Příušnice. strategie laboratorní diagnostiky u vysoce proočkované populace

Rozměr: px
Začít zobrazení ze stránky:

Download "Příušnice. strategie laboratorní diagnostiky u vysoce proočkované populace"

Transkript

1 Příušnice strategie laboratorní diagnostiky u vysoce proočkované populace Radomíra Limberková F.Sedláček, J.Poustková, O.Hégrová, M.G.Schreinerová, J.Trmal VIII. Hradecké vakcinologické dny

2 Laboratorní průkaz onemocnění příušnicemi vyhl.473/2008 o systému epidemiologické bdělosti pro vybrané infekce ve znění vyhlášky č.233/2011; příl. č.14 Systém epidemiologické bdělosti příušnic; čl.2 - Laboratorní diagnostika 1. Přímý průkaz nevakcinálního kmene viru příušnic izolací z klinického vzorku odebraného v akutní fázi onemocnění 2. Detekce nukleové kyseliny nevakcinálního kmene viru příušnic izolací z klinického vzorku odebraného v akutní fázi onemocnění 3. Detekce IgM protilátek proti viru příušnic u osob, které nebyly v posledních 6 týdnech očkovány 4. Průkaz sérokonverze nebo výrazného, několikanásobného vzestupu hladiny specifických parotitických IgG protilátek vyšetřením dvojice vzorků sér nebo slin osob, které nebyly v posledních 6 týdnech očkovány 5. Průkaz vzrůstu hladin již existujících parotitických IgG protilátek u reinfekcí 6. Detekce antigenu nevakcinálního kmene viru příušnic (DFA) pomocí specifických parotitických monoklonálních protilátek v klinickém vzorku, odebraném v akutní fázi onemocnění Ke správné interpretaci laboratorních výsledků je třeba brát v úvahu též klinické a epidemiologické údaje včetně statusu očkování.

3 Doporučení WHO WHO doporučuje provádění molekulárně epidemiologických studií zahrnujících genotypizaci recentních příušnicových kmenů jako součást programu surveillance. Detailní monitoring by mohl pomoci objasnit vzorce cirkulace viru, jeho evoluci a rovněž by mohl napomoci k vytvoření strategie kontroly nad vznikajícími epidemiemi. Pro detailní monitoring ovšem v ČR chybí legislativní opora, neboť na rozdíl od spalniček a zarděnek, pro příušnice není vyhláškou stanovena povinnost zasílání izolátů z klinických vzorků do NRL k dalšímu určování.

4 Současná praxe v laboratorní diagnostice příušnic 1. sérologie - běžně zasílanými klinickými vzorky jsou diagnosticky méně vhodná akutní séra, jejichž vyšetřením obvykle získáme problematicky interpretovatelná data a pro definitivní diagnostický závěr je nutné provést vyšetření párového vzorku séra, čímž je laboratorní závěr oddálen 2. vhodnější možnost přímého průkazu infekčního agens není zatím využívána, ačkoli se jedná o neinvazivní způsob odběru s výhodou rychlého diagnostického závěru (RT-PCR)

5 Vhodné vzorky pro přímý průkaz - Stěr z bukální sliznice, sliny nejpozději do 9.dne od začátku klinických příznaků (ideálně do 3.-4.dne) - Moč nejpozději do 9.dne od začátku klinických příznaků (ideálně do 4.dne) méně vhodná (náročnější ke zpracování, cytotoxická na tkáňové kultury) Příušnice: příručka pro odběr, skladování a transport klinického materiálu - Likvor parotitická meningitida

6 Skladování a transport vzorků Bukálně orální stěry, sliny, moč do 24 hodin od odběru při teplotě +4 C dlouhodobě při teplotě -70 C, při přepravě nesmí rozmrznout (suchý led) Sérum do týdne od odběru při teplotě +4 C dlouhodobě při teplotě -20 C

7 Nejvhodnější klinické vzorky Ideální sestava zaslaného klinického materiálu: - vzorek pro přímý průkaz + párové sérum Reálná sestava klinického materiálu - vhodná pro zjištění primárního či sekundárního selhání vakcinace u vzorků s prokázanou přítomností viru příušnic (PCR, TK) - vzorek pro přímý průkaz + akutní sérum

8 Sérologický průkaz primárního či sekundárního selhání vakcinace vyšetřením akutního vzorku séra u pacientů s pozitivním záchytem viru příušnic RRL RKI, Berlín primární selhání vakcinace (= primoinfekce) IgM pozitivní IgG negativní,hraniční, pozitivní sekundární selhání vakcinace (= reinfekce) IgM negativní IgG pozitivní, rychle se zvyšující

9 Specifika diagnostiky vakcinovaných FALEŠNĚ NEGATIVNÍ NÁLEZY U VAKCINOVANÝCH OSOB: v akutním séru často nejsou detekovatelné IgM protilátky (až u 30%) u párových sér často nedochází k očekávanému signifikantnímu vzestupu titru protilátek ani sérokonverzi v párových sérech vakcinovaní vylučují méně viru a po kratší dobu, protože IgG protilátky stoupají v akutní fázi často velmi rychle (nutnost časného odběru nejlépe do 3.dne) 80% nemocných v ČR patří mezi vakcinované osoby Nespolehlivá sérologie - jednoznačným průkazem probíhající infekce je izolace viru či průkaz virové RNA

10 Diagnostické metody NRL PŘÍMÝ PRŮKAZ VIRU: 1. Izolace na tkáňových kulturách Vero 2. RT-PCR Mumps Virus RT-PCR kit, Shanghai ZJ, BioTech SÉROLOGIE: 1. ELISA Enzygnost Anti-ParotitisVirus/IgM, Siemens Enzygnost Anti-ParotitisVirus/IgG, Siemens 2. Hemaglutinačně inhibiční test (HIT) 3. Virus neutralizační test (VNT)

11 Vzorky k přímému průkazu viru příušnic únor-květen stěrů z bukální sliznice zejména od ambulantních pacientů infekčních klinik z regionů se zvýšeným výskytem onemocnění (5 z nich nebylo validních nestandardní odběr a nevhodné dlouhodobé skladování - 40 dní při +8 C) - odebrané převážně v počátku klinické manifestace onemocnění (do 4.dne od začátku onemocnění) - časnost odběru (nejlépe do 3.dne) je pro záchyt viru nezbytná zejména u vakcinovaných

12 Růstové vlastnosti příušnicových kmenů izolovaných v roce 2012 Virus má velmi dobré růstové vlastnosti: - cytopatický efekt obvykle již od 3.dne 1.pasáže - i z PCR negativního vzorku se podařilo izolovat virus - izolace viru i ze vzorku, který byl 40 dní uchovaný v lednici a nestandardně odebrán matka této pacientky (1968) hospitalizace - mening., pankreatitis dvě vakcinované sestry neonemocněla, 2003 onemocněla pozitivní záchyty kmenů příušnic (izolace, PCR) 16/27 59,25% resp. 15/22 68,18% (pouze validní vzorky)

13 Přímý průkaz viru-vyšetřovací schéma Izolační pokus pozitivita 13x identifikace (RT-PCR, IHAd, HIT) 27 stěrů negativita, bakt.kontam, atyp.cpe 5x 6x 3 x HSV-1 RT-PCR pozitivita negativita 3x (2x BK, 1x CPE HSV-1)

14 Výsledky izolace na buňkách Vero Místo Počet vzorků TK + TK - BK HSV Genotypizace Karlovy Vary Pardubice Teplice Praha Praha Liberec celkem x PCR + 3 1xPCR + 12

