnění v rodině Genealogické

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u

Více

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový

Více

CHROMOZOMÁLNÍ ABERACE

CHROMOZOMÁLNÍ ABERACE CHROMOZOMÁLNÍ ABERACE Chromosomální aberace numerické (změny v počtu chromosomů) polyploidie - změna v počtu celých chromosomových sad triploidie tetraploidie aneuploidie - změna v počtu jednotlivých chromosomů

Více

Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci

Více

Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

Druhová a mezidruhová hybridizace

Druhová a mezidruhová hybridizace Druhová a mezidruhová hybridizace Obsah Druhová a mezidruhová hybridizace... 1 Obsah... 1 Monohybridní křížení... 1 Dihybridní křížení... 2 Polyhybridní křížení... 3 Souhrn Mendelismus v dědičnosti kvalitativních

Více

Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových

Více

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.

Více

Nemoc a její příčiny

Nemoc a její příčiny Nemoc a její příčiny Definice zdraví a nemoc zdraví stav úplné tělesné, duševní a sociální pohody s harmonickým průběhem vitálních procesů nemoc porucha zdraví poškození určitého počtu bb. (bb. reagují

Více

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

Dědičnost kvantitativních znaků. Proměnlivost a dědivost. Mutace

Dědičnost kvantitativních znaků. Proměnlivost a dědivost. Mutace Přehled GMH Seminář z biologie Genetika 3 Dědičnost kvantitativních znaků Kvantitativní znaky mají kontinuální proměnlivost a jsou polygenní. Za velikost znaku je většinou zodpovědný systém několika genů

Více

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické

Více

Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem

Více

Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.

Více

Praktická cvičení z biologie Letní semestr

Praktická cvičení z biologie Letní semestr Univerzita Palackého v Olomouci Ústav biologie, Lékařská fakulta Praktická cvičení z biologie Letní semestr Olomouc 2014 Podpořeno projektem EU: Implementace laboratorní medicíny do systému vzdělávání

Více

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická

Více

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce?

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce? REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince Co bylo dřív? Slepice nebo vejce? Rozmnožování Rozmnožování (reprodukce) může být nepohlavní (vegetativní, asexuální) pohlavní (sexuální;

Více

TERATOGENEZA ONTOGENEZA

TERATOGENEZA ONTOGENEZA TERATOGENEZA ONTOGENEZA Vrozené vývojové vady (VVV) Jsou defekty orgánů, ke kterým došlo během prenatálního vývoje plodu a jsou přítomny při narození jedince. Postihují v různém rozsahu okolo 3-5 % novorozenců.

Více

Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u

Více

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě Otázka: Genetika I Předmět: Biologie Přidal(a): Paris -věda, která se zabývá dědičností a proměnlivostí -zakladatelem je Johan Gregor Mendel (1822 1884), který se narodil v Hynčicích na Moravě 1. MOLEKULÁRNÍ

Více

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou

Více

GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných

Více

Karyologie. Typy chromosomů. Chromosom. Karyotyp člověka. Chromosomy. Koncové části lineárních chromosomů - telomery

Karyologie. Typy chromosomů. Chromosom. Karyotyp člověka. Chromosomy. Koncové části lineárních chromosomů - telomery Karyologie Typy chromosomů A telocentrický B akrocentrický C submetacentrický D metacentrický Člověk nemá typ telocentrický! Chromosom Koncové části lineárních chromosomů - telomery telomera chromosom

Více

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům Karlova univerzita, Lékařská fakulta Hradec Králové Obor: všeobecné lékařství - test z biologie Vyberte tu z nabídnutých odpovědí (1-5), která je nejúplnější. Otázka Odpověď 1. Mezi organely membránového

Více

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865

Více

MUTACE mutageny: typy mutací:

MUTACE mutageny: typy mutací: MUTACE charakteristika: náhodné změny v genotypu organismu oproti normálu jsou poměrně vzácné z hlediska klinické genetiky, jsou to právě mutace, které způsobují genetické choroby nebo nádorové bujení

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Příčiny a projevy abnormálního vývoje

Příčiny a projevy abnormálního vývoje Příčiny a projevy abnormálního vývoje Ústav histologie a embryologie 1. LF UK v Praze MUDr. Filip Wagner Předmět: Obecná histologie a obecná embryologie (B02241) 1 Vrozené vývojové vady vývojové poruchy

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Stavba chromozomů Lidský karyotyp

Stavba chromozomů Lidský karyotyp Přípravný kurz z biologie 5 Stavba chromozomů Lidský karyotyp 3. 12. 2011 Mgr. Kateřina Caltová Stavba chromozomů Lidský karyotyp Chromozom buněčná struktura v jádře eukaryotních buněk řec. chroma = barva,

Více

=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům

=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům Otázka: Genetika Předmět: Biologie Přidal(a): t.klodnerova REALIZACE GENETICKÉ INFORMACE, MUTACE, ZÁKLADNÍ GENETICKÉ POJMY: GEN, ZNAK, ALELA, GENOTYP, FENOTYP, HOMOZYGOT, HETEROZYGOT, HYBRIDIZACE, DOMINANCE,

Více

Proč jsme podobní rodičům? A jak k tomu vlastně může dojít?

Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Základy genetiky Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Johann Gregor Mendel (1822 1884) O jeho životě byl mnich, zakladatel genetiky a opat augustiniánského kláštera v Brně studium

Více

DĚDIČNOST Monogenní dědičnost Multifaktoriální dědičnost Expresivita Penetrance Gen (strukturní gen

DĚDIČNOST Monogenní dědičnost Multifaktoriální dědičnost Expresivita Penetrance Gen (strukturní gen DĚDIČNOST Předtím než se začneme věnovat jednotlivým typům genetické determinace a přenosu genetické informace z rodičovské generace na potomky, objasníme si některé termíny. Monogenní dědičnost znamená

Více

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika 1/6 3.2.11.18 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost

Více

Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého

Více

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické Gonozomáln lní dědičnost Mgr. Aleš RUDA Chromozomové určení pohlaví autozomy gonozomy člověk má 22 párůp autozomů a 1 pár p gonozomů označen ení pohlavních chromozomů: : X a Y. jsou možné celkem 3 kombinace:

Více

13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu

Více

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika

Více

Chromosomové změny. Informace pro pacienty a rodiny

Chromosomové změny. Informace pro pacienty a rodiny 12 Databáze pracovišť poskytujících molekulárně genetická vyšetření velmi častých genetických onemocnění v České republice (CZDDNAL) www.uhkt.cz/nrl/db Chromosomové změny Unique - Britská svépomocná skupina

Více