Příušnice. strategie laboratorní diagnostiky u vysoce proočkované populace

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Příušnice. strategie laboratorní diagnostiky u vysoce proočkované populace"

Transkript

1 Příušnice strategie laboratorní diagnostiky u vysoce proočkované populace Radomíra Limberková F.Sedláček, J.Poustková, O.Hégrová, M.G.Schreinerová, J.Trmal VIII. Hradecké vakcinologické dny

2 Laboratorní průkaz onemocnění příušnicemi vyhl.473/2008 o systému epidemiologické bdělosti pro vybrané infekce ve znění vyhlášky č.233/2011; příl. č.14 Systém epidemiologické bdělosti příušnic; čl.2 - Laboratorní diagnostika 1. Přímý průkaz nevakcinálního kmene viru příušnic izolací z klinického vzorku odebraného v akutní fázi onemocnění 2. Detekce nukleové kyseliny nevakcinálního kmene viru příušnic izolací z klinického vzorku odebraného v akutní fázi onemocnění 3. Detekce IgM protilátek proti viru příušnic u osob, které nebyly v posledních 6 týdnech očkovány 4. Průkaz sérokonverze nebo výrazného, několikanásobného vzestupu hladiny specifických parotitických IgG protilátek vyšetřením dvojice vzorků sér nebo slin osob, které nebyly v posledních 6 týdnech očkovány 5. Průkaz vzrůstu hladin již existujících parotitických IgG protilátek u reinfekcí 6. Detekce antigenu nevakcinálního kmene viru příušnic (DFA) pomocí specifických parotitických monoklonálních protilátek v klinickém vzorku, odebraném v akutní fázi onemocnění Ke správné interpretaci laboratorních výsledků je třeba brát v úvahu též klinické a epidemiologické údaje včetně statusu očkování.

3 Doporučení WHO WHO doporučuje provádění molekulárně epidemiologických studií zahrnujících genotypizaci recentních příušnicových kmenů jako součást programu surveillance. Detailní monitoring by mohl pomoci objasnit vzorce cirkulace viru, jeho evoluci a rovněž by mohl napomoci k vytvoření strategie kontroly nad vznikajícími epidemiemi. Pro detailní monitoring ovšem v ČR chybí legislativní opora, neboť na rozdíl od spalniček a zarděnek, pro příušnice není vyhláškou stanovena povinnost zasílání izolátů z klinických vzorků do NRL k dalšímu určování.

4 Současná praxe v laboratorní diagnostice příušnic 1. sérologie - běžně zasílanými klinickými vzorky jsou diagnosticky méně vhodná akutní séra, jejichž vyšetřením obvykle získáme problematicky interpretovatelná data a pro definitivní diagnostický závěr je nutné provést vyšetření párového vzorku séra, čímž je laboratorní závěr oddálen 2. vhodnější možnost přímého průkazu infekčního agens není zatím využívána, ačkoli se jedná o neinvazivní způsob odběru s výhodou rychlého diagnostického závěru (RT-PCR)

5 Vhodné vzorky pro přímý průkaz - Stěr z bukální sliznice, sliny nejpozději do 9.dne od začátku klinických příznaků (ideálně do 3.-4.dne) - Moč nejpozději do 9.dne od začátku klinických příznaků (ideálně do 4.dne) méně vhodná (náročnější ke zpracování, cytotoxická na tkáňové kultury) Příušnice: příručka pro odběr, skladování a transport klinického materiálu - Likvor parotitická meningitida

6 Skladování a transport vzorků Bukálně orální stěry, sliny, moč do 24 hodin od odběru při teplotě +4 C dlouhodobě při teplotě -70 C, při přepravě nesmí rozmrznout (suchý led) Sérum do týdne od odběru při teplotě +4 C dlouhodobě při teplotě -20 C

7 Nejvhodnější klinické vzorky Ideální sestava zaslaného klinického materiálu: - vzorek pro přímý průkaz + párové sérum Reálná sestava klinického materiálu - vhodná pro zjištění primárního či sekundárního selhání vakcinace u vzorků s prokázanou přítomností viru příušnic (PCR, TK) - vzorek pro přímý průkaz + akutní sérum

8 Sérologický průkaz primárního či sekundárního selhání vakcinace vyšetřením akutního vzorku séra u pacientů s pozitivním záchytem viru příušnic RRL RKI, Berlín primární selhání vakcinace (= primoinfekce) IgM pozitivní IgG negativní,hraniční, pozitivní sekundární selhání vakcinace (= reinfekce) IgM negativní IgG pozitivní, rychle se zvyšující

9 Specifika diagnostiky vakcinovaných FALEŠNĚ NEGATIVNÍ NÁLEZY U VAKCINOVANÝCH OSOB: v akutním séru často nejsou detekovatelné IgM protilátky (až u 30%) u párových sér často nedochází k očekávanému signifikantnímu vzestupu titru protilátek ani sérokonverzi v párových sérech vakcinovaní vylučují méně viru a po kratší dobu, protože IgG protilátky stoupají v akutní fázi často velmi rychle (nutnost časného odběru nejlépe do 3.dne) 80% nemocných v ČR patří mezi vakcinované osoby Nespolehlivá sérologie - jednoznačným průkazem probíhající infekce je izolace viru či průkaz virové RNA

10 Diagnostické metody NRL PŘÍMÝ PRŮKAZ VIRU: 1. Izolace na tkáňových kulturách Vero 2. RT-PCR Mumps Virus RT-PCR kit, Shanghai ZJ, BioTech SÉROLOGIE: 1. ELISA Enzygnost Anti-ParotitisVirus/IgM, Siemens Enzygnost Anti-ParotitisVirus/IgG, Siemens 2. Hemaglutinačně inhibiční test (HIT) 3. Virus neutralizační test (VNT)

11 Vzorky k přímému průkazu viru příušnic únor-květen stěrů z bukální sliznice zejména od ambulantních pacientů infekčních klinik z regionů se zvýšeným výskytem onemocnění (5 z nich nebylo validních nestandardní odběr a nevhodné dlouhodobé skladování - 40 dní při +8 C) - odebrané převážně v počátku klinické manifestace onemocnění (do 4.dne od začátku onemocnění) - časnost odběru (nejlépe do 3.dne) je pro záchyt viru nezbytná zejména u vakcinovaných

12 Růstové vlastnosti příušnicových kmenů izolovaných v roce 2012 Virus má velmi dobré růstové vlastnosti: - cytopatický efekt obvykle již od 3.dne 1.pasáže - i z PCR negativního vzorku se podařilo izolovat virus - izolace viru i ze vzorku, který byl 40 dní uchovaný v lednici a nestandardně odebrán matka této pacientky (1968) hospitalizace - mening., pankreatitis dvě vakcinované sestry neonemocněla, 2003 onemocněla pozitivní záchyty kmenů příušnic (izolace, PCR) 16/27 59,25% resp. 15/22 68,18% (pouze validní vzorky)

13 Přímý průkaz viru-vyšetřovací schéma Izolační pokus pozitivita 13x identifikace (RT-PCR, IHAd, HIT) 27 stěrů negativita, bakt.kontam, atyp.cpe 5x 6x 3 x HSV-1 RT-PCR pozitivita negativita 3x (2x BK, 1x CPE HSV-1)

14 Výsledky izolace na buňkách Vero Místo Počet vzorků TK + TK - BK HSV Genotypizace Karlovy Vary Pardubice Teplice Praha Praha Liberec celkem x PCR + 3 1xPCR + 12

15 Genom viru příušnic - jednovláknitá nesegmentovaná RNA negativní polarity nukleotidů - 7 genů pro následujících 7 proteinů genomové mapy: core proteiny: 1. nukleokapsidový (NP) 2. phosphoprotein (P) V a I 3. membránový matrix (M) 4. large (L) povrchové glykoproteiny: 5. fúzní (F) 6. hemaglutinin-neuraminidáza (HN) nejvariabilnější s neobjasněnou funkcí: 7. small hydrophobic (SH)

