Genetika pohlaví genetická determinace pohlaví

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "Genetika pohlaví genetická determinace pohlaví"


1 Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u vejcorodých plazů - TSD). Lze sledovat čtyři základní typy dědičnosti: Autozomálně dominantní dědičnost 1. je-li vlastnost vzácná, většina křížení se děje mezi heterozygoty (ovlivnění) a recesivními homozygoty (neovlivnění), což vede k fenotypovému poměru u potomků 1:1 bez ohledu na pohlaví, 2. dominantní fenotyp se může projevit v každé generaci, pokud nemá sníženou penetranci. Autozomálně recesivní dědičnost 1. generace jsou často, ale ne vždy, přeskakovány, 2. je rovnoměrná distribuce mezi pohlavími, 3. jestliže jsou oba rodiče ovlivnění, všichni potomci jsou také ovlivněni, 4. často se nachází při příbuzenském křížení, 5. většina ovlivněných potomků mají normální rodiče. Na pohlaví vázaná dominance 1. nepřeskakuje generace, 2. ovlivnění samci pocházejí od ovlivněných matek, 3. všechny dcery, ale ne synové, po ovlivněném otci jsou ovlivnění, 4. přibližně polovina ovlivněných synů a dcer po ovlivněných matkách jsou ovlivnění. Na pohlaví vázaná recesivita 1. samci jsou většinou ovlivnění, 2. ovlivněné samice pocházejí od ovlivněných otců a přenašeček matek, 3. synové ovlivněných matek jsou ovlivnění, 4. přibližně polovina synů po matkách přenašečkách může být ovlivněných. Podstata determinace pohlaví Determinace pohlavními chromozomy Chromozomy, které se účastní determinace pohlaví se nazývají pohlavní (sex chromozomy) nebo heterochromozomy. Ostatní chromozomy se nazývají autozomální (somatické) nebo autozomy. Ačkoliv pohlavní chromozomy se největší mírou podílejí na determinaci pohlaví, jsou i další různorodé mechanizmy genetické i negenetické v závislosti na evoluční úrovni daného druhu. Autozomy jsou v homologních párech, na každém je umístěna jedna kopie (alela) každého genu. Segregace a kombinovatelnost vede ke vzorům dědičnosti, které jsou TGU /8

2 popsány v klasickém mendelizmu. Pohlavní chromozomy mohou být geneticky odlišné a homologní páry ve smyslu autozomů vlastně nejsou a toto odlišení vede k jiným vzorům přenosů genetické informace než u autozomální dědičnosti. Molekulárně genetická podstata determinace pohlaví u živočichů Pro determinaci samčího pohlaví je důležitý gen SRY, který se nachází v těsné blízkosti párových oblastí chromozomu X a Y. Byly dokonce zaznamenány případy, kdy u ženy genotypu AAXX byl detekován gen SRY. Pro determinaci samčího pohlaví je důležitý gen SRY, který se nachází v těsné blízkosti párových oblastí chromozomu X a Y. Byly dokonce zaznamenány případy, kdy u ženy genotypu AAXX byl detekován gen SRY. Do každého kroku znázorněného šipkou mohou promluvit svojí expresí další geny genomu. Mezi tyto geny patří i F (feminní, samičí) a M (maskulinní, samčí) komplexy, které se liší svým uložením u jednotlivých typů gonochoristů. Vliv M a F komplexů Kromě sestavy heterochromozomů se podílí na determinaci pohlaví i genové komplexy samičích (F) a samčích (M) faktorů. Ty mohou být uloženy na heterochromozomech i na autozomech. Vznik pohlaví je dán působením obou komplexů během vývoje organizmu. Organizmy jsou z tohoto pohledu potenciálně bisexuální. Tento model determinace pohlaví platí u drosofily a nižších organizmů, ale ne u savců. Typ gonochorizmu Drosophila Abraxas F na X chromozomu M na autozomech MM < FF = MM > F = F na Y (W) chromozomu M na X (Z) chromozomu F > M = Mimo těchto komplexů bylo zjištěno, že na determinaci pohlaví mohou mít vliv i repetitivní (opakující se) sekvence DNA v chromozomech. TGU /8

