MENDELOVA UNIVERZITA V BRNĚ AGRONOMICKÁ FAKULTA DISERTAČNÍ PRÁCE

Transkript

1 MENDELOVA UNIVERZITA V BRNĚ AGRONOMICKÁ FAKULTA DISERTAČNÍ PRÁCE BRNO 2017 Mgr. ROMAN GURÁŇ

2 Mendelova univerzita v Brně Agronomická fakulta Ústav chemie a biochemie Využití MALDI-TOF zobrazovací hmotnostní spektrometrie pro studium potenciálních markerů živočišných tkání Disertační práce Studijní obor: 4106V017 Zemědělská chemie Vedoucí práce: RNDr. Ondřej Zítka, Ph.D. Školitel-specialista: Ing. Pavlína Adam, Ph.D. Vypracoval: Mgr. Roman Guráň Brno 2017

3 Čestné prohlášení Prohlašuji, že jsem práci: Využití MALDI-TOF zobrazovací hmotnostní spektrometrie pro studium potenciálních markerů živočišných tkání vypracoval samostatně a veškeré použité prameny a informace uvádím v seznamu použité literatury. Souhlasím, aby moje práce byla zveřejněna v souladu s 47b zákona č. 111/1998 Sb., o vysokých školách ve znění pozdějších předpisů a v souladu s platnou Směrnicí o zveřejňování vysokoškolských závěrečných prací. Jsem si vědom, že se na moji práci vztahuje zákon č. 121/2000 Sb., autorský zákon, a že Mendelova univerzita v Brně má právo na uzavření licenční smlouvy a užití této práce jako školního díla podle 60 odst. 1 autorského zákona. Dále se zavazuji, že před sepsáním licenční smlouvy o využití díla jinou osobou (subjektem) si vyžádám písemné stanovisko univerzity, že předmětná licenční smlouva není v rozporu s oprávněnými zájmy univerzity, a zavazuji se uhradit případný příspěvek na úhradu nákladů spojených se vznikem díla, a to až do jejich skutečné výše. V Brně dne: podpis

4 Faculty of Electrical Engineering and Communication Brno University of Technology Technicka 12, CZ Brno, Czechia PODĚKOVÁNÍ Výzkum popsaný v této disertační práci byl realizován v laboratořích podpořených z projektu SIX; registrační číslo CZ.1.05/2.1.00/ , operační program Výzkum a vývoj pro inovace. Brno (podpis autora)

5 Poděkování Děkuji prof. Ing. Renému Kizekovi, DrSc. a prof. RNDr. Vojtěchu Adamovi, Ph.D. za přijetí do jejich týmu na Ústavu chemie a biochemie (Agronomická fakulta, Mendelova univerzita v Brně) a za cenné rady, připomínky a čas, který věnovali mně a mojí práci. Dále chci poděkovat RNDr. Ondřeji Zítkovi, Ph.D. za vedení mé disertační práce a podporu při mém vědeckém rozvoji. Za vedení práce děkuji také Ing. Pavlíně Adam, Ph.D. Spoluautorům děkuji za pomoc při experimentální práci, konzultaci výsledků a přípravu publikací, které jsou podkladem této práce. Všem ostatním kolegům děkuji za příjemnou a přátelskou atmosféru na pracovišti. V neposlední řadě děkuji své rodině a přátelům za zázemí, lásku a podporu. Nejvíce děkuji mojí manželce za psychickou podporu a nenahraditelné zážitky, které dávají smysl mému životu.

6 Anotace MALDI-TOF zobrazovací hmotnostní spektrometrie (MSI) se začala rozvíjet na přelomu druhého a třetího tisíciletí a již od prvních aplikací poskytovala důležité informace o prostorovém výskytu různých biomolekul, nejčastěji peptidů, proteinů, lipidů a oligosacharidů, v řezech živočišných tkání, rostlinných pletiv a podobně. Nejvíce se metoda uplatňuje ve výzkumu potenciálních biomarkerů různých typů nádorů. Tato disertační práce se zabývá využitím MALDI-TOF MSI pro studium prostorové distribuce potenciálních markerů v řezech živočišných tkání. V teoretické části práce je podán obecný přehled o MALDI-TOF hmotnostní spektrometrii a jejím využitím pro zobrazování potenciálních markerů v nádorech. V praktické části práce jsou okomentovány dosažené publikované výsledky. Pomocí MALDI-TOF MSI byla zjištěna prostorová distribuce estradiol-3,4-chinonu, fytochelatinů PC2 a PC3, oxidovaného glutathionu (GSSG) a metalothioneinu v příčných řezech žížaly hnojní (Eisenia fetida). Dále byla tato metoda využita pro mapování metalothioneinu v řezech myších xenograftů nádoru prostaty (PC-3). V případě sledování procesů zahrnutých ve spontánní regresi melanomu u MeLiM (Melanoma-bearing Libechov Minipigs, melanom nesoucí miniaturní prasata z Liběchova) miniaturních prasat byla tato metoda využita pro klasifikaci specifických m/z píků, které signifikantně odlišovaly zdravou kůži a melanom z MeLiM miniaturních prasat. Klíčová slova MALDI-TOF MSI, biomarkery, nádory

7 Annotation MALDI-TOF imaging mass spectrometry (MSI) began to develop at the turn of the second and third millennia, and since the first applications it provided important information about the spatial occurrence of various biomolecules, most commonly peptides, proteins, lipids and oligosaccharides, in animal tissue sections. This method has been most widely applied in the research on potential biomarkers of various types of tumors. The dissertation thesis deals with the use of MALDI-TOF MSI for studying spatial distribution of potential markers in animal tissue sections. In the theoretical part of the thesis is provided an overview of MALDI-TOF mass spectrometry and its use for imaging of potential markers in tumors. In the practical part, the achieved published results are commented. Using MALDI-TOF MSI, the spatial distribution of estradiol-3,4-quinone, phytochelatins PC2 and PC3, oxidized glutathione (GSSG) and metallothioneins was determined in transverse sections of the Eisenia fetida. Furthermore, this method was used to map metallothionein in sections of prostate tumor murine xenografts (PC-3). In a case of monitoring the processes involved in the spontaneous regression of melanoma in MeLiM (Melanoma-bearing Libechov Minipigs) miniature pigs, this method was used to classify specific m/z peaks that significantly differentiated healthy skin and melanoma from MeLiM miniature pigs. Keywords MALDI-TOF MSI, biomarkers, tumors

8 Obsah 1 ÚVOD CÍLE PRÁCE LITERÁRNÍ PŘEHLED MALDI-TOF hmotnostní spektrometrie Historie MALDI-TOF MS Princip metody Příprava analytů Detekce MALDI ionizovaných molekul pomocí TOF MALDI-TOF identifikace proteinů Zobrazovací hmotnostní spektrometrie MALDI MSI Biomarkery a jejich detekce pomocí MALDI MSI MALDI MSI pro studium fyziologických procesů v nádorech souhrnný článek MATERIÁL A METODIKA Chemikálie Metodika Příprava mražených vzorků tkání pro MALDI MSI Příprava parafinovaných vzorků tkání pro MALDI MSI Aplikace matrice pomocí Bruker ImagePrep MALDI-TOF MSI Histologické pozorování VÝSLEDKY A DISKUSE Vědecký článek I Vědecký článek II Vědecký článek III Shrnutí výsledků ZÁVĚR LITERATURA... 96

9 8 SEZNAM OBRÁZKŮ A TABULEK SEZNAM ZKRATEK

10 1 ÚVOD S rozvojem výpočetní techniky se v oblasti hmotnostní spektrometrie začaly více prosazovat průletové hmotnostní analyzátory (TOF, time-of-flight), jelikož potřebovaly vhodný hardware a software pro zpracování množství dat získaného během okamžiku (stovky až tisíce hmotnostních spekter za sekundu). TOF detektory umožňují v jednom okamžiku zaznamenávat hmotnostní spektra analytů v širokém rozsahu m/z a zároveň pracují na relativně jednoduchém principu detekce hmotnosti analytů na základě jejich doby letu průletovou trubicí. K největšímu rozmachu dochází v souvislosti s vývojem nových, tzv. měkkých ionizačních technik, jako jsou elektrosprejová ionizace (ESI, electrospray ionisation) nebo laserová desorpce/ionizace za účasti matrice (MALDI, matrix assisted laser desorption / ionisation), jejichž první aplikace byly zaznamenány v 80. letech 20. století. Výhodou MALDI je ionizace převážně celých molekul analytů, čímž je umožněno stanovení jejich molekulové hmotnosti. Zároveň je interpretace získaných hmotnostních spekter snazší díky menší fragmentaci molekul. Nejčastěji se MALDI-TOF využívá pro analýzu peptidů, proteinů, oligosacharidů a různých polymerů. První studie zabývající se MALDI zobrazovací hmotnostní spektrometrií (MSI, mass spectrometry imaging) se začaly objevovat na konci 90. let 20. století. Pomocí MALDI MSI lze zobrazovat prostorovou distribuci různých látek nejčastěji v řezech biologických vzorků. Velký důraz je kladen na studium potenciálních biomarkerů živočišných tkání a určení jejich prostorové distribuce, především u nádorů, s ohledem na detailnější pochopení biochemických dějů a možnosti jejich ovlivnění. Z hlediska využitelnosti MALDI MSI při studiu řezů klinických vzorků je výhodou dostupnost rozsáhlých sbírek klinických vzorků fixovaných formalínem a zalitých parafinem (FFPE, formalin-fixed and paraffin-embedded). V současné době je MALDI MSI využívána pro analýzu široké škály vzorků, od analýz jednotlivých buněk a buněčných linií po 3D analýzy celých orgánů a organismů, kdy jsou 3D MSI obrazy složeny z několika po sobě následujících 2D MSI obrazů. Tato metoda poskytuje cenné informace o výskytu a identitě různých biomarkerů a doplňuje tak znalosti získané imunohistochemií, fluorescenční mikroskopií a jinými metodami. Získané hmotnostní mapy biomarkerů lze také kombinovat s dalšími zobrazovacími technikami, jako je laserová ablace ve spojení s indukčně vázaným plazmatem a průletovým hmotnostním analyzátorem (LA-ICP- TOF, laser ablation inductively-coupled plasma time-of-flight), která zjišťuje prvkovou prostorovou distribuci. 10

11 2 CÍLE PRÁCE Literární rešerše se zaměřením na MALDI MSI nádorů Optimalizace přípravy parafinovaných a mražených tkáňových řezů pro MALDI MSI a optimalizace stěžejních parametrů MALDI MSI Vývoj metod MALDI MSI pro studium živočišných tkání, především nádorů Aplikace MALDI MSI na parafinovaných a mražených řezech reálných zvířecích vzorků za účelem detekce potenciálních biomarkerů 11

12 3 LITERÁRNÍ PŘEHLED V této kapitole je podán stručný přehled historie MALDI-TOF a jsou popsány základní principy a aplikace této techniky, především s ohledem na zobrazovací hmotnostní spektrometrii nádorů a jiných živočišných tkání. Detailnější informace o základech MALDI-TOF najde čtenář v článcích [1-6]. Rozšiřující informace o dalších aplikacích MALDI- TOF, které nejsou součástí této práce, lze najít v souhrnných článcích pojednávajících o analýze sacharidů a glykokonjugátů [7], analýze proteinů a jejich nekovalentních komplexů [8], analýze léčiv a jejich metabolitů [9], analýze bakterií spojené s jejich identifikací [10-12], a forenzní analýze využívající povrchově modifikované substráty pro MALDI [13]. 3.1 MALDI-TOF hmotnostní spektrometrie Historie MALDI-TOF MS První využití laseru pro ionizaci analytů v hmotnostní spektrometrii bylo popsáno na konci 60. let 20. století [14,15]. Jednalo se však především o využití při prvkové analýze a analýze molekul menších než 5 kda [16-19]. Pro analýzu molekul větších než 5 kda byla vyvinuta řada technik [20], přičemž se začaly uplatňovat hlavně tzv. měkké ionizační techniky, které ionizují molekuly s minimální fragmentací a mezi které patří v současné době nejvíce rozšířená elektrosprejová ionizace (ESI) [21], desorpční elektrosprejová ionizace (DESI) [22] a MALDI [23]. Díky MALDI a ostatním laserovým desorpčním a ionizačním technikám tak došlo k renesanci laserů v hmotnostní spektrometrii. O vyvinutí techniky MALDI se zasloužili Franz Hillenkamp a Michael Karas v roce 1985 [24] a později v letech poprvé využili organickou matrici a dosáhli tak ionizace molekul větších než 5 kda [23]. Nezávisle na nich se o rozvoj MALDI techniky zasloužil také Tanaka a kol., kdy díky použití anorganické matrice dokázali analyzovat molekuly kolem 100 kda [25] Koichimu Tanakovi byl nakonec v roce 2002 udělen čtvrtinový podíl na Nobelově ceně za chemii [26]. V průběhu dalšího vývoje našly uplatnění jako MALDI matrice hlavně slabší organické kyseliny, ale vyvíjí se i jiné typy matric: uhlíkové nanomateriály [27], iontové kapaliny [28], kvantové tečky [29], nanočástice [30-32]. V případě, že je použit jiný typ matrice než klasické organické kyseliny, označuje se MALDI většinou jako povrchově asistovaná laserová desorpce / ionizace (SALDI, surface-assisted laser desorption / ionisation) nebo povrchově vylepšená laserová desorpce / ionizace (SELDI, 12

13 surface-enhanced laser desorption / ionisation), zároveň se tato označení užívají v případě použití různě modifikovaných substrátů a MALDI terčíků [33-36] Princip metody Základní postup při MALDI je smíchání roztoku analytu s roztokem matrice v objemovém poměru 1:1, přičemž molární poměr matrice a analytu by měl být minimálně 1000:1, krystalizace matrice s analytem na MALDI terčíku a desorpce / ionizace analytu s matricí pomocí krátkých pulsů laseru (~ ns) v iontovém zdroji hmotnostního spektrometru. V iontovém zdroji je vytvořeno hrubé vakuum řádově 10 2 Pa a v TOF analyzátoru je vytvořeno hluboké vakuum řádově 10-6 Pa. Podle dosavadních znalostí probíhá ionizace analytu především přenosem náboje (protonu, H + ) z molekul matrice na molekuly analytu, kdy vznikají převážně jedenkrát nabité (protonované) molekulární ionty analytu [A+H] +, kde A je analyt a H atom vodíku. Vznikat mohou i záporně nabité (deprotonované) molekulární ionty [A-H] - a různé adukty analytu se sodnými a draselnými ionty, s ionty matrice a s případnými dalšími kontaminanty. Následně jsou molekulární ionty extrahovány z iontového zdroje (iontové komory) pomocí vysokého napětí (obvykle kolem kv) do hmotnostního analyzátoru, nejčastěji TOF. MALDI terčík musí být vyroben z vodivého materiálu, aby bylo možné aplikovat extrakční napětí. Volbou polarity napětí mezi extrakční elektrodou a terčíkem lze do hmotnostního analyzátoru extrahovat buď kladně nabité ionty, tzv. pozitivní mód, nebo záporně nabité ionty, tzv. negativní mód. Schéma procesu je zobrazeno na Obrázku 1. Obrázek 1: Schéma MALDI. MALDI destička je uzemněna a extrakční elektroda může být nabita kladně nebo záporně. Převzato z [37]. 13

14 Jako terčík / substrát se pro MALDI typicky používá ocel [38]. Využívají se však i jiné typy terčíků / substrátů, případně různé modifikace jejich povrchů: alobal [39], křemíková destička [40], zlatem pokrytý terčík z polyethylentereftalát-glykolu (Au-PETG) [41], modifikace grafitem [42], modifikace zlatými nanočásticemi [43], modifikace parafinem [44] a jiné. Nejběžněji používané lasery pro MALDI jsou dusíkové lasery s vlnovou délkou 337 nm nebo pevnolátkové Nd:YAG (neodymem dopovaný yttrito-hlinitý granát) lasery o základní vlnové délce 1064 nm (první harmonická frekvence záření), přičemž se častěji používá třetí harmonická frekvence laseru, která odpovídá 355 nm [45]. Využívají se i infračervené lasery [46,47]. Typická frekvence laserových pulsů je 1 2 khz, ale jsou využívány i lasery s frekvencí pulsů do 20 khz, experimentálně i 510 khz [48]. Výkon laseru je pak normalizován vzhledem k ozařované ploše, jejíž průměr se typicky pohybuje v rozmezí µm; označuje se jako hustota výkonu laseru (power density) a obecně se pohybuje řádově v W.cm -2 [49,50]. Princip ionizace není dosud zcela objasněn [51,52]. Poslední poznatky poukazují na to, že množství iontů, které se vyskytují v hmotnostním spektru, je stálé, pokud je stálá také účinná teplota při vzniku daného spektra [53]. Tyto poznatky mimojiné potvrzují hypotézu, že tvorba primárních iontů matrice je řízena tepelným mechanismem po ozáření laserem. Matrice plní v procesu ionizace zásadní roli a musí splňovat následující vlastnosti [54,55]: i) vysoký molární absorpční koeficient při vlnové délce použitého laseru, ii) rozpustnost v rozpouštědle analytu, iii) vhodnou strukturu krystalové mřížky a optimální skupenské teplo sublimace, iv) schopnost podporovat ionizaci (odštěpení / přenos protonu ) v) stabilitu ve vakuu. Z praktického hlediska by matrice měla poskytovat reprodukovatelnou ionizaci analytů s maximálním ionizačním účinkem, i v případě kontaminace roztoku matrice nebo analytu solemi, detergenty a jinými častými kontaminanty. Zároveň by neměla způsobovat fragmentaci molekul analytů a tvořit s nimi adukty. Kvůli počáteční dostupnosti malého počtu MALDI matric bylo zkoumáno použití různých ko-matric a vícesložkových matric, dále byly zkoumány různé MALDI substráty a způsoby přípravy směsí analytů s matricí. Mezi klasické a nejčastěji používané matrice patří (viz Obrázek 2) [56]: kyselina α-kyano-4-hydroxyskořicová (HCCA), kyselina 14

15 2,5-dihydroxybenzoová (DHB) a kyselina 3,5-dimethoxy-4-hydroxyskořicová (SA). Využívají se i různě derivatizované klasické matrice [57-61]. Obrázek 2: Klasické MALDI matrice. Kyselina α-kyano-4-hydroxyskořicová (HCCA), kyselina 2,5-dihydroxybenzoová (DHB) a kyselina 3,5-dimethoxy-4-hydroxyskořicová (SA) Příprava analytů Pro MALDI existuje několik způsobů přípravy analytů. Jedná se o metody dried-droplet, quick and dirty, thin-layer, double-layer, overlayer, sandwich, vacuum drying a fast evaporation a jiné [62-64]. Nejběžněji se používají metody dried-droplet, quick and dirty a fast evaporation, jejichž postup je následující (u všech metod platí, že smíchání roztoků probíhá obvykle v objemovém poměru 1:1): i) U metody dried-droplet se připraví směs roztoku analytu s roztokem matrice v mikrovialce a poté se nanese na terčík nejčastěji 1 µl směsi a odpaření rozpouštědel se provede při laboratorní teplotě, případně ve vakuovém exsikátoru. ii) U metody quick and dirty dochází ke smíchání roztoku analytu s roztokem matrice přímo na terčíku, kdy se pořadí nanesení roztoků může měnit a po nanesení obou kapek na stejné místo se může ještě provést jejich promíchání špičkou mikropipety. Následně se provede odpaření rozpouštědel buď při laboratorní teplotě nebo ve vakuovém exsikátoru. iii) U metody fast evaporation probíhá smíchání roztoku analytu a roztoku matrice separátně. Pořadí nanesení roztoků na terčík se opět může měnit, ale vždy platí, že se analyt i matrice připraví v roztocích s vyšším obsahem organického rozpouštědla (nejčastěji acetonitrilu, ethanolu nebo methanolu), aby došlo k rychlému odpaření roztoku při laboratorní teplotě za atmosférického tlaku. Obvykle se nejprve nanesene 1 µl roztoku matrice, rozpouštědlo se nechá odpařit při laboratorní teplotě, a pak se nanese 1 µl roztoku analytu a opět se nechá rozpouštědlo odpařit za stejných podmínek. 15