15 Genom viru příušnic - jednovláknitá nesegmentovaná RNA negativní polarity nukleotidů - 7 genů pro následujících 7 proteinů genomové mapy: core proteiny: 1. nukleokapsidový (NP) 2. phosphoprotein (P) V a I 3. membránový matrix (M) 4. large (L) povrchové glykoproteiny: 5. fúzní (F) 6. hemaglutinin-neuraminidáza (HN) nejvariabilnější s neobjasněnou funkcí: 7. small hydrophobic (SH)

16 SH protein na základě sekvenční analýzy genu SH proteinu (nejvariabilnější části genomu viru příušnic) se kmeny viru příušnic dělí na jednotlivé genotypy v současnosti je známo třináct genotypů: A-M v rámci daného genotypu existují varianty genotypy C, D, E, G, H - západní polokoule B, F, I - Asie genotypy C, D, G, H, I, J jsou považovány za neuropatogenní genetický základ neurovirulence není zatím objasněn v určitém geografickém regionu může současně cirkulovat více genotypů, např Španělsko: genotyp H hromadný výskyt genotyp D sporadické případy

17 Označení NRL Kmeny viru příušnic zaslané ke genotypizaci do RRL RKI Místo odběru Označení RRL Rok narození Vakcinační status MuVi-CZE12-56 Karlovy Vary dávky MuVi-CZE12-59 Karlovy Vary dávky MuVi-CZE12-72 Pardubice neznámo MuVi-CZE12-73 Pardubice dávky MuVi-CZE12-77 Pardubice dávky MuVi-CZE12-80 Pardubice dávky MuVi-CZE12-81 Pardubice dávky MuVi-CZE12-86 Pardubice nevakcinován MuVi-CZE12-89 Pardubice dávky MuVi-CZE Teplice dávky MuVi-CZE Praha dávky MuVi-CZE Praha dávky

18 Výsledky genotypizace z RRL RKI ze všech 12 zaslaných kmenů (2 KV, 7 PA, 2 Pha,1 TE) byla úspěšně extrahována MuV RNA a následně byla provedena sekvenace 316 nukleotidů genu SH proteinu všechny izolované kmeny viru příušnic v ČR - genotyp G genotypizované kmeny z daných regionů se liší: jedním nukleotidem: varianta Karlovy Vary ( shodné s Prahou 10) varianta Pardubice (shodné s Prahou 5) jedním nukleotidem od varianty Pardubice a dvěma nukleotidy od varianty Karlovy Vary: varianta Teplice

19 Sekvence nukleotidů reprezentující jednotlivé varianty genotypu G >MuVi-CZE Karlovy Vary AAGAATGAATCTCATGGGGTCGTAACGTCTCGTGACCCTGCCGTTGCACTATGC CGGCGATCCAACCCCCATTATACCTCACATTTCTATTGCTAATTCTTCTTTATCTG ATCATAACTTTGTATGTCTGGATTATATTAACTGTTACTTATAAGACTGCGGTGCG ACATGCAGCACTGTACCAGAGATCCTTCTCTCACTGGAGTTTCGATCACTCACTC TAAGAAGATCCCCAGTTAGGACAAGTCCCGATCCATCATGCAAGAACAATCTGC ATTTGAATAATGCCGTTCAATCATGAGACATAAAGAAAAAA >MuVi-CZE Pardubice AAGAATGAATCTCATGGGGTCGTAACGTCTCGTGACCCTGCCGTTGCACTATGC CGGCGATCCAACCCCCATTATACCTCACATTTCTATTGCTAATTCTTCTTTATCTG ATCATAACTTTGTATGTCTGGATTATATTAACTGTTACTTATAAGACTGCGGTGCG ACATGCAGCACTGTACCAGAGATCCTTCTTTCACTGGAGTTTCGATCACTCACTC TAAGAAGATCCCCAGTTAGGACAAGTCCCGATCCATCATGCAAGAACAATCTGC ATTTGAATAATGCCGTTCAATCATGAGACATAAAGAAAAAA >MuVi-CZE Teplice AAGAATGAATCTCATGGGGTCGTAACGTCTCGTGACCCTGCCGTTGCACTATGC CGGCGATCCAACCCCCATTATACCTCACATTTCTATTGCTAATTCTTCTTTATCTG ATCATAACTTTGTATGTCTGGATTATATTAACTGTTACTTATAAGACTGCGGTGCG ACATGCAGCACTGTACCAGGGATCCTTCTTTCACTGGAGTTTCGATCACTCACTC TAAGAAGATCCCCAGTTAGGACAAGTCCCGATCCATCATGCAAGAACAATCTGC ATTTGAATAATGCCGTTCAATCATGAGACATAAAGAAAAAA

20 Distribuce hlášených genotypů, (údaje k dubnu 2012) G H C J B C D J D G F G H I G D,C,H H J K

21 Výskyt genotypu G 2004/05 UK 2005/06 ČR 2006 USA 2007/08 Kanada (současně i genotyp D) 2008/09 Makedonie (6% komplikací: 39% orchitid, 4,7% meningitid) 2009 Nizozemí (16% komplikací: 20% orchitid, 4% meningitid) 2010 Bavorsko (většina komplikací-orchitidy) 2010/11 Skotsko 2012 ČR (10,9 % komplikací-očkovaní v 8%, neočkovaní 27%; orchitida 6% očkovaných a 21% neočkovaných; meningitis 1,2% očkovaných a 4% neočkovaných)

22 Genotypy a účinnost vakcinace - ve vakcíně je obsažen příušnicový kmen Jeryl Lynn (genotyp A), který je fylogeneticky odlišný od cirkulujících genotypů - největší antigenní rozdílnost je mezi genotypy A x B - D A x G - I - výsledkem je nekompletní zkřížená neutralizace Přesto zatím nejsou jednoznačné důkazy o tom, že by genotypová neshoda současných kmenů vedla k selhávání vakcinace či že by byla epidemiologicky významná. Účinnost vakcinace ve vztahu ke genotypu, ale i možnost přispění vyvanutí imunity ke zvýšenému výskytu onemocnění, jsou široce řešenou stále otevřenou otázkou.

23 Genotypy a účinnost vakcinace Mumps virus neutralizing antibodies do not protect against reinfection with a heterologous mumps virus genotype; Johan Nojd a kol.; Vaccine 19 (2001) vakcinací JL (1996) nedošlo k vytvoření průkazných VN Ab proti genotypu A - v séru jen VN Ab proti genotypu D (onemocnění v dětství souběh cirkulace A a D genotypu ve Švédsku ) - VN Ab proti genotypu D neochránily před chronickým onemocněním genotypem A (V-X /1999) - až v II /2000 prokazatelné VN Ab proti A X Antibody Induced by Immunization with the Jeryl Lynn Mumps Vaccine Strain Effectively Neutralizes a Heterologous Wild-Type Mumps Virus Associated with a Large Outbreak; S.A. Rubin a kol.; J Infect Dis. (2008); 198 (4): geometrický průměr titrů VN Ab proti genotypu G byl asi o polovinu nižší než proti genotypu A; - titry VN Ab proti oběma genotypům s časovým odstupem od vakcinace klesaly (10 let po 2.dávce na úroveň titrů před její aplikací); - protilátky indukované vakcinací efektivně neutralizovaly virus genotypu G u všech 88 osob Long-Term Persistence of Mumps Antibody after Receipt of 2 Measles-Mumps-Rubella (MMR) Vaccinations and Antibody Response after a Third MMR Vaccination among a University Population A. A. Date a kol.; J Infect Dis.(2008); 197: EIA IgG+ 94% (ze 440 osob); 28 osob IgG- ; 19 IgG- dostalo 3. dávku vakcíny - 1 osoba nadále EIA IgG- (průkaz reakce paměťových B buněk nešlo o primární selhání vakcinace) - VN Ab proti genotypu A u 91 EIA pozitivních osob, titr 1:4 vakcinovaní < 1-5 lety 95% vakcinovaní > 15 lety 58% X