3 Byly popsány 2 základní případy: fragilní X chromozom kdy se zvyšoval počet repetitivních sekvencí z generaci na generaci, což vedlo k úhynu jedince SRF (repetitivní sekvence) u myší: 12 (CAG) 12 normál vývoj pohlaví a 13 (CAG) 13 částečný pohlavní zvrat Pohlavní indexy Pohlavní index vyjadřuje poměr X:A a také poměr M:F, kdy pro normálně plodné samice je 1 a samce je 0,5. Genotyp Poměr X:A Pohlavní index Fenotyp AAXX 2 : 2 1 samička AAXY 1 : 2 0,5 sameček AAAXX 2 : 3 0,67 intersex AAAAXXX 3 : 4 0,75 intersex AAXXX 3 : 2 1,5 nadsamička AAAX 1 : 3 0,33 nadsameček Intersexy jsou označováni jedinci, u kterých není jasně zřejmé pohlavní vzezření. Mají sestavu chromozomů jednoho pohlaví, ale během vývoje se vyvíjí znaky druhého pohlaví. Bridges podal vysvětlení v poměru mezi počtem X chromozomů a kterýmkoliv párem autozomů (A). Pohlavní index je poměr počtu X chromozomů k počtu autozomálních sad chromozomů. Anomální sestavy chromozomů vznikají nondisjunkcí při meióze. Intersex se také vysvětluje existencí faktorů M a F. Molekulárně genetická determinace a vývoj pohlaví u rostlin Geny řídící determinaci vývoje pohlaví u rostlin se nazývají homeotické geny. Homeotické geny kódují transkripční faktory aktivující specifické geny důležité pro vývoj samčího a samičího pohlaví. Vlastní homeotické geny se dají rozdělit do 2 oblastí: a. konzervativní DNA vázaná doména vyznačuje se specifickou vazbou na regulační sekvence DNA b. aktivační doména schopná interakce s jinými faktory Dle fenotypového projevu se geny člení do tří skupin: 1. geny ovlivňující vývoj nebo iniciaci květního primordia i jiné geny např. Vrn (gen jarovizace sumy nízkých teplot nutných pro vývoj generativních orgánů) a Ppd (gen fotoperiody určující požadavek na délku dne pro vytvoření generativní orgánů). 2. geny ovlivňující změnu květní symetrie 3. geny determinující identitu jednotlivých orgánů a jejich architekturu gen pistillata přeměna tyčinek na pestík (jednopohlavní květ) gen agamous přeměna tyčinek na korunní plátky a pestíku na kališní lístky (květ sterilní) V případě determinace generativních orgánů u rostlin se uplatňuje i epigenetická dědičnost, což jsou hypo- a hypermetylace DNA, které mohou ovlivnit expresi genetické informace v kladném nebo záporném směru. TGU /8

4 Mimo již popsaných systému mají na fertilitu (plodnost) a sterilitu (neplodnost) vliv i jaderné geny Rf a mitochondriální faktory. V tomto případě mluvíme o 3 možných systémech pylové sterility: 1. Genová samčí sterilita jaderné geny Rf (fertilita) a rf (sterilita) 2. Cytoplazmatická samčí sterilita N fertilní, S- sterilní dáno mtdna dědí se po matce, stejně jako všechna cytoplazma 3. Cytoplazmaticky-genová sterilita interakce jaderných genů s cytoplazmatickými faktory (jaderné geny nadřazeny) Determinace pohlaví A) typ Drosophila (savčí) název odvozen od octomilky (Drosophila melanogaster) Samice u typu drosofila jsou homogametní XX a samci jsou heterogametní XY. genotyp gamety samička AAXX AX sameček AAXY, AAX0 AX, AY, A0 A sada autozomů (somatických chromozomů, autochromozomy) X, Y pohlavní chromozomy (heterochomozomy, gonozomy) Chromozom Y se označuje také jako alozom. Ve většině případu je menší, akrocentrický s větším podílem heterochromatinu. Výskyt: u savců, u většiny hmyzích řádů, u některých ryb, obojživelníků a plazů a u některých druhů rostlin (chmel, konopí, šťovík, špenát, knotovka aj.). 2) XO systém, odchylka od typu drosofila, v kterém samice mají 2 X chromozomy a samci pouze 1 X a žádný další pohlavní chromozom. Samice mají stejný počet chromozomů a samci odlišný počet. Tento systém je u mnoha druhů hmyzu, např. u včely. Gamety samců nesou buď X chromozom nebo jsou bez pohlavního chromozomu. TGU /8