16 Výběr optimální matrice a způsobu přípravy vzorků je potřeba si empiricky ověřit pro každý typ analytu [65-67]. Důležité je také pracovat s chemikáliemi v čistotě pro hmotnostní spektrometrii a analyty mít dostatečně purifikovány klasickými separačními metodami. Připravený MALDI terčík s krystaly matrice a analytů se nakonec vloží do MALDI iontového zdroje přes přechodovou komoru, kde se vyrovná tlak z atmosférického tlaku na tlak hrubého vakua v iontovém zdroji Detekce MALDI ionizovaných molekul pomocí TOF Průletové hmotnostní analyzátory (TOF) se začaly spojovat s MALDI prakticky už od počátku vývoje z důvodu kompatibility s pulsním způsobem ionizace. TOF analyzátory poskytují výhodu v jednoduchosti, v simultánní detekci všech ionizovaných a extrahovaných analytů, v rychlosti analýzy a v teoreticky neomezeném hmotnostním rozsahu [68,69]. Existují dvě základní uspořádání MALDI-TOF, kdy se TOF analyzátor zařazuje za MALDI iontový zdroj buď horizontálně, nebo vertikálně / ortogonálně [70]. Byly také vyvinuty různé geometrie TOF trubic: klasická lineární trubice, trubice ve tvaru S [71] a trubice s více ohyby [72]. Jako detektory se u TOF analyzátorů nejčastěji používají mikrokanálové desky (micro-channel plate, MCP) [5,73,74]. MCP detektor má průměr obvykle několik cm a skládá se z mikrokanálů o průměru cca 6 10 µm, které mají povrch z vysoce odolného polovodivého materiálu. Když na povrch mikrokanálu dopadne ion, tak z povrchu vyrazí elektron a následně dochází k emisi dalších sekundárních elektronů vlivem gradientu vnějšího napětí; tím dochází k elektronové amplifikaci signálu. Celkem se emituje až několik milionů elektronů, které nakonec dopadnou na zadní stěnu desky, kde dojde k zaznamenání proudové odezvy. Moderní MCP detektory se skládají z chevronového páru MCP detektorů, kdy jsou na obou MCP deskách mikrokanály oproti sobě otočeny o 90 (vytvoří se vroubky chevronový vzor) [75]. Hmotnost iontů je u TOF analyzátorů vypočítaná na základě doby letu průletovou trubicí. Čas se začíná měřit v okamžiku ozáření laserovým pulsem nebo v okamžiku aplikace extrakčního napětí. Díky extrakčnímu napětí získají ionty kinetickou energii Ekin [69]: E kin = zeu ex = 1 2 mv2 = 1 2 m (L t ) 2 (1) kde z je náboj molekulárního iontu, e je elementární náboj, Uex je extrakční napětí, m je hmotnost molekulárního iontu, v je jeho rychlost, L je délka dráhy letu a t je doba letu molekulárního iontu průletovou trubicí. 16

17 Rychlost molekulárních iontů lze považovat za konstantní vzhledem k tomu, že počáteční zrychlení v iontovém zdroji působí krátkou dobu na krátkou vzdálenost v porovnání s časem stráveným v TOF analyzátoru a celkovou délkou dráhy letu [69]. Z rovnice (1) pak lze vyjádřit poměr hmotnosti a náboje m/z molekulárního iontu: m z = 2eU ex ( t L ) 2 (2) Z vyjádření závislosti rychlosti v na hmotnosti m v rovnici (3) vyplývá, že rychlost molekulárních iontů v TOF analyzátoru klesá nepřímo úměrně s druhou odmocninou jejich hmotnosti, tzn. že citlivost TOF je pro vysokomolekulární ionty nižší [69]. v = 2zeU ex m (3) Pro částečnou kompenzaci rozdílů v kinetických energií molekulárních iontů, které vznikají díky charakteru MALDI ionizace a kvůli kterým není možné dosáhnout vysokého hmotnostního rozlišení (rozlišovací schopnosti, m/δm poměr hmotnosti ionu m a šířky píku Δm tohoto iontu v polovině výšky) u vysokomolekulárních látek, byl vyvinut reflektron, který se obvykle skládá ze dvou lineárních oblastí bez pole (field-free region) mezi iontovým zdrojem a reflektronem, respektive mezi reflektronem a reflektronovým detektorem, a z iontového zrcadla, což je nejčastěji soustava prstrencových elektrod, na které je aplikováno vysoké napětí s opačnou polaritou, než bylo u extrakce [69]. Umístění reflektronu před lineární detektor uvnitř TOF trubice je zobrazeno na Obrázku 3. Reflektron kompenzuje rozdílné počáteční kinetické energie pro ionty se stejným poměrem m/z. U molekul s větší kinetickou energií dochází k většímu proniknutí do elektrického pole uvnitř reflektronu a díky tomu tyto ionty zůstávají déle v reflektronu a urazí větší vzdálenost, než molekulární ionty s menší kinetickou energií a stejným poměrem m/z. Tím dojde ke kompenzaci vyšší rychlosti v oblasti bez pole a k lepšímu rozlišení [69]. 17

18 Obrázek 3: Schéma MALDI-TOF s reflektronem. Pokud je kinetická energie molekulárních iontů větší než potenciální energie elektrického pole reflektronu, pak reflektron tyto ionty propustí na lineární detektor a v tom případě slouží jako energetický filtr iontů. Z toho důvodu je reflektron vhodný pro lehčí molekulární ionty (cca <10 kda). Pro zlepšení hmotnostního rozlišení MALD-TOF byla také vyvinuta tzv. zpožděná extrakce (delayed extraction). Díky MALDI ionizaci vznikají při procesu laserové desorpce / ionizace ze stejného místa molekulární ionty s různou kinetickou energií. Zpožděná extrakce, kdy je aplikace extrakčního napětí po MALDI ionizaci zpožděna řádově o 10 2 ns, tyto rozdíly do jisté míry koriguje [69]. Další typy TOF analyzátorů a způsobů zlepšení hmotnostního rozlišení jsou uvedeny v rozsáhlém souhrnném článku Radionové a kol. [69] MALDI-TOF identifikace proteinů Identifikace proteinů pomocí MALDI-TOF probíhá nejčastěji tzv. peptidovým mapováním (PMF, peptide mass fingerprinting) [76,77]. Obvykle je nejprve provedena separace proteinů buď pomocí 2D PAGE (polyakrylamidové gelové elektroforézy), nebo pomocí UHPLC / HPLC (ultra- / vysoce-účinné kapalinové chromatografie). Následně je provedeno enzymatické štěpení proteinů ve výřezcích z gelu, tzv. in-gel štěpení, nebo ve frakcích sesbíraných z HPLC. Jako enzym se nejčastěji používá trypsin, který specificky štěpí peptidové vazby na karboxylovém konci argininu (R) nebo lysinu (K), pokud po nich 18

19 nenásleduje prolin (P); optimální teplota reakce je 37 C, ph cca 8 a doba štěpení minimálně 4 h, optimálně přes noc (10 16 h) [78]. Vzniklé peptidy jsou poté zakoncentrovány a odsoleny, v případě štěpení v gelu jsou peptidy nejprve extrahovány a až poté zakoncentrovány a odsoleny; poté jsou naneseny na MALDI terčík spolu s matricí HCCA nebo DHB. Hmotnostní spektra peptidů jsou poté změřena v reflektronovém pozitivním módu MALDI-TOF v rozsahu m/z od 500 Da do maximálně 8000 Da. Nakonec se provede identifikace proteinu na základě statistické shody porovnáním hmotnostních spekter peptidů daného proteinu s hmotnostními spektry v průběžně aktualizovaných databázích jako jsou např. NCBIprot a SwissProt; pro porovnání hmotnostních spekter lze využít software MASCOT server (Matrix Science, Boston, MA, USA). U MALDI-TOF/TOF hmotnostních spektrometrů lze provést identifikaci naštěpeného proteinu i pomocí zjištění sekvence peptidů díky tandemové hmotnostní analýze jejich fragmentačních spekter a porovnáním zjištěných sekvencí s peptidovými / proteinovými databázemi, například opět pomocí MASCOT serveru díky tzv. MASCOT MS/MS Ion Search. Fragmenty peptidů vznikají díky tzv. rozpadu / rozkladu za zdrojem (post-source decay, PSD), kdy se molekulární ionty analytů samovolně rozpadají díky energii získané extrakcí z iontového zdroje MALDI do TOF analyzátoru [79-81]. Pro fragmentaci analytů lze využít i laserem indukovanou disociaci (LID), kolizně indukovanou disociaci (CID) nebo rozpad ve zdroji (in-source decay, ISD) [82]. Při MALDI-TOF analýze tyto fragmenty pak dopadají na detektor iontů ve stejný okamžik jako mateřský ion a není možné je proto ve spektru detekovat. Proto je potřeba využít tandemové hmotnostní spektrometrie. V případě tzv. LIFT ( potential lift, potenciálové vytáhnutí ) cely se jedná o pseudo-tandemovou hmotnostní spektrometrii, protože nejsou za sebe fyzicky zařazené dva TOF analyzátory, ale druhý rozměr zde vytváří LIFT cela. V MS módu není LIFT cela aktivní a v případě MS 2 módu dokáže vhodným nastavením elektrického pole na elektrodách LIFT cely selektovat z proudu molekulárních iontů vybraný mateřský ion nebo jeho fragmenty (dceřiné ionty) [82]. Více informací o hmotnostním spektrometru LIFT-TOF/TOF lze najít v publiakci Suckau a kol. [82]. 3.2 Zobrazovací hmotnostní spektrometrie Zobrazovací hmotnostní spektrometrie (MSI) se začala rozvíjet nejprve pro zobrazování povrchů v rámci elementární anorganické analýzy materiálů v 60. letech 20. století, kdy byla vyvinuta technika hmotnostní spektrometrie sekundárních iontů (SIMS, secondary ion mass spektrometry). SIMS využívá bombardování povrchu primárními ionty (nejčatěji se jedná o 19

20 ionty argonu, xenonu, kyslíku nebo cesia), které z povrchu vyrazí sekundární ionty, jež jsou následně analyzovány v hmotnostním spektrometru [83,84]. V 80. letech 20. století pak byl pro zobrazování poprvé použit hmotnostní spektrometr s doutnavým výbojem (GDMS, glow discharge mass spectrometer) a v 90. letech byla použita technika laserové ablace ve spojení s hmotnostní spektrometrií s indukčně vázaným plazmatem (LA-ICP MS) [83]. S rozvojem měkkých ionizačních technik se začala rozvíjet i molekulová zobrazovací hmotnostní spektrometrie. V současné době se nejvíce využívají techniky hmotnostní spektrometrie sekundárních iontů ve spojení s průletovým hmotnostním analyzátorem (TOF-SIMS), MALDI, DESI a laserová ablace ve spojení s elektrosprejovou ionizací (LAESI, laser ablation-electrospray ionisation) [83,85-89] MALDI MSI MALDI zobrazovací hmotnostní spektrometrie je nejvhodnější z dostupných zobrazovacích metod pro zobrazování vysokomolekulárních látek, především peptidů a proteinů, a proto hraje klíčovou roli při aplikaci MSI pro analýzu biologických a klinických vzorků a hledání proteinových biomarkerů. Výhoda MSI metody oproti jiným zobrazovacím technikám spočívá v tom, že umožňuje cílenou i necílenou detekci molekul bez potřeby jejich předchozího značení, a také umožňuje detekovat stovky až tisíce různých molekul během jedné analýzy [90]. Ionizace laserem umožňuje dosáhnout relativně vysokého prostorového rozlišení díky fokusaci laserového svazku na průměr až 1 µm (obvykle µm). Zároveň došlo díky vývoji laserů s opakovací frekvencí laserových pulsů až do 20 khz ke značnému zrychlení MSI analýzy. Důležitý byl pro rozvoj MALDI MSI i rychlý vývoj počítačové techniky, bez kterého by nebylo reálné zpracování velkého množství dat (stovky GB) [90]. Mezi hmotnostní analyzátory používané pro MALDI MSI patří hlavně lineární TOF, reflektronový TOF, TOF/TOF, iontový cyklotron s Fourierovou transformací (FT-ICR), kvadrupól spojený s TOF (QTOF), lineární iontová past (LIT), QQQ (trojitý kvadrupól) a FT- Orbitrap (Orbitrap spojený s Fourierovou transformací) [90-92]. Nejvyšší hmotnostní rozlišení (rozlišovací schopnost, m/δm) poskytují FT-ICR a FT-Orbitrap, řádově [93]. Jsou ale schopné analyzovat pouze látky do cca 10 kda. Díky tomu se hodí především pro MSI analýz nízkomolekulárních látek, hlavně různých metabolitů [92], léčiv apod. Rozlišovací schopnost u lineárního TOF je řádově 10 3 a umožňuje detekovat látky až do 10 6 Da. Reflektronový TOF má hmotnostní rozlišení řádově [90]. 20

21 Při MSI analýze se uplatňují dva základní postupy: buď se provede MSI analýza celého řezu vzorku a poté se zobrazí vybrané hodnoty m/z, nebo se nejprve označí histologicky odlišné regiony na imunohistochemicky obarvených řezech vzorků a MSI analýza se pak provede pouze na těchto regionech [90,94,95]. Získaná MSI data jsou velmi obsáhlá, proto se využívá a vyvíjí software, který pomocí různých statistických metod, nejčastěji analýzy hlavních komponent (PCA), dokáže multidimenzionalitu dat zredukovat a klasifikovat data podle různých charakteristik [96]. Obecný postup při MALDI MSI analýze, včetně schématu a přípravy parafinovaných nebo mražených vzorků tkání, je popsán ve vloženém přehledovém článku v kapitole 3.3. Pro další informace o MALDI MSI lze doporučit přehledový článek od Jeremyho L. Norrise a Richarda M. Caprioliho [90] Biomarkery a jejich detekce pomocí MALDI MSI Existuje několik definicí pojmu biomarker (biologický marker). Definice podle Světové zdravotnické organizace (WHO, World Health Organisation) označuje biomarker jako jakoukoliv látku, strukturu nebo proces, který lze změřit v těle nebo jeho produktech a který ovlivňuje nebo předpovídá výsledek nebo výskyt nemoci. Do této definice zahrnuje také téměř jakékoliv měření odrážející interakci mezi biologickým systémem a potenciálním nebezpečím, které může být chemické, fyzikální nebo biologické. Naměřená odezva může být funkční a fyziologická, biochemická na úrovni buněk nebo molekulární interakce [97]. Biomarkery slouží i jako indikátory normálního stavu. V této disertační práci je biomarker chápán především jako molekula analytu, která signifikantně charkaterizuje daný stav / danou vlastnost analyzovaného regionu vzorku. Nejčastěji se pojem biomarker používá v klinickém výzkumu, protože právě medicína využívá již validované biomarkery pro posuzování stavu pacienta a pro určení vhodné léčby / zákroku. Ideální biomarker by měl být specifický pro daný stav organismu / pro daný orgán, měl by být dostatečné koncentrovaný, jeho hladina by měla korelovat s vývojem daného stavu a měl by být snadno zjistitelný nejlépe bez většího zásahu do organismu [98]. Pomocí MALDI MSI byla zkoumána prostorová distribuce různých potenciálních biomarkerů v různých biologických vzorcích. O MALDI MSI biomarkerů v nádorech je pojednáno v následující kapitole 3.3. Kromě biomarkerů v nádorech se jednalo mimojiné o: lipidy v řezech octomilky obecné (Drosophila melanogaster) a membránové lipidy thylakoidů kukuřice (Zea mays) [99-101], proteiny v pacifických bílých krevetách (Litopenaeus vannamei) [102], aktivní signální molekuly královny bezžihadlových včel 21

22 (Meliponini) [103], degradační produkty chlorofylu ve střevě Spodoptera littoralis [104], glukosinoláty na povrchu listů huseníčku rolního (Arabidopsis thaliana) [105], alkaloidy paličkovice nachové (námelu, Claviceps purpurea) v jejím sklerociu [106], sekundární metabolity bakterie Burkholderia seminalis v houbě srpovničce špičatovýtrusé (Fusarium oxysporum) [107] a další. Více lze najít v přehledových článcích [ ]. 3.3 MALDI MSI pro studium fyziologických procesů v nádorech souhrnný článek Guráň, R.; Zítka, O.; Rodrigo, M. A. M.; Adam, V.; Kizek, R., MALDI zobrazovací hmotnostní spektrometrie pro studium fyziologických procesů v nádorech. Chemické Listy 2016, roč. 110, č. 2, s Dostupné z: Celkový podíl autora Guráň R.: 65 %. 22

23 Chem. Listy 110, (2016) Referát MALDI ZOBRAZOVACÍ HMOTNOSTNÍ SPEKTROMETRIE PRO STUDIUM FYZIOLOGICKÝCH POCHODŮ V NÁDORECH ROMAN GURÁŇ a,b, ONDŘEJ ZÍTKA a,b, MIGUEL ANGEL MERLOS RODRIGO a,b, VOJTĚCH ADAM a,b a RENÉ KIZEK a,b a Ústav chemie a biochemie, Mendelova univerzita v Brně, Zemědělská 1, Brno, b Středoevropský technologický institut, Vysoké učení technické v Brně, Technická 10, Brno kizek@sci.muni.cz Došlo , přepracováno , přijato Klíčová slova: MALDI MSI, nádorové markery, zobrazovací metody Obsah 1. Úvod 2. Studium nádorů pomocí MALDI MSI 2.1. Princip MALDI MSI 2.2. Techniky přípravy vzorku pro MALDI MSI 2.3. Využitelnost MALDI MSI v diagnostice nádorových onemocnění 2.4. MALDI MSI pro studium fyziologie nádorů 2.5. MALDI MSI kombinace s jinými technikami 3. Závěr 1. Úvod Pro lepší pochopení dějů probíhajících v nádorech bylo nutné rozvíjet analytické metody s vhodným prostorovým rozlišením, s širokým dynamickým rozsahem, s možností přesné a rychlé analýzy desítek až stovek analytů zároveň. Jednou z metod, která se začala kolem roku 2000 uplatňovat v analýze prostorové distribuce různých biomarkerů, byla MALDI zobrazovací hmotnostní spektrometrie (MALDI MSI, MALDI imaging). Tato metoda využívá desorpce analytů s matricí pomocí laserového záření, nejčastěji v UV oblasti. Díky následné měkké ionizaci dochází k tvorbě především jedenkrát nabitých molekulárních iontů, což umožňuje relativně jednoduchou interpretaci hmotnostních spekter a zjištění molekulových hmotností analytů je proto rychlé. Nejčastěji se MALDI používá v kombinaci s průletovým hmotnostním analyzátorem (TOF), který umožňuje měření v širokém hmotnostním rozsahu a zaznamenává celé spektrum najednou. Poprvé byl MALDI MSI použit pro analýzu exprese proteinů v myším a lidském mozku 1. Od té doby se metodou zabývá stále více výzkumných týmů. Zároveň dochází k vývoji instrumentace, např. ke zrychlování analýzy 2. V tomto referátu byla provedena literární rešerše zaměřená na výsledky MALDI MSI různých nádorů z posledních dvou let. Základní rešerše byla provedena s využitím databáze Web of Science s použitím klíčových slov MALDI imaging of tumors a MALDI imaging and cancer. Následně byly vybrány články podle toho, aby tematicky co nejvíce pojednávaly o různých typech nádorů a aby pocházely z renomovaných impaktovaných časopisů. 2. Studium nádorů pomocí MALDI MSI 2.1. Princip MALDI MSI Hmotnostní spektrometrie MALDI-TOF se nejčastěji využívá pro identifikaci proteinů a peptidů a analýzu dalších biomolekul. Díky měkké ionizaci, širokému rozsahu měřitelných hmotností a rychlému záznamu spekter se tato metoda začala uplatňovat ve výzkumu molekulárních profilů různých karcinomů a v hledání vhodných biomarkerů jednotlivých typů onkologických onemocnění a tím se z MALDI-TOF hmotnostní spektrometrie stává jeden z dalších diagnostických nástrojů. Pro kvantitativní a diagnostickou proteomiku lze využít principu SELDI (surface enhanced laser desorption/ionization laserová desorpce/ ionizace usnadněná povrchem), který využívá povrchově upravené MALDI destičky pro interakci analytů s povrchem 3,4. Typický postup MALDI MSI je následující. Nejprve je řez tkáně, nejčastěji o tloušťce 5 20 m, nanesen na mikroskopické sklíčko pokryté vodivou vrstvou oxidu inditého dopovaného cínem (kvůli extrakčnímu napětí u MALDI), bílým korekčním perem jsou označeny minimálně tři kalibrační značky a pak jsou dané řezy na sklíčku skenovány pro vytvoření kvalitních fotografií vzorků. Po skenování je na vzorky tkáně nanesena rozprašovačem (existuje několik typů, komerčních i nekomerčních) souvislá homogenní vrstva připraveného roztoku matrice. Vzorek je vysušen a poté jsou sklíčka připevněna k MALDI adaptéru a vložena do iontového zdroje hmotnostního spektrometru. V ovládacím programu hmotnostního spektrometru se nejprve načte naskenovaný obrázek sklíčka se vzorkem a souřadnice sklíčka na adaptéru v iontovém zdroji se kalibrují pomocí kalibračních značek na sklíčku. Jakmile ovládací program vypočte souřadnice vzorku v iontovém zdroji, na skenovaném obrázku se označí regiony, které se budou měřit, a nastaví se hustota rastru pomocí šířky jednoho rastrového bodu. Nyní se nastaví automatická metoda s potřebnými parametry měření a před samotným měřením se provede kalibrace přístroje pomocí externí kalibrace na směsi standardů peptidů/ proteinů v potřebném hmotnostním rozsahu. Data ze změ