24 Současné cíle NRL - zkvalitnění laboratorní diagnostiky onemocnění opřené především o přímý průkaz agens (izolace viru, PCR) jako jednoznačného průkazu probíhající infekce - vyšetřování dalšími sérologickými metodami (HIT, VNT), neboť doposud rutinně uplatňované sérologické vyšetření metodou ELISA (IgG/IgM) neposkytne vždy jednoznačný diagnostický závěr - získání komplexních informací o cirkulujících kmenech na území ČR a sérologické odpovědi nemocných, neboť vzhledem k rozdílnosti neutralizačních epitopů u různých genotypů nelze vyloučit, že imunita zajišťovaná virem určitého genotypu nebude stejně účinná proti kmenům jiných genotypů

25 Závěr Nemocnými jsou převážně vakcinovaní mladí dospělí jedinci s delším časovým odstupem od aplikace vakcíny (kolem 15 let), poměrně častý je i výskyt komplikací, zejména pak orchitidy a meningitidy. Specifika laboratorní diagnostiky vakcinovaných osob vede k nutnosti změny vyšetřovací strategie zaměřené více na přímý průkaz infekčního agens. Monitorování genotypové distribuce příušnicových kmenů a genotypově specifické imunity populace je ve vakcinální éře, vzhledem ke kontinuální evoluci viru a tlaku na výběr vakcíny, nezbytné.

26 Poděkování všem spolupracujícím infekčním klinikám a příslušným hygienickým stanicím

PAROTITIDA VRACEJÍCÍ SE ONEMOCNĚNÍ. Vlasta Štěpánová 1, Miroslav Fajfr 1,2, Lenka Plíšková 3

PAROTITIDA VRACEJÍCÍ SE ONEMOCNĚNÍ. Vlasta Štěpánová 1, Miroslav Fajfr 1,2, Lenka Plíšková 3 PAROTITIDA VRACEJÍCÍ SE ONEMOCNĚNÍ Vlasta Štěpánová 1, Miroslav Fajfr 1,2, Lenka Plíšková 3 Ústav klinické mikrobiologie 1, Ústav klinické biochemie a diagnostiky 3, Fakultní nemocnice Hradec Králové,

Více

Sérologická diagnostika chřipky možnosti a diagnostická úskalí

Sérologická diagnostika chřipky možnosti a diagnostická úskalí Sérologická diagnostika chřipky možnosti a diagnostická úskalí Martina Havlíčková, Radka Limberková, Pavla Růžičková, Helena Jiřincová NRL pro chřipku, Státní zdravotní ústav K historii vyšetřování sér

Více

Laboratorní di agnostik HBV HCV a Vratislav Němeček Státní zdravotní stav ústav

Laboratorní di agnostik HBV HCV a Vratislav Němeček Státní zdravotní stav ústav Laboratorní diagnostika HBV a HCV Vratislav Němeček Státní zdravotní ústav Rozdílná role sexuálního 30 přenosu HBV a HCV 25 Rozdíly v četnosti virové nálože 20 15 10 HCV RNA HBV DNA HBV 5 hlavní způsoby

Více

A37 Dávivý kašel pertussis

A37 Dávivý kašel pertussis počet případů pertuse K R A J S K Á H Y G I E N I C K Á S T A N I C E KARLOVARSKÉHO KRAJE SE SÍDLEM V KARLOVÝCH VARECH adresa: Závodní 94, 36021 Karlovy Vary, tel:355 328 311, e-mail:sekretariat@khskv.cz,

Více

Situace ve výskytu dávivého kašle (A37.0) v České republice v roce 2008

Situace ve výskytu dávivého kašle (A37.0) v České republice v roce 2008 Situace ve výskytu dávivého kašle (A37.0) v České republice v roce 2008 Update of whooping cough (A37.0) situation in the Czech Republic, 2008 Kateřina Fabiánová, Čestmír Beneš Souhrn Summary Od roku 1958

Více

Interpretace sérologických nálezů v diagnostice herpetických virů. K.Roubalová

Interpretace sérologických nálezů v diagnostice herpetických virů. K.Roubalová Interpretace sérologických nálezů v diagnostice herpetických virů K.Roubalová Specifické vlastnosti herpetických virů ovlivňují protilátkovou odpověď Latence a celoživotní nosičství Schopnost reaktivace,

Více

α herpesviry Diagnostika, epidemiologie a klinický význam. RNDr K.Roubalová NRL pro herpetické viry

α herpesviry Diagnostika, epidemiologie a klinický význam. RNDr K.Roubalová NRL pro herpetické viry α herpesviry Diagnostika, epidemiologie a klinický význam. RNDr K.Roubalová NRL pro herpetické viry Biologické vlastnosti α herpesvirů HSV1,2: Produktivní infekce epitelálních buněk a fibroblastů kůže

Více

Martina Havlíčková Helena Jiřincová. NRL pro chřipku, Státní zdravotní ústav

Martina Havlíčková Helena Jiřincová. NRL pro chřipku, Státní zdravotní ústav Pandemic H1N1 2009 Martina Havlíčková Helena Jiřincová NRL pro chřipku, Státní zdravotní ústav Z historie H1N1 1916-1917 pravděpodobná cirkulace viru, malá ohniska, lokální epidemie ve vojenských táborech,

Více

Výskyt a význam infekce Borna disease virem u pacientů léčených

Výskyt a význam infekce Borna disease virem u pacientů léčených Výskyt a význam infekce Borna disease virem u pacientů léčených pro závislost Sylva Racková Psychiatrická klinika LF UK v Plzni AT konference 28.04. 2010, Špindlerův Mlýn Borna Disease virus (BDV) charakteristika

Více

Syfilis přehledně. MUDr.Hana Zákoucká Odd. STI, NRL pro syfilis, Státní zdravotní ústav ROCHE 6-2014

Syfilis přehledně. MUDr.Hana Zákoucká Odd. STI, NRL pro syfilis, Státní zdravotní ústav ROCHE 6-2014 Syfilis přehledně MUDr.Hana Zákoucká Odd. STI, NRL pro syfilis, Státní zdravotní ústav ROCHE 6-214 LEGISLATIVA Zákon č. 258/2 Sb., o ochraně veřejného zdraví Vyhláška MZ ČR č. 36/212 Sb., podmínky předcházení

Více

Praktické využití serologických metod

Praktické využití serologických metod Praktické využití serologických metod Daniel Sperling 21.3. 2014 Hotel Myslivna, Brno Využití sérologie v diagnostice infekčních onemocnění prasat sérologie je vědecká disciplína zaměřená na detekci protilátek

Více

www.vidia.cz α herpesviry Diagnostika, epidemiologie a klinický význam. kroubalova@vidia.cz

www.vidia.cz α herpesviry Diagnostika, epidemiologie a klinický význam. kroubalova@vidia.cz www.vidia.cz α herpesviry Diagnostika, epidemiologie a klinický význam. RNDr K.Roubalová kroubalova@vidia.cz Průběh infekce α herpesviry HSV1,2: Přenos kontaktem (sliny, poševní sekret,kožní léze) Produktivní

Více

PERTUSE diagnostika a klinické projevy. Vilma Marešová I.infekční klinika UK 2.LF a IPVZ FN Na Bulovce, Praha

PERTUSE diagnostika a klinické projevy. Vilma Marešová I.infekční klinika UK 2.LF a IPVZ FN Na Bulovce, Praha PERTUSE diagnostika a klinické projevy Vilma Marešová I.infekční klinika UK 2.LF a IPVZ FN Na Bulovce, Praha Pertuse Lidská endemická nákaza, přenos vzduchem Původce: Bordetella pertussis/b.parapertussis

Více

Diagnostika a epidemiologie HIV. Vratislav Němeček, Marek Malý NRL pro HIV/AIDS, Státní zdravotní ústav, Praha