16 SH protein na základě sekvenční analýzy genu SH proteinu (nejvariabilnější části genomu viru příušnic) se kmeny viru příušnic dělí na jednotlivé genotypy v současnosti je známo třináct genotypů: A-M v rámci daného genotypu existují varianty genotypy C, D, E, G, H - západní polokoule B, F, I - Asie genotypy C, D, G, H, I, J jsou považovány za neuropatogenní genetický základ neurovirulence není zatím objasněn v určitém geografickém regionu může současně cirkulovat více genotypů, např Španělsko: genotyp H hromadný výskyt genotyp D sporadické případy

17 Označení NRL Kmeny viru příušnic zaslané ke genotypizaci do RRL RKI Místo odběru Označení RRL Rok narození Vakcinační status MuVi-CZE12-56 Karlovy Vary dávky MuVi-CZE12-59 Karlovy Vary dávky MuVi-CZE12-72 Pardubice neznámo MuVi-CZE12-73 Pardubice dávky MuVi-CZE12-77 Pardubice dávky MuVi-CZE12-80 Pardubice dávky MuVi-CZE12-81 Pardubice dávky MuVi-CZE12-86 Pardubice nevakcinován MuVi-CZE12-89 Pardubice dávky MuVi-CZE Teplice dávky MuVi-CZE Praha dávky MuVi-CZE Praha dávky

18 Výsledky genotypizace z RRL RKI ze všech 12 zaslaných kmenů (2 KV, 7 PA, 2 Pha,1 TE) byla úspěšně extrahována MuV RNA a následně byla provedena sekvenace 316 nukleotidů genu SH proteinu všechny izolované kmeny viru příušnic v ČR - genotyp G genotypizované kmeny z daných regionů se liší: jedním nukleotidem: varianta Karlovy Vary ( shodné s Prahou 10) varianta Pardubice (shodné s Prahou 5) jedním nukleotidem od varianty Pardubice a dvěma nukleotidy od varianty Karlovy Vary: varianta Teplice

19 Sekvence nukleotidů reprezentující jednotlivé varianty genotypu G >MuVi-CZE Karlovy Vary AAGAATGAATCTCATGGGGTCGTAACGTCTCGTGACCCTGCCGTTGCACTATGC CGGCGATCCAACCCCCATTATACCTCACATTTCTATTGCTAATTCTTCTTTATCTG ATCATAACTTTGTATGTCTGGATTATATTAACTGTTACTTATAAGACTGCGGTGCG ACATGCAGCACTGTACCAGAGATCCTTCTCTCACTGGAGTTTCGATCACTCACTC TAAGAAGATCCCCAGTTAGGACAAGTCCCGATCCATCATGCAAGAACAATCTGC ATTTGAATAATGCCGTTCAATCATGAGACATAAAGAAAAAA >MuVi-CZE Pardubice AAGAATGAATCTCATGGGGTCGTAACGTCTCGTGACCCTGCCGTTGCACTATGC CGGCGATCCAACCCCCATTATACCTCACATTTCTATTGCTAATTCTTCTTTATCTG ATCATAACTTTGTATGTCTGGATTATATTAACTGTTACTTATAAGACTGCGGTGCG ACATGCAGCACTGTACCAGAGATCCTTCTTTCACTGGAGTTTCGATCACTCACTC TAAGAAGATCCCCAGTTAGGACAAGTCCCGATCCATCATGCAAGAACAATCTGC ATTTGAATAATGCCGTTCAATCATGAGACATAAAGAAAAAA >MuVi-CZE Teplice AAGAATGAATCTCATGGGGTCGTAACGTCTCGTGACCCTGCCGTTGCACTATGC CGGCGATCCAACCCCCATTATACCTCACATTTCTATTGCTAATTCTTCTTTATCTG ATCATAACTTTGTATGTCTGGATTATATTAACTGTTACTTATAAGACTGCGGTGCG ACATGCAGCACTGTACCAGGGATCCTTCTTTCACTGGAGTTTCGATCACTCACTC TAAGAAGATCCCCAGTTAGGACAAGTCCCGATCCATCATGCAAGAACAATCTGC ATTTGAATAATGCCGTTCAATCATGAGACATAAAGAAAAAA

20 Distribuce hlášených genotypů, (údaje k dubnu 2012) G H C J B C D J D G F G H I G D,C,H H J K

21 Výskyt genotypu G 2004/05 UK 2005/06 ČR 2006 USA 2007/08 Kanada (současně i genotyp D) 2008/09 Makedonie (6% komplikací: 39% orchitid, 4,7% meningitid) 2009 Nizozemí (16% komplikací: 20% orchitid, 4% meningitid) 2010 Bavorsko (většina komplikací-orchitidy) 2010/11 Skotsko 2012 ČR (10,9 % komplikací-očkovaní v 8%, neočkovaní 27%; orchitida 6% očkovaných a 21% neočkovaných; meningitis 1,2% očkovaných a 4% neočkovaných)

22 Genotypy a účinnost vakcinace - ve vakcíně je obsažen příušnicový kmen Jeryl Lynn (genotyp A), který je fylogeneticky odlišný od cirkulujících genotypů - největší antigenní rozdílnost je mezi genotypy A x B - D A x G - I - výsledkem je nekompletní zkřížená neutralizace Přesto zatím nejsou jednoznačné důkazy o tom, že by genotypová neshoda současných kmenů vedla k selhávání vakcinace či že by byla epidemiologicky významná. Účinnost vakcinace ve vztahu ke genotypu, ale i možnost přispění vyvanutí imunity ke zvýšenému výskytu onemocnění, jsou široce řešenou stále otevřenou otázkou.

23 Genotypy a účinnost vakcinace Mumps virus neutralizing antibodies do not protect against reinfection with a heterologous mumps virus genotype; Johan Nojd a kol.; Vaccine 19 (2001) vakcinací JL (1996) nedošlo k vytvoření průkazných VN Ab proti genotypu A - v séru jen VN Ab proti genotypu D (onemocnění v dětství souběh cirkulace A a D genotypu ve Švédsku ) - VN Ab proti genotypu D neochránily před chronickým onemocněním genotypem A (V-X /1999) - až v II /2000 prokazatelné VN Ab proti A X Antibody Induced by Immunization with the Jeryl Lynn Mumps Vaccine Strain Effectively Neutralizes a Heterologous Wild-Type Mumps Virus Associated with a Large Outbreak; S.A. Rubin a kol.; J Infect Dis. (2008); 198 (4): geometrický průměr titrů VN Ab proti genotypu G byl asi o polovinu nižší než proti genotypu A; - titry VN Ab proti oběma genotypům s časovým odstupem od vakcinace klesaly (10 let po 2.dávce na úroveň titrů před její aplikací); - protilátky indukované vakcinací efektivně neutralizovaly virus genotypu G u všech 88 osob Long-Term Persistence of Mumps Antibody after Receipt of 2 Measles-Mumps-Rubella (MMR) Vaccinations and Antibody Response after a Third MMR Vaccination among a University Population A. A. Date a kol.; J Infect Dis.(2008); 197: EIA IgG+ 94% (ze 440 osob); 28 osob IgG- ; 19 IgG- dostalo 3. dávku vakcíny - 1 osoba nadále EIA IgG- (průkaz reakce paměťových B buněk nešlo o primární selhání vakcinace) - VN Ab proti genotypu A u 91 EIA pozitivních osob, titr 1:4 vakcinovaní < 1-5 lety 95% vakcinovaní > 15 lety 58% X