24 Chem. Listy 110, (2016) Referát řených hmotnostních spekter se následně nahrají do vyhodnocovacího programu a v něm se vytvoří 2D mapy distribuce analytů o určitých molekulových hmotnostech pro každou hmotnost je vybrána určitá barva a intenzita této barvy značí intenzitu daného píku v hmotnostním spektru (obr. 1). Získané 2D hmotnostní mapy lze korelovat s mikroskopickou fotografií daného řezu Techniky přípravy vzorku pro MALDI MSI Pomocí MALDI zobrazovací hmotnostní spektrometrie mohou být zkoumány vzorky rozdílné povahy, nejčastěji různé orgány, rostlinná pletiva, kolonie bakterií a buňky samotné 5 8. Existuje několik typů řezů tkání využívaných pro MALDI MSI, jedná se o řezy z čerstvé tkáně, z tkáně konzervované v ethanolu, z tkáně fixované formaldehydem a zalité v parafinu nebo z rychle a hluboce zmrazené tkáně Nejvíce se analyzují tkáně z mozku, ledvin, jater, plic, srdce a různé typy nádorů. Lidské tkáně se získávají převážně z biopsií, případně po resekci. Preferováno je okamžité a hluboké zmrazení získané tkáně (teplota 80 C), které minimalizuje degradaci analytů a fixuje jejich prostorovou distribuci. Důležité je, aby proběhlo zmrazení celé tkáně najednou a co nejrychleji, protože jinak může docházet k jejímu popraskání a k tvorbě nežádoucích ledových krystalů. Proto je žádoucí postupovat tak, že se tkáň volně zabalí do hliníkové fólie a postupně se ponoří do mrznoucí tekutiny, jako je dusík, ethanol nebo isopropanol, a udržuje se v závislosti na použité tekutině při teplotě 40 nebo 80 C (cit. 12 ). Řezy zmražené tkáně o tloušťce 5 20 m se běžně získávají pomocí kryotomu. Fixace mražených řezů na vodivé sklíčko se zpravidla provádí dehydratací obvykle se sklíčko s tkání nejprve krátce namočí do 70% ethanolu a poté se na pár minut namočí do % ethanolu. Pro analýzu proteinů se před nanesením matrice vymyjí lipidy a soli ethanolem a vodou, případně pomocí jiných organických rozpouštědel jako je xylen nebo chloroform. Pro odsolení tkáně při analýze lipidů je možné použít roztok octanu amonného nebo mravenčanu amonného 12. U metody MALDI MSI z řezů tkání, které byly fixované formaldehydem a zalité parafinem, je příprava vzor- Obr. 1. Schéma obecného pracovního postupu u MALDI zobrazovací hmotnostní spektrometrie

25 Chem. Listy 110, (2016) Referát ků komplikovanější. Parafin může potlačovat ionizaci a formaldehydová fixace způsobuje dehydrataci, denaturaci, síťování (methylenové můstky), srážení a aglutinaci proteinů, což znemožňuje jejich detekci. Po přichycení tkáňových řezů na vodivé sklíčko je proto potřeba vzorek deparafinovat inkubací v xylenu po dobu několika minut. Poté se vzorek rehydratuje namáčením sklíčka se vzorkem do řady roztoků ethanolu s jeho postupně snižující se koncentrací. Následně se pro znovuzískání antigenů pomocí rozrušení methylenových můstků zesíťovaných proteinů vzorek inkubuje v pufrech o různém ph a iontové síle při vysokých teplotách jedná se např. o Tris (2-amino-2- -hydroxymethyl-propan-1,3-diol, 100 mm, na ph 9 upraveno pomocí 100mM NaOH nebo HCl) a citrátový (11,5 ml 100mM monohydrátu kyseliny citronové + 88,5 ml 100mM dihydrátu citrátu sodného, ph 6) pufr. K pufrům se také mohou přidávat různá chelatační činidla a organická rozpouštědla 10. Po fixaci tkáňových řezů na vodivém sklíčku se vzorky nechají vysušit a poté se může nanést roztok matrice, případně lze před nanesením matrice aplikovat roztok proteolytického enzymu pro štěpení proteinů přímo v tkáni, tzv. on-tissue digestion štěpení probíhá v tkáňovém řezu na sklíčku 12. Další informace o metodách přípravy vzorků pro MALDI MSI lze získat např. v publikacích 13, Využitelnost MALDI MSI v diagnostice nádorových onemocnění MALDI MSI se využívá především jako experimentální diagnostický nástroj pro detekci a identifikaci nových biomarkerů spojených s různými patologickými stavy převážně s nádory 4. Ve spojení s histologickým vyhodnocením poskytuje cenné údaje o rozdílech biomolekulárních profilů mezi nemocnou a zdravou tkání. Potenciál pro využití MALDI MSI jako běžného diagnostického nástroje v klinických laboratořích je poměrně velký 15. Jeden z hlavních důvodů, proč zatím nepatří MALDI MSI mezi rutinní diagnostické nástroje, je pravděpodobně nedostatek proškolených pracovníků klinických laboratoří a využívání validovaných a dobře fungujících imunoanalytických metod na automatizovaných analytických linkách MALDI MSI pro studium fyziologie nádorů Od svého počátku byla MALDI MSI využívána pro analýzu různých nádorů. V této kapitole je podán stručný přehled současných významných výsledků. Studium nádorů mozku Při charakterizaci molekulárního profilu glioblastomu (zhoubný mozkový nádor) s využitím metody MALDI MSI ve spojení s ISD (in-source decay rozpad ve zdroji) byly vytvořeny 2D hmotnostní mapy řezů mozkových tkání myší s 30 m prostorovým rozlišením a byla vypozorována heterogenita glioblastomu 17. Bylo identifikováno několik proteinů v různých oblastech a vývojových stádiích nádoru, které hrají zásadní roli při jeho vzniku. Mezi tyto proteiny patří mimo jiné GFAP (gliální fibrilární acidický protein), Thymosin β4, S100-A6 (calcyclin kalcyklin). Studium nádorů jícnu Spojení MALDI MSI a tkáňového mikročipu (TMA) bylo využito pro hledání molekulárních profilů spojených s klinicko-patologickými parametry karcinomu jícnu 18. Takto bylo odhaleno 72 rozdílných m/z píků spojených s nádorovými buňkami, z nichž 48 bylo detegováno pouze v karcinomu dlaždicových buněk a 12 jich bylo detegováno pouze v adenokarcinomech (nádory vzniklé ze žlázového epitelu). Výsledky zdůrazňují podstatné biologické rozdíly mezi adenokarcinomy a karcinomy dlaždicových buněk, a zároveň podtrhují možnosti výkonu MALDI MSI. Dále byly metodou MALDI MSI charakterizovány proteomické změny u Barrettova adenokarcinomu a jeho premaligních stadií 19. Barrettův adenokarcinom vzniká u pacientů s tzv. Barrettovým jícnem (BJ) jedná se o stav jícnu, kdy je část původního dlaždicového epitelu sliznice nahrazena metaplastickým cylindrickým epitelem, je to jeden z následků refluxní nemoci jícnu. Z 60 m/z píků různě exprimovaných molekul v Barrettově adenokarcinomu a prekurzorové lézi byly hmotnostní spektrometrií a imunohistochemií identifikovány dva proteiny COX7A2 (cytochrom c oxidasa polypeptid 7A2) a S100-A10. S100-A10 byl multivariační analýzou identifikován jako nezávislý nový prognostický faktor Barrettova adenokarcinomu. Studium nádorů plic Metodou MALDI ve spojení s lineární iontovou pastí (LTQ) a orbitrapem byla charakterizována prostorová distribuce léčiv v mikroprostředí karcinomu lidských plic a krysích xenoimplantátů (implantáty, které pochází z jiného organismu) 20. Studium nádorů prsu Poprvé byla využita kombinace optického zobrazení ve spojení s MALDI MSI a iontově-mobilitní separací pro analýzu distribuce lipidů u rostoucích nádorů prsu (proliferace nádorových buněk, invazivita, metastáze) 21. V jiné studii byly metodami MALDI MSI a MALDI tandemové hmotnostní spektrometrie detegovány markery rané přestavby tkáňového mikroprostředí invazivní rakoviny prsu. Bylo zjištěno, že IGHA2 (imunoglobulin HA2) je v mikroprostředí nádoru prsu zónově specifický a mohl by sloužit jako marker rané přestavby mikroprostředí nádoru u invazivní rakoviny prsu, i jako marker metastáz u místních lymfatických uzlin pacientů s nádorem prsu 22. Studium nádorů slinivky břišní MALDI MSI umožnila rozlišit metastáze nádorů prsu a slinivky břišní studiem parafinových řezů tkáně, fixovaných formaldehydem. Podařilo se rozeznat primární nádory prsu od primárních nádorů slinivky břišní s přesností 83 %, s citlivostí 86 % a se specifitou 77 %. Taktéž byly správně identifikovány prsní metastáze a metastáze slinivky břišní 23. Pomocí MALDI MSI byly detegovány uvol

26 Chem. Listy 110, (2016) Referát něné N-glykany v řezech zdravých myších ledvin, lidských karcinomů slinivky břišní a prostaty a v tkáňovém mikročipu hepatocelulárního karcinomu. Složení N-glykanů bylo následně ověřeno přímou kolizně-indukovanou fragmentací v tkáni. Výsledky prokázaly účinnost MALDI MSI pro rozlišení nádorových tkání od normálních 24. Studium nádorů jater Porovnáním MALDI MSI proteomických profilů dvou hlavních subtypů (H a P) jaterních cholangiokarcinomů (CC) byla prokázána jejich nádorová heterogenita. CC jsou druhým nejčastějším typem primárního nádoru u jater. V H subtypech byly nejvíce diskriminační lidské neutrofilní peptidy 1 3, které byly exprimovány nádorovými buňkami, a S100 proteiny (A6 a A11), které byly omezeny na stromální oblast; v P subtypech byl nejvíce diskriminační thymosin β4 (cit. 25 ). V jiné studii byl zjištěn proteinový profil jaterních metastáz kolorektálního karcinomu (CRC). Byly vybrány dva antigeny, LTBP2 a TGFBI, které jsou konzistentně exprimovány v metastázích CRC a jejichž klinický potenciál byl demonstrován pomocí in vivo protilátkové analýzy 26. Další studie byla zaměřena na komparaci proteomu hepatocelulárního karcinomu (HCC), s a bez mikrovaskulární invaze (MiVI), za účelem identifikace zástupných biomarkerů MiVI. Srovnávací analýzou hmotnostních spekter těchto dvou skupin bylo detegováno 30 diferenčních m/z píků, z nichž dva píky byly poté identifikovány jako N-acetylovaný histon H4, jenž jeden byl dimethylovaný na K20 a druhý byl dimethylovaný na K20 a acetylovaný na K16. Oba píky byly ověřeny pomocí western blotu a imunohistochemie. Díky získaným výsledkům by mohla být detekce modifikovaných forem histonu H4 využitelná pro léčbu pacientů s HCC (cit. 27 ). Studium nádorů ledvin Pro profilování proteinů v nádorové tkáni ledvin byly využity metody MALDI MSI a tandemová hmotnostní spektrometrie a pro celkovou analýzu lipidů ve stejných tkáních byla využita MALDI-FT-ICR (MALDI ve spojení s Fourierovou transformační iontovou cyklotronovou rezonancí) hmotnostní spektrometrie. Celkem bylo identifikováno 26 proteinů a 39 lipidů, které rozlišují zdravou tkáň od nádorové tkáně 28. Studium nádorů tlustého střeva MALDI MSI analýzou tkáňových řezů kolorektálních karcinomů (CRC) a přilehlých zdravých tkání sliznice bylo zjištěno, že CRC tkáň obsahuje charakteristické fosfolipidové profily ve srovnání se zdravou tkání a že různé oblasti uvnitř mikroprostředí CRC ukazují odlišné biochemické profily. Byly také objeveny biochemické rozdíly mezi zdravou tkání, přilehlou k nádoru a vzdálenou od nádoru 29. Studium nádorů prostaty Pro charakterizaci řezů prostatické tkáně byla využita HR-MALDI MSI (MALDI MSI s vysokým rozlišením). Bylo detegováno 26 exprimovaných molekul v prostatě, které byly identifikovány tandemovou hmotnostní spektrometrií. Bylo zjištěno, že fosfatidylinositoly PI (18:0/18:1), PI (18:0/20:3) a PI (18:0/20:2) jsou signifikantně více exprimovány v nádorové tkáni než v benigním epitelu. Rozdíly v expresi fosfatidylinositolů proto mohou sloužit jako nový diagnostický nástroj karcinomu prostaty 30. Ve studii zabývající se zlepšením specifity detekce karcinomu prostaty a charakterizací jednotlivých tumorů byly pomocí MALDI MSI proteomického profilování identifikovány charakteristické m/z píky rozlišující mezi karcinomem, benigním epitelem a stromální oblastí. Bylo zjištěno, že v prostatické tkáni je nadměrně exprimována biliverdin reduktasa B (BLVRB) 31. V další studii byla využita metoda MALDI MSI tkáňového mikročipu (TMA), obsahujícího vzorky prostaty 1044 pacientů, k identifikaci molekulárních profilů spojených s klinicko-patologickými parametry karcinomu prostaty. Bylo identifikováno 15 rozdílných m/z píků souvisejících s karcinomem prostaty 32. Studium nádorů kostí V inspirativní studii bylo vůbec poprvé využito spojení MALDI MSI a magnetické rezonance (MRI) pro studium kostních nádorů a metastází. Ze získaných dat byly vytvořeny 3D modely kostních nádorů. Byla zjištěna rozdílná exprese kalcyklinu, ubiquitinu a dalších proteinů uvnitř nádorových buněk, a zároveň hemoglobin A a kalgranulin A pomohly při rozlišení regionů bohatých na červené, resp. na bílé krvinky 33. V jiné studii bylo, pomocí hmotnostně-spektrometrické molekulární histologie pacientů s heterogenními, mikroskopicky identickými, kostními tumory (chondrosarkomy), možné zvýraznit typy nádorových buněk, které mohou být charakterizovány jediným hmotnostním profilem MALDI MSI kombinace s jinými technikami U metody MALDI MSI je poměrně běžná kombinace 2D hmotnostních map s imunohistochemickými mikroskopickými fotografiemi. Lze využít 3 možné postupy přípravy vzorků pro MALDI MSI a imunohistochemii 12 : 1) je využito barvení řezu pomocí barviva, které neinterferuje při MSI analýze (kresylová violeť apod.), 2) jsou nařezány dva po sobě následující řezy, přičemž jeden je použit pro MSI analýzu a druhý pro imunohistochemii, 3) je nejprve provedena MSI analýza a následně je odstraněna matrice pomocí rozpouštědla a stejný řez je použit pro imunohistochemii. Poslední postup patří mezi nejpoužívanější a pro barvení se využívá nejčastěji hematoxylin a eosin (H&E). Další možnost spočívá v kombinaci MALDI 2D hmotnostních map s LA-ICP MS (laserová ablace ve spojení s hmotnostní spektrometrií s indukčně vázaným plazmatem) 35, což by bylo možné využít např. při korelaci prostorové distribuce metaloproteinů, zjištěných pomocí MALDI MSI, s prostorovou distribucí iontů kovů, zjištěnou pomocí LA-ICP MS. Použít by se dala taky LA-ICP OES (laserová ablace ve spojení s optickou emisní spek

27 Chem. Listy 110, (2016) Referát trometrií s indukčně vázaným plazmatem). Mezi cílové analyty lze zařadit zejména metalothioneiny Je žádoucí, aby rozlišení obrazů pro korelaci bylo shodné nebo alespoň podobné, protože jinak může dojít ke zkreslení a nesprávné interpretaci. 3. Závěr Podle získaných výsledků lze konstatovat, že díky MALDI MSI různých typů karcinomů je možné identifikovat několik vhodných biomarkerů. Aby je bylo možné považovat za klinicky významné analyty, bude nutné ověření v nezávislých studiích. Jakmile bude jejich validace úspěšná, lze očekávat větší zapojení této techniky v klinické praxi. S rychlejším rozšířením MALDI MSI v klinických laboratořích dojde pravděpodobně ke standardizaci metody. Pro významnější zapojení v klinické praxi je však zapotřebí, aby neustál výzkum a vývoj účinnější ionizace a přesnější a rychlejší detekce. Otázkou však je, zda proti většímu rozšíření této metody nepřispívá její invazivní charakter, kdy je potřeba pro analýzu odebrat vzorek. Z tohoto hlediska lze o MALDI MSI uvažovat spíše jako o podpůrné a verifikační metodě in vivo zobrazovacích metod. Tato práce byla podpořena projektem SIX CZ.1.05/2.1.00/ Seznam zkratek BLVRB biliverdin reductase B biliverdin reduktasa B CC cholangiocarcinoma cholangiokarcinom COX7A2 cytochrome c oxidase polypeptide 7A2 cytochrom c oxidasa polypeptid 7A2 CRC colorectal cancer/carcinoma kolorektální karcinom FT Fourier transform Fourierova transformace GFAP glial fibrillary acidic protein gliální fibrilární acidický protein HCC hepatocellular carcinoma hepatocelulární karcinom HR high resolution vysoké rozlišení ICR ion cyclotron resonance iontová cyklotronová rezonance IGHA2 immunoglobulin heavy constant alpha 2 imunoglobulin HA2 LA-ICP MS laser ablation-inductively coupled plasma mass spectrometry laserová ablace ve spojení s hmotnostní spektrometrií s indukčně vázaným plazmatem LA-ICP OES laser ablation-inductively coupled plasma optical emission spectrometry laserová ablace ve spojení s optickou emisní spektrometrií s indukčně vázaným plazmatem LTBP2 latent-transforming growth factor betabinding protein 2 latentní transformační růstový faktor beta vázající protein 2 LTQ linear trap quadrupole lineární iontová kvadrupólová past MiVI microvascular invasion mikrovaskulární invaze MSI mass spectrometry imaging zobrazovací hmotnostní spektrometrie PI phosphatidylinositol fosfatidylinositol SELDI surface enhanced laser desorption/ ionization laserová desorpce/ionizace usnadněná povrchem TGFBI transforming growth factor, beta-induced transformační růstový faktor beta TMA tissue microarray tkáňová microarray/ tkáňový mikročip LITERATURA 1. Stoeckli M., Chaurand P., Hallahan D. E., Caprioli R. M.: Nat. Med. 7, 493 (2001). 2. Bednařík A., Kuba P., Houška P., Moskovets E., Tomalová I., Krásenský P., Preisler J.: Chem. Listy 107, S294 (2013). 3. Češková P., Brožková K., Hernychová L., Štěrba J., Valík D., Vojtěšek B.: Chem. Listy 100, 974 (2006). 4. Rodrigo M. A. M., Zitka O., Krizkova S., Moulick A., Adam V., Kizek R.: J. Pharm. Biomed. Anal. 95, 245 (2014). 5. Gorzolka K., Bednarz H., Niehaus K.: Planta 239, 1321 (2014). 6. Passarelli M. K., Ewing A. G.: Curr. Opin. Chem. Biol. 17, 854 (2013). 7. Louie K. B., Bowen B. P., Cheng X. L., Berleman J. E., Chakraborty R., Deutschbauer A., Arkin A., Northen T. R.: Anal. Chem. 85, (2013). 8. Liu H., Chen R., Wang J., Chen S., Xiong C., Wang J., Hou J., He Q., Zhang N., Nie Z., Mao L.: Anal. Chem. 86, (2014). 9. Chaurand P., Latham J. C., Lane K. B., Mobley J. A., Polosukhin V. V., Wirth P. S., Nanney L. B., Caprioli R. M.: J. Proteome Res. 7, 3543 (2008). 10. Gorzolka K., Walch A.: Histol. Histopathol. 29, 1365 (2014). 11. Steven R. T., Bunch J.: Anal. Bioanal. Chem. 405, 4719 (2013). 12. Nimesh S., Mohottalage S., Vincent R., Kumarathasan P.: Int. J. Mol. Sci. 14, (2013). 13. Thomas A., Chaurand P.: Bioanalysis 6, 967 (2014). 14. Martin-Lorenzo M., Balluff B., Sanz-Maroto A., van Zeijl R. J. M., Vivanco F., Alvarez-Llamas G., McDonnell L. A.: J. Proteomics 108, 465 (2014). 15. Ko K. H., Kwon C. I., Park S. H., Han N. Y., Lee H. K., Kim E. H., Hahm K. B.: Clin. Endosc. 46, 611 (2013). 16. Nedvěd J., Hajdúch M., Lemr K., Havlíček V.: Chem