Diagnostika a epidemiologie HIV. Vratislav Němeček, Marek Malý NRL pro HIV/AIDS, Státní zdravotní ústav, Praha Diagnostika a epidemiologie HIV Vratislav Němeček, Marek Malý NRL pro HIV/AIDS, Státní zdravotní ústav, Praha Původ SIVy se přirozeně vyskytují u afrických primátů a není známo, že by vyvolávaly onemocnění

Více

Laboratorní diagnostika klíšťové encefalitidy a dalších

Laboratorní diagnostika klíšťové encefalitidy a dalších Laboratorní diagnostika klíšťové encefalitidy a dalších flavivirových neuroinfekcí Hana Zelená Jan Raszka Jiří Januška Zdravotní ústav se sídlem v Ostravě Centrum klinických laboratoří Virologické i oddělení

Více

LNÍ SITUACE V EPIDEMIOLOGII SPALNIČEK V EU

LNÍ SITUACE V EPIDEMIOLOGII SPALNIČEK V EU AKTUÁLN LNÍ SITUACE V EPIDEMIOLOGII SPALNIČEK V EU M. Špliňo Katedra epidemiologie FVZ UO Hradec Králov lové 1 EPIDEMICKÝ VÝSKYT SPALNIČEK V EU Závažné vysoce kontagiózn zní virové onemocnění Klinický

Více

Varicella v těhotenství. K.Roubalová Vidia s.r.o.

Varicella v těhotenství. K.Roubalová Vidia s.r.o. Varicella v těhotenství K.Roubalová Vidia s.r.o. Infekce VZV 90% v dětství (3-5 let), 10% v dospělosti (horší průběh) Většina primárních infekcí symptomatická - Varicella Vždy virémie Infekčnost: vysoká:

Více

Očkovací kalendář v dospělosti CHLÍBEK ROMAN K A T E D R A E P I D E M I O L O G I E F A K U L T A V O J E N S K É H O Z D R A V O T N I C T V Í U O H R A D E C K R Á L O V É 2 0 1 4 Očkování dospělých

Více

PŘÍPRAVA PACIENTA : Speciální příprava pacienta ani dieta není nutná, pro obvyklé vyšetřování je vhodný odběr ráno, nalačno.

PŘÍPRAVA PACIENTA : Speciální příprava pacienta ani dieta není nutná, pro obvyklé vyšetřování je vhodný odběr ráno, nalačno. SEROLOGIE HEPATITID NÁZEV : Hepatitida A HAV-IgM POUŽITÍ : kvalitativní detekce protilátek proti viru hepatitidy A třídy IgM v lidském séru a plazmě při diagnostice akutní nebo nedávno proběhlé virové

Více

Vrozený zarděnkový syndrom - kazuistika. MUDr. Martina Marešová HS hl.m. Prahy

Vrozený zarděnkový syndrom - kazuistika. MUDr. Martina Marešová HS hl.m. Prahy Vrozený zarděnkový syndrom - kazuistika MUDr. Martina Marešová HS hl.m. Prahy Zarděnky - historie zarděnky byly poprvé popsány ve 2. pol. 18. stol. v roce 1866 nazvány rubella v roce 1941 australský oftalmolog

Více

Podaří se zkvalitněním diagnostiky a očkováním adolescentů a dospělých snížit pertusi u dětí?

Podaří se zkvalitněním diagnostiky a očkováním adolescentů a dospělých snížit pertusi u dětí? Podaří se zkvalitněním diagnostiky a očkováním adolescentů a dospělých snížit pertusi u dětí? Fabiánová Kateřina Oddělení epidemiologie infekčních nemocí Centrum epidemiologie a mikrobiologie SZÚ Praha

Více

VÝZNAM NĚKTERÝCH FAKTORŮ PREANALYTICKÉ FÁZE V MOLEKULÁRNÍ BIOLOGII

VÝZNAM NĚKTERÝCH FAKTORŮ PREANALYTICKÉ FÁZE V MOLEKULÁRNÍ BIOLOGII VÝZNAM NĚKTERÝCH FAKTORŮ PREANALYTICKÉ FÁZE V MOLEKULÁRNÍ BIOLOGII Plíšková L., Hrochová K., Kutová R. Ústav klinické biochemie a diagnostiky FN Hradec Králové PREANALYTICKÁ FÁZE V MOLEKULÁRNÍ BIOLOGII

Více

Cytomegalovirus. RNDr K.Roubalová CSc. NRL pro herpetické viry

Cytomegalovirus. RNDr K.Roubalová CSc. NRL pro herpetické viry Cytomegalovirus RNDr K.Roubalová CSc. NRL pro herpetické viry Lidský cytomegalovirus Β-herpesviridae, největší HV, cca 200 genů Příbuzné viry: myší, krysí, opičí, morčecí Kosmopolitní rozšíření, vysoká

Více

POVINNÉ VERSUS NEPOVINNÉ OČKOVÁNÍ A EVROPSKÉ OČKOVACÍ KALENDÁŘE PRYMULA R. FAKULTNÍ NEMOCNICE HRADEC KRÁLOVÉ

POVINNÉ VERSUS NEPOVINNÉ OČKOVÁNÍ A EVROPSKÉ OČKOVACÍ KALENDÁŘE PRYMULA R. FAKULTNÍ NEMOCNICE HRADEC KRÁLOVÉ POVINNÉ VERSUS NEPOVINNÉ OČKOVÁNÍ A EVROPSKÉ OČKOVACÍ KALENDÁŘE PRYMULA R. FAKULTNÍ NEMOCNICE HRADEC KRÁLOVÉ Očkovací kalendář Snaha optimalizovat schémata a odstupy mezi jednotlivými očkováními. Kalendář

Více

Podíl Haemophilus influenzae na ORL onemocněních po zavedení očkování antihemofilovou vakcínou

Podíl Haemophilus influenzae na ORL onemocněních po zavedení očkování antihemofilovou vakcínou Podíl Haemophilus influenzae na ORL onemocněních po zavedení očkování antihemofilovou vakcínou MUDr. Gabriela Forstová Dětská ORL klinika FN Brno a LFMU Infekce u dětí Nejčastější patogeny: Haemophilus

Více

MVDr. Zbyněk Semerád 3.12.2014

MVDr. Zbyněk Semerád 3.12.2014 MVDr. Zbyněk Semerád 3.12.2014 Infekční bovinní rinotracheitida Infekční bovinní rinotracheitida (IBR) je vysoce infekční onemocnění respiračního traktu vyvolané bovinním herpesvirem a projevuje se u skotu

Více

SARS - Severe Acute Respiratory Syndrome (těžký akutní respirační syndrom).

SARS - Severe Acute Respiratory Syndrome (těžký akutní respirační syndrom). SARS - Severe Acute Respiratory Syndrome (těžký akutní respirační syndrom). Charakteristika: SARS je závažné respirační onemocnění probíhající převážně jako těžká atypická pneumonie, komplikovaná respirační

Více

Eradikace BVD v Německu naše zkušenosti

Eradikace BVD v Německu naše zkušenosti Eradikace BVD v Německu naše zkušenosti MVDr. Kirsten Stemme Základní údaje o BVD Virus BVD - pestivirus - různé genotypy a subtypy - dva rozdílné biotypy (necytopatogenní, cytopatogenní) podle Heckerta

Více

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Charakteristika testu: Set AMPLICOR HPV vyráběný firmou Roche je určený pro detekci vysoko-rizikových typů lidských

Více

Elecsys anti HCV II ROCHE. 8. střešovický transfuzní den Praha 26. listopadu 2014

Elecsys anti HCV II ROCHE. 8. střešovický transfuzní den Praha 26. listopadu 2014 Posouzení IVD: Elecsys anti HCV II ROCHE Tesařová Eva, Křížová Eva, Pacasová Rita 8. střešovický transfuzní den Praha 26. listopadu 2014 Hepatitis C virus obalený RNA virus o průměru 50 nm čeleď Flaviviridae,

Více

18.11.2011. 23.11.2011 prezentace OKMP 1

18.11.2011. 23.11.2011 prezentace OKMP 1 18.11.2011 23.11.2011 prezentace OKMP 1 Zasílání vzorků na mikrobiologické vyšetření Zásady,chyby a využití MVDr.Petr Ježek Organizační členění OKMP. OKMP MVDr.Petr Ježek ATB středisko MUDr.Romana Filová

Více

Očkování těhotných nejúčinnější strategie prevence vzestupu pertuse u dětí?