24 Současné cíle NRL - zkvalitnění laboratorní diagnostiky onemocnění opřené především o přímý průkaz agens (izolace viru, PCR) jako jednoznačného průkazu probíhající infekce - vyšetřování dalšími sérologickými metodami (HIT, VNT), neboť doposud rutinně uplatňované sérologické vyšetření metodou ELISA (IgG/IgM) neposkytne vždy jednoznačný diagnostický závěr - získání komplexních informací o cirkulujících kmenech na území ČR a sérologické odpovědi nemocných, neboť vzhledem k rozdílnosti neutralizačních epitopů u různých genotypů nelze vyloučit, že imunita zajišťovaná virem určitého genotypu nebude stejně účinná proti kmenům jiných genotypů

25 Závěr Nemocnými jsou převážně vakcinovaní mladí dospělí jedinci s delším časovým odstupem od aplikace vakcíny (kolem 15 let), poměrně častý je i výskyt komplikací, zejména pak orchitidy a meningitidy. Specifika laboratorní diagnostiky vakcinovaných osob vede k nutnosti změny vyšetřovací strategie zaměřené více na přímý průkaz infekčního agens. Monitorování genotypové distribuce příušnicových kmenů a genotypově specifické imunity populace je ve vakcinální éře, vzhledem ke kontinuální evoluci viru a tlaku na výběr vakcíny, nezbytné.

26 Poděkování všem spolupracujícím infekčním klinikám a příslušným hygienickým stanicím

Situace ve výskytu dávivého kašle (A37.0) v České republice v roce 2008

Situace ve výskytu dávivého kašle (A37.0) v České republice v roce 2008 Situace ve výskytu dávivého kašle (A37.0) v České republice v roce 2008 Update of whooping cough (A37.0) situation in the Czech Republic, 2008 Kateřina Fabiánová, Čestmír Beneš Souhrn Summary Od roku 1958

Více

Martina Havlíčková Helena Jiřincová. NRL pro chřipku, Státní zdravotní ústav

Martina Havlíčková Helena Jiřincová. NRL pro chřipku, Státní zdravotní ústav Pandemic H1N1 2009 Martina Havlíčková Helena Jiřincová NRL pro chřipku, Státní zdravotní ústav Z historie H1N1 1916-1917 pravděpodobná cirkulace viru, malá ohniska, lokální epidemie ve vojenských táborech,

Více

Laboratorní diagnostika klíšťové encefalitidy a dalších

Laboratorní diagnostika klíšťové encefalitidy a dalších Laboratorní diagnostika klíšťové encefalitidy a dalších flavivirových neuroinfekcí Hana Zelená Jan Raszka Jiří Januška Zdravotní ústav se sídlem v Ostravě Centrum klinických laboratoří Virologické i oddělení

Více

Syfilis přehledně. MUDr.Hana Zákoucká Odd. STI, NRL pro syfilis, Státní zdravotní ústav ROCHE 6-2014

Syfilis přehledně. MUDr.Hana Zákoucká Odd. STI, NRL pro syfilis, Státní zdravotní ústav ROCHE 6-2014 Syfilis přehledně MUDr.Hana Zákoucká Odd. STI, NRL pro syfilis, Státní zdravotní ústav ROCHE 6-214 LEGISLATIVA Zákon č. 258/2 Sb., o ochraně veřejného zdraví Vyhláška MZ ČR č. 36/212 Sb., podmínky předcházení

Více

Vrozený zarděnkový syndrom - kazuistika. MUDr. Martina Marešová HS hl.m. Prahy

Vrozený zarděnkový syndrom - kazuistika. MUDr. Martina Marešová HS hl.m. Prahy Vrozený zarděnkový syndrom - kazuistika MUDr. Martina Marešová HS hl.m. Prahy Zarděnky - historie zarděnky byly poprvé popsány ve 2. pol. 18. stol. v roce 1866 nazvány rubella v roce 1941 australský oftalmolog

Více

Eradikace BVD v Německu naše zkušenosti

Eradikace BVD v Německu naše zkušenosti Eradikace BVD v Německu naše zkušenosti MVDr. Kirsten Stemme Základní údaje o BVD Virus BVD - pestivirus - různé genotypy a subtypy - dva rozdílné biotypy (necytopatogenní, cytopatogenní) podle Heckerta

Více

Očkování proti klíšťové encefalitidě v létě a po přisátí klíštěte

Očkování proti klíšťové encefalitidě v létě a po přisátí klíštěte Očkování proti klíšťové encefalitidě v létě a po přisátí klíštěte Jan Smetana Fakulta vojenského zdravotnictví UO, Hradec Králové X. Hradecké vakcinologické dny, 2. - 4. 0. 204 2 Klíšťová encefalitida

Více

Současná situace ve výskytu dávivého kašle v ČR a související změny v očkovacím kalendáři MUDr. Fabiánová Kateřina MUDr.

Současná situace ve výskytu dávivého kašle v ČR a související změny v očkovacím kalendáři MUDr. Fabiánová Kateřina MUDr. Současná situace ve výskytu dávivého kašle v ČR a související změny v očkovacím kalendáři MUDr. Fabiánová Kateřina MUDr. Beneš Čestmír 23. Pečenkovy epidemiologické dny, 22. 24.9.29, Jihlava 1 B. pertussis

Více

C 16 Zásady odběrů biologického materiálu

C 16 Zásady odběrů biologického materiálu C 16 Zásady odběrů biologického materiálu Odběrovou soupravu tvoří dva vatové tampony, zkumavka s virologickým odběrovým médiem a záznamová karta. Odběrové médium se uchovává v mrazničce při teplotě 20

Více

Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku. Richard J W Currie

Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku. Richard J W Currie Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku Richard J W Currie Virus infekční bronchitidy RNA (nukleová kyselina) uvnitř Proteiny (spike proteiny S1 a S2) na vnější straně

Více

Státní politika v oblasti očkování. MUDr. Michael Vít, PhD.

Státní politika v oblasti očkování. MUDr. Michael Vít, PhD. Státní politika v oblasti očkování MUDr. Michael Vít, PhD. VII. Hradecké vakcinologické dny 29. 9. 1. 10. 2011 Pravidelné, zvláštní a mimořádné očkování Pravidelné, zvláštní a mimořádné očkování je založeno

Více

Zkušenosti s očkováním proti klíšťové encefalitidě, základní epidemiologické charakteristiky v souboru nemocných za 50 let

Zkušenosti s očkováním proti klíšťové encefalitidě, základní epidemiologické charakteristiky v souboru nemocných za 50 let Zkušenosti s očkováním proti klíšťové encefalitidě, základní epidemiologické charakteristiky v souboru nemocných za 50 let P. Pazdiora 24. Pečenkovy dny, České Budějovice 15.-17.9.2010 Historie poznatků

Více

Klinika infekčních nemocí, FN Hradec Králové

Klinika infekčních nemocí, FN Hradec Králové Pavel Kosina Klinika infekčních nemocí, FN Hradec Králové Centrum očkování a cestovní medicíny historie imunizace charakteristika očkovací látky bezpečnost, imunogenita a účinnost vakcíny vakcinační schémata,

Více

Vědecký výbor veterinární

Vědecký výbor veterinární Vědecký výbor veterinární Klasifikace: Draft Pro vnitřní potřebu VVV Oponovaný draft Pro vnitřní potřebu VVV Finální dokument X Pro oficiální použití Deklasifikovaný dokument Pro veřejné použití MOŽNOSTI

Více

Aktuální pohled na očkování dětské populace v ČR

Aktuální pohled na očkování dětské populace v ČR Aktuální pohled na očkování dětské populace v ČR X. Hradecké Vakcinologické dny 3. října 2014 MUDr. Hana Cabrnochová Česká vakcinologická společnost ČLS JEP Aktuální témata roku 2014 Dosažení vysoké proočkovanosti