5 3) typ Abraxas (ptačí) název odvozen od píďalky angreštové (Abraxas grossulariata) V typu abraxas jsou samice heterogametní XY ( ZW) a samci homogametní XX (ZZ). genotyp gamety Samička AAXY(AAZW) AX, AY (AZ, AW) Sameček AAXX (AAZZ) AX (AZ) A sada autozomů (somatických chromozomů, autochromozomy) X (Z), Y (W) pohlavní chromozomy (heterochomozomy, gonozomy) Výskyt: u ptáků, motýlů, některých ryb, obojživelníků a plazů, u rostlin nalezen jen u jahodníku. 4) Směsný chromozomální systém Tento může být velmi komplexní s násobnými počty X a Y chromozomů, např. u červa Ascaris incurva, který má 26 autozomů, 8 X chromozomů a 1 Y chromozom. Samci mají sestavu 26A + 8X + Y z 35 chromosomů a samice 26A + 16X z 42 chromosomů. Tento systém mají také pavouci. Pohlavní chromatin a kompenzace dávky Pohlavní chromatin - lyonizace (inaktivace X chromozomu, kompenzace dávky) Barvitelný materiál chromozomu se nazývá chromatin. 1. euchromatin je nespiralizovaný a nekondenzovaný během interfáze 2. heterochromatin zůstává spiralizovaný a kondenzovaný během interfáze a je replikován později během S fáze a. fakultativní heterochromatin - může se změnit zpět v euchromatin závisející na fyziologických nebo vývojových podmínkách buňky. Příkladem takovéto inaktivace X chromozomu je tvorba Barrova tělíska. b. konstitutivní heterochromatin - je stále kondenzovaný a nemění se nikdy na euchromatin. Tento typ heterochromatinu se nachází v oblasti centromery, ale i v dalších oblastech. Do proteosyntézy je zapojen vždy jen jeden X chromozom z páru - kompenzace dávky. Druhý z páru vytváří kondenzovaný pohlavní chromatin, který dostal název dle svého objevitele Baarovo tělísko. Právě detekce Baarova tělíska slouží k identifikaci pohlaví např. u sportovců. Lyonová v roce 1962 vytvořila teorii mozaiky, přičemž systém zapojení chromozomu do proteosyntézy považovala za náhodný. Tato teorie byla později doplněna o molekulární mechanizmy určující inaktivaci X chromozomu. TGU /8

6 Jednotlivé chromozomy X se mohou lišit svojí genetickou informací a tím mohou podmiňovat různý fenotyp. Co rozhoduje o inaktivaci X chromozomu? 3 oblasti X chromozomu: 1. gen XIC (X-inactivation centre) hlavní kontrolní jednotka lokalizace na proximálním konci kratšího ramena chromozomu 2. gen XIST (X-inactive specific transcript) řídí transkripci kontrolní jednotka 3. nukleotidová sekvence ORF (open reading frame) řídí translaci kontrolní jednotky U samců je jeden X chromozom, který je ve stavu euchromatinu. U samic jsou dva X chromozomy, z nichž jeden je kondenzován do heterochromatinu u člověka asi v 16. dni embryonálního vývoje. V interfázovém jádře jsou pak viditelné tmavé skvrny na jeho okrajích. Jedinec má N-1 Barrových tělísek, kde N je počet X chromozomů. Pak: normální žena (XX) má jen 1 Barrovo tělísko normální muž (XY) nemá žádné Barrovo tělísko žena s Turnerovým syndromem (XO) nemá žádné Barrovo tělísko muž s Klinefelterovým syndromem (XXY) má 1 Barrovo tělísko. Výsledkem inaktivace X chromozomu je tvorba fenotypové mozaiky u samic, které jsou heterozygotní v lokusu na X chromozomu. Jednou inaktivovaný X chromozom jím zůstává po všechny následující mitózy v dané buněčné linii. Tato inaktivace se ruší až při gametogenezi. Dědičnost vázaná na pohlavní chromozomy A) Dědičnost znaků vázaných na pohlaví U zvířat s XY pohlaví určujícím mechanizmem je na X chromozomu uloženo mnoho lokusů, z nichž mnohé nemusí být ve spojení s určením pohlaví. Chromozom Y je obvykle menší a obsahuje méně lokusů, které nejsou stejné jako na chromozomu X. Takže samice se stejnými alelami v lokusu na X chromozomu jsou homozygotní, s různými heterozygotní. Samci, protože mají jen jeden X chromozom, jsou hemizygotní a mohou mít jen jednu alelu v lokusu. Stačí jedna recesivní alela, aby se projevila ve fenotypu samce. Tyto geny podmiňují vlastnosti vázané na pohlaví. 1. Dědičnost znaků neúplně vázaných na pohlaví Geny jsou umístěny na homologních úsecích pohlavních chromozomů, takže může docházet ke crossing-overům. Alely těchto znaků se dědí jako geny na autozomech. TGU /8