28 Chem. Listy 110, (2016) Referát Listy 105, 356 (2011). 17. Ait-Belkacem R., Berenguer C., Villard C., Ouafik L., Figarella-Branger D., Chinot O., Lafitte D.: Proteomics 14, 1290 (2014). 18. Quaas A., Bahar A. S., von Loga K., Seddiqi A. S., Singer J. M., Omidi M., Kraus O., Kwiatkowski M., Trusch M., Minner S., Burandt E., Stahl P., Wilczak W., Wurlitzer M., Simon R., Sauter G., Marx A., Schluter H.: Histopathology 63, 455 (2013). 19. Elsner M., Rauser S., Maier S., Schone C., Balluff B., Meding S., Jung G., Nipp M., Sarioglu H., Maccarrone G., Aichler M., Ruchtinger A., Langer R., Jutting U., Feith M., Kuster B., Ueffing M., Zitzelsberger H., Hofler H., Walch A.: J. Proteomics 75, 4693 (2012). 20. Vegvari A., Fehniger T. E., Rezeli M., Laurell T., Dome B., Jansson B., Welinder C., Marko-Varga G.: J. Proteome Res. 12, 5626 (2013). 21. Chughtai K., Jiang L., Greenwood T. R., Glunde K., Heeren R. M. A.: J. Lipid Res. 54, 333 (2013). 22. Kang S. K., Maeng H., Kim B. G., Qing G. M., Choi Y. P., Kim H. Y., Kim P. S., Kim Y., Kim Y. H., Choi Y. D., Cho N. L.: J. Proteome Res. 11, 4567 (2012). 23. Casadonte R., Kriegsmann M., Zweynert F., Friedrich K., Bretton G., Otto M., Deininger S. O., Paape R., Belau E., Suckau D., Aust D., Pilarsky C., Kriegsmann J.: Proteomics 14, 956 (2014). 24. Powers T. W., Neely B. A., Shao Y., Tang H. Y., Troyer D. A., Mehta A. S., Haab B. B., Drake R. R.: Plos One 9, (2014). 25. Le Faouder J., Laouirem S., Alexandrov T., Ben- Harzallah S., Leger T., Albuquerque M., Bedossa P., Paradis V.: Proteomics 14, 965 (2014). 26. Turtoi A., Blomme A., Debois D., Somja J., Delvaux D., Patsos G., Di Valentin E., Peulen O., Mutijima E. N., De Pauw E., Delvenne P., Detry O., Castronovo V.: Hepatology 59, 924 (2014). 27. Pote N., Alexandrov T., Le Faouder J., Laouirem S., Leger T., Mebarki M., Belghiti J., Camadro J. M., Bedossa P., Paradis V.: Hepatology 58, 983 (2013). 28. Jones E. E., Powers T. W., Neely B. A., Cazares L. H., Troyer D. A., Parker A. S., Drake R. R.: Proteomics 14, 924 (2014). 29. Mirnezami R., Spagou K., Vorkas P. A., Lewis M. R., Kinross J., Want E., Shion H., Goldin R. D., Darzi A., Takats Z., Holmes E., Cloarec O., Nicholson J. K.: Mol. Oncol. 8, 39 (2014). 30. Goto T., Terada N., Inoue T., Nakayama K., Okada Y., Yoshikawa T., Miyazaki Y., Uegaki M., Sumiyoshi S., Kobayashi T., Kamba T., Yoshimura K., Ogawa O.: Plos One 9, (2014). 31. Pallua J. D., Schaefer G., Seifarth C., Becker M., Meding S., Rauser S., Walch A., Handler M., Netzer M., Popovscaia M., Osl M., Baumgartner C., Lindner H., Kremser L., Sarg B., Bartsch G., Huck C. W., Bonn G. K., Klocker H.: J. Proteomics 91, 500 (2013). 32. Steurer S., Borkowski C., Odinga S., Buchholz M., Koop C., Huland H., Becker M., Witt M., Trede D., Omidi M., Kraus O., Bahar A. S., Seddiqi A. S., Singer J. M., Kwiatkowski M., Trusch M., Simon R., Wurlitzer M., Minner S., Schlomm T., Sauter G., Schluter H.: Int. J. Cancer 133, 920 (2013). 33. Seeley E. H., Wilson K. J., Yankeelov T. E., Johnson R. W., Gore J. C., Caprioli R. M., Matrisian L. M., Sterling J. A.: Bone 61, 208 (2014). 34. Jones E. A., Schmitz N., Waaijer C. J. F., Frese C. K., van Remoortere A., van Zeijl R. J. M., Heck A. J. R., Hogendoorn P. C. W., Deelder A. M., Altelaar A. F. M., Bovee J., McDonnell L. A.: J. Proteome Res. 12, 1847 (2013). 35. Sabine Becker J.: J. Mass Spec. 48, 255 (2013). 36. Raudenska M., Gumulec J., Podlaha O., Sztalmachova M., Babula P., Eckschlager T., Adam V., Kizek R., Masarik M.: Metallomics 6, 55 (2014). 37. Gumulec J., Raudenska M., Adam V., Kizek R., Masarik M.: Plos One 9, e85346 (2014). 38. Sztalmachová M., Gumulec J., Cernei N., Hlavna M., Zítka O., Babula P., Adam V., Kizek R., Masařík M.: Chem. Listy 106, 1075 (2012). 39. Rodrigo M. A. M., Zitka O., Adam V., Kizek R.: J. Metallomics Nanotechnol. 1(2), 25 (2014). R. Guráň a,b, O. Zítka a,b, M. A. M. Rodrigo a,b, V. Adam a,b, and R. Kizek a,b ( a Department of chemistry and biochemistry, Mendel University, Brno, b Central European Institute of Technology, Brno University of Technology): The MALDI Imaging for Study of the Physiological Processes in Tumors In recent years, MALDI imaging mass spectrometry, also known as MALDI imaging or MALDI MSI, has been getting wider recognition thanks to an increasing number of studies devoted to various tumor markers, comparing 2D mass maps of healthy and diseased tissue sections. By determining the spatial distribution of markers in the tissue we step forward to clarify the physiological processes in tumors and to better understand them. Moreover, by combining 2D mass maps with microscopic photos of the sections from histology, we get a more comprehensive picture of the distribution of the examined analytes. However, one of the disadvantages of MALDI imaging is a complicated ionization of analytes in a complex matrix of tissues and thus low detection limits. In this paper we report on the current state of MALDI imaging in oncology research. Development option of this method in the near future is outlined according to authors opinion

29 4 MATERIÁL A METODIKA 4.1 Chemikálie Standardy peptidů a proteinů pro kalibraci hmotnostního spektrometru byly pořízeny od firmy Bruker Daltonik GmbH (Brémy, SRN). Ostatní chemikálie byly pořízeny od firmy Sigma-Aldrich (St. Louis, MO, USA), pokud není uvedeno jinak. Čistota chemikálií je uvedena v příslušných vědeckých článcích (kapitola 5). Milli-Q voda byla připravena reverzní osmózou pomocí systému Aqual 25 (Aqual, Brno, ČR) a purifikována purifikačním systémem Direct-Q 3 UV (Millipore, Billerica, MA, USA) na výsledný měrný odpor 18,2 MΩ cm. 4.2 Metodika V této kapitole jsou popsány pouze hlavní metody a postupy, související s tématem disertační práce, s obecnými parametry / popisy. Přesný popis parametrů, včetně popisu dalších metod, je podrobně popsán v příslušných vědeckých článcích (kapitola 5) Příprava mražených vzorků tkání pro MALDI MSI Příprava kryořezů byla provedena kolegy na Ústavu živočišné fyziologie a genetiky AV ČR v Liběchově. Z každého vzorku byly získány tkáňové bloky (přibližně 8 5 mm) nepravidelného (lichoběžníkového) tvaru. Specifický polygonální tvar průřezu každého bloku usnadňuje identickou orientaci sériových příčných řezů tkáně použitých jak pro histologii, tak pro MALDI-TOF MSI. Tkáňové bloky byly umístěny na kousek korku, pokryté mrazícím mediem (Jung Tissue Freezing Medium, Leica Micro-systems, Wetzlar, SRN) a zmrazené v kapalném dusíku bezprostředně po excizi nádoru. Příčné kryořezy byly připraveny na kryostatu Leica CM 1850 (Leica Micro-systems, Wetzlar, SRN). Kryořezy pro MALDI MSI byly uchyceny na skleněná sklíčka pokrytá vodivou vrstvou oxidu indito-cíničitého ITO (Bruker Daltonik GmbH, Brémy, SRN) a skladovány v mrazáku při -80 C do dalšího zpracování. Po vytažení z mrazáku byla sklíčka ohřáta na zápěstí ruky a sušena ve vakuovém exsikátoru po dobu 15 min. Poté byla sklíčka promyta v Coplinově nádobě dvakrát v 70% ethanolu po dobu 2 min a jednou ve 100% ethanolu po dobu 2 min, následně byla několikanásobně (10 krátkých ponoření) promyta ve studené vodě ACS čistoty (specifikace čistoty zaručená Americkou chemickou společností) a nakonec opět několikrát promyta 70% a 100% ethanolem jak již bylo uvedeno. Před aplikací roztoku matrice 29

30 byly vzorky vysušeny ve vakuovém exsikátoru po dobu 15 min a pozice tkáňových řezů na sklíčkách byly označeny minimálně třemi značkami pomocí bílého korekčního pera. Následně byla sklíčka skenována ve skeneru Epson Perfection V500 Office (Epson Europe B. V., Amsterdam, Nizozemsko) s rozlišením 2400 DPI Příprava parafinovaných vzorků tkání pro MALDI MSI Vzorky tkáně byly přes noc zafixovány v 10% vodném roztoku formaldehydu a následně dehydratovány postupným namáčením v % roztocích ethanolu. Poté byly zality parafinem. Parafinovaná tkáň byla nařezána pomocí mikrotomu Leica RM2235 (Leica Micro-systems, Wetzlar, SRN) a řezy o různé tloušťce (6 10 µm) byly uchyceny na ITO sklíčka. Před MALDI MSI analýzou bylo potřeba vzorky deparafinovat inkubací v xylenu (2 po 3 min) a rehydratovat postupně v 100% ethanolu (2 po 1 min), 95% ethanolu (1 min), 70% ethanolu (1 min) a ACS vodě (2 po 3 min). Následně se provedlo tzv. znovuzískání antigenů, kdy proběhla inkubace vzorků v 10mM Tris (2-amino-2-hydroxymethyl-propan-1,3- diol) pufru o ph 9 při teplotě 95 C po dobu 20 min s jejich následným promytím 5 ACS vodou a vysušením ve vakuovém exsikátoru po dobu 15 min. Nakonec se vyznačila pozice tkáňových řezů na sklíčkách bílým korekčním perem a ITO sklíčka se skenovala pomocí Epson Perfection V500 Office (Epson Europe B. V., Amsterdam, Nizozemsko) s rozlišením 2400 DPI Aplikace matrice pomocí Bruker ImagePrep Matrice byla nanesena rozprášením na ITO sklíčka za použití standardních programů nanášecího zařízení ImagePrep (Bruker Daltonik GmbH, Brémy, SRN). Byly použity následující matrice: roztok kyseliny 3,5-dimethoxy-4-hydroxyskořicové (SA) o koncentraci 10 mg.ml -1 v acetonitrilu / ACS vodě (objemový poměr 60:40) s 0,2% kyselinou trifluoroctovou (TFA), roztok kyseliny 2,5-dihydroxybenzoové (DHB) o koncentraci 30 mg.ml -1 v methanolu / ACS vodě (objemový poměr 50:50) s 0,2% TFA a roztok kyseliny α-kyano-4-hydroxyskořicové (HCCA) o koncentraci 7 mg.ml -1 v acetonitrilu / ACS vodě (objemový poměr 50:50) s 0,2% TFA. Obsah mikrovialek s roztoky matric byl důkladně promíchán a mikrovialky byly vloženy do ultrazvukové lázně Bandelin 152 Sonorex Digital 10P (Bandelin electronic GmbH, Berlín, SRN) na 2 min při 50% intenzitě a laboratorní teplotě. Sklíčka byla po 15 min sušení ve vakuovém exsikátoru připravena k analýze. 30

31 4.2.4 MALDI-TOF MSI Pro MALDI-TOF MSI analýzy byl použit hmotnostní spektrometr MALDI-TOF/TOF Bruker ultraflextreme (Bruker Daltonik GmbH, Brémy, SRN). Naskenované obrázky ITO sklíček s řezy vzorků byly nahrány do programu Bruker FlexImaging 3.0 a MALDI adaptér se dvěma ITO sklíčky byl vsunut do iontového zdroje hmotnostního spektrometru. Pozice sklíček na MALDI adaptéru byla kalibrována podle bílých značek na ITO sklíčkách. Požadované oblasti měření byly vyznačeny pomocí ukazatele myši ručně v programu FlexImaging a byla zvolena šířka rastrového bodu 50 nebo 100 μm. Kalibrace hmotnostního spektrometru byla provedena externě s využitím směsi standardů peptidů a proteinů v rozsahu m/z 0 20 kda. Výkon laseru byl nastaven 5 10 % nad prahovou hodnotu, kdy je detekován dostatečný odstup signálu od šumu. Celkem bylo zprůměrováno spekter z jednoho rastrového bodu. Analýza peptidů a jiných nízkomolekulárních analytů probíhala v reflektronovém pozitivním modu, zatímco analýza proteinů probíhala v lineárním pozitivním modu. MSI data získaná z automatické analýzy byla nejprve zobrazena v programu FlexImaging a následně byla převedena do programu SCiLS Lab 2014b (SCiLS - Bruker Daltonik GmbH, Brémy, SRN), kde byla spektra upravena pomocí různých algoritmů (odečtení základní čáry baseline, normalizace hmotnostních spekter, apod.) a kde byla provedena statistická analýza významnosti rozdílů mezi jednotlivými MSI daty. Hmotnostní mapy signifikantních píků a další obrázky vygenerované ve SCiLS Lab byly nakonec upraveny v programu GIMP 2.8 ( do článkové podoby. Identifikace proteinů v tkáňových řezech byla provedena pomocí MALDI-TOF/TOF charakterizace peptidů po in situ trypsinizaci a následném statistickém srovnání získaných hmotnostních spekter s dostupnými databázemi na MASCOT serveru (Matrix Science, Boston, MA, USA). Nejprve bylo na ITO sklíčko s tkáňovým řezem naneseno přibližně 300 μl roztoku trypsinu (20 μg.ml -1 v 40mM NH4HCO3, 0.1mM HCl a 9% acetonitrilu) pomocí ImagePrepu, následně bylo sklíčko ponecháno v ImagePrepu naplněném dusíkem po dobu 15 hodin při laboratorní teplotě, a nakonec byla na sklíčko nanesena DHB matrice. Před MALDI-TOF/TOF analýzou bylo sklíčko se vzorkem sušeno ve vakuovém exsikátoru 15 min. Pro identifikaci pomocí MASCOT MS/MS Ion Search byly nastaveny tyto parametry: trypsin jako použitý enzym; žádné nebo jedno vynechané štěpné místo bylo povoleno; taxonomie byla nastavena na Metazoa (Animalia) nebo na Mammalia, případně na Homo sapiens; oxidace methioninu a / nebo N-koncová acetylace byly zahrnuty jako možné modifikace; tolerance hmotnosti peptidů byla nastavena maximálně na ± 1.2 Da; tolerance 31

32 hmotnosti peptidových fragmentů byla nastavena na ± 0.5 Da a hodnoty monoizotopické hmotnosti byly zadány jako [M+H] Histologické pozorování Pro optické zobrazení struktury tkáňových řezů bylo použito barvení tkáně pomocí hematoxylinu a eosinu (H&E). Kryořezy byly ponořeny do ethanolu na 20 min, 3 promyty destilovanou vodou po dobu 5 min a ponořeny na 20 min do Weigertova hematoxylinu pro obarvení buněčných jader. Poté byly řezy 20 min promývané kohoutkovou vodou a následně byly 3 promyty destilovanou vodou po dobu 5 min. Cytoplasma buněk byla kontrastně obarvena 1% alkoholovým roztokem eosinu (1 min). Po promytí v destilované vodě (3 po 5 min) byly obarvené řezy uloženy v glycerinovém želé. Obarvené řezy byly nakonec pozorovány mikroskopem Olympus DP73 (Olympus, Tokyo, Japonsko). Parafinované řezy byly nejprve deparafinovány inkubací v xylenu (2 po 3 min) a rehydratovány postupně v 100% ethanolu (2 po 1 min), 95% ethanolu (1 min), 70% ethanolu (1 min) a Milli-Q vodě (2 po 3 min). Následně byly obarveny hematoxylinem a eosinem podle postupu uvedeném v předchozím odstavci. Mikroskopická pozorování byla provedena na mikroskopu Olympus IX 71S8F-3 (Olympus, Tokyo, Japonsko). 32

33 5 VÝSLEDKY A DISKUSE Výsledková část předkládané disertační práce je přiložena ve formě publikací v odborných časopisech a dále doplněna o komentáře autora. U každé práce je vyznačen podíl autora na vytvoření publikace. 5.1 Vědecký článek I Heger, Z.; Michalek, P.; Guran, R.; Havelkova, B.; Kominkova, M.; Cernei, N.; Richtera, L.; Beklova, M.; Adam, V.; Kizek, R., Exposure to 17β-Oestradiol Induces Oxidative Stress in the Non-Oestrogen Receptor Invertebrate Species Eisenia fetida. PLOS ONE 2015, roč. 10, č. 2: e Dostupné z: Celkový podíl autora Guran R.: 30 %. Endokrinní disruptory (hormonálně aktivní látky) patří mezi kontaminanty životního prostředí a jejich zvyšující se koncentrace v odpadních, povrchových i pitných vodách vyvolává rostoucí obavy před nežádoucími účinky na konzumenty v celém potravním řetězci [ ]. Mezi tyto látky patří přírodní estrogeny, jako jsou 17β-estradiol (E2), estron (E1) nebo estriol (E3), syntetické estrogeny jako 17α-ethynylestradiol (EE2). Předpokládá se, že E2 se v půdě rychle rozptýlí a může být přeměněn na E1, který je dlouhodobě stabilní, případně může být E2 postupně metabolicky oxidován na E3 a E1 a dále přeměněn na chinony a semichinony [115,116]. Biologický účinek E2 na půdní organismy ale ještě není zcela objasněn. Cílem této studie proto bylo zjistit efekt E2 na růst, reprodukci a tvorbu volných radikálů v žížale hnojní (Eisenia fetida). Žížala hnojní byla vybrána jako častý modelový organismus pro hodnocení dlouhodobého působení kontaminantů na životní prostředí. Byla sledována exprese genů pro metalothionein (MT), fytochelatin synthasu (PCS) a glutathion peroxidasu (GPx). Následně byl detekován metalothionein, redukovaný a oxidovaný glutathion (GSH a GSSG), glutathion peroxidasa a isoformy fytochelatinu (PC2, PC3 a PC4). Bylo zjištěno, že reprodukce žížal byla silně ovlivněna, při použité koncentraci E2 100 µg.kg -1 půdy byla pozorována 51% inhibice. Dále E2 signifikantně ovlivnil hladiny antioxidantů, kdy docházelo k produkci reaktivních forem kyslíku (ROS) a stimulaci antioxidantů metalothioneinu a GSH / GSSG, ale ne fytochelatinů. 33