Více

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Charakteristika testu: Set AMPLICOR HPV vyráběný firmou Roche je určený pro detekci vysoko-rizikových typů lidských

Více

KLINICKÉ A LABORATORNÍ CHARAKTERISTIKY ROTAVIROVÝCH A NOROVIROVÝCH INFEKCÍ. Helena Ambrožová 1. infekční klinika 2. LF UK a NNB

KLINICKÉ A LABORATORNÍ CHARAKTERISTIKY ROTAVIROVÝCH A NOROVIROVÝCH INFEKCÍ. Helena Ambrožová 1. infekční klinika 2. LF UK a NNB KLINICKÉ A LABORATORNÍ CHARAKTERISTIKY ROTAVIROVÝCH A NOROVIROVÝCH INFEKCÍ Helena Ambrožová 1. infekční klinika 2. LF UK a NNB X. Hradecké vakcinologické dny, Hradec Králové 4.10.2014 Rotaviry - charakteristika

Více

Závěrečná zpráva. Zkoušení způsobilosti v lékařské mikrobiologii (Externí hodnocení kvality) PT#M/32/2010 (č. 677) Identifikace herpetických virů

Závěrečná zpráva. Zkoušení způsobilosti v lékařské mikrobiologii (Externí hodnocení kvality) PT#M/32/2010 (č. 677) Identifikace herpetických virů Státní zdravotní ústav Expertní skupina pro zkoušení způsobilosti Organizátor programů zkoušení způsobilosti akreditovaný ČIA, reg. č. 7001 Šrobárova 48, 100 42 Praha 10 Vinohrady Závěrečná zpráva Zkoušení

Více

Vývoj očkovacího kalendáře v ČR IX. Hradecké vakcinologické dny 3. - 5.10.2013

Vývoj očkovacího kalendáře v ČR IX. Hradecké vakcinologické dny 3. - 5.10.2013 Vývoj očkovacího kalendáře v ČR IX. Hradecké vakcinologické dny 3. - 5.10.2013 MUDr. Hana Cabrnochová Česká vakcinologická společnost ČLS JEP PLDD Vývoj očkování před rokem 1945 Očkování proti neštovicím

Více

Surveillance a epidemiologická situace invazivních bakteriálních onemocnění v ČR a v Evropě Pavla Křížová, Jana Kozáková, Věra Lebedová Centrum epidemiologie a mikrobiologie Státní zdravotní ústav Praha

Více

Interpretace sérologických nálezů u chlamýdií

Interpretace sérologických nálezů u chlamýdií Interpretace sérologických nálezů u chlamýdií MUDr. Dana Hrubá VIDIA-DIAGNOSTIKA Poliklinika Černý Most, Praha 9 hruba@vidia-diagnostika.cz Onemocnění u lidí způsobovaná chlamydiemi Druh chlamydií Sérotypy

Více

laboratorní diagnostika a očkování

laboratorní diagnostika a očkování Bordetella pertussis laboratorní diagnostika a očkování Olga Štěpáníková Imunologické oddělení laboratoří IFCOR-99, Brno XI. Den laboratorní diagnostiky - nejen lymeské boreliózy, Brno, 27.3.2012 Kdo jednou

Více

MODUL č. III. Epidemiologie a Hygiena

MODUL č. III. Epidemiologie a Hygiena MODUL č. III Epidemiologie a Hygiena Definice epidemiologie a rozdělení Definice: Epidemiologie je nauka o teoretických a praktických otázkách ochrany před chorobami (infekčními i neinfekčními). Rozdělení

Více

Prevence klíš meningoencefalitidy u starší. ších osob

Prevence klíš meningoencefalitidy u starší. ších osob Prevence klíš íšťové meningoencefalitidy u starší ších osob Eva Jílková, Iva Stiborová, Vlastimil Král, Jiří Skorkovský Zdravotní ústav se sídlem v Ústí nad Labem 24.Pečenkovy epidemiologické dny, České

Více

Epidemiologie virových hepatitid, vakcinace

Epidemiologie virových hepatitid, vakcinace Epidemiologie virových hepatitid, vakcinace MUDr. Jan Smetana Katedra epidemiologie Fakulta vojenského zdravotnictví Univerzity obrany Hradec Králové Virové hepatitidy - zánětlivé onemocnění jater vyvolané

Více

Epidemie Q horečky v Nizozemí a situace v ČR

Epidemie Q horečky v Nizozemí a situace v ČR Epidemie Q horečky v Nizozemí a situace v ČR Kateřina Fabiánová, Čestmír Beneš SZÚ Praha 24. Pečenkovy epidemiologické dny, 15. 17. 9.2010 České Budějovice Epidemiologické charakteristiky Původce: Coxiella

Více

Sledování zdravotníků po poranění ostrými předměty v praxi FN Brno. Mgr. Jana Fialová, Ph.D. OHE FN Brno MUDr. Lucie Rausová PLS FN Brno

Sledování zdravotníků po poranění ostrými předměty v praxi FN Brno. Mgr. Jana Fialová, Ph.D. OHE FN Brno MUDr. Lucie Rausová PLS FN Brno Sledování zdravotníků po poranění ostrými předměty v praxi FN Brno Mgr. Jana Fialová, Ph.D. OHE FN Brno MUDr. Lucie Rausová PLS FN Brno Poranění ostrým předmětem Bodná / řezná poranění Poranění nástrojem

Více

PŘEDČASNĚ NAROZENÝCH DĚTÍ

PŘEDČASNĚ NAROZENÝCH DĚTÍ OČKOVÁNÍ PŘEDČASNĚ NAROZENÝCH DĚTÍ Jitka Škovránková Dětské očkovací centrum FN Motol Ve světě se doporučuje stejně očkovat nezralé jako zralé děti, přestože existují kvalitativní i kvantitativní rozdíly

Více

po přisátí klíštěte virus prokazován kůže virémie buňky RES (slezina, játra, kostní dřeň) mechanismus invaze do CNS nejasný, HEB při virémii

po přisátí klíštěte virus prokazován kůže virémie buňky RES (slezina, játra, kostní dřeň) mechanismus invaze do CNS nejasný, HEB při virémii Středoevropská klíšťová meningoencefalitida klinický obraz MUDr. Dita Smíšková, PhD Doc.MUDr.Vilma Marešová, CSc. MEK patogeneze po přisátí klíštěte virus prokazován nejprve v Langerhansových h buňkách

Více

CÍL 7: PREVENCE INFEKČNÍCH ONEMOCNĚNÍ

CÍL 7: PREVENCE INFEKČNÍCH ONEMOCNĚNÍ CÍL 7: PREVENCE INFEKČNÍCH ONEMOCNĚNÍ PODSTATNĚ SNÍŽIT NEPŘÍZNIVÉ DŮSLEDKY INFEKČNÍCH NEMOCÍ PROSTŘEDNICTVÍM SYSTEMATICKY REALIZOVANÝCH PROGRAMŮ NA VYMÝCENÍ, ELIMINACI NEBO ZVLÁDNUTÍ INFEKČNÍCH NEMOCÍ,

Více

Pandemický plán Ústeckého kraje. MUDr. Josef Trmal Ph.D.