7 2. Dědičnost znaků úplně vázaných na pohlaví Geny jsou umístěny na nehomologních (heterologních) úsecích pohlavních chromozomů, takže nemůže docházet ke crossing-overům. Zde jsou odchylky od Mendelova pravidla segregace. a) alely lokalizované na nehomologním úseku X (Z) chromozomu Genetická informace (gen) je lokalizován na nehomologním (nepárovém) úseku chromozomu X (Z). Na chromozomu Y (W) se tento gen nevyskytuje - stav hemizygotní. V tomto případě lokalizace genetické informace mluvíme o dědičnosti křížem. Prakticky se využívá při autosexingu kuřat. b) alely umístěny na nehomologních úsecích Y (W) Geny lokalizované na nehomologních úsecích chromozomu Y (W) vykazují tzv. dědičnost přímou. Tyto geny se nazývají jako holandrické. Na chromozomu X (Z) není tento gen lokalizován. Jsou přenášeny z otce na syna (Y) u savců, nebo z matky na dceru (W) u drůbeže. B) Dědičnost znaků pohlavím ovládaných - SEX CONTROLLED, LIMITED Geny jsou lokalizované na autozomech a jejich fenotypový projev je kontrolován faktory vnitřního prostředí (pohlavím), u gonochoristů pohlavními chromozomy. Projevuje se jen u jednoho pohlaví, ale ne u druhého. Praktické příklady: sekundární pohlavní znaky (hlasový projev, zbarvení, hřeben u drůbeže, habitus, intenzita ochlupení těla, paroží u jelenovitých), užitkové znaky hospodářských zvířat (dojivost, snáška). Jedním z takto kontrolovaných znaků je zbarvení u rybek paví očko. Za barevnou kresbu Zebrus na zadní části těla ryby odpovídá dominantní alela genu Ze, naopak recesivní alela ze podmiňuje fenotyp bez této kresby. Pro vlastní expresi je však důležité pohlaví nositele dominantní alely Ze, která se může projevit jen u samčích jedinců. Pokud je samičí genotyp nositelem dominantní alely Ze, zůstává i v tomto případě bez kresby. Samčí jedinci jsou bez kresby jen v případě recesivního homozygota ze ze. C) Dědičnost znaků pohlavím ovlivněných - SEX INFLUENCED Geny jsou lokalizovány na autozomech obou pohlaví a projevuje se u obou pohlaví, ale v různé úrovni či intenzitě ovlivněné pohlavím nositele (pohlavní hormony), ale jen tehdy, jsou-li založeny heterozygotně - u jednoho pohlaví se chová jako dominantní a u druhého jako recesivní znak. Praktické příklady: předčasná plešatost u člověka, mahagonové zbarvení u skotu plemene Ayrshire. TGU /8

8 Jedním z takto determinovaných znaků je zbarvení srsti ayshirského skotu. Dominantní alela M determinuje mahagonové zbarvení srsti a recesivní alela m pak zbarvení červené. Mahagonové zbarvení mohou mít dominantní homozygoti MM jak krávy, tak býci. V případě heterozygota Mm, jsou však mahagonového zbarvení jen býci, protože kravám chybí faktory vnitřního prostředí pro projev dominantní alely v heterozygotní konstituci. Recesivní homozygoti mm jsou červeného zbarvení bez ohledu na pohlaví. TGU /8

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto


Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový


Determinace pohlaví a evoluce pohlavních chromosomů

Determinace pohlaví a evoluce pohlavních chromosomů Determinace pohlaví a evoluce pohlavních chromosomů Radka Reifová Katedra zoologie Prezentaci naleznete na: v záložce Courses Jak vznikají dvě pohlaví Mechanismy determinace


GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním



GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky


Dědičnost pohlaví a znaků s pohlavím souvisejících

Dědičnost pohlaví a znaků s pohlavím souvisejících Dědičnost pohlaví a znaků s pohlavím souvisejících Rozmnožování Nepohlavní amixis bez zvýšení genotypové proměnlivosti ý g yp proměnlivosti Pohlavní - amfimixis zvýšení genotypové Hermafrodité: jeden jedinec


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


Dědičnost pohlaví a znaků s pohlavím souvisejících

Dědičnost pohlaví a znaků s pohlavím souvisejících Dědičnost pohlaví a znaků s pohlavím souvisejících Rozmnožování Nepohlavní amixis, bez zvýšení genotypové proměnlivosti Pohlavní amfimixis střídání 2n a n fáze, zvýšení genotypové proměnlivosti Hermafrodité:


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA


REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce?

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce? REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince Co bylo dřív? Slepice nebo vejce? Rozmnožování Rozmnožování (reprodukce) může být nepohlavní (vegetativní, asexuální) pohlavní (sexuální;


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto


lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické Gonozomáln lní dědičnost Mgr. Aleš RUDA Chromozomové určení pohlaví autozomy gonozomy člověk má 22 párůp autozomů a 1 pár p gonozomů označen ení pohlavních chromozomů: : X a Y. jsou možné celkem 3 kombinace:


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI


Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


Gonosomální dědičnost

Gonosomální dědičnost Gonosomální dědičnost Praktické cvičení č.12 Jaro 2016 Aneta Kohutová Biologický ústav Lékařská fakulta Masarykova univerzita Kamenice 5, 625 00 Brno Cíle cvičení Student:


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem


Genetika člověka - reprodukce

Genetika člověka - reprodukce Gymnázium Václava Hraběte Školní rok 2015/2016 Genetika člověka - reprodukce Seminární práce z biologie autor práce: Andrea Jirásková; 8.A vedoucí práce: RNDr. Roman Slušný Prohlášení Prohlašuji tímto,


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


BARVY BORDER COLLIÍ. Na konci tohoto dokumentu naleznete schéma hlavních barev podle lokusů.

BARVY BORDER COLLIÍ. Na konci tohoto dokumentu naleznete schéma hlavních barev podle lokusů. BARVY BORDER COLLIÍ Barva psí srsti je dána geneticky. Pro všechny border collie (snad až na vzácné výjimky) platí, že ve své genetické výbavě nesou alelu Si, která determinuje irské zbarvení (bílé znaky)


Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by - Ned?le, B?ezen 01, 2015 Otázka: Genetika I P?edm?t: Biologie P?idal(a):


Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010


MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák MENDELISMUS Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák 1822-1884 In the ten years G. Mendel worked on his plants in the garden of the monastery, he made the greatest discovery in biology that


Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina

Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina Přehled GMH Seminář z biologie GENETIKA Molekulární genetika Základní dogma molekulární biologie Základním nosičem genetické informace je molekula DNA. Tato molekula se může replikovat (kopírovat). Informace


Stavba chromozomů Lidský karyotyp

Stavba chromozomů Lidský karyotyp Přípravný kurz z biologie 5 Stavba chromozomů Lidský karyotyp 3. 12. 2011 Mgr. Kateřina Caltová Stavba chromozomů Lidský karyotyp Chromozom buněčná struktura v jádře eukaryotních buněk řec. chroma = barva,


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela


Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Spermatogeneze saranče stěhovavé (Locusta migratoria)

Spermatogeneze saranče stěhovavé (Locusta migratoria) Spermatogeneze saranče stěhovavé (Locusta migratoria) Vývoj pohlavních buněk u živočichů zahrnuje několik dějů, které zajistí, že dojde k redukci a promíchání genetického materiálu a vzniklé buňky jsou


Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků



GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností


Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je


Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým


1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat





Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje


RURGenetika zápočtový program Programování II

RURGenetika zápočtový program Programování II RURGenetika zápočtový program Programování II Rudolf Rosa cvičící: Doc. RNDr. Pavel Töpfer, CSc. Obsah Specifikace...1 Původní specifikace...1 Upravená specifikace...2 Program...3 třída Populace...4 Datové


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro



GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


DĚDIČNOST A POHLAVÍ. Lekce 4 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc.