34 Pomocí MALDI-TOF MSI byla nakonec v příčných řezech žížaly hnojní (nultý až osmý týden inkubace) zjištěna prostorová distribuce estradiol-3,4-chinonu, fytochelatinů PC2 a PC3, GSSG a MT. Podle informací na Web of Science se jednalo o první využití MALDI MSI pro studium žížal. 34

35 RESEARCH ARTICLE Exposure to 17β-Oestradiol Induces Oxidative Stress in the Non-Oestrogen Receptor Invertebrate Species Eisenia fetida Zbynek Heger 1,2,3, Petr Michalek 1,2, Roman Guran 1,2, Barbora Havelkova 3, Marketa Kominkova 1,2, Natalia Cernei 1,2, Lukas Richtera 1,2, Miroslava Beklova 2,3, Vojtech Adam 1,2, Rene Kizek 1,2 * 1 Department of Chemistry and Biochemistry, Mendel University in Brno, Zemedelska 1, CZ Brno, Czech Republic, European Union, 2 Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ Brno, Czech Republic, European Union, 3 Department of Ecology and Diseases of Game, Fish and Bees, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences, Palackeho 1 3, CZ Brno, Czech Republic, European Union a11111 * kizek@sci.muni.cz Abstract OPEN ACCESS Citation: Heger Z, Michalek P, Guran R, Havelkova B, Kominkova M, Cernei N, et al. (2015) Exposure to 17β-Oestradiol Induces Oxidative Stress in the Non- Oestrogen Receptor Invertebrate Species Eisenia fetida. PLoS ONE 10(12): e doi: / journal.pone Editor: Mei LI, Jinling Institute of Technology, CHINA Received: September 1, 2015 Accepted: December 3, 2015 Published: December 22, 2015 Copyright: 2015 Heger et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper. Funding: Financial support was received through a grant (Central European Institute of Technology [CEITEC] CZ.1.05/1.1.00/ ). Competing Interests: The authors have declared that no competing interests exist. Background The environmental impacts of various substances on all levels of organisms are under investigation. Among these substances, endocrine-disrupting compounds (EDCs) present a threat, although the environmental significance of these compounds remains largely unknown. To shed some light on this field, we assessed the effects of 17β-oestradiol on the growth, reproduction and formation of free radicals in Eisenia fetida. Methodology/Principal Findings Although the observed effects on growth and survival were relatively weak, a strong impact on reproduction was observed (50.70% inhibition in 100 μg/kg of E 2 ). We further demonstrated that the exposure of the earthworm Eisenia fetida to a contaminant of emerging concern, 17β-oestradiol (E 2 ), significantly affected the molecules involved in antioxidant defence. Exposure to E 2 results in the production of reactive oxygen species (ROS) and the stimulation of antioxidant systems (metallothionein and reduced oxidized glutathione ratio) but not phytochelatins at both the mrna and translated protein levels. Matrix-assisted laser desorption/ionization (MALDI)-imaging revealed the subcuticular bioaccumulation of oestradiol-3,4-quinone, altering the levels of local antioxidants in a time-dependent manner. Conclusions/Significance The present study illustrates that although most invertebrates do not possess oestrogen receptors, these organisms can be affected by oestrogen hormones, likely reflecting free diffusion into the cellular microenvironment with subsequent degradation to molecules that PLOS ONE DOI: /journal.pone December 22, / 17 35

36 The Effect of 17β-Estradiol on Eisenia fetida undergo redox cycling, producing ROS, thereby increasing environmental contamination that also perilously affects keystone animals, forming lower trophic levels. Introduction Contaminants of emerging concern such as endocrine-disrupting compounds (EDCs), which are of an organic nature, have been detected in wastewater, surface water, and drinking water worldwide [1 3]. EDCs enter the wastewater treatment system from the excreta of livestock and humans [4]. These substances can be natural oestrogens 17β-oestradiol (E 2 ), oestrone (E 1 ) or oestriol (E 3 ) and also of synthetic origin, like 17α-ethynyloestradiol (EE 2 ), a common ingredient of human contraceptives. All species, sexes, and classes of farm animals eliminate natural oestrogenic hormones into the environment [5]; however, the environmental significance of this contamination remains largely unknown. Under common conditions, E 2 is expected to rapidly dissipate in the soil, reflecting absorption [6]. Subsequently, E 2 can be transformed into E 1, which persists in the soil for a long time without further degradation, as previously described [7]. Alternatively, E 2 is degraded through a metabolic oxidation sequence to produce E 3 and E 1 [8] and further transformed into semiquinones and quinones [9]. Although the potential fate of E 2 in the soil system has been suggested, the actual biological impact of this substance on soil inhabitants is not fully understood. The soil environment contains many organisms from different trophic levels. Earthworms are animals from the lower trophic level (60 80% of the total biomass), whose contamination can result in bioaccumulation and biomagnification along the food chain [10]. The semi-permeable body walls of these animals facilitate the absorption of various low-molecular weight chemicals. Earthworms are well known for their bioaccumulation of environmental pollutants both via the ingestion of contaminated organic matter and water and the body surface [11]. Thus, earthworms are commonly used as bioindicators for evaluating pollution in toxicity tests. Although the earthworm Eisenia fetida is one of the recommended test species for environmental surveillance (together with E. andrei)[12], to the best of our knowledge, data concerning the effects of E 2 on protective molecular mechanisms are unavailable. In a survey of annelid endocrine disruptors, Krajniak reported that EDCs affect invertebrates by inducing decreased growth and reproductive output, delayed sexual maturation and immune system inhibition. However, the mechanisms underlying these responses remain largely unknown [13]. Some studies have demonstrated that the exogenous addition of E 2 increases oxidative stress in fish [14] or rat-derived cell lines [15], describing elevation of a number of indicators of oxidative stress, including metallothionein (MT) and glutathione peroxidase (GPx). Despite this fact, no data regarding this phenomenon in invertebrates are available. Considering the oxidative stress hypothesis, it is general fact that unnatural generation of free radicals alters growth and reproduction attributes, as was described in aquatic invertebrates [16]. However, involvement of estrogens in such alterations in soil invertebrates needs to be addressed. Because the majority of E 2 is absorbed in soil particles and subsequently transformed into other biologically active low-molecular weight products, thereby affecting soil inhabitants, we examined whether E 2 exposure influences the substantial antioxidant and transport mechanisms in E. fetida. To address this question, we assessed the effects of E 2 on the growth, reproduction and formation of free radicals in E. fetida. To obtain further insight into E 2 influences, the effects on the expression of MT, phytochelatin synthase (PCS) and GPx as well as the PLOS ONE DOI: /journal.pone December 22, / 17 36

37 The Effect of 17β-Estradiol on Eisenia fetida subsequent detection of metallothionein, reduced and oxidized glutathiones (GSH and GSSG), GPx and phytochelatin isoforms (PC 2,PC 3 and PC 4, respectively) at the translated protein/ peptide level was revealed. Results and Discussion The effects of E 2 exposure on the growth and reproduction of E. fetida The application of manure to a field results in the surface runoff of E 2, reaching dozens of μg per litre; however these numbers depend on the application rate and time between applications [17]. Thus, for these experiments, we utilized the concentration range of μg/kg. The entire experiment fulfilled the OECD validity criteria, suggesting that each replicate (containing 10 adults) should produce 30 juveniles through the end of the experimental period; the coefficient of variation of reproduction should be 30%; and the adult mortality over the initial 4 weeks of the experimental period should be 10%. The results demonstrated that the highest applied concentrations of E 2 (100 μg/kg) induced 10% E. fetida mortality after 4 weeks of exposure (Table 1). Although the observed effects on growth (biomass) and survival were weak, a strong impact on reproduction was observed (50.70% inhibition in 100 μg/kg of E 2 ). Notably, lower E 2 doses (10, 30 and 50 μg/kg) stimulated reproduction (expressed as the negative inhibition of reproduction at -10.2; and -23.7%, respectively). However, higher concentrations (80 and 100 μg/kg) significantly inhibited reproduction (25.1 and 50.7%), with an EC 50 of 98 μg/kg for E 2. According to Marksman and colleagues, earthworms bioaccumulate E 2 and other EDCs [18], however the impact of the animals on biologically important molecules remains elusive. Thus, we aimed to determine whether the MALDI-TOF profiling of tissue homogenates would reveal the presence of E 2 in earthworm homogenates. Fig 1A demonstrates that there are no E 2 peaks ( Da) in the untreated control; however, treatment resulted in the formation of peaks corresponding to 4-hydroxyoestradiol (4-OHE 2 ) and the final metabolic product of E 2, oestradiol-3,4-quinone (E 2 )-3,4-Q) (Fig 1B), which is frequently associated with oxidative stress [19]. Thus, we further evaluated the formation of free radicals, and the results of the chlorophyllin assay revealed a positive correlation between the E 2 dose and the amount of free radicals (Fig 2). Although E 2 inhibits oxidative stress and prevents H 2 O 2 -induced apoptosis in some mammalian cells [20], other studies have demonstrated that the exogenous addition of E 2 elevates oxidative stress in fish [14] or rat-derived cell lines [15]. This result likely reflects the degradation of E 2 to 4-OHE 2, which subsequently undergoes redox cycling, producing reactive oxygen species (ROS) [19]. ROS affect the cellular microenvironment in a concentration-dependent manner and influence stimulatory or inhibitory growth signals. Thus, we further described the potential antioxidant protection in E 2 -exposed E. fetida individuals. The effects of E 2 exposure on gene expression We examined the expression of three genes involved in oxidative stress (MT, GPx and pcs). MT expression is characterized by strong induction associated with E 2 exposure (Fig 3A). Yoshido Kadota and coworkers demonstrated that the level of metallothionein gene expression directly determines the ROS scavenging of MT [21], and it is obvious that exposure to E 2 induces oxidative conditions in E. fetida. The analysis of GPx mrna expression revealed that E 2 exposure up-regulates this gene (Fig 3B). GPx converts H 2 O 2 to H 2 O with the subsequent oxidation of GSH to GSSG [22]. Although GSH acts as a substrate for phytochelatins and metal exposure results in the depletion of glutathiones as a result of elevated synthesis [23], intracellular ROS did not affect the expression of pcs mrna (Fig 3C). These data suggest divergent roles of closely linked antioxidant mechanisms. As previously described, pcs is up-regulated during PLOS ONE DOI: /journal.pone December 22, / 17 37

38 The Effect of 17β-Estradiol on Eisenia fetida Table 1. Summary of the toxic effects of E 2 on E. fetida growth and reproduction. Concentration of E 2 (μg/kg) No. of adults Biomass Mortality (%) 0 th 4 th week week 0 th week (mean ± SD)* (g) 4 th week (mean ± SD) (g) Increase (mean ± SD) (g) No. of juveniles produced (mean ± SD) CV (%) ** Inhibition of reproduction (%) 0 (Control) ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± *SD standard deviation; **CV coefficient of variation doi: /journal.pone t001 Fig 1. Schematic depiction of E 2 metabolites. The E 2 ratios to (A) 4-OHE 2 and (B) the final metabolite (E 2 )-3,4-Q represents the conversions over time. In control samples, no E 2, 4-OHE 2 or (E 2 )-3,4-Q was found. To evaluate the conversion ratios, the following mass weights were utilized: [E 2 +H] + m/z Da, [4-OHE 2 +H] + m/z Da and [(E 2 )-3,4-Q + H] + at m/z Da. The values are presented as the means of three independent replicates (n = 3). The vertical bars indicate standard error. doi: /journal.pone g001 PLOS ONE DOI: /journal.pone December 22, / 17 38

39 The Effect of 17β-Estradiol on Eisenia fetida Fig 2. The free radical contents in E. fetida immediately after the termination of the test. The error bars indicate standard deviations. The asterisks indicate significant differences (p<0.05) compared with the control groups. doi: /journal.pone g002 cellular interactions with metal ions, but based on the results of the present study, this gene is not up-regulated in response to ROS derived from the metabolic degradation of E 2. The effects of exposure to E 2 on the levels of antioxidant molecules Antioxidant defence involves two general classes of molecules, including enzymes (SOD, CAT, etc.) and water-soluble reductants, such as GSH, MT or PCs. Based on previous experience, we selected these biochemical parameters based on susceptive compensatory responses to various environmental contaminants (reviewed in [24]). MTs are a family of evolutionarily conserved proteins that are generally involved in the intracellular binding of metals, and a role for these proteins has been described in E. fetida after exposure to Zn, Cu, Pb, and Cd, respectively [25]. Another important function of MTs is protection against free radical attacks. MTs scavenge a variety of ROS molecules, reflecting the cysteinyl thiol moieties of this molecule [26]. Fig 4A illustrates the response of MT formation to treatment with E 2 and suggests a dose-dependent effect, with a significant increase in MT production compared with the untreated control. The highest MT values were achieved in the 3 rd and 5 th sampling weeks (3.11 and 3.04 μg/mg of total protein). Further analyses of the samples were conducted in the 8 th week, revealing a significant decrease in MT levels, which reflects a return to redox equilibrium. Previous studies PLOS ONE DOI: /journal.pone December 22, / 17 39

40 The Effect of 17β-Estradiol on Eisenia fetida Fig 3. Influence of E 2 exposure (100 μg/kg) on the expression of mrna encoding selected antioxidant molecules. (A) MT,(B) GPx and (C) pcs genes in E. fetida, collected in the 1 st ;3 rd ;5 th and 8 th weeks of the experiment. For evaluation, the corresponding molecular-weight bands of amplicons coinciding with the values shown in Table 1 were obtained using RT-PCR. The fluorescence intensities of the bands, obtained using ethidium bromide staining, were transformed into numerical forms, and expression was normalized to β-actin expression from the same cdna template. The values are presented as the means of three independent replicates (n = 3). The vertical bars indicate standard error. The asterisks indicate significant differences (p <.05) compared with the control groups. doi: /journal.pone g003 PLOS ONE DOI: /journal.pone December 22, / 17 40

41 The Effect of 17β-Estradiol on Eisenia fetida Fig 4. The levels of antioxidant molecules in E. fetida after exposure to E 2 (0 100 μg/l). (A) The levels of metallothionein, determined using DPV. (B) The ratio between GSH and GSSG, determined using HPLC-ED. The antioxidant molecules were analysed in the 1 st ;3 rd ;5 th and 8 th weeks of the experiment. The values are presented as the means of three independent replicates (n = 3). The vertical bars indicate standard errors. The asterisks indicate significant differences (p.05) compared with the control groups. doi: /journal.pone g004 have shown that MT expression is primarily controlled at the transcription level (consistent with the results of the present study) and affected through a variety of environmental stressors [27]. The obtained data demonstrated that E 2 induces MT expression; however E 2 induces MT less effectively than metal ions [28]. GSH is the most abundant antioxidant in aerobic cells, acting as a fundamental component of signalling processes, detoxifying certain xenobiotics and heavy metals [29]. Upon oxidative stress, GPx converts GSH to its oxidized form (GSSG). Thus, the GSH/GSSG ratio might serve as a marker of cellular stress [22]. Fig 4B demonstrates that the increasing E 2 concentrations triggered a higher GSH-to-GSSG conversion, and similar to MT, the highest impact was observed in the 3 nd and 5 th weeks (4.0 and 4.2, respectively). Because the thiol moieties of GSH donate a reducing equivalent to other unstable molecules, such as ROS, and become reactive, readily forming GSSG, the significant decreasing GSH/GSSG ratio indicates oxidative stress in the E. fetida cellular microenvironment upon exposure to E 2. Furthermore, we determined the enzymatic activity of GPx, and Fig 5 illustrates the elevation of activity during E 2 exposure, consistent with the levels of GPx transcripts. Thus, it is obvious that the glutathione pathway is involved in defence against E 2 metabolites. PCs are post-transcriptionally synthesized through constitutive phytochelatin synthase using GSH as a substrate. PCs play major roles in the detoxification of heavy metal ions in plants; however, the presence of PCs was also observed in Caenorhabditis elegans [30] and Lumbricus rubellus [31]. Although Brulle and coworkers determined the complete coding sequence of the pcs gene in E. fetida [32], the presence of PCs has not yet been described. Three isoforms (PC 2,PC 3 and PC 4 ) were identified in the present study, and the biosynthesis of these compounds was negatively affected after E 2 exposure. PC 2 is a predominant isoform (the highest tissue concentration was 2.83 μg/g of total protein) in E. fetida (Fig 6A), followed by PC 3 (0.16 μg/g of total protein) (Fig 6B) and PC 4 (0.09 μg/g of total protein) (Fig 6C). The total PCs protein levels reflect decreasing PCs levels with elevated E 2 concentration (Fig 6D). This phenomenon likely reflects a decline in GSH content, which is preferentially converted to GSSG. This conversion is also supported by the above-mentioned data, illustrating the largest decrease PLOS ONE DOI: /journal.pone December 22, / 17 41

42 The Effect of 17β-Estradiol on Eisenia fetida Fig 5. Determination of GPx activity after exposure to E2 (0 100 μg/kg). The enzymatic activity was examined in the 1 st ;3 rd ;5 th and 8 th weeks of the experiment. The values are presented as the means of three independent replicates (n = 3). The vertical bars indicate the standard error. The asterisks indicate significant differences (p <.05) compared with the control groups. doi: /journal.pone g005 in the GSH/GSSG ratio in the 3 nd and 5 th weeks of exposure. Taken together, these results confirmed the presence of the pcs gene in E. fetida. Furthermore, evidence of the presence of PC isoforms in other metazoan species was obtained; however, these were not directly affected after E 2 exposure but rather were more affected by the oxidation of the substrate glutathione. To elucidate the role of these peptides in the antioxidant protection of E. fetida, additional studies examining the response of PCs to the primary target, heavy metal ions, are needed. To further demonstrate the impact of E 2, cross sections of E. fetida individuals (Fig 7A 7E) collected in the 0 th 8 th sampling weeks and the MALDI-IMS (Fig 7Aa 7Ee) data were examined. Although the histological sections revealed no significant impact on the earthworm organism, the MALDI-IMS data obtained from the tissue slides revealed that E 2 exposure resulted in the subcuticular bioaccumulation of molecules with m/z Da, corresponding to oestradiol-3,4-quinone quasi-molecular ions with hydrogen [(E 2 )-3,4-Q + H] +, whose presence was not determined in the untreated control (Fig 7b 7Eb). Hence, these sites were further utilized to examine antioxidant molecules. Particularly in the case of PC 2 /PC 3, the decrease in intensity and abundance supported the HPLC-ED results. The PC 4 isoform was not identified, likely reflecting the low amount and problematic ionization of this isoform. Similarly, the elevation of GSSG and MTs (two isoforms with m/z and Da, previously described in E. fetida [33]) was associated with the length of exposure. PLOS ONE DOI: /journal.pone December 22, / 17 42