Pandemický plán Ústeckého kraje. MUDr. Josef Trmal Ph.D. Pandemický plán Ústeckého kraje MUDr. Josef Trmal Ph.D. Pandemický plán Ústeckého kraje Pandemický plán je zpracován v souladu s krizovým a havarijním plánováním a tvoří součást Krizového plánu Ústeckého

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

ProGastrin-Releasing Peptide (ProGRP) u nemocných s malobuněčným karcinomem plic

ProGastrin-Releasing Peptide (ProGRP) u nemocných s malobuněčným karcinomem plic ProGastrin-Releasing Peptide (ProGRP) u nemocných s malobuněčným karcinomem plic FONS Symposium klinické biochemie Pardubice, 23.9. 25.9.202 M. Tomíšková, J. Skřičková, I. Klabenešová, M. Dastych 2 Klinika

Více

Alena Šteflová 22.duben 2014

Alena Šteflová 22.duben 2014 European Immunization Week 22-26 April 2014 Alena Šteflová 22.duben 2014 Proč European Immunization Week? Očkování učinilo mnoho infekčních onemocnění vzácnými nebo téměř se nevyskytujícími. Tento úspěch

Více

Interpretace výsledků měření základních lymfocytárních subpopulací očima (průtokového J ) cytometristy a klinického imunologa

Interpretace výsledků měření základních lymfocytárních subpopulací očima (průtokového J ) cytometristy a klinického imunologa Interpretace výsledků měření základních lymfocytárních subpopulací očima (průtokového J ) cytometristy a klinického imunologa Marcela Vlková, Zdeňka Pikulová Fakultní nemocnice u sv. Anny v Brně Ústav

Více

Pacasová R., Tesařová E., Křížová E. Transfuzní a tkáňové oddělení FN Brno. 8. Střešovický transfuzní den, Praha 26.11.2014

Pacasová R., Tesařová E., Křížová E. Transfuzní a tkáňové oddělení FN Brno. 8. Střešovický transfuzní den, Praha 26.11.2014 OBI v registru dárců krve FN Brno Pacasová R., Tesařová E., Křížová E. Transfuzní a tkáňové oddělení FN Brno 8. Střešovický transfuzní den, Praha 26.11.2014 Virus hepatitidy B Virus hepatitidy B (HBV)

Více

KORONAVIROVÉ INFEKCE PRASAT

KORONAVIROVÉ INFEKCE PRASAT KORONAVIROVÉ INFEKCE PRASAT Jana Prodělalová Oddělení virologie Virové choroby prasat Výzkumný ústav veterinárního lékařství, v.v.i., Brno Evoluce koronavirů: 8 100 př.n.l. rekombinace, mutace adaptace

Více

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést

Více

Výskyt salmonelózy po konzumaci tatarského bifteku v restauraci

Výskyt salmonelózy po konzumaci tatarského bifteku v restauraci Výskyt salmonelózy po konzumaci tatarského bifteku v restauraci Průchová J., Pazdiora P. KHS Plzeňského kraje se sídlem v Plzni 24. Pečenkovy epidemiologické dny České Budějovice, 15. 17.9.2010 25.3.2009

Více

,, Cesta ke zdraví mužů

,, Cesta ke zdraví mužů PREZENTACE VÝSLEDKŮ ŘEŠENÍ PILOTNÍHO PROJEKTU PREVENTIVNÍ PÉČE PRO MUŢE,, Cesta ke zdraví mužů prim. MUDr. Monika Koudová GHC GENETICS, s.r.o.- NZZ, Praha Projekt byl realizován ve dvou etapách: I. etapa

Více

SUBJEKTY ZAJIŠŤUJÍCÍ OPATŘENÍ PŘI VÝSKYTU VNN VE ZDRAVOTNICKÉM ZAŘÍZENÍ POSKYTOVATELE ZDRAVOTNÍCH SLUŽEB

SUBJEKTY ZAJIŠŤUJÍCÍ OPATŘENÍ PŘI VÝSKYTU VNN VE ZDRAVOTNICKÉM ZAŘÍZENÍ POSKYTOVATELE ZDRAVOTNÍCH SLUŽEB S M Ě R N I C E PRO JEDNOTNÝ POSTUP PŘI VZNIKU MIMOŘÁDNÉ UDÁLOSTI PODLÉHAJÍCÍ MEZINÁRODNÍM ZDRAVOTNICKÝM PŘEDPISŮM (2005) V SOUVISLOSTI S VÝSKYTEM VYSOCE NAKAŽLIVÉ NEMOCI VE ZDRAVOTNICKÉM ZAŘÍZENÍ POSKYTOVATELE

Více

Subjekty zajišťující v regionu opatření při výskytu VNN ve zdravotnickém zařízení poskytovatele zdravotních služeb

Subjekty zajišťující v regionu opatření při výskytu VNN ve zdravotnickém zařízení poskytovatele zdravotních služeb Č.j.: KHSV/ 16258/2014/JI/Ř/Říha Směrnice pro jednotný postup při vzniku mimořádné události podléhající mezinárodním zdravotnickým předpisům (2005) v souvislosti s výskytem vysoce nakažlivé nemoci ve zdravotnickém

Více

Obsah. IMUNOLOGIE... 57 1 Imunitní systém... 57 Anatomický a fyziologický základ imunitní odezvy... 57

Obsah. IMUNOLOGIE... 57 1 Imunitní systém... 57 Anatomický a fyziologický základ imunitní odezvy... 57 Obsah Předmluva... 13 Nejdůležitější pojmy používané v textu publikace... 14 MIKROBIOLOGIE... 23 Mikroorganismy a lidský organismus... 24 Třídy patogenních mikroorganismů... 25 A. Viry... 25 B. Bakterie...

Více

Co víme nového o borelióze a klíšťové meningoencefalitidě?

Co víme nového o borelióze a klíšťové meningoencefalitidě? Co víme nového o borelióze a klíšťové meningoencefalitidě? Schánilec P. Hájek I. Agudelo C. F. Tato prezentace je spolufinancována Evropským sociálním fondem a státním rozpočtem České republiky. Rozšíření

Více

Současné možnosti a úskalí diagnostiky pertuse

Současné možnosti a úskalí diagnostiky pertuse Současné možnosti a úskalí diagnostiky pertuse Mgr. Jana Zavadilová NRL pro pertusi a difterii Státní zdravotní ústav Aktuality v diagnostice virových a bakteriálních infekcí, 26.5.2014, SZÚ Výběr vhodné

Více

KLÍŠŤOVÁ ENCEFALITIDA pohledem epidemiologa

KLÍŠŤOVÁ ENCEFALITIDA pohledem epidemiologa KLÍŠŤOVÁ ENCEFALITIDA pohledem epidemiologa MUDr. Renata Vaverková Krajská hygienická stanice Jihomoravského kraje se sídlem v Brně HVD - Hradec Králové 4. 10. 2013 KLÍŠŤOVÁ ENCEFALITIDA je nákazou s přírodní

Více

OČKOVÁNÍ POLYSACHARIDOVÝMI A KONJUGOVANÝMI VAKCÍNAMI Aneb kdy a proč je výhodná imunologická paměť a kdy cirkulující protilátky

OČKOVÁNÍ POLYSACHARIDOVÝMI A KONJUGOVANÝMI VAKCÍNAMI Aneb kdy a proč je výhodná imunologická paměť a kdy cirkulující protilátky OČKOVÁNÍ POLYSACHARIDOVÝMI A KONJUGOVANÝMI VAKCÍNAMI Aneb kdy a proč je výhodná imunologická paměť a kdy cirkulující protilátky Prof. MUDr. Jiří Beran, CSc. Centrum očkování a cestovní medicíny Hradec

Více

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11.