Očkování těhotných nejúčinnější strategie prevence vzestupu pertuse u dětí? Očkování těhotných nejúčinnější strategie prevence vzestupu pertuse u dětí? Fabiánová Kateřina Centrum epidemiologie a mikrobiologie Státní zdravotní ústav, Praha X. Hradecké Vakcinologické dny 2. 4.10.2014,

Více

Vývoj VZV vakcín. Chlíbek Roman Katedra epidemiologie Fakulta vojenského zdravotnictví UO Hradec Králové

Vývoj VZV vakcín. Chlíbek Roman Katedra epidemiologie Fakulta vojenského zdravotnictví UO Hradec Králové Vývoj VZV vakcín Ticháčkovy dny vojenských epidemiologů, 17.5. 2012 Chlíbek Roman Katedra epidemiologie Fakulta vojenského zdravotnictví UO Hradec Králové Herpes zoster (HZ) 1953 první izolace viru (Thomas

Více

Akreditované zkoušky prováděné v Laboratořích CEM

Akreditované zkoušky prováděné v Laboratořích CEM Strana č.: 1 Nahrazuje stranu: 1 Akreditované zkoušky prováděné v Laboratořích CEM EIA - stanovení protilátek HIV-1/2, HIV-1 p24 antigenu a současné stanovení protilátek HIV-1/2 a HIV-1 p24 antigenu SOP-NRL/AIDS-01-01

Více

Současná situace ve výskytu dávivého kašle v ČR a související změny v očkovacím kalendáři MUDr. Fabiánová Kateřina MUDr.

Současná situace ve výskytu dávivého kašle v ČR a související změny v očkovacím kalendáři MUDr. Fabiánová Kateřina MUDr. Současná situace ve výskytu dávivého kašle v ČR a související změny v očkovacím kalendáři MUDr. Fabiánová Kateřina MUDr. Beneš Čestmír 23. Pečenkovy epidemiologické dny, 22. 24.9.29, Jihlava 1 B. pertussis

Více

Aktuální pohled na očkování dětské populace v ČR

Aktuální pohled na očkování dětské populace v ČR Aktuální pohled na očkování dětské populace v ČR X. Hradecké Vakcinologické dny 3. října 2014 MUDr. Hana Cabrnochová Česká vakcinologická společnost ČLS JEP Aktuální témata roku 2014 Dosažení vysoké proočkovanosti

Více

Očkování proti klíšťové encefalitidě v létě a po přisátí klíštěte

Očkování proti klíšťové encefalitidě v létě a po přisátí klíštěte Očkování proti klíšťové encefalitidě v létě a po přisátí klíštěte Jan Smetana Fakulta vojenského zdravotnictví UO, Hradec Králové X. Hradecké vakcinologické dny, 2. - 4. 0. 204 2 Klíšťová encefalitida

Více

Výskyt infekčních nemocí preventabilních očkováním v České republice v roce 2011

Výskyt infekčních nemocí preventabilních očkováním v České republice v roce 2011 INFORMACE Z NRL A ODBORNÝCH PRACOVIŠŤ CEM INFORMATION FROM THE NRL AND RESEARCH GROUPS OF THE CEM Výskyt infekčních nemocí preventabilních očkováním v České republice v roce 2011 The incidence of vaccine-preventable

Více

Surveillance a epidemiologická situace invazivních bakteriálních onemocnění v ČR a v Evropě Pavla Křížová, Jana Kozáková, Věra Lebedová Centrum epidemiologie a mikrobiologie Státní zdravotní ústav Praha

Více

Vývoj očkovacího kalendáře v ČR IX. Hradecké vakcinologické dny 3. - 5.10.2013

Vývoj očkovacího kalendáře v ČR IX. Hradecké vakcinologické dny 3. - 5.10.2013 Vývoj očkovacího kalendáře v ČR IX. Hradecké vakcinologické dny 3. - 5.10.2013 MUDr. Hana Cabrnochová Česká vakcinologická společnost ČLS JEP PLDD Vývoj očkování před rokem 1945 Očkování proti neštovicím

Více

EPIDEMIOLOGIE HEPATITID TYPU A A B NEJEN VE VZTAHU K LABORATORNÍM VÝSLEDKŮM

EPIDEMIOLOGIE HEPATITID TYPU A A B NEJEN VE VZTAHU K LABORATORNÍM VÝSLEDKŮM Hana Tkadlecová, Čestmír Beneš protiepidemický odbor KHS ZK se sídlem ve Zlíně Státní zdravotní ústav v Praze EPIDEMIOLOGIE HEPATITID TYPU A A B NEJEN VE VZTAHU K LABORATORNÍM VÝSLEDKŮM Legislativa vyhláška

Více

C 16 Zásady odběrů biologického materiálu

C 16 Zásady odběrů biologického materiálu C 16 Zásady odběrů biologického materiálu Odběrovou soupravu tvoří dva vatové tampony, zkumavka s virologickým odběrovým médiem a záznamová karta. Odběrové médium se uchovává v mrazničce při teplotě 20

Více

PŘÍPRAVA ZDRAVOTNICKÉHO ZAŘÍZENÍ NA PANDEMII CHŘIPKY

PŘÍPRAVA ZDRAVOTNICKÉHO ZAŘÍZENÍ NA PANDEMII CHŘIPKY PŘÍPRAVA ZDRAVOTNICKÉHO ZAŘÍZENÍ NA PANDEMII CHŘIPKY TEORIE A PRAXE MUDr. Jarmila Kohoutová Oddělení nemocniční hygieny FNOL V.celostátní konference Medicína katastrof, traumatologické plánování a příprava,

Více

Rizikový pacient a pertuse. Diagnostika a očkování.

Rizikový pacient a pertuse. Diagnostika a očkování. Rizikový pacient a pertuse. Diagnostika a očkování. MUDr. Kateřina Fabiánová 1,2 Oddělení epidemiologie infekčních nemocí, CEM, Státní zdravotní ústav, Praha 1 Ústav epidemiologie, 3. LF UK, Praha 2 IX.

Více

Diagnostika chlamydiových infekcí. MUDr. Hana Zákoucká Odd. STI, SZÚ Dynex, Brno 3-2012

Diagnostika chlamydiových infekcí. MUDr. Hana Zákoucká Odd. STI, SZÚ Dynex, Brno 3-2012 Diagnostika chlamydiových infekcí MUDr. Hana Zákoucká Odd. STI, SZÚ Dynex, Brno 3-2012 TAXONOMIE CHLAMYDIÍ Nová a znovu opuštěná klasifikace chlamydií přijatá z roku 2000 zahrnuje v čeledi Chlamydiaceae

Více

Klinika infekčních nemocí, FN Hradec Králové

Klinika infekčních nemocí, FN Hradec Králové Pavel Kosina Klinika infekčních nemocí, FN Hradec Králové Centrum očkování a cestovní medicíny historie imunizace charakteristika očkovací látky bezpečnost, imunogenita a účinnost vakcíny vakcinační schémata,

Více

SAMOSTATNÁ PRÁCE 2012 jmeno a prijmeni

SAMOSTATNÁ PRÁCE 2012 jmeno a prijmeni ZÁPADOČESKÁ UNIVERZITA V PLZNI SAMOSTATNÁ PRÁCE 2012 jmeno a prijmeni ZÁPADOČESKÁ UNIVERZITA V PLZNI Příušnice Samostatná práce Informatika a výpočetní technika KIV/IFYER jmeno a prijmeni Obsah 1 Příušnice

Více

Interpretace serologických výsledků. MUDr. Pavel Adamec Sang Lab klinická laboratoř, s.r.o.