DĚDIČNOST A POHLAVÍ. Lekce 4 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. DĚDIČNOST A POHLAVÍ Lekce 4 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. V evoluci předcházejí asexuální organismy organismům sexuálním a organismy haploidní organismům diploidním. Sexualita se může


Determinace pohlaví a evoluce pohlavních chromosomů

Determinace pohlaví a evoluce pohlavních chromosomů Determinace pohlaví a evoluce pohlavních chromosomů Radka Reifová Katedra zoologie Prezentaci naleznete na: v záložce Courses Jak vznikají dvě pohlaví Mechanismy determinace


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)



MENDELISMUS GENOVÉ INTERAKCE NEMENDELISMUS MENDELISMUS GENOVÉ INTERAKCE NEMENDELISMUS Biologie a genetika BSP, LS4, 2014/2015, Ivan Literák 4. GENOVÉ INTERAKCE Dva (příp. více) geny ovlivňují 1 znak (kvalitativní!) 2 major-geny se ovlivňují -


13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


Zvyšování kvality výuky technických oborů

Zvyšování kvality výuky technických oborů Zvyšování kvality výuky technických oborů Klíčová aktivita V.2 Inovace a zkvalitnění výuky směřující k rozvoji odborných kompetencí žáků středních škol Téma V.2.18 Dřeviny Kapitola 2 Rozmnožování rostlin



ŠKOLNÍ VZDĚLÁVACÍ PROGRAM Vyučovací předmět : Období ročník : Učební texty : Přírodopis 3. období 9. ročník Danuše Kvasničková, Ekologický přírodopis pro 9. ročník ZŠ a nižší ročníky víceletých gymnázií, nakl. Fortuna Praha 1998



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v



OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 Genetika a plemenné znaky u králíků Chov králíků, II. Kategorie Johana Vinšová *13. 8. 1997 Žabonosy 113, Kolín 2, 280 02 ZO ČSCH Kolín 1 Práce započata dne: 25. 11. 2014


GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných


Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.


Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické


1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická


Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním


EMBRYOLOGIE Učebnice pro studenty lékařství a oborů všeobecná sestra a porodní asistentka

EMBRYOLOGIE Učebnice pro studenty lékařství a oborů všeobecná sestra a porodní asistentka 6pt;font-style:normal;color:grey;font-family:Verdana,Geneva,Kalimati,sans-serif;text-decoration:none;text-align:center;font-variant:n = = < p s t y l e = " p a d d i n g : 0 ; b o r d e r : 0 ; t e x t


8 Odhad plemenné hodnoty (OPH)

8 Odhad plemenné hodnoty (OPH) Genetika ve šlechtění zvířat TGU 006 část 7. (rough draft version) 8 Odhad plemenné hodnot (OPH) V populaci jedinců je genetická variabilita způsobená jedinci s různými genotp. U kvantitativních vlastností


Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Chromozomová teorie dědičnosti KBI / GENE Mgr. Zbyněk Houdek Proč octomilka a T.H. Morgan? Drosophila melanogaster ideální objekt pro genetický výzkum : Rychlý reprodukční cyklus a snadný chov v laboratorních


Rukověť genetiky pro chovatele potkanů

Rukověť genetiky pro chovatele potkanů Rukověť genetiky pro chovatele potkanů Příručka pro chovatele, kteří by se rádi dozvěděli, jak celá ta věc funguje Bc. Markéta Čacká Praha, 2013 Verze určená pro čtečky (optimalizováno na Kindle 3) OBSAH


Populační genetika II

Populační genetika II Populační genetika II 4. Mechanismy měnící frekvence alel v populaci Genetický draft (genetické svezení se) Genetický draft = zvýšení frekvence alely díky genetické vazbě s výhodnou mutací. Selekční vymetení


11.12.2011 Brno - Lužánky Základy genetiky pro chovatele potkanů

11.12.2011 Brno - Lužánky Základy genetiky pro chovatele potkanů 11.12.2011 Brno - Lužánky Základy genetiky pro chovatele potkanů Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou


ANOTACE vytvořených/inovovaných materiálů

ANOTACE vytvořených/inovovaných materiálů ANOTACE vytvořených/inovovaných materiálů Číslo projektu Číslo a název šablony klíčové aktivity Tematická oblast Formát Druh učebního materiálu Druh interaktivity CZ.1.07/1.5.00/34.0722 III/2 Inovace a