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. Personalizovaná medicína Roche v oblasti onkologie Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. listopadu 2013 Personalizovaná vs standardní péče Cílená léčba Spojení diagnostiky

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

Progrese HIV infekce z pohledu laboratorní imunologie

Progrese HIV infekce z pohledu laboratorní imunologie Progrese HIV infekce z pohledu laboratorní imunologie 1 Lochmanová A., 2 Olbrechtová L., 2 Kolčáková J., 2 Zjevíková A. 1 OIA ZÚ Ostrava 2 klinika infekčních nemocí, FN Ostrava HIV infekce onemocnění s

Více

Organizace transfuzní služby. I.Sulovská

Organizace transfuzní služby. I.Sulovská Organizace transfuzní služby I.Sulovská Transfuzní oddělení Výroba transfuzních přípravků (TP) řízena zákony, vyhláškami a metodickými pokyny 2 druhy TO: výrobci TP odběrová střediska Výrobci TP mají uděleno

Více

Diagnostické metody v lékařské mikrobiologii

Diagnostické metody v lékařské mikrobiologii Diagnostické metody v lékařské mikrobiologii Výuková prezentace z: Lékařské mikrobiologie Jan Smíšek ÚLM 3. LF UK 2009 Princip identifikace Soubor znaků s rozdílnou diskriminační hodnotou Základní problémy

Více

Titrace autoprotilátek detekovaných metodami nepřímé imunofluorescence. Jan Martinek Ivo Lochman

Titrace autoprotilátek detekovaných metodami nepřímé imunofluorescence. Jan Martinek Ivo Lochman Titrace autoprotilátek detekovaných metodami nepřímé imunofluorescence Jan Martinek Ivo Lochman OSNOVA ÚVOD TITRACE DLE EUROIMMUN DATA SEKK STANDARTIZACE ANA STANDARTIZACE ICA HOOK EFEKT ZÁVĚR Titrace

Více

Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová

Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Centrum nádorové cytogenetiky Ústav klinické biochemie a laboratorní diagnostiky VFN a 1. LF UK v Praze Klinický význam cytogenetických

Více

Příloha č. 1 HLÁŠENÍ PŘI PODEZŘENÍ NA VÝSKYT VYSOCE NAKAŽLIVÉ NEMOCI VE ZDRAVOTNICKÉM ZAŘÍZENÍ POSKYTOVATELE ZDRAVOTNÍCH SLUŽEB

Příloha č. 1 HLÁŠENÍ PŘI PODEZŘENÍ NA VÝSKYT VYSOCE NAKAŽLIVÉ NEMOCI VE ZDRAVOTNICKÉM ZAŘÍZENÍ POSKYTOVATELE ZDRAVOTNÍCH SLUŽEB HLÁŠENÍ PŘI PODEZŘENÍ NA VÝSKYT VYSOCE NAKAŽLIVÉ NEMOCI VE ZDRAVOTNICKÉM ZAŘÍZENÍ POSKYTOVATELE ZDRAVOTNÍCH SLUŽEB Hlášení pořizuje v rozsahu dostupných údajů a předává místně příslušnému orgánu ochrany

Více

Poliomyelitida stanovisko SZO k zavádění inaktivované vakcíny

Poliomyelitida stanovisko SZO k zavádění inaktivované vakcíny Poliomyelitida stanovisko SZO k zavádění inaktivované vakcíny (zkráceno a přeloženo Hygienickou stanicí hl. m. Prahy) Toto stanovisko bylo uveřejněno ve Weekly Epidemiological Record, 2003, 78 (28): 241-252.

Více

NEBUNĚČNÁ ŽIVÁ HMOTA VIRY

NEBUNĚČNÁ ŽIVÁ HMOTA VIRY NEBUNĚČNÁ ŽIVÁ HMOTA VIRY Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje 11.3.2011 Mgr.Petra Siřínková Rozdělení živé přírody 1.nadříše.PROKARYOTA 1.říše:Nebuněční

Více

Těhotná v průběhu chřipkové epidemie

Těhotná v průběhu chřipkové epidemie Těhotná v průběhu chřipkové epidemie MUDr. Jan Kynčl, Ph.D. Státní zdravotní ústav Praha Oddělení epidemiologie infekčních nemocí 6. konference SIN ČGPS ČLS JEP, 14. únor 2015, Praha Kolik stojí chřipka

Více

MUDr. Miroslav Toms Dětské odd. Jindřichův Hradec

MUDr. Miroslav Toms Dětské odd. Jindřichův Hradec Helicobacter pylori u dětí MUDr. Miroslav Toms Dětské odd. Jindřichův Hradec Bakterie H.pylori 1 leden 2003 MUDr.Miroslav Toms 4 Bakterie H.pylori 2 G-neg spirální mikroaerofilní tyčka Adaptace na kyselé

Více

Imunoprofylaxe RSV infekce. M.Čihař, K.Liška¹, K.Klenková Neonatologické oddělení, FN Na Bulovce ¹Neonatologické oddělení, VFN, Praha

Imunoprofylaxe RSV infekce. M.Čihař, K.Liška¹, K.Klenková Neonatologické oddělení, FN Na Bulovce ¹Neonatologické oddělení, VFN, Praha Imunoprofylaxe RSV infekce M.Čihař, K.Liška¹, K.Klenková Neonatologické oddělení, FN Na Bulovce ¹Neonatologické oddělení, VFN, Praha RSV - RNA (objeven 1956) - Skupina paramyxoviridae - 2 skupiny (povrchové

Více

Interpretace výsledků bakteriologických vyšetření

Interpretace výsledků bakteriologických vyšetření Interpretace výsledků bakteriologických vyšetření Veškeré nálezy vyšetření je nutno hodnotit vzhledem k diagnóze, věku, zánětlivým parametrům, klinickému stavu pacienta, ev. k dalším důležitým anamnestickým

Více

PROGRAM XI. HRADECKÝCH VAKCINOLOGICKÝCH DNŮ 201 5 1. - 3. 10. 2015, ALDIS, HRADEC KRÁLOVÉ

PROGRAM XI. HRADECKÝCH VAKCINOLOGICKÝCH DNŮ 201 5 1. - 3. 10. 2015, ALDIS, HRADEC KRÁLOVÉ PROGRAM XI. HRADECKÝCH VAKCINOLOGICKÝCH DNŮ 201 5 Čtvrtek 1. 10. 2015 14.00-15.00 Káva na uvítanou 1. - 3. 10. 2015, ALDIS, HRADEC KRÁLOVÉ 15.00-16.30 Satelitní sympózium Pfizer Nové příležitosti a zdolávání

Více

VIROVÉ HEPATITIDY. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

VIROVÉ HEPATITIDY. Markéta Vojtová VOŠZ a SZŠ Hradec Králové VIROVÉ HEPATITIDY Markéta Vojtová VOŠZ a SZŠ Hradec Králové Hepatitidy 1 Zánět jaterního parenchymu Nejčastější jaterní onemocnění v celosvětovém měřítku Hepatotropní viry A, B, C, D, E, G, TTV (transfusion

Více

Přenosné a parazitární NZP u zdravotnických pracovníků MUDr. Markéta Petrovová Prof. MUDr. Petr Brhel, CSc.

Přenosné a parazitární NZP u zdravotnických pracovníků MUDr. Markéta Petrovová Prof. MUDr. Petr Brhel, CSc. Přenosné a parazitární NZP u zdravotnických pracovníků MUDr. Markéta Petrovová Prof. MUDr. Petr Brhel, CSc. Klinika pracovního lékařství LF MU a FN USA v Brně Obsah analýza NZP u zdravotnických pracovníků

Více

West Nile Virus, aneb je třeba být připraven

West Nile Virus, aneb je třeba být připraven West Nile Virus, aneb je třeba být připraven RNDr. Eva Křížová, Ph.D Transfuzní a tkáňové oddělení Fakultní nemocnice Brno Taxonomické zařazení a charakteristika WNV Rod: Flavivirus Charakteristika: RNA

Více

Stanovení protilátek proti parotitidě a interpretace výsledků

Stanovení protilátek proti parotitidě a interpretace výsledků Jihočeská univerzita v Českých Budějovicích Zdravotně sociální fakulta Stanovení protilátek proti parotitidě a interpretace výsledků bakalářská práce Autor práce: Kateřina Nusková Studijní program: Specializace