Interpretace serologických výsledků. MUDr. Pavel Adamec Sang Lab klinická laboratoř, s.r.o. Interpretace serologických výsledků MUDr. Pavel Adamec Sang Lab klinická laboratoř, s.r.o. Serologická diagnostika EBV Chlamydia pneumoniae Mycoplasma pneumoniae EBV - charakteristika DNA virus ze skupiny

Více

Mezinárodní surveillance infekčních onemocnění. 24. Pečenkovy epidemiologické dny České Budějovice, září 2010

Mezinárodní surveillance infekčních onemocnění. 24. Pečenkovy epidemiologické dny České Budějovice, září 2010 Mezinárodní surveillance infekčních onemocnění 24. Pečenkovy epidemiologické dny České Budějovice, září 2010 Pavla Křížová Státní zdravotní ústav, Praha Koncepce surveillance byla založena již v šedesátých

Více

Zkušenosti s očkováním proti klíšťové encefalitidě, základní epidemiologické charakteristiky v souboru nemocných za 50 let

Zkušenosti s očkováním proti klíšťové encefalitidě, základní epidemiologické charakteristiky v souboru nemocných za 50 let Zkušenosti s očkováním proti klíšťové encefalitidě, základní epidemiologické charakteristiky v souboru nemocných za 50 let P. Pazdiora 24. Pečenkovy dny, České Budějovice 15.-17.9.2010 Historie poznatků

Více

SPALNIČKY V ZEMÍCH EU

SPALNIČKY V ZEMÍCH EU SPALNIČKY V ZEMÍCH EU M. Špliňo, V. Boštíková Univerzita obrany Fakulta vojenského zdravotnictví Hradec Králové 1 EPIDEMICKÝ VÝSKYT SPALNIČEK V EU Závažné vysoce kontagiózní virové onemocnění Celosvětový

Více

Aktuality v očkování 2015

Aktuality v očkování 2015 Aktuality v očkování 2015 XI. Hradecké vakcinologické dny 2015 1.- 3.10. 2015 MUDr. Hana Cabrnochová, MBA Česká vakcinologická společnost ČLS JEP Katedra PLDD IPVZ Praha Aktuální témata roku 2015 Odmítání

Více

R. Šošovičková, J. Smetana, R. Chlíbek Fakulta vojenského zdravotnictví UO, Hradec Králové

R. Šošovičková, J. Smetana, R. Chlíbek Fakulta vojenského zdravotnictví UO, Hradec Králové R. Šošovičková, J. Smetana, R. Chlíbek Fakulta vojenského zdravotnictví UO, Hradec Králové epidemiologicky nejzávažnější typ mezi virovými hepatitidami případy 4000 3500 3000 2500 2000 1500 1982-2014 r.

Více

Státní politika v oblasti očkování. MUDr. Michael Vít, PhD.

Státní politika v oblasti očkování. MUDr. Michael Vít, PhD. Státní politika v oblasti očkování MUDr. Michael Vít, PhD. VII. Hradecké vakcinologické dny 29. 9. 1. 10. 2011 Pravidelné, zvláštní a mimořádné očkování Pravidelné, zvláštní a mimořádné očkování je založeno

Více

Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku. Richard J W Currie

Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku. Richard J W Currie Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku Richard J W Currie Virus infekční bronchitidy RNA (nukleová kyselina) uvnitř Proteiny (spike proteiny S1 a S2) na vnější straně

Více

Lékařská mikrobiologie pro ZDRL

Lékařská mikrobiologie pro ZDRL Lékařská mikrobiologie pro ZDRL Týden 10: Umělá imunizace rozvedení Serologické reakce opakování před další částí Ondřej Zahradníček 777 031 969 zahradnicek@fnusa.cz ICQ 242-234-100 Dnes máme na programu

Více

KLINICKÉ A LABORATORNÍ CHARAKTERISTIKY ROTAVIROVÝCH A NOROVIROVÝCH INFEKCÍ. Helena Ambrožová 1. infekční klinika 2. LF UK a NNB

KLINICKÉ A LABORATORNÍ CHARAKTERISTIKY ROTAVIROVÝCH A NOROVIROVÝCH INFEKCÍ. Helena Ambrožová 1. infekční klinika 2. LF UK a NNB KLINICKÉ A LABORATORNÍ CHARAKTERISTIKY ROTAVIROVÝCH A NOROVIROVÝCH INFEKCÍ Helena Ambrožová 1. infekční klinika 2. LF UK a NNB X. Hradecké vakcinologické dny, Hradec Králové 4.10.2014 Rotaviry - charakteristika

Více

Očkování a chemoprofylaxe chřipky u dětí aneb měly by být zdravé děti očkovány proti chřipce?

Očkování a chemoprofylaxe chřipky u dětí aneb měly by být zdravé děti očkovány proti chřipce? Očkování a chemoprofylaxe chřipky u dětí aneb měly by být zdravé děti očkovány proti chřipce? Martina Havlíčková Jan Kynčl Státní zdravotní ústav Proč je chřipka stále problém? Je stále přítomna v populaci

Více

Výskyt enterovirových meningitid v kolektivu

Výskyt enterovirových meningitid v kolektivu Výskyt enterovirových meningitid v kolektivu Hana Tkadlecová Protiepidemický odbor KHS ZK se sídlem ve Zlíně 577 006 741, hana.tkadlecova@khszlin.cz 1 Enteroviry Čeleď Picornaviridae: Rody: Enterovirus

Více

Legislativní problematika očkování dospělých. X.Hradecké vakcinologické dny

Legislativní problematika očkování dospělých. X.Hradecké vakcinologické dny Legislativní problematika očkování dospělých X.Hradecké vakcinologické dny Něco z historie Průběžné četné změny právních předpisů.. 2009 změny v organizaci a kompetencích OHS, zejm. distribuce vakcín,

Více

Společnost pro transfuzní lékařství

Společnost pro transfuzní lékařství Česká lékařská společnost Jana Evangelisty Purkyně Společnost pro transfuzní lékařství Česká společnost infekčního lékařství ČLS JEP Doc. MUDr. Staňková Marie CSc. předsedkyně V Hradci Králové, 29. května

Více

CHŘIPKA KONÍ JE HROZBOU NA POKRAČOVÁNÍ

CHŘIPKA KONÍ JE HROZBOU NA POKRAČOVÁNÍ CHŘIPKA KONÍ JE HROZBOU NA POKRAČOVÁNÍ Na naší polokouli chřipka zpravidla koně nezabíjí: zabíjí události. Rychlost šíření a síla chřipkové vlny závisí na: množství nenavakcinovaných koní frekvenci přesunů

Více

Chřipka - neviditelný nepřítel: zvýšíme proočkovanost u indikovaných pacientů na 75%? Jan Kynčl Státní zdravotní ústav Praha

Chřipka - neviditelný nepřítel: zvýšíme proočkovanost u indikovaných pacientů na 75%? Jan Kynčl Státní zdravotní ústav Praha Chřipka - neviditelný nepřítel: zvýšíme proočkovanost u indikovaných pacientů na 75%? Jan Kynčl Státní zdravotní ústav Praha Obsah prezentace Chřipka: výskyt onemocnění závažnost chřipky Očkování proti