43 The Effect of 17β-Estradiol on Eisenia fetida Fig 6. Expression of phytochelatin isoforms in E. fetida after exposure to E 2 (0 100 μg/l) determined using HPLC-ED. (A) The levels of isoform PC 2, (B) isoform PC 3,(C) isoform PC 4 and (D) all analysed isoforms. Other known isoforms (PC 5,PC 6 ) were not determined. The PCs were analysed in the 1 st ; 3 rd ;5 th and 8 th weeks of the experiment. The values are presented as the means of three independent replicates (n = 3). The vertical bars indicate standard errors. The asterisks indicate significant differences (p <.05) compared with the control groups. doi: /journal.pone g006 Proposed fate of E 2 and its effects on the redox equilibrium in E. fetida cells Based on the above-mentioned data, it is obvious that E 2 exposure triggers a cascade of events, resulting in the elevation of biomarkers of oxidative stress. In vertebrates, E 2 interacts with transmembrane oestrogen receptors (ERs), leading to translocation and signal transduction [34]. Because invertebrates do not possess ERs, with a few exceptions in which active ERs were detected only in Platynereis dumerilii and Capitella capitata [35], E 2 can be internalized into the cellular microenvironment through free diffusion, which has been previously demonstrated for steroid hormones [36]. E 2 undergoes degradation through physiological oxidation via enzymes from the superfamily of cytochrome P450 (CYPs), whose activity in E. fetida has previously been described [37]. It is likely that the activity of these enzymes results in the formation of 4-OHE 2, which can subsequently be oxidized to oestradiol-3,4-semiquinone (E 2 )- 3,4-SQ) and finally to (E 2 )-3,4-Q. These events are physiological and conditioned in the presence of E 2 and CYPs enzymes [38]. (E 2 )-3,4-Q easily undergoes redox cycling, generating superoxide anions [19]. These products can further be converted to H 2 O 2 through superoxide PLOS ONE DOI: /journal.pone December 22, / 17 43

44 The Effect of 17β-Estradiol on Eisenia fetida Fig 7. Examination of E. fetida cross sections after E 2 exposure. H&E-stained cross sections of E. fetida exposed to E 2 (100 μg/l), collected in the (A)0 th (control), (B)1 st,(c)3 rd,(d)5 th and (E)8 th weeks of the experiment. The collected individuals were scanned (a) and employed for the MALDI-IMS analysis of (b) the final metabolites of E 2 [(E 2 )-3,4-Q + H] + at m/z Da ± 0.05%, (c) [PC 2 and PC 3 +H] + merge at m/z Da ± 0.05% (red) and Da ± 0.05% (green), respectively, (d) [GSSG + H] + at m/z Da ± 0.05% and (e) [MT 1 +H] + at m/z Da ± 0.05% (red) and [MT 2 +H] + at m/z Da (green). Matrix HCCA was used. The following conditions were used to acquire the MALDI spectra: 500 shots per raster spot, 45% laser energy and 50-μm spatial resolution. The length of scale bar is 500 μm. doi: /journal.pone g007 dismutase and H 2 O through GPx, which reversibly oxidizes two molecules of GSH to GSSG. As previously described, GSH is a fundamental substrate for the biosynthesis of PCs. Thus, the oxidation to GSSG decreases the formation of PC isoforms through phytochelatin synthase [31], whose gene expression is not affected after E 2 exposure. In the case of MT, H 2 O 2 is a major target of antioxidant activity, particularly reflecting the low reactivity of this molecule (other ROS are scavenged through GSH near the site of production), facilitating deeper penetration into the cell [39]. This interaction induces the oxidation of MT thiolate moieties, the loss of metal binding capacity, and the release of zinc from the physiologically predominant PLOS ONE DOI: /journal.pone December 22, / 17 44

45 The Effect of 17β-Estradiol on Eisenia fetida form, Zn-MT, and subsequent conversion to MT-disulphide. Selenium catalysts accelerate the reversible reduction process, resulting in the simultaneous formation of Zn-MT and oxidation of GSH to GSSG (which contributes to the decrease in the GSH:GSSG ratio, as shown in Fig 4B)[26]. Released zinc activates metal transcription factor 1 (MTF-1), which regulates the transcription of a wide array of genes, including MT. The induction of MT mrna expression was higher after E 2 exposure (Fig 3A), suggesting that ROS production in cells induced the release of zinc ions from metallothionein, leading to the induction of MT protein synthesis through MTF-1. Experimental Section Chemical compounds All standards and other chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA) at ACS purity, unless otherwise noted. Tested earthworm species The Oligochaete Eisenia fetida (family Lumbricidae) were obtained from the Ecotoxicological Laboratory of the University of Veterinary and Pharmaceutical Sciences, Brno, Czech Republic. Adult hermaphrodites between two and twelve months old (weighing between 350 and 500 mg), with fully developed clitellum, were used for testing. Reproduction test The experiments were performed as described in OECD Guideline 222 [12]. The artificial soil used as a testing substrate was prepared as a mixture of 70% sand, 20% kaolin clay and 10% finely ground sphagnum peat, ph 6.0 ± 0.5, adjusted with CaCO 3. All tests were conducted at 20 ± 2 C with a 16:8 (light/dark) photoperiod and illumination of 600 lx in the area of the test containers. Both, ph and moisture were evaluated at the beginning and end of the tests. During the test, the soil was contaminated with E 2 dissolved in an adequate amount of deionized water to achieve soil moisture equal to 50% of the maximum water-holding capacity. The concentrations were selected according to an experimentally determined range. Each E 2 stock solution was mixed with the soil immediately prior to use, generating nominal concentrations of 10, 30, 50, 80 and 100 μg/kg of E 2 per vessel. Five replicates were used per tested concentration. The mortality and growth effects on adult worms were determined at the end of the 4 th week of exposure. The effects on reproduction were subsequently assessed after another 4 weeks after counting the number of offspring present in the soil. After the termination of the experiment, the earthworms were immediately washed with MilliQ water and bathed in 500 μl of RNAlater 1 (Life Technologies, Carlsbad, CA, USA) to avoid undesired RNA degradation. Extraction and quantification of RNA Each individual was crushed under liquid nitrogen using a mortar and pestle and subsequently mixed with 350 μl of Tissue Lysis Buffer (Roche, Basel, Switzerland) in an Eppendorf tube. After 30 min at 25 C, the samples were centrifuged (13000 g at 20 C for 2 min) using an Eppendorf 5402 microcentrifuge (Eppendorf, Hamburg, Germany). Subsequently, 350 μlof the lysate supernatant was pipetted into the sample tube as a component of the MagNA Pure Compact RNA Isolation Kit (Roche, Basel, Switzerland). The isolation steps were performed according to the manufacturer s instructions. The concentration of obtained RNA was quantified using Infinite M200 PRO (Tecan, Männedorf, Switzerland). PLOS ONE DOI: /journal.pone December 22, / 17 45

46 The Effect of 17β-Estradiol on Eisenia fetida Reverse transcription, PCR amplification and agarose gel electrophoresis To obtain cdna, 500 ng of total RNA was subjected to reverse transcription polymerase chain reaction (RT-PCR) using the High Capacity cdna Reverse Transcription Kit (Life Technologies, Carlsbad, CA, USA) and random hexamer primers. The following reaction profile was used: 25 C for 10 min, 37 C for 120 min and 85 C for 5 min. The obtained cdna was diluted five times and subsequently used as a template for the amplification of MT, pcs, GPx, and β-actin gene fragments. The Taq polymerase chain reaction kit was purchased from New England BioLabs (Ipswich, MA, USA) and the PCR reaction mixture (25 μl) comprised 5 μl of cdna, 1 standard Taq reaction buffer, 0.2 μm of each deoxynucleotide, 0.4 μm of each primer and 1 U of Taq DNA polymerase. The PCR reaction was performed using a Mastercycler Ep realplex4 (Eppendorf AG, Hamburg, Germany) with the following thermal profile: initial denaturation at 95 C for 4 min; 25 cycles of denaturation at 95 C for 30 s, annealing at 55 C for 30 s and extension at 72 C for 30 s; with the final extension at 72 C for 7 min. The DNA fragments were confirmed through electrophoresis on a 1.5% agarose gel. The intensity of the bands was quantified using Molecular Imaging software (Bruker Corporation, Billerica, MA, USA). The primers for PCR were synthesized using the synthesizer Expedite 8908 (Applied Biosystems, Waltham, MA, USA) with the sequences shown in Table 2. Preparation of samples for the detection of MT, GSH/GSSG, 4-OHE 2 /E 2 and E 2 /(E 2 )-3,4-Q The E. fetida were frozen in liquid nitrogen and disrupted. The frozen samples were further homogenized using an Ultra-Turrax T8 homogenizer (IKA, Staufen, Germany). Subsequently, 1 ml of 0.2 M phosphate buffer (ph = 7.0) was added, and the samples were homogenized for another 5 min. The homogenates were centrifuged (16,000 g, 15 min, 4 C) using an Eppendorf 5402 microcentrifuge (Eppendorf, Hamburg, Germany). The supernatant was further filtered through a membrane filter (0.45-μm nylon filter disk, Millipore, Billerica, MA, USA). The 4-OHE 2 /E 2 and E 2 /(E 2 )-3,4-Q ratio was determined in the E. fetida homogenates using a matrix-maldi-tof/tof mass spectrometer (Bruker ultraflextreme (Bruker Daltonik, GmbH, Bremen, Germany). The matrix used for the analyses was α-cyano-4-hydroxycinnamic acid (HCCA) with the addition of ammonium citrate (0.8 mg in 100 μl of water). The spectra were typically acquired from the average of 20 subspectra from a total of 500 shots of the laser. Prior to the analysis of glutathiones and phytochelatins, the samples were enriched with 10% trifluoroacetic acid (ratio 1:1). Subsequently, the mixtures were centrifuged (4 C, 25,000 g, 20 min) using an Eppendorf 5402 microcentrifuge, and the supernatant was employed for HPLC-ED measurements. For the determination of metallothionein, 1 ml of sample was denatured at 99 C for 20 min in a Thermomixer comfort (Eppendorf, Hamburg, Germany) and centrifuged for 10 min (Eppendorf 5402 microcentrifuge) to remove high-abundance proteins and peptides. Quantification of free radicals and total protein content Free radicals were quantified using the chlorophyllin assay (Free Radicals kit, Sevapharma, Prague, Czech Republic) as previously described [40]. The total protein content was determined for standardization, performed using a SKALAB CBT 600T kit (Skalab, Svitavy, Czech Republic) according to the manufacturer's instructions. For both analyses, a BS-400 automated spectrophotometer (Mindray, Schenzhen, China) was employed. PLOS ONE DOI: /journal.pone December 22, / 17 46

47 The Effect of 17β-Estradiol on Eisenia fetida Table 2. Sequences of the primers used for RT-PCR. Gene Abbreviation GenBankAccession no. Primer pair ( )* Amplicon size (bp) Beta-actin β-actin GU TCCATCGTCCACAGAAAG 149 Determination of metallothionein MT was electrochemically quantified using differential pulse voltammetry (DPV) as previously described [41]. Determination of GPx enzymatic activity A Glutathione Peroxidase Cellular Activity Assay Kit (CGP1, Sigma-Aldrich) was employed to determine GPx enzymatic activity. The analyses were performed according to the manufacturer's instructions using a BS-400 automated spectrophotometer (Mindray). HPLC-ED of phytochelatins and glutathiones The antioxidant molecule contents were determined using high performance liquid chromatography coupled with an electrochemical detector (HPLC-ED) as previously described for the analyses of GSH/GSSG [42] and PCs [43]. Histological procedure AAATGTCCTCCGCAAGCT Metallothionein MT GU CGCAAGAGAGGGATCAACTT 190 ACAGCACCCCTTCTTGCAT Phytochelatin synthase pcs EF ATGTCGTGCGGTTCATAACA 201 TCTGCTTGATGGCGTACTTG Glutathione peroxidase GPx GU TCTGCTATCATTCGCGGACT 102 * Upper and lower sequences represent forward and reverse primers, respectively. doi: /journal.pone t002 CTTGGTCGGCATACTGGTTC The samples were fixed in formaldehyde (10%) overnight, subsequently dehydrated in serial ethanol concentrations and embedded in paraffin wax. The sections were cut at 5 μm, mounted onto glass slides, deparaffinized and stained with haematoxylin-eosin. Microscopic observations were performed using an Olympus DP73 microscope (Olympus, Tokyo, Japan). Matrix-assisted laser desorption/ionization imaging mass spectrometry E. fetida sections were mounted onto ITO glass slides (Bruker Daltonik, GmbH), and the slides were scanned using an Epson Perfection V500 scanner (Epson Europe, Amsterdam, Netherland) with a resolution of 2400 DPI. Subsequently, HCCA was prepared (7 mg/ml in 50% acetonitrile and 0.2% trifluoroacetic acid) and sprayed using ImagePrep (Bruker Daltonik, GmbH). The mass spectrometry experiments were performed on a MALDI-TOF/TOF Bruker ultraflextreme mass spectrometer (Bruker Daltonik, GmbH). The scanning raster was set to 50 μm, and prior to each measurement, the mass spectrometer was calibrated using a standard calibration mixture of proteins and peptides (Bruker). For low-mass molecules, imaging mass spectrometry (IMS) was performed in reflectron positive mode, and for metallothioneins the IMS was performed in linear positive mode; both analyses were performed at 45% laser power. The MS spectra were typically acquired after averaging 500 subspectra from a total of 500 laser PLOS ONE DOI: /journal.pone December 22, / 17 47

48 The Effect of 17β-Estradiol on Eisenia fetida shots per raster spot. After analyses, the mass spectra were automatically loaded into flexanalysis and subsequently processed (baseline subtraction). Moreover, IMS figures were prepared after selecting the peaks of interest PC 2 /PC 3,(E 2 )- 3,4-Q, GSSG and MTs. The molecular weights were selected according to the UniProt database ( and processed in a molecular weight + hydrogen ± 0.05% format. Descriptive statistics The mathematical analysis of the data and graphical interpretations were performed using Microsoft Excel 1, Microsoft Word 1 and Microsoft PowerPoint 1. The results are expressed as the mean ± standard deviation unless otherwise noted. Differences between the groups were analysed using paired t-test and ANOVA. Unless noted otherwise, the threshold for significance was p <0.05. Statistica 12 software (StatSoft, Tulsa, OK, USA) was employed for all analyses. Conclusion The results of the present study demonstrated that exposure to E 2 might affect E. fetida with respect to oxidative stress. A significant impact on fundamental ecotoxicological parameters, such as the reproduction rate and biomass production, was observed. The analysis of gene expression and identification of antioxidant molecules revealed that E 2 generates oxidative stress in the cellular microenvironment of E. fetida through antioxidant defence systems, comprising glutathiones and metallothioneins. These mechanisms protect the earthworm against the harmful effects of hormones. These results also showed the presence of three various isoforms of PCS in E. fetida; however, exposure to E 2 decreased the tissue concentration of PCS, reflecting the oxidation of GSH to GSSG. In conclusion, E 2 generated oxidative stress in cells, which do not contain oestrogen receptors, through bioaccumulation and further degradation to redox cycling forms. To further elucidate this phenomenon, metabolomics studies describing the interactions between E 2 and enzyme antioxidants (CAT, SOD) in E. fetida could be performed together with experiments utilizing actual complex soil, where the soil structure and/or other soil biota affect the bioaccumulation and degradation of E 2. Understanding the effects of pollutants from EDCs on soil inhabitants, particularly earthworms, could enhance the potential utilization of these organisms as biomarkers of environmental status. Acknowledgments The authors express their special thanks to Zuzana Lackova, Martina Stankova and Hana Buchtelova for technical assistance. Author Contributions Conceived and designed the experiments: ZH VA MB RK. Performed the experiments: ZH RG PM MK BH NC LR. Analyzed the data: ZH LR VA. Contributed reagents/materials/analysis tools: VA MB RK. Wrote the paper: ZH VA RK. References 1. Benotti MJ, Trenholm RA, Vanderford BJ, Holady JC, Stanford BD, Snyder SA. Pharmaceuticals and Endocrine Disrupting Compounds in US Drinking Water. Environ Sci Technol. 2009; 43(3): doi: /es801845a. WOS: PMID: Kolpin DW, Furlong ET, Meyer MT, Thurman EM, Zaugg SD, Barber LB, et al. Pharmaceuticals, hormones, and other organic wastewater contaminants in US streams, : A national reconnaissance. Environ Sci Technol. 2002; 36(6): doi: /es011055j. WOS: PMID: PLOS ONE DOI: /journal.pone December 22, / 17 48

49 The Effect of 17β-Estradiol on Eisenia fetida 3. Jiang WW, Yan Y, Ma M, Wang DH, Luo Q, Wang ZJ, et al. Assessment of source water contamination by estrogenic disrupting compounds in China. J Environ Sci. 2012; 24(2): doi: /s (11) WOS: Liu R, Zhou JL, Wilding A. Simultaneous determination of endocrine disrupting phenolic compounds and steroids in water by solid-phase extraction-gas chromatography-mass spectrometry. J Chromatogr A. 2004; 1022(1 2): WOS: PMID: Hanselman TA, Graetz DA, Wilkie AC. Manure-borne estrogens as potential environmental contaminants: A review. Environ Sci Technol. 2003; 37(24): doi: /es WOS: PMID: Yu ZQ, Xiao BH, Huang WL, Peng P. Sorption of steroid estrogens to soils and sediments. Environ Toxicol Chem. 2004; 23(3): doi: / WOS: PMID: Colucci MS, Bork H, Topp E. Persistence of estrogenic hormones in agricultural soils: I. 17 beta-estradiol and estrone. J Environ Qual. 2001; 30(6): WOS: PMID: Carr DL, Morse AN, Zak JC, Anderson TA. Biological Degradation of Common Pharmaceuticals and Personal Care Products in Soils with High Water Content. Water Air Soil Pollut. 2011; 217(1 4): doi: /s z. WOS: Bolton JL, Pisha E, Zhang FG, Qiu SX. Role of quinoids in estrogen carcinogenesis. Chem Res Toxicol. 1998; 11(10): doi: /tx WOS: PMID: Vasseur P, Cossu-Leguille C. Linking molecular interactions to consequent effects of persistent organic pollutants (POPs) upon populations. Chemosphere. 2006; 62(7): doi: /j. chemosphere WOS: PMID: Phipps GL, Ankley GT, Benoit DA, Mattson VR. Use of the aquatic oligochaete Lumbriculus-variegatus for assessing the toxicitiy and bioaccumulation of sediment-associated contaminants. Environ Toxicol Chem. 1993; 12(2): WOS:A1993KK OECD. Test No. 222: Earthworm Reproduction Test (Eisenia fetida/eisenia andrei): OECD Publishing. 13. Krajniak KG. Annelid endocrine disruptors and a survey of invertebrate FMRFamide-related peptides. Integr Comp Biol. 2005; 45(1): doi: /icb/ WOS: PMID: Woo S, Won H, Lee A, Yum S. Oxidative stress and gene expression in diverse tissues of Oryzias javanicus exposed to 17 beta-estradiol. Mol Cell Toxicol. 2012; 8(3): doi: /s WOS: Chaki SP, Misro MM, Gautam DK, Kaushik M, Ghosh D, Chainy GB. Estradiol treatment induces testicular oxidative stress and germ cell apoptosis in rats. Apoptosis. 2006; 11(8): doi: / s WOS: PMID: Segner H, Caroll K, Fenske M, Janssen CR, Maack G, Pascoe D, et al. Identification of endocrine-disrupting effects in aquatic vertebrates and invertebrates: report from the European IDEA project. Ecotox Environ Safe. 2003; 54(3): doi: /s (02) WOS: Finlay-Moore O, Hartel PG, Cabrera ML. 17 beta-estradiol and testosterone in soil and runoff from grasslands amended with broiler litter. J Environ Qual. 2000; 29(5): WOS: Markman S, Guschina IA, Barnsley S, Buchanan KL, Pascoe D, Muller CT. Endocrine disrupting chemicals accumulate in earthworms exposed to sewage effluent. Chemosphere. 2007; 70(1): doi: /j.chemosphere WOS: PMID: Muzandu K, Shaban Z, Ishizuka M, Kazusaka A, Fujita S. Nitric oxide enhances catechol estrogeninduced oxidative stress in LNCaP cells. Free Radic Res. 2005; 39(4): doi: / WOS: PMID: Kanda N, Watanabe S. 17 beta-estradiol inhibits oxidative stress-induced apoptosis in keratinocytes by promoting Bcl-2 expression. J Invest Dermatol. 2003; 121(6): doi: /j x. WOS: PMID: Kadota Y, Suzuki S, Ideta S, Fukinbara Y, Kawakami T, Imai H, et al. Enhanced metallothionein gene expression induced by mitochondrial oxidative stress is reduced in phospholipid hydroperoxide glutathione peroxidase-overexpressed cells. Eur J Pharmacol. 2010; 626(2 3): doi: /j. ejphar WOS: PMID: Carelli S, Ceriotti A, Cabibbo A, Fassina G, Ruvo M, Sitia R. Cysteine and glutathione secretion in response to protein disulfide bond formation in the ER. Science. 1997; 277(5332): doi: /science WOS:A1997XV PMID: Devos CHR, Vonk MJ, Vooijs R, Schat H. Glutathione depletion due to copper-induced phytochelatin synthesis causes oxidative stress in Silene cucubalus. Plant Physiol. 1992; 98(3): doi: / pp WOS:A1992HL PMID: PLOS ONE DOI: /journal.pone December 22, / 17 49