Více

MUDr. Hana Zákoucká Odd. STI SZÚ SZÚ, 12 2014

MUDr. Hana Zákoucká Odd. STI SZÚ SZÚ, 12 2014 MUDr. Hana Zákoucká Odd. STI SZÚ SZÚ, 12 2014 Zákon č. 258/2000 Sb., o ochraně veřejného zdraví Zákon č. 372/2011 Sb., o zdravotních službách Vyhláška MZ ČR č. 306/2012 Sb., podmínky předcházení vzniku

Více

Surveillance infekčních nemocí v ČR

Surveillance infekčních nemocí v ČR Kyjevská 44, 532 03 Pardubice Tel. 465 352 040, Fax: 465 524 328 podatelna@zupu.cz, www.zupu.cz Surveillance infekčních nemocí v ČR MUDr. Pavel Slezák VI. konference Medicína katastrof, traumatologické

Více

Vakcíny z nádorových buněk

Vakcíny z nádorových buněk Protinádorové terapeutické vakcíny Vakcíny z nádorových buněk V. Vonka, ÚHKT, Praha Výhody vakcín z nádorových buněk 1.Nabízejí imunitnímu systému pacienta celé spektrum nádorových antigenů. 2. Jejich

Více

Příloha list Laboratorní příručky

Příloha list Laboratorní příručky _ Datum aktualizace: 15. 2.2014 Příloha list Laboratorní příručky Název metody: ASGPR Název metody na výsledcích laboratorního vyšetření: S_ASGPR IgG Jednotky: index Indikace: diferenciální diagnostika

Více

Zdraví 2020 Národní strategie ochrany a podpory zdraví a prevence nemocí. Akční plán č. 6: Zvládání infekčních onemocnění na období 2015 2020

Zdraví 2020 Národní strategie ochrany a podpory zdraví a prevence nemocí. Akční plán č. 6: Zvládání infekčních onemocnění na období 2015 2020 Zdraví 2020 Národní strategie ochrany a podpory zdraví a prevence nemocí Akční plán č. 6: Zvládání infekčních onemocnění na období 2015 2020 a) Provakcinace Ministerstvo zdravotnictví 2015 Ministerstvo

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

PNEUMOKOKOVÉ INFEKCE A MOŽNOSTI PREVENCE aneb CO MŮŽE ZPŮSOBIT PNEUMOKOK

PNEUMOKOKOVÉ INFEKCE A MOŽNOSTI PREVENCE aneb CO MŮŽE ZPŮSOBIT PNEUMOKOK PNEUMOKOKOVÉ INFEKCE A MOŽNOSTI PREVENCE aneb CO MŮŽE ZPŮSOBIT PNEUMOKOK Očkování! Nejvýznamnější možnost prevence infekčních chorob! Lepší infekční chorobě předcházet než ji léčit! Významný objev v medicíně,

Více

Klinické sledování. Screening kardiomyopatie na podkladě familiární transthyretinové amyloidózy. u pacientů s nejasnou polyneuropatií

Klinické sledování. Screening kardiomyopatie na podkladě familiární transthyretinové amyloidózy. u pacientů s nejasnou polyneuropatií Klinické sledování Screening kardiomyopatie na podkladě familiární transthyretinové amyloidózy u pacientů s nejasnou polyneuropatií Informace pro pacienta Vážená paní, vážený pane, Na základě dosud provedených

Více

Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12

Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12 Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12 Firma Abbott Laboratories nabízí na imunoanalytických systémech ARCHITECT test ke stanovení biologicky aktivní části vitaminu

Více

Současný systém očkování v Armádě České republiky

Současný systém očkování v Armádě České republiky Současný systém očkování v Armádě České republiky Mjr. MUDr. Petr DÍTĚ Pplk. MUDr. Radovan SMETANA Mjr. MUDr. Martina POKORNÁ Ústřední vojenský zdravotní ústav 1 Legislativní rámec Zákon č. 258/2000 Sb.,

Více

Mikroskopie versus kultivace, kdy, komu a proč? Jan Kestřánek PGK, FNHK

Mikroskopie versus kultivace, kdy, komu a proč? Jan Kestřánek PGK, FNHK Mikroskopie versus kultivace, kdy, komu a proč? Jan Kestřánek PGK, FNHK Vulvovaginální dyskomfort Akutní vulvovaginální dyskomfort (AVD): obtíže v oblasti zevního genitálu a pochvy jako je výtok, svědění

Více

M e t o d i c k ý n á v o d : ZÁKLADNÍ USTANOVENÍ

M e t o d i c k ý n á v o d : ZÁKLADNÍ USTANOVENÍ Ministerstvo zdravotnictví Č.j. MZDR 36368/2007 Prevence virového zánětu jater A(VHA), B(VHB), C(VHC), D(VHD) a E(VHE) K zabezpečení jednotného postupu zdravotnických zařízení a orgánů ochrany veřejného

Více

SOUČASNÉ TRENDY V DIAGNOSTICE A LÉČBĚ CHLAMYDIOVÝCH PNEUMONIÍ V. TORŠOVÁ, E. CHMELAŘOVÁ ATB STŘEDISKO, ZÚ OSTRAVA

SOUČASNÉ TRENDY V DIAGNOSTICE A LÉČBĚ CHLAMYDIOVÝCH PNEUMONIÍ V. TORŠOVÁ, E. CHMELAŘOVÁ ATB STŘEDISKO, ZÚ OSTRAVA SOUČASNÉ TRENDY V DIAGNOSTICE A LÉČBĚ CHLAMYDIOVÝCH PNEUMONIÍ V. TORŠOVÁ, E. CHMELAŘOVÁ ATB STŘEDISKO, ZÚ OSTRAVA ETIOLOGIE RESPIRAČNÍCH INFEKCÍ VČETNĚ ORL AKUTNÍ INFEKCE VIRY H. INFLUENZAE MYKOPLASMA

Více

KONCEPCE OBORU EPIDEMIOLOGIE (2012)

KONCEPCE OBORU EPIDEMIOLOGIE (2012) KONCEPCE OBORU EPIDEMIOLOGIE (2012) Koncepci zpracovala skupina odborníků jmenovaná výborem Společnosti pro epidemiologii a mikrobiologii ČLS JEP ve složení (uvedeno abecedně): MUDr. Jitka Částková, CSc.

Více

Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady

Více

Víceúčelový sérologický přehled (spalničky, příušnice, pertuse, virová hepatitida B) SP 2013, ČR. Závěrečná zpráva

Víceúčelový sérologický přehled (spalničky, příušnice, pertuse, virová hepatitida B) SP 2013, ČR. Závěrečná zpráva Víceúčelový sérologický přehled (spalničky, příušnice, pertuse, virová hepatitida B) SP 2013, ČR Závěrečná zpráva Zdravotní ústav se sídlem v Ostravě Zdravotní ústav se sídlem v Ústí nad Labem Sérologické

Více

PREVENCE A KONTROLA ČLENSKÝCH ZEMÍCH EU. MUDr. Miroslava Girod Schreinerová KHS Karlovarského kraje

PREVENCE A KONTROLA ČLENSKÝCH ZEMÍCH EU. MUDr. Miroslava Girod Schreinerová KHS Karlovarského kraje PREVENCE A KONTROLA ŠÍŘEN ENÍ MRSA V NĚKTERÝCH ČLENSKÝCH ZEMÍCH EU MUDr. Miroslava Girod Schreinerová KHS Karlovarského kraje Sledované údaje Obecná národní údaje Existence národní směrnice Regionální

Více

LÉKOVÁ POLITIKA OČKOVÁNÍ A SENIOŘI. Jan Švihovec

LÉKOVÁ POLITIKA OČKOVÁNÍ A SENIOŘI. Jan Švihovec LÉKOVÁ POLITIKA OČKOVÁNÍ A SENIOŘI Jan Švihovec Vliv demografického vývoje na financování zdravotnictví v ČR Náklady ZP na pojištěnce Výdaje na zdravotnictví jako % HDP = pod průměrem OECD Výdaje na zdravotnictví