Více

laboratorní diagnostika a očkování

laboratorní diagnostika a očkování Bordetella pertussis laboratorní diagnostika a očkování Olga Štěpáníková Imunologické oddělení laboratoří IFCOR-99, Brno XI. Den laboratorní diagnostiky - nejen lymeské boreliózy, Brno, 27.3.2012 Kdo jednou

Více

Očkování proti pneumokokovým nákazám v dětském a dospělém věku

Očkování proti pneumokokovým nákazám v dětském a dospělém věku Očkování proti pneumokokovým nákazám v dětském a dospělém věku Milan Trojánek Klinika infekčních nemocí 2. lékařská fakulta, Univerzita Karlova v Praze Klinika infekčních, parazitárních a tropických nemocí

Více

Zhodnocení epidemiologické situace ve výskytu akutních respiračních onemocnění a chřipky v Karlovarském kraji v sezóně 2015/2016

Zhodnocení epidemiologické situace ve výskytu akutních respiračních onemocnění a chřipky v Karlovarském kraji v sezóně 2015/2016 K R A J S K Á H Y G I E N I C K Á S T A N I C E KARLOVARSKÉHO KRAJE SE SÍDLEM V KARLOVÝCH VARECH adresa: Závodní 94, 36021 Karlovy Vary, tel:355 328 311, e-mail:sekretariat@khskv.cz, ID:t3jai32 Váš dopis

Více

Plíšková L. Ústav klinické biochemie a diagnostiky LF a FN Hradec Králové

Plíšková L. Ústav klinické biochemie a diagnostiky LF a FN Hradec Králové PCR v diagnostice Lymeské boreliózy Plíšková L. Ústav klinické biochemie a diagnostiky LF a FN Hradec Králové obtížná Diagnostika lymeské boreliózy klinický obraz velmi rozmanitý anamnestické údaje (přisátí

Více

Vědecký výbor veterinární

Vědecký výbor veterinární Vědecký výbor veterinární Klasifikace: Draft Pro vnitřní potřebu VVV Oponovaný draft Pro vnitřní potřebu VVV Finální dokument X Pro oficiální použití Deklasifikovaný dokument Pro veřejné použití MOŽNOSTI

Více

Epidemie Q horečky v Nizozemí a situace v ČR

Epidemie Q horečky v Nizozemí a situace v ČR Epidemie Q horečky v Nizozemí a situace v ČR Kateřina Fabiánová, Čestmír Beneš SZÚ Praha 24. Pečenkovy epidemiologické dny, 15. 17. 9.2010 České Budějovice Epidemiologické charakteristiky Původce: Coxiella

Více

PERTUSE LABORATORNÍ DIAGNOSTIKA

PERTUSE LABORATORNÍ DIAGNOSTIKA PERTUSE LABORATORNÍ DIAGNOSTIKA Jana Zavadilová Státn tní zdravotní ústav, Praha Konference Problematika Pertuse, 15.4. 2011 1 EU definice potvrzeného případu p padu pro pertusi vyhláš áška č.. 275/2010

Více

Závěrečná zpráva. Zkoušení způsobilosti v lékařské mikrobiologii (Externí hodnocení kvality) PT#M/32/2010 (č. 677) Identifikace herpetických virů

Závěrečná zpráva. Zkoušení způsobilosti v lékařské mikrobiologii (Externí hodnocení kvality) PT#M/32/2010 (č. 677) Identifikace herpetických virů Státní zdravotní ústav Expertní skupina pro zkoušení způsobilosti Organizátor programů zkoušení způsobilosti akreditovaný ČIA, reg. č. 7001 Šrobárova 48, 100 42 Praha 10 Vinohrady Závěrečná zpráva Zkoušení

Více

ková Jan Smetana,, Roman Chlíbek Fakulta vojenského zdravotnictví Hradec Králov lové

ková Jan Smetana,, Roman Chlíbek Fakulta vojenského zdravotnictví Hradec Králov lové Očkování proti tetanu Jan Smetana,, Roman Chlíbek Vanda Boštíkov ková Fakulta vojenského zdravotnictví Hradec Králov lové V. Hradecké vakcinologické dny, 1. 3. 10.2009 Tetanus - epidemiologie Clostridium

Více

8. Přehled vyšetření interpretace výsledků

8. Přehled vyšetření interpretace výsledků 8. Přehled vyšetření interpretace výsledků 8.1. Laboratoř sérologie a PCR Interpretace výsledků jednotlivých vyšetření je standardně přejímána z návodů na používanou diagnostiku, obvyklé hodnocení výsledků

Více

Bakteriologická analýza potravin

Bakteriologická analýza potravin Bakteriologická analýza potravin a. Souhrn Ve studii zaměřené na bakteriologickou analýzu potravin jsme sledovali výskyt vybraných patogenních agens v potravinách z tržní sítě. Výběr vyšetřovaných komodit

Více

Současné očkovací kalendáře evropských zemí v porovnání s českým kalendářem

Současné očkovací kalendáře evropských zemí v porovnání s českým kalendářem Současné očkovací kalendáře evropských zemí v porovnání s českým kalendářem IX. HVD, 3.-5.10. 2013 Hradec Králové Roman Chlíbek Fakulta vojenského zdravotnictví UO Česká vakcinologická společnost Hradec

Více

Seznam vyšetření Pracoviště virologie

Seznam vyšetření Pracoviště virologie Obsah: Seznam vyšetření Pracoviště virologie A/ Diagnostika hepatitid a HIV 2 Protilátky proti viru hepatitidy A, IgM a celkové (total) 2 HBsAg, povrchový antigen viru hepatitidy B.. 2 Anti-HBs, protilátky

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

Interpretace sérologických nálezů u chlamýdií

Interpretace sérologických nálezů u chlamýdií Interpretace sérologických nálezů u chlamýdií MUDr. Dana Hrubá VIDIA-DIAGNOSTIKA Poliklinika Černý Most, Praha 9 hruba@vidia-diagnostika.cz Onemocnění u lidí způsobovaná chlamydiemi Druh chlamydií Sérotypy

Více

Epidemiologie virových hepatitid, vakcinace

Epidemiologie virových hepatitid, vakcinace Epidemiologie virových hepatitid, vakcinace MUDr. Jan Smetana Katedra epidemiologie Fakulta vojenského zdravotnictví Univerzity obrany Hradec Králové Virové hepatitidy - zánětlivé onemocnění jater vyvolané

Více

Progrese HIV infekce z pohledu laboratorní imunologie

Progrese HIV infekce z pohledu laboratorní imunologie Progrese HIV infekce z pohledu laboratorní imunologie 1 Lochmanová A., 2 Olbrechtová L., 2 Kolčáková J., 2 Zjevíková A. 1 OIA ZÚ Ostrava 2 klinika infekčních nemocí, FN Ostrava HIV infekce onemocnění s

Více

Epidemický výskyt parotitis epidemica v Ústeckém kraji

Epidemický výskyt parotitis epidemica v Ústeckém kraji EXTRAMURAL CONTRIBUTIONS Epidemický výskyt parotitis epidemica v Ústeckém kraji Mumps outbreak in the Ústí administrative region Josef Trmal, Josef Kočí, Lenka Šimůnková, Olga Štorkánová, Zdeňka Trmalová

Více

METODY IDENTIFIKACE VIRU HIV

METODY IDENTIFIKACE VIRU HIV Název: Školitel: METODY IDENTIFIKACE VIRU HIV Soňa KŘÍŽKOVÁ Datum: 5.12.2013 Reg.č.projektu: CZ.1.07/2.4.00/31.0023 Název projektu: Partnerská síť centra excelentního bionanotechnologického výzkumu Virus

Více

Klinika virových hepatitid je sourodá, ale etiopatogeneze je nesourodá.