50 The Effect of 17β-Estradiol on Eisenia fetida 24. Bernard E, Brulle F, Dumez S, Lemiere S, Platel A, Nesslany F, et al. Antioxidant responses of Annelids, Brassicaceae and Fabaceae to pollutants: a review. Ecotox Environ Safe. 2015; 114: doi: /j.ecoenv WOS: Homa J, Olchawa E, Sturzenbaum SR, Morgan AJ, Plytycz B. Early-phase immunodetection of metallothionein and heat shock proteins in extruded earthworm coelomocytes after dermal exposure to metal ions. Environ Pollut. 2005; 135(2): doi: /j.envpol WOS: PMID: Sato M, Kondoh M. Recent studies on metallothionein: Protection against toxicity of heavy metals and oxygen free radicals. Tohoku J Exp Med. 2002; 196(1):9 22. doi: /tjem WOS: PMID: Asselman J, Glaholt SP, Smith Z, Smagghe G, Janssen CR, Colbourne JK, et al. Functional characterization of four metallothionein genes in Daphnia pulex exposed to environmental stressors. Aquat Toxicol. 2012; 110: doi: /j.aquatox WOS: PMID: Demuynck S, Grumiaux F, Mottler V, Schikorski D, Lemiere S, Lepretre A. Cd/Zn exposure interactions on metallothionein response in Eisenia fetida (Annelida, Oligochaeta). Comp Biochem Physiol C-Toxicol Pharmacol. 2007; 145(4): doi: /j.cbpc WOS: PMID: Owen JB, Butterfield DA. Measurement of oxidized/reduced glutathione ratio. In: Bross P, Gregersen N, editors. Protein misfolding and cellular stress in disease and aging. Methods in Molecular Biology. 648: Humana Press; p Hughes SL, Bundy JG, Want EJ, Kille P, Sturzenbaum SR. The Metabolomic Responses of Caenorhabditis elegans to Cadmium Are Largely Independent of Metallothionein Status, but Dominated by Changes in Cystathionine and Phytochelatins. J Proteome Res. 2009; 8(7): doi: / pr WOS: PMID: Liebeke M, Garcia-Perez I, Anderson CJ, Lawlor AJ, Bennett MH, Morris CA, et al. Earthworms produce phytochelatins in response to arsenic. PLoS One. 2013; 8(11):1 13. e81271 doi: /journal. pone WOS: Brulle F, Cocquerelle C, Wamalah AN, Morgan AJ, Kille P, Lepretre A, et al. cdna cloning and expression analysis of Eisenia fetida (Annelida: Oligochaeta) phytochelatin synthase under cadmium exposure. Ecotox Environ Safe. 2008; 71(1): doi: /j.ecoenv WOS: Gruber C, Sturzenbaum S, Gehrig P, Sack R, Hunziker P, Berger B, et al. Isolation and characterization of a self-sufficient one-domain protein (Cd)-metallothionein from Eisenia foetida. Eur J Biochem. 2000; 267(2): doi: /j x. WOS: PMID: Heger Z, Zitka O, Krizkova S, Beklova M, Kizek R, Adam V. Molecular biology of beta-estradiol-estrogen receptor complex binding to estrogen response element and the effect on cell proliferation. Neuroendocrinol Lett. 2013; 34: WOS: PMID: Keay J, Thornton JW. Hormone-Activated Estrogen Receptors in Annelid Invertebrates: Implications for Evolution and Endocrine Disruption. Endocrinology. 2009; 150(4): doi: /en WOS: PMID: Oren I, Fleishman SJ, Kessel A, Ben-Tal N. Free diffusion of steroid hormones across biomembranes: a simplex search with implicit solvent model calculations. Biophys J. 2004; 87(2): doi: / biophysj WOS: PMID: Zhang W, Song YF, Gong P, Sun TH, Zhou QX, Liu M. Earthworm cytochrome P450 determination and application as a biomarker for diagnosing PAH exposure. J Environ Monit. 2006; 8(9): doi: /b605450a. WOS: PMID: Thomas MP, Potter BVL. The structural biology of oestrogen metabolism. J Steroid Biochem Mol Biol. 2013; 137: doi: /j.jsbmb WOS: PMID: Kassim R, Ramseyer C, Enescu M. Oxidation reactivity of zinc-cysteine clusters in metallothionein. J Biol Inorg Chem. 2013; 18(3): doi: /s WOS: PMID: Sochor J, Ryvolova M, Krystofova O, Salas P, Hubalek J, Adam V, et al. Fully Automated Spectrometric Protocols for Determination of Antioxidant Activity: Advantages and Disadvantages. Molecules. 2010; 15(12): doi: /molecules WOS: PMID: Heger Z, Gumulec J, Cernei N, Tmejova K, Kopel P, Balvan J, et al. 17 beta-estradiol-containing liposomes as a novel delivery system for the antisense therapy of ER-positive breast cancer: an in vitro study on the MCF-7 cell line. Oncol Rep. 2015; 33(2): doi: /or WOS: PMID: PLOS ONE DOI: /journal.pone December 22, / 17 50

51 The Effect of 17β-Estradiol on Eisenia fetida 42. Kominkova M, Michalek P, Cihalova K, Guran R, Cernei N, Nejdl L, et al. Study of linkage between glutathione pathway and the antibiotic resistance of Escherichia coli from patients swabs. Int J Mol Sci. 2015; 16(4): doi: /ijms PMID: Krystofova O, Sochor J, Zitka O, Babula P, Kudrle V, Adam V, et al. Effect of magnetic nanoparticles on tobacco by-2 cell suspension culture. Int J Environ Res Public Health. 2013; 10(1): doi: / ijerph WOS: PLOS ONE DOI: /journal.pone December 22, / 17 51

52 5.2 Vědecký článek II Heger, Z.; Polanska, H.; Rodrigo, M. A. M.; Guran, R.; Kulich, P.; Kopel, P.; Masarik, M.; Eckschlager, T.; Stiborova, M.; Kizek, R.; Adam, V., Prostate tumor attenuation in the nu/nu murine model due to anti-sarcosine antibodies in folate-targeted liposomes. Scientific Reports 2016, roč. 6, Dostupné z: Celkový podíl autora Guran R.: 25 %. Nádor prostaty byl v roce 2013 nejčastějším typem nádorů u mužů v USA [117]. I když existují rozsáhlé informace o genových a proteinových expresích u nádorů prostaty, tak stále nejsou úplně objasněny metabolické změny. Jako jeden ze slibných biomarkerů je studován sarkosin (N-methylglycin), meziprodukt / vedlejší produkt metabolismu glycinu. Byla zjištěna jeho vyšší koncentrace v moči pacientů s lokalizovanými nádory prostaty i s metastázemi [118]. Potvrdilo se také, že sarkosin ovlivňuje redoxní stav prostatických PC-3 buněk [119]. Cílem této publikace bylo aplikovat připravené liposomy, modifikované kyselinou listovou pro cílení na folátové receptory, s uzavřenými anti-sarkosinovými protilátkami (antisarabs@lip) nebo sarkosinem (sar@lip), in vivo na myší PC-3 xenografty a zjistit, jak tyto látky ovlivňují růst PC-3 nádorů a genové exprese. Dalším cílem bylo zjistit efekt připravených látek na homeostázi zinku a metalothioneinu. Bylo zjištěno, že aplikace sar@lip signifikantně zvýšila objem a váhu PC-3 nádorů oproti kontrole, kdy byly použity prázdné liposomy. Dále bylo zjištěno, že aplikace antisarabs@lip vykázala mírný protinádorový účinek. Byly také detekovány rozdíly v genových expresích a aplikace sar@lip také snížila koncentraci zinečnatých iontů a celkových metalothioneinů (MT). Díky MALDI-TOF MSI byla zjištěna prostorová distribuce metalothioneinu MT1X. Nejnižší průměrná intenzita píku MT1X byla zjištěna u řezu nádoru po aplikaci sar@lip, což bylo potvrzeno i elektrochemickou analýzou MT. Po aplikaci antisarabs@lip byla průměrná exprese MT1X zvýšena. To potvrzuje, že sarkosin pravděpodobně hraje důležitou roli v metabolismu nádoru prostaty a může sloužit jako potenciální biomarker. 52

53 OPEN received: 11 April 2016 accepted: 25 August 2016 Published: 20 September 2016 Prostate tumor attenuation in the nu/nu murine model due to antisarcosine antibodies in folatetargeted liposomes Zbynek Heger 1,2, Hana Polanska 1,3, Miguel Angel Merlos Rodrigo 1,2, Roman Guran 1,2, Pavel Kulich 4, Pavel Kopel 1,2, Michal Masarik 1,3, Tomas Eckschlager 5, Marie Stiborova 6, Rene Kizek 1,2 & Vojtech Adam 1,2 Herein, we describe the preparation of liposomes with folate-targeting properties for the encapsulation of anti-sarcosine antibodies and sarcosine The competitive inhibitory effects of exogenously added folic acid supported the role of folate targeting in liposome internalization. We examined the effects of repeated administration on mice PC-3 xenografts. treatment significantly increased tumor volume and weight compared to controls treated with empty liposomes. Moreover, administration exhibited a mild antitumor effect. We also identified differences in gene expression patterns post-treatment. Furthermore, Sar@LIP treatment resulted in decreased amounts of tumor zinc ions and total metallothioneins. Examination of the spatial distribution across the tumor sections revealed a sarcosine-related decline of the MT1X isoform within the marginal regions but an elevation after antisarabs@lip administration. Our exploratory results demonstrate the importance of sarcosine as an oncometabolite in PCa. Moreover, we have shown that sarcosine can be a potential target for anticancer strategies in management of PCa. Prostate cancer (PCa) was the most common cause of cancer in men in the USA in 2013, afflicting one in nine men over the age of Distinct sets of genes, proteins, and metabolites orchestrate cancer progression from a precursor lesion to localized disease and finally to metastatic cancer 2. However, despite a broad knowledge of gene/protein expression profiles in PCa, complex metabolomic alterations are still not yet understood. PCa-specific metabolites can be effective targets that are exploitable in not only early diagnostics but also in the enhancement of therapeutic possibilities. In 2009, Sreekumar and coworkers discovered that the urinary level of sarcosine (N-methylglycine), an intermediate by-product of glycine synthesis and degradation, increased within the localized PCa and metastatic PCa cohorts 3. Although the linkage of sarcosine with PCa development 4 6 and its potential in the diagnosis of early-stage tumors have been reported 7, its use as a biomarker is still unclear 8. Khan et al. demonstrated that addition of sarcosine induced invasion and intravasation in an in vivo PCa model 9. Their comprehensive study of sarcosine-related enzymes shed light on sarcosine as a substantial PCa oncometabolite that can impact the oncogenic potential of prostate cells. Similarly, our in vitro pilot study revealed that sarcosine supplementation affects the redox status of PC-3 cells 10. Hence, we used our anti-sarcosine antibodies (antisarabs), whose immunoperformance was tested in ref. 11, as cargo for liposomal nanotransporters (antisarabs@lip) to promote the internalization of these antibodies into intracellular regions and the subsequent neutralization of sarcosine. To increase the liposomal shuttling efficiency, the outer surface was modified with folic acid (FA) 12. This Trojan horse 1 Central European Institute of Technology, Brno University of Technology, Purkynova 123, CZ Brno, Czech Republic. 2 Department of Chemistry and Biochemistry, Mendel University in Brno, Zemedelska 1, CZ Brno, Czech Republic. 3 Department of Pathological Physiology, Faculty of Medicine, Masaryk University, Kamenice 5, Brno CZ , Czech Republic. 4 Department of Chemistry and Toxicology, Veterinary Research Institute, Hudcova 296/70, CZ Brno, Czech Republic. 5 Department of Pediatric Hematology and Oncology, 2nd Faculty of Medicine, Charles University, and University Hospital Motol, V Uvalu 84, CZ Prague 5, Czech Republic. 6 Department of Biochemistry, Faculty of Science, Charles University, Albertov 2030, CZ Prague 2, Czech Republic. Correspondence and requests for materials should be addressed to V.A. ( vojtech.adam@mendelu.cz) Scientific Reports 6:33379 DOI: /srep

54 Carrier Cargo LE% SD FA- Liposomes Sarcosine antisarabs Table 1. Loading efficiencies (LE%) of sarcosine and antisarabs in folate-targeted liposomes. Values are expressed as the mean of three independent replicates (n = 3). Figure 1. Characterization of FA-modified liposomal formulations of sarcosine and antisarabs. (A) TEM micrograph (length of scale bar is 50 nm) and (B) dynamic light scattering analyzed in PBS, ph 7.4, with corresponding ζ potential inserted. (C) UV-Vis absorption spectrum of antisarabs-bearing liposomes (λ = 270 nm corresponds to encapsulated antisarabs, and λ = 365 nm corresponds to surface modification with FA) with the inserted photoluminescence spectra of liposomes before and after modification with FA (λ exc = 360 nm). (D) Time dependence of the cellular uptake of QD-labeled antisarabs@lip into PC-3 cells obtained via inverted fluorescence microscopy (length of scale bar is 200 μ m). Cells were incubated with 10 μ M QD-labeled antisarabs@lip. (E) Competitive inhibitory effects in PC-3 cells. Values represent the mean ± SD of three experiments. Asterisks indicate significant differences (p < 0.05). process performed through FA-folate receptor affinity promotes cellular uptake via clathrin-mediated endocytosis, which enables the passage of larger objects (including liposomes) across cellular membranes 13. The main objective of our study was to determine whether the administration of antisarabs and sarcosine liposomal formulations affected PC-3 xenografts in terms of tumor growth and gene expression patterns to obtain insight into the uncertain role of sarcosine in PCa development. To enhance the uptake into prostate tumor tissue, we utilized FA-targeted liposomes, which enabled us to investigate sarcosine-related cellular issues in highly specific way. A special emphasis was placed on the administration effects on a key regulatory factor in the intermediary metabolism of prostate cells (zinc) and a substantial transporter protein involved in zinc homeostasis (metallothioneins, MTs). Results Characterization and in vitro intracellular uptake of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) liposomes. Liposomal sarcosine and antisarabs were produced using the lipidic thin-film hydration method 14 as well as control liposomes without cargo (hereinafter denoted as No cargo). Subsequent surface modification with FA was achieved through an esterification reaction using the zero-length linker 1,1 -carbonyldiimidazole (CDI). Table 1 demonstrates the relatively high yields of encapsulation for both types of cargos [loading efficiency (LE) 78.9% for sarcosine, LE 56.2% for antisarabs]. Transmission electron microscopy (TEM) observations revealed spherical multilamellar vesicles (Fig. 1A) averaging 172 nm in diameter (Fig. 1B). FA-modified liposomes exhibited ζ potential + 22 mv. Successful surface modification was confirmed using optical methods (Fig. 1C). The absorption spectra of antisarabs@lip revealed two absorption maxima, one due to the presence of encapsulated antibodies (λ = 280 nm) and one due to FA (λ = 365 nm). Liposome suspensions exhibited the characteristic fluorescence emission peaks of FA (insert in Fig. 1C), suggesting successful coating of FA molecules onto the liposome surfaces. Scientific Reports 6:33379 DOI: /srep

55 Figure 2. In vivo antitumor efficacy of liposomal formulations in PC-3 tumor xenografts. (A) Average tumor volume in nude mice bearing subcutaneous PC-3 tumors. Arrows indicate the time of therapeutic injections (i.p.). (B) Average tumor weight at the endpoint of the experiment. Inserted are chosen photographs of PC-3 tumors after termination. Values are expressed as the mean of five independent replicates (n = 5). Vertical bars indicate standard error. Asterisks indicate significant differences (p < 0.05) compared to the group treated with empty liposomes. In vitro cellular uptake experiments were performed using human prostate cancer PC-3 cells, which overexpress folate receptors 15,16. The uptake of quantum dots (QD)-labeled antisarabs@lip was evaluated over time (0 12 h) and is shown in Fig. 1D. After 6 h of incubation, the fluorescence considerably increased, and high uptake was also measured after 12 h of incubation, demonstrating that liposomes interacted with PC-3 cells. The uptake of substances into cells via folate receptors is reduced in the presence of excess amounts of FA due to competitive inhibitory effects. Hence, to ascertain that liposomes were indeed internalized through folate targeting, we assessed the cellular uptake of QD-labeled antisarabs@lip in the presence of FA, and the results from this assay are illustrated in Fig. 1E. The cellular uptake of QD-labeled antisarabs@lip was significantly reduced in PC-3 cells as the FA concentration increased. Thus, our results indicate the important role of folate receptors in the cellular uptake of our liposomal formulations in PC-3 cancer cells. In vivo effects of antisarabs@lip and sar@lip on PC-3 xenografts. Treatment of mice PC-3 xenografts with various formulations of liposomes began when the tumor volume reached approximately 30 mm 3 and was considered the first treatment day. The mice in all experimental groups were administered treatments nine times by intraperitoneal injection for 35 days. The tumor growth time profile obtained by measuring the tumor diameter in the test animals twice per week is presented in Fig. 2A. Treatment with sar@lip remarkably enhanced tumor growth from approximately the 7 th day of administration. In contrast, antisarabs@lip administration showed moderate antitumor activity. Tumor weight was calculated to evaluate the impact on tumors and is shown in Fig. 2B. Administration of antisarabs@lip led to the inhibition of tumor weight by 32.5%. Notably, the mean weight of the excised tumors was approximately 71.4% higher in mice treated with sar@lip than in mice treated with empty liposomes (No cargo). No mice died or had to be euthanized before the endpoint of the experiment, and administration did not cause significant differences in mouse weight. Gene expression patterns and apoptosis in excised tumors. To understand the gene expression patterns, we performed electrochemical microarray analyses of RNA isolated from tumor tissues. We compared the effects of both administration types with the expression patterns of PC-3 xenografts treated with empty liposomes (complete array heatmaps are depicted in Supplementary Figure 1, together with a control expression heatmap of benign prostate PNT1A cells). The Venn diagram in Fig. 3A illustrates that the administration of sar@lip and antisarabs@lip resulted in significant differential expression patterns, with only 17 overlapping genes up-regulated as a result of treatment with either sar@lip or antisarabs@lip. The other (n = 121 and n = 118, respectively) up-regulated genes were uniquely connected to individual treatments. The complete lists of up- and down-regulated genes and their relative expression levels are shown in Supplementary Tables 2 and 3. Furthermore, we highlighted 12 genes that were specific to any aspect of PCa (Fig. 3B). Most (n = 10) were significantly up-regulated by the presence of exogenously added liposomal sarcosine (p < 0.05). In contrast, antisarabs@ LIP administration led to the up-regulation of only two of these genes (KLK3 [kallikrein 3] and pro-apoptotic BAX [Bcl2-associated X protein) and, moreover, caused significant down-regulation of GAB2 (growth factor receptor-bound protein 2 (GRB2)-associated binding protein 2). The annotation analysis from GoMiner indicated that some of those genes, including CCND1 (cyclin D1, alpha polypeptide), BAX, TEGT (transmembrane BAX inhibitor motif containing 6), E2F3 (E2F transcription factor 3) or PDGFRB (platelet-derived growth factor receptor, beta polypeptide), were related to the positive regulation of cell proliferation and apoptosis. Noteworthy, sar@lip induced the up-regulation of SLC43A1 (solute carrier family 43, member 1), whose major role is amino acid transport and the supply of nutrients into cancer cells. We further detected the apoptosis-related proteins in excised xenografts. Figure 3C demonstrates that antisarabs@lip treatment slightly increased the amount of cleaved caspase-3 when compared to sar@lip administration, which is in agreement with the expression of pro-apoptotic BAX. Scientific Reports 6:33379 DOI: /srep