Více

MUDr.M.Doleželová 23/10/2010 1

MUDr.M.Doleželová 23/10/2010 1 23/10/2010 1 Historie a představení společnosti Orion Diagnostica Oy je společností náležící k Orion Group, jedné z předních finských společností zabývajících se péčí o zdraví. Orion Diagnostica Oy byla

Více

OZDRAVOVACÍ PROGRAM od BOVINNÍ VIROVÉ DIARHOE (BVD)

OZDRAVOVACÍ PROGRAM od BOVINNÍ VIROVÉ DIARHOE (BVD) STÁTNÍ VETERINÁRNÍ ÚSTAV JIHLAVA Referenční laboratoř pro bovinní virovou diarrhoeu (BVD/MD) Oddělení virologie Rantířovská 93, 586 05 Jihlava Tel.: +420 567 143 263, Fax: +420 567 143 262, Web: www.svujihlava.cz,

Více

Laboratorní diagnostika Močových onemocnění

Laboratorní diagnostika Močových onemocnění Laboratorní diagnostika Močových onemocnění Onemocnění močového aparátu Chronická močová onemocnění jsou jedny z nejčastějších onemocnění psů a koček Častou příčinou jsou chronické infekce močových cest

Více

METODICKÝ POKYN PREVENCE VIROVÉHO ZÁNĚTU JATER. M e t o d i c k ý n á v o d : ZÁKLADNÍ USTANOVENÍ. Čl. 1

METODICKÝ POKYN PREVENCE VIROVÉHO ZÁNĚTU JATER. M e t o d i c k ý n á v o d : ZÁKLADNÍ USTANOVENÍ. Čl. 1 4 VĚSTNÍK MZ ČR ČÁSTKA 2 Ministerstvo zdravotnictví Č.j. MZDR 36368/2007 2. METODICKÝ POKYN PREVENCE VIROVÉHO ZÁNĚTU JATER Prevence virového zánětu jater A(VHA), B(VHB), C(VHC), D(VHD) a E(VHE) K zabezpečení

Více

Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor

Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor Moto: Nejvyšším štěstím každé rodiny je zdravé dítě Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor ČLK, 14. února 2013 Úvod Od poznání možností, které nám nabízí prenatální diagnostika, se embryo či později

Více

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Níže uvedené komentáře by měly pomoci soutěžícím z kategorie B ke snazší orientaci

Více

SOUHRN ÚDAJŮ O PŘÍPRAVKU. Vakcína proti Haemophilus influenzae b 2. KVALITATIVNÍ A KVANTITATIVNÍ SLOŽENÍ

SOUHRN ÚDAJŮ O PŘÍPRAVKU. Vakcína proti Haemophilus influenzae b 2. KVALITATIVNÍ A KVANTITATIVNÍ SLOŽENÍ SOUHRN ÚDAJŮ O PŘÍPRAVKU 1. NÁZEV PŘÍPRAVKU Act-HIB Vaccine, prášek pro přípravu inj. roztoku s rozpouštědlem Vakcína proti Haemophilus influenzae b 2. KVALITATIVNÍ A KVANTITATIVNÍ SLOŽENÍ Léčivá látka:

Více

Krajská hygienická stanice Moravskoslezského kraje se sídlem v Ostravě

Krajská hygienická stanice Moravskoslezského kraje se sídlem v Ostravě Krajská hygienická stanice Moravskoslezského kraje se sídlem v Ostravě NA BĚLIDLE 7, 702 00 OSTRAVA VÁŠ DOPIS N.: E DNE: ČÍSLO JEDNACÍ: EPID/OV- 1955/ 1.10.10 /12 VYŘIUJE: MUDr. Martinková, MUDr. Matlerová

Více

JIŘÍ WIDIMSKÝ, JAROSLAV MALÝ A KOLEKTIV / AKUTNÍ PLICNÍ EMBOLIE A ŽILNÍ TROMBÓZA

JIŘÍ WIDIMSKÝ, JAROSLAV MALÝ A KOLEKTIV / AKUTNÍ PLICNÍ EMBOLIE A ŽILNÍ TROMBÓZA 1 Výskyt akutní plicní embolie Jiří Widimský, Jaroslav Malý 13 2 Patogeneze žilní trombózy a plieni embolie (tromboembolie) Jaroslav Malý, Jiří Widimský 19 2.1.1 Velké chirurgické výkony, zejména ortopedické

Více

Závažnost chřipky, analýza výskytu úmrtí v interpandemickém a pandemickém období. Jan Kynčl

Závažnost chřipky, analýza výskytu úmrtí v interpandemickém a pandemickém období. Jan Kynčl Závažnost chřipky, analýza výskytu úmrtí v interpandemickém a pandemickém období Jan Kynčl Chřipka akutní vysoce nakažlivé virové onemocnění postihuje lidstvo každoročně v epidemiích, někdy v pandemiích

Více

Infekce, které jsou zahrnuty v systému epidemiologické bdělosti, jsou uvedeny v příloze č. 1 této vyhlášky.

Infekce, které jsou zahrnuty v systému epidemiologické bdělosti, jsou uvedeny v příloze č. 1 této vyhlášky. 473/2008 Sb. VYHLÁŠKA Ministerstva zdravotnictví ze dne 17. prosince 2008 o systému epidemiologické bdělosti pro vybrané infekce ve znění vyhlášek č. 275/2010 Sb. a č. 233/2011 Sb. Ministerstvo zdravotnictví

Více

Studijní materiál důchodce č. 99 Říjen 2001

Studijní materiál důchodce č. 99 Říjen 2001 1 Studijní materiál důchodce č. 99 Říjen 2001 Nežádoucí postvakcinační reakce po vakcínách proti spalničkám, příušnicím a zarděnkám ( 12. Adverse events following measles, mumps and rubella vaccines- MMR)

Více

Evropské asociace proti rakovině děložního čípku

Evropské asociace proti rakovině děložního čípku Evropské asociace proti rakovině děložního čípku Založena 2002, řízena představenstvem 125 institucí ze 34 zemí Cíl: šířit informace o karcinomu hrdla děložního a možnostech prevence tohoto onemocnění

Více

Časné fáze klinických studií

Časné fáze klinických studií Časné fáze klinických studií Mikulov, 13.4.2012 Regina Demlová, FÚ LF MU a MOÚ Stávající situace v klinickém výzkumu Počet nových látek v klinickém výzkumu (NMEs) v posledních 15-20-ti letech narůstá Počet

Více

CO VÁM MÁM ŘÍCT. Několik poznámek, pikošek z 600 přednášek a 800 posterů za 5 10 minut Nosné téma: Novel Diagnostics Tools & New

CO VÁM MÁM ŘÍCT. Několik poznámek, pikošek z 600 přednášek a 800 posterů za 5 10 minut Nosné téma: Novel Diagnostics Tools & New JAN MARTINEK CO VÁM MÁM ŘÍCT Několik poznámek, pikošek z 600 přednášek a 800 posterů za 5 10 minut Nosné téma: Novel Diagnostics Tools & New Therapeutic Avenues in Autoimmune Diseases LIST OF TOPICS ANTIPHOSPHOLIPID

Více

Riziko pneumokokové pneumonie u dospělých a možnosti prevence Vilma Marešová a spol. I. infekční klinika 2.LF UK, FNB Praha

Riziko pneumokokové pneumonie u dospělých a možnosti prevence Vilma Marešová a spol. I. infekční klinika 2.LF UK, FNB Praha Riziko pneumokokové pneumonie a možnosti prevence Vilma Marešová a spol. I. infekční klinika 2.LF UK, FNB Praha Patogeneze pneumokokových onemocnění Kolonizace Překonání slizniční bariéry Invaze krevního

Více