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém


Základy molekulární a buněčné biologie. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy molekulární a buněčné biologie. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy molekulární a buněčné biologie Přípravný kurz Komb.forma studia oboru Všeobecná sestra Genetický aparát buňky DNA = nositelka genetické informace - dvouvláknová RNA: jednovláknová mrna = messenger


OBECNÁ GENETIKA 2006. - jeho dílo (Versuche über Pflanzen Hybriden - Pokusy s rostlinnými hybridy )

OBECNÁ GENETIKA 2006. - jeho dílo (Versuche über Pflanzen Hybriden - Pokusy s rostlinnými hybridy ) OBECNÁ GENETIKA 2006 - přesné datum narození Mendela (20.7.1822) - kdy uveřejnil Mendel výsledky své práce (8. 2. a 8. 3. 1865) - kdy byl Mendel pokřtěn (22. 7. 1822 v Dolním Vražném) - kde se narodil



Buněčné dělení ŘÍZENÍ BUNĚČNÉHO CYKLU BUNĚČNÝ CYKLUS Buněčné dělení Cykliny a na cyklinech závislé proteinkinázy (Cyclin- Dependent Protein Kinases; Cdk-proteinkinázy) - proteiny, které jsou součástí řídícího systému buněčného cyklu 8 cyklinů


Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským


1) Je vydána na základě a v mezích zákona, do něhož již byly příslušné směrnice Evropských společenství promítnuty.

1) Je vydána na základě a v mezích zákona, do něhož již byly příslušné směrnice Evropských společenství promítnuty. 448/2006 Sb. VYHLÁŠKA Ministerstva zemědělství ze dne 1. září 2006 o provedení některých ustanovení plemenářského zákona ve znění vyhlášky č. 57/2011 Sb. Ministerstvo zemědělství stanoví podle 33 zákona


Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého


8 cyklinů (A, B, C, D, E, F, G a H) - v jednotlivých fázích buněčného cyklu jsou přítomny určité typy cyklinů

8 cyklinů (A, B, C, D, E, F, G a H) - v jednotlivých fázích buněčného cyklu jsou přítomny určité typy cyklinů Buněč ěčné dělení BUNĚČ ĚČNÝ CYKLUS ŘÍZENÍ BUNĚČ ĚČNÉHO CYKLU cykliny a na cyklinech závislé proteinkinázy (Cyclin-Dependent Protein Kinases; Cdk-proteinkinázy) - proteiny, které jsou součástí řídícího


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


Hermafroditismus - pohlavni rozmnozovani, ten jedinec je schopen produkce obou typu pohlavnich bunek (gonády samčí i samičí)

Hermafroditismus - pohlavni rozmnozovani, ten jedinec je schopen produkce obou typu pohlavnich bunek (gonády samčí i samičí) Otázka: Genetika Předmět: Biologie Přidal(a): Klára Mavrov Hermafroditismus - pohlavni rozmnozovani, ten jedinec je schopen produkce obou typu pohlavnich bunek (gonády samčí i samičí) Obligatni hermafrodit


Otázka: Genetika. Předmět: Biologie. Přidal(a): - GENETIKA

Otázka: Genetika. Předmět: Biologie. Přidal(a): - GENETIKA Otázka: Genetika Předmět: Biologie Přidal(a): - GENETIKA = nauka o dědičnosti a proměnlivosti organismů Dědičnost Schopnost organismů předávat určité znaky potomkům Zabezpečuje stálost druhu Způsobuje


"Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT ". Základy Genetiky

Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT . Základy Genetiky "Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT ". Základy Genetiky ROSTLINNÁ BUŇKA aaaaaaaa jádro mitochondrie chromatin (DNA) aaaaaaaa aaaaaaa aaaaaaaa aaaaaaaa plastid


Virtuální svět genetiky 1. Cytogenetika

Virtuální svět genetiky 1. Cytogenetika - struktura chromozomu se zabývá studiem dědičnosti a genetické informace na úrovni chromozomu za pomocí cytologických a genetických technik. Metacentrický má jednotlivá ramena stejně dlouhá Submetacetrický


Velká rodina života. mlha se zvedá

Velká rodina života. mlha se zvedá Úvod Jen málo národů a lidských pospolitostí na Zemi nemá svůj mýtus o stvoření. Američtí Irokézové věřili, že svět a všechno v něm stvořili nebeští lidé, podle starověkých Japonců byl svět výtvorem bohů,