Klinika virových hepatitid je sourodá, ale etiopatogeneze je nesourodá. Charakteristika analýzy: Identifikace: ANTI-HEV TOTAL, ANTI-HEV IGM Využití: ukazatel přítomnosti hepatitis E viru (nejlépe v kombinaci s průkazem patogenu metodou PCR) Referenční mez : < 0,9 OD (hodnoty

Více

MUDr. Helena Šutová Laboratoře Mikrochem a.s.

MUDr. Helena Šutová Laboratoře Mikrochem a.s. Laboratorní diagnostika celiakie MUDr. Helena Šutová Laboratoře Mikrochem a.s. Celiakie Autoimunní onemocnění způsobené požitím lepku (glutenu) s typickým zánětlivým postižením tenkého střeva s genetickou

Více

Očkování cestovatelů. 1. infekční klinika 2. lékařská fakulta, Univerzita Karlova v Praze

Očkování cestovatelů. 1. infekční klinika 2. lékařská fakulta, Univerzita Karlova v Praze Očkování cestovatelů Milan Trojánek 1. infekční klinika 2. lékařská fakulta, Univerzita Karlova v Praze Klinika infekčních, parazitárních a tropických nemocí Nemocnice Na Bulovce, Praha Cestovní a

Více

WWW.DYNEX.CZ DEN LABORATORNÍ DIAGNOSTIKY

WWW.DYNEX.CZ DEN LABORATORNÍ DIAGNOSTIKY DEN LABORATORNÍ DIAGNOSTIKY LYMESKÉ BORRELIÓZY Brno, seminář f. Dynex 1.4.2009 Zdravotní ústav se sídlem v Ostravě Centrum klinických laboratoří Hana Bílková Fránková á Oddělení parazitologie a lékařské

Více

Očkování pacientů s chronickým renálním selháváním

Očkování pacientů s chronickým renálním selháváním Hradecké vakcinologické dny 2.-4.10.2014 Sympozium všeobecných praktických lékařů Očkování pacientů s chronickým renálním selháváním Sylvie Dusilová Sulková Hemodialyzační středisko Fakultní nemocnice

Více

Lidský herpesvirus 6 biologie, diagnostika, patogeneze. K.Roubalová Vidia spol.s r.o.

Lidský herpesvirus 6 biologie, diagnostika, patogeneze. K.Roubalová Vidia spol.s r.o. Lidský herpesvirus 6 biologie, diagnostika, patogeneze K.Roubalová Vidia spol.s r.o. Zařazení, genetika HHV6B vs. HHV6A: 75% shoda genů, 62% shoda proteinů Epidemiologie Dospělá populace promořena z >

Více

Původci morbiliformního exantému v anglické, vysoce proočkované populaci (Causes of morbilliform rash in a highly immunised English population)

Původci morbiliformního exantému v anglické, vysoce proočkované populaci (Causes of morbilliform rash in a highly immunised English population) 1 Studijní materiál důchodce č. 140 Listopad 2002 Původci morbiliformního exantému v anglické, vysoce proočkované populaci (Causes of morbilliform rash in a highly immunised English population) Ramsay

Více

Problematika dialyzovaných pacientů s MRSA

Problematika dialyzovaných pacientů s MRSA Problematika dialyzovaných pacientů s MRSA Mgr. Irena Stašková Petra Lacinová Dialyzační středisko Praha Homolka B. Braun Avitum s.r.o. MRSA Methicilin rezistentní S. aureus Představuje významnou zdravotní

Více

ProGastrin-Releasing Peptide (ProGRP) u nemocných s malobuněčným karcinomem plic

ProGastrin-Releasing Peptide (ProGRP) u nemocných s malobuněčným karcinomem plic ProGastrin-Releasing Peptide (ProGRP) u nemocných s malobuněčným karcinomem plic FONS Symposium klinické biochemie Pardubice, 23.9. 25.9.202 M. Tomíšková, J. Skřičková, I. Klabenešová, M. Dastych 2 Klinika

Více

Pneumokokové pneumonie u dětí. Vilma Marešová Univerzita Karlova 2.LF I. Infekční klinika FNB Praha

Pneumokokové pneumonie u dětí. Vilma Marešová Univerzita Karlova 2.LF I. Infekční klinika FNB Praha Pneumokokové pneumonie u dětí Vilma Marešová Univerzita Karlova 2.LF I. Infekční klinika FNB Praha Streptococcus pneumoniae Charakteristika: Ubikvitérní grampozitivní koky, které jsou často přítomny na

Více

po přisátí klíštěte virus prokazován kůže virémie buňky RES (slezina, játra, kostní dřeň) mechanismus invaze do CNS nejasný, HEB při virémii

po přisátí klíštěte virus prokazován kůže virémie buňky RES (slezina, játra, kostní dřeň) mechanismus invaze do CNS nejasný, HEB při virémii Středoevropská klíšťová meningoencefalitida klinický obraz MUDr. Dita Smíšková, PhD Doc.MUDr.Vilma Marešová, CSc. MEK patogeneze po přisátí klíštěte virus prokazován nejprve v Langerhansových h buňkách

Více

Detekce papillomavirové infekce před vakcinací Silgardem či Cervarixem u žen v ČR

Detekce papillomavirové infekce před vakcinací Silgardem či Cervarixem u žen v ČR Detekce papillomavirové infekce před vakcinací Silgardem či Cervarixem u žen v ČR Šmahelová J., Hamšíková E., Ludvíková V., Stašíková J., Saláková M., Tachezy R. NRL pro papillomaviry ÚHKT Praha www.papillomavirus.cz

Více

Stanovisko Světové zdravotnické organizace k vakcínám proti zarděnkám (Rubella vaccines: WHO position paper)

Stanovisko Světové zdravotnické organizace k vakcínám proti zarděnkám (Rubella vaccines: WHO position paper) 1 Studijní materiál - speciál č. 128 Září 2011 Stanovisko Světové zdravotnické organizace k vakcínám proti zarděnkám (Rubella vaccines: WHO position paper) Weekly epidemiological record, No. 29, 2011,

Více

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést

Více

VAKCÍNY PRO PRASATA SUIVAC

VAKCÍNY PRO PRASATA SUIVAC VAKCÍNY PRO PRASATA SUIVAC v a c c i n e s f o r p i g s Inaktivovaná purifikovaná subjednotková vakcína proti aktinobacilové pleuropneumonii pro klasickou intramuskulární nebo bezjehelnou intradermální

Více

PREVENAR 13 A JEHO VÝZNAM V PREVENCI PNEUMOKOKOVÝCH ONEMOCNĚNÍ. Roman Chlíbek. Fakulta vojenského zdravotnictví UO Hradec Králové

PREVENAR 13 A JEHO VÝZNAM V PREVENCI PNEUMOKOKOVÝCH ONEMOCNĚNÍ. Roman Chlíbek. Fakulta vojenského zdravotnictví UO Hradec Králové PREVENAR 13 A JEHO VÝZNAM V PREVENCI PNEUMOKOKOVÝCH ONEMOCNĚNÍ Roman Chlíbek Fakulta vojenského zdravotnictví UO Hradec Králové Satelitní sympózium Pfizer VI. Hradecké vakcinologické dny 2010 Onemocnění

Více

Očkování v těhotenství. T. Binder, B. Vavřinková Výbor SPaFMM ČGPS Revize R. Prymula, P. Kosina, ČVS JEP

Očkování v těhotenství. T. Binder, B. Vavřinková Výbor SPaFMM ČGPS Revize R. Prymula, P. Kosina, ČVS JEP Očkování v těhotenství T. Binder, B. Vavřinková Výbor SPaFMM ČGPS Revize R. Prymula, P. Kosina, ČVS JEP Obecná pravidla 1) K očkování těhotné ženy je třeba přistupovat individuálně. 2) Vždy je třeba zvážit

Více