56 Figure 3. Effects of administration on the gene expression patterns. (A) Venn diagram showing the overlapping genes that were up-regulated after both types of administration. (B) Representation of the relative expression levels of genes specific to any aspect of PC, which were significantly up- or down-regulated in posttreatment tumor tissues. GAB2 Growth factor receptor-bound protein 2 (GRB2)-associated binding protein 2; SLC43A1 Solute carrier family 43, member 1; KLK3 Kallikrein 3 (prostate-specific antigen) PSA; KLK4 Kallikrein 4 (prostase, enamel matrix, prostate); CCND1 Cyclin D1, alpha polypeptide; TCF7 Transcription factor 7 (T-cell specific, HMG-box); PART1 Prostate androgen regulated transcript 1; PSCA Prostate stem cell antigen; E2F3 E2F transcription factor 3; PDGFRB Platelet-derived growth factor receptor, beta polypeptide; BAX Bcl2-associated X protein, TEGT Transmembrane BAX inhibitor motif containing 6. Values are expressed as the mean of three independent replicates (n = 3). Vertical bars indicate standard error. Asterisks indicate significant differences (p < 0.05) compared to the group treated with empty liposomes. (C) Western blot analysis for the xenografts expression of caspase-3 and cleaved caspase-3. Zinc and MT content in tumor tissue. Zinc homeostasis maintains physiological conditions in PCa, and zinc levels are significantly diminished in cancerous tissue (Fig. 4A). Thus, we determined the zinc levels in excised tumors. Figure 4B illustrates that sar@lip administration significantly decreased the amount of zinc in tumor tissue (mean of 14.3 μ g/g compared to 23.2 μ g/g in mice treated with empty liposomes). In contrast, treatment with antisarabs@lip did not alter zinc levels in tumor tissue. Zn regulation is partially performed through MT proteins. Thus, we focused on the expression profiles of mrnas encoding three isoforms of MT (1B, 1X and M). Figure 4C indicates that only antisarabs@lip administration significantly up-regulated MT1X and MTM mrna expression levels (p < 0.05). To further elucidate the disparities in MT levels in tumor tissue after the treatments, we performed electrochemical examination by differential pulse voltammetry utilizing Brdicka s solution as an electrolyte. Because the MTs exhibit exceptional thermal stability, tumor homogenates were denatured and filtered to remove undesired interfering particles. Figure 4D demonstrates that voltammetry partially supported the results obtained using microarray and that antisarabs@lip administration elevated the MT content to 35.3 μ g/g compared to mice treated with empty liposomes (mean 30.3 μ g/g). In contrast, sar@lip treatment significantly decreased MT content in xenograft tumors (mean 13.6 μ g/g). Overall, our results indicate a plausible linkage between sarcosine metabolism and metal homeostasis in PCa. Examination of tumor cross-sections. We further visualized molecules using imaging mass spectrometry (IMS). Figure 5 shows the images that were first obtained by performing matrix-assisted laser/desorption ionization (MALDI)-IMS and a hematoxylin and eosin (H&E) staining of the tumor section. The tumor specimens stained by H&E were ascertained by microscopic examination, which revealed no observable histological changes in the control and post-treatment excised tumor xenografts (Fig. 5A C). Figure 5Aa Cd depicts typical images that were obtained from MALDI-IMS and were used to visualize the distribution of predominant peaks (m/z 4484 Da, m/z 7207 Da and m/z Da) determined in the mean mass spectra represented in Fig. 5Ae Ce. Generally, our treatment protocol did not result in expression pattern changes. However, our treatment protocol did affect the intensities of chosen peaks. The highest differences were found in the case of m/z 7207 Da after sar@lip administration, with a substantially reduced ion signal compared to empty liposomes and antisarabs@lip. The spatial distribution was relatively homogenous, except for the margins of tumors treated with sar@lip, where the ion signal was nearly lost. AntisarAbs@LIP treatment resulted in elevated signal at the margins. Subsequent on-tissue digestion resulted in the successful identification of three predominant peaks as follows: m/z Da corresponded Scientific Reports 6:33379 DOI: /srep

57 Figure 4. Effect on treatment on tumor zinc and metallothionein content. (A) Schematic depiction of zinc and metallothioneins and their importance in benign and malignant prostate cells. In malignant cells, ZIP transporters are inhibited through the Ras-Raf-Mek-Erk cascade, resulting in a decrease of Zn 2+ ions in the cytosol. This phenomenon, together with Bcl-2 activity, inhibits the pro-apoptotic activity of cytochrome 1 c (CytC) in these cells. MT expression is closely linked to the Zn amount in the intracellular space. (B) Zinc levels in PC- 3 tumors after administration of liposomal sarcosine and antisarabs. (C) Relative expression levels of mrnas encoding different human metallothionein isoforms (1B, 1X and 1M) in tumor tissue after administration of liposomal sarcosine and antisarabs, analyzed using electrochemical microarray. (D) Determination of total MTs using the Brdicka reaction after sample denaturation. Values are expressed as the mean of three independent replicates (n = 3). Vertical bars indicate standard error. Asterisks indicate significant differences (p < 0.05) compared to the group treated with empty liposomes. to beta-defensin 1 (DEFB1, approx. MASCOT score 65.2), m/z Da corresponded to MT isoform 1X (MT1X approx. score 55.0), and m/z Da corresponded to cytochrome b5 (CYB5, approx. score 78.1). Discussion In this study, we demonstrated that FA-modified liposomes are suitable to target cancer cells, as folate receptors are overexpressed in a wide variety of tumors, including PCa 17. We provide evidence that sarcosine plays a substantial role in PCa progression and can be a potential target for the development of novel treatment modalities. PCa remains a leading cause of illness and death among men in the US and Western Europe. Autopsy series have revealed small prostatic carcinomas in up to 29% of men age 30 to 40 years and 64% of men age 60 to 70 years. Moreover, the risk of PCa is 1 in 6, and the risk of death due to metastatic PCa is 1 in Despite these astounding statistics, the mechanism of prostate tumorigenesis is still not well understood, although it appears to be multifactorial. Thus, the rationale of encapsulating sarcosine and antisarabs is primarily to further understand the role of sarcosine as a suspicious oncometabolite important in PCa development. We used a liposomal transporter due to the inability of antibodies to enter the intracellular space, which can occur through the well-described FA-folate receptor interaction 19 21, leading to folate receptor-mediated endocytosis. The encapsulation into the FA-modified liposomes produced stable delivery systems, which enabled highly specific investigation of sarcosine-induced cellular events. We anticipate that exploitation of advanced nanomaterials for research on cancer metabolism can benefit from their exceptional properties, including specificity, prolonged circulation and wide payload spectrum of studied substance. Indeed, our results confirmed interactions between PC-3 cells and our designated nanotransporter in vitro. These were first provided by electrostatics between the negatively charged proteoglycans contained on cellular surfaces and the positively charged liposome surface. Second, folate targeting facilitated the endocytosis of liposomes, as was proved by our competitive inhibitory assay (Fig. 1E). Considering the in vivo tumor microenvironment, the enhanced permeability and retention effects should be taken into account as important mediators of the increased liposome accumulation in the tumor mass 22. As approximations of human disease, animal models of cancer are critical for the understanding of the pivotal mechanisms of cellular transformation and the development of novel antitumor therapies. Therefore, it is Scientific Reports 6:33379 DOI: /srep

58 Figure 5. Administration results in disparities in a spatial distribution of proteins. H&E-stained cross sections of PC-3 xenografts (A) without treatment and after treatment with (B) liposomal antisarabs and (C) liposomal sarcosine. Tumor sections (scale bar = 100 μ m) were (a) scanned and utilized for MALDI-IMS profiling. Normalized pseudo-colored images of the spatial distribution of proteins with m/z values of: (b) 4484 ± 0.25% Da, (c) 7207 ± 0.25% Da and (d) ± 0.25% Da. (e) Mean mass spectrum of spectra obtained from MALDI IMS of PC-3 tumors. DHB was used as a matrix. The conditions used to acquire the MALDI spectra were as follows: 1,600 shots per raster spot, 65% laser energy and spatial resolution of 100 μ m. All treated animals were euthanized 35 days after dosing. The scale bar length for the MALDI-IMS scans is 2 mm. important to have systems that can mimic the tumor biology observed in patients, providing accurate information on the signaling networks and biochemical pathways in the tumor microenvironment 23. The direct addition of sarcosine imparted an invasive phenotype to benign prostate cells, and the number of motile prostate cells was significantly higher upon sarcosine treatment 3. Therefore, in this work, PC-3 cells were grown as xenografts in nude mice as a model for sar@lip and antisarabs@lip administration. We found that sar@lip exerted a dramatic tumor growth-supporting activity, leading to increases in tumor volume and weight. In contrast, antisar- Abs@LIP exerted mild antitumor activity, as shown in Fig. 2A,B. We acknowledge that these findings are in agreement with results published by Khan and coworkers, who reported the substantial role of sarcosine in invasion and intravasation in an in vivo PCa model 9. We believe that these findings portray the importance of sarcosine in PCa progression. Furthermore, we expanded this knowledge to include the possible exploitation of anti-sarcosine antibodies, which caused mild antitumor effects. However, further examination must be performed to distinguish and overcome possible drawbacks, such as their low tissue penetration 24. Sarcosine is produced from glycine by the enzymatic action of glycine-n-methyltransferase (GNMT), which is frequently elevated in localized and metastatic PCa relative to benign tissue 25. However, how the elevated sarcosine levels affect the cellular microenvironment is uncertain. As a first level of organization, we examined the administration-related gene expression patterns of tumors using microarrays, which provided a snapshot of the cell functions and processes of thousands of genes and should yield insights concerning changes in gene expression associated with tumor cellular dysfunction and any concomitant regulatory pathways. Gene microarrays revealed the interesting differential expression profiles of a number of cancer-related genes in post-administration analyses. In particular, the c-jun and c-fos proto-oncogenes, MMP2, an independent predictor of decreased PCa survival rates, and CCDN1, a cell cycle progression regulator 26 28, were up-regulated only after sar@lip treatment, illustrating that sarcosine can markedly affect the cellular microenvironment of PCa cells. Within the significantly regulated genes, we further selected those that are associated with any aspect of PCa (Fig. 3B). Noteworthy, GAB2, which encodes the GAB2 scaffolding protein, which serves as a platform for the assembly of signaling systems fundamental for PCa development 29, was significantly down-regulated by antisarabs@lip (p < 0.05). This prevents PCa cells from interactions with signaling molecules, which are vital for tumorigenesis 30. On the contrary, sar@lip treatment induced slight up-regulation of GAB2, which supports its tumor stimulatory role. These findings describe a plausible mechanism for the moderate antitumor activity of antisarabs@lip, together with the capability to up-regulate BAX, encoding Bcl-2-like protein 4, which accelerates programmed cell death through increase of the opening of the mitochondrial voltage-dependent anion channels, which leads to the loss in membrane potential and the release of cytochrome c (Fig. 4A) 31. In contrast, sar@lip induced the up-regulation of a broad spectrum of genes related to the positive induction of cell proliferation (CCND1, E2F3, PDGFRB and TEGT, a described BAX inhibitor), which corresponds to the tumor growth enhancement observed in vivo after sar@lip administration. Interestingly, both types of treatments triggered up-regulation of KLK3, Scientific Reports 6:33379 DOI: /srep

59 which encodes prostate-specific antigen (PSA) - a serine protease produced by epithelial cells in prostate, which represents the gold standard biomarker of PCa 32. We hypothesize that this phenomenon is due to utilization of FA for liposomes surface modification. Tisman and Garcia have demonstrated that FA supplementation is associated with a serum PSA acceleration, while its withdrawal from diet resulted in a significant PSA decline 33. Despite that there is a lack of information describing a stimulation of PSA through FA exploited for folate targeting. Hence, further research is needed to rule out this phenomenon. Proliferative stimuli are highly dependent on metabolic responses. A critical aspect of the re-programming of cancer cell metabolism involves changes in the glycolytic pathway, referred to as the Warburg effect. Glutaminase is a key enzyme involved in the Warburg effect, and its role is to convert glutamine, an amino acid essential for tumor growth, to glutamate 34. In sar@lip, but not in antisarabs@lip-administered tumors, we found significantly up-regulated expression of GLS, which encodes glutaminase. Furthermore, PCa cells overexpress L-type amino acid transporters (LATs) to enhance their nutrient status and to stimulate cell growth 35. Our results also illustrate that sar@lip administration results in significant up-regulation of SLC43A1, which encodes LAT3 proteins. LAT3 can contribute to various signaling pathways, including mammalian target of rapamycin complex 1, implicated in tumorigenesis 36. Our pioneering data highlight the important role of sarcosine in PCa cells. However, the mechanism of action by which sarcosine affects these genes needs to be further investigated. In normal prostate tissue, Zn 2+ ions enter cells via ZIP (Zrt- and Irt-like protein) transporters. Crossing the membranes, zinc induces BAX to form pores in the outer mitochondrial membrane, through which cytochrome c (CytC) is released into the cytosol. CytC then interacts with caspases to cause apoptosis (Fig. 4A). The growth effect of low intracellular zinc levels results from the elimination of the pro-apoptotic effects of zinc. Together with increased energy production, the growth effect promotes transformation into energy-efficient, proliferative, malignant cells. Our data suggest that sar@lip administration is significantly associated with decreased amounts of zinc in tumor tissue (p < 0.05). We anticipate that the disruption of the tight homeostatic control of the cellular zinc level serves as an indicator of the stimulant effects of sarcosine on PCa cells. AntisarAbs@LIP treatment resulted in the partial regression of zinc homeostasis. Thus, sarcosine accumulation and zinc depletion appear to play important roles in PCa development. MTs are intracellular proteins that bind transition metals, including zinc. Hasumi et al. demonstrated that similarly to zinc, decreased levels of MT are associated with PCa 37. Furthermore, zinc treatment up-regulates MT expression. Notably, after antisarabs@lip administration, similar effects were achieved on both the mrna (isoforms 1B; 1X and 1M) and protein levels (total MTs). In contrast, sar@lip significantly decreased the amount of total MT protein but not the transcribed mrna. These results correspond to our preliminary in vitro study with PC-3 cells administered sarcosine 10. The amount of MT was reduced in sarcosine-supplemented cells in a time-dependent manner. Alterations in zinc-metallothionein metabolism are described as the early signs of PCa progression 38, and our data reveal that sarcosine decreases their amounts in tumor tissue. MT expression is tightly regulated by the intracellular zinc pool through metal-regulatory transcription factor 1. Thus, MT down-regulation is likely linked to decreased zinc, which reflects the proliferative and malignant transformation of the prostate cells. Such a phenomenon should also be reflected in a significant down-regulation of MT-encoding mrna. Nevertheless, it is important to note that we examined only the three basic isoforms of MT1, and many other distinct isoforms have been identified 39. Moreover, the correlation between transcription and translation is affected by a number of factors, including expression rates and protein stability 40. Thus, single-cell analysis with RNA probes and antibodies should be performed to provide detailed insight. Previously, it was shown that zinc biodistribution is not uniform, even in the same anatomical region of the prostate. Leitao and coworkers identified significant differences among transitional and peripheral zones 41. However, to the best of our knowledge, the zinc-mt biodistribution in PCa is not known. Hence, we performed IMS visualization of proteins in the m/z range of 0 20 kda, where MTs are expected. Instead of a number of low-intensity peaks, the three major peaks were detected, where MT isoform 1X was identified. Disparities in MT1X expression reflected the administration type, and the lowest overall intensities were achieved in sar@lip-administered tumors, consistent with our previous electrochemical analyses. Furthermore, the administration-related changes were found mostly in the marginal regions of tumors. One plausible explanation is the enhanced angiogenesis of the margins, causing the accumulation of our designated nanotransporters. Hence, the liposomal formulations act mostly in these regions, significantly affecting prostate tumor progression. Although additional work is necessary to understand the mechanistic basis of sarcosine-induced MT down-regulation, it is apparent that pathological changes in sarcosine metabolism leading to its accumulation in cells can be an important player in prostate tumorigenesis. In conclusion, our exploratory study revealed that sarcosine plays an important role in PCa progression. Sarcosine administration significantly affected genes linked with proliferation and apoptosis, and thus, significantly stimulated in vivo tumor xenograft growth. Treatment with sar@lip decreased the amounts of tumor zinc and MT. However, the mechanistic basis of the sarcosine influence on MT regulation needs to be further investigated. In contrast, using a liposomal formulation of our developed antisarabs, we achieved mild antitumor activity, together with positive regulation of selected pro-apoptotic genes and elevations of tumor zinc and MT. Overall, sarcosine is an important oncometabolite affecting PCa progression. We have shown that sarcosine molecules are suitable targets for the development of biological treatment modalities. Although our antibodies exhibited only moderate antitumor effects, further co-administration with various anticancer drugs should be tested to enhance the treatment efficiency. One option could be exploitation of specific inhibitors of enzymes involved in sarcosine biosynthesis, such as sirna or aptamers. Song and coworkers have shown that sirna knock-down of GNMT in PC-3 and LNCaP cells resulted in apparent decrease in proliferation with simultaneous increase of apoptotic cell counts 42, however the knock-down effect on sarcosine amount was not investigated. Hence a question, whether the antiproliferative effects were due to a decrease in concentrations of intracellular sarcosine remains unanswered and further research is required to shed light into this phenomenon. Scientific Reports 6:33379 DOI: /srep

60 Materials and Methods Chemicals. All reagents for syntheses, standards, and other chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA) in ACS purity, unless otherwise noted. Liposome synthesis and sarcosine and antisarabs encapsulation. Liposomes were prepared following the lipidic thin-film hydration method. Briefly, 100 mg of cholesterol, 100 mg of 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE) and 100 mg of phosphatidylcholine were dissolved in chloroform (4.5 ml). A lipidic film was obtained by rotary evaporation of solvent. The residual chloroform was blown out with nitrogen until a thin film was formed. For encapsulation, 500 μ L of sarcosine (200 μ g/ml) and antisarabs (500 μ g/ml), produced in leghorn hens as described in our previous study 11, was utilized. After addition to the lipidic film (10 mg), the samples were sonicated in an ultrasonic bath (15 min). The sample was then heated on a Biosan Thermo Shaker TS-100C (Biosan, Riga, Latvia) for 15 min at 60 C. After cooling, FA was poured, followed by the addition of 1,1 -carbonyldiimidazole (CDI) (the molar ratio of CDI to FA was 1:1). The samples were shaken on a thermoshaker for 2 h. Finally, the liposomes were filtered using Amicon Ultra 0.5 ml centrifugal filters (Merck Millipore, Billerica, MA, USA) to remove unbound residual impurities. Transmission electron microscopy (TEM). Liposomes were suspended within a drop of MilliQ purified H 2 O. The resulting suspension was covered with a grid-coated formvar film (Sigma-Aldrich) and carbon (Agar Scientific, Essex, UK). After drying, 2% ammonium molybdate was placed onto the grid, and the excess was dried. Liposomes were examined using a Philips 208 S Morgagni transmission electron microscope (FEI, Brno, Czech Republic) at 18,000 magnification and an accelerating voltage of 80 kv. Determination of the mean hydrodynamic diameter of the liposomal transporter. The liposome hydrodynamic diameters were examined using a Particle Size Analyzer (Zetasizer Nano ZS90, Malvern Instruments, Malvern, UK). Particles were dispersed in phosphate-buffered saline (PBS, 137 mm NaCl, 2.7 mm KCl, 1.4 mm NaH 2 PO 4, and 4.3 mm Na 2 HPO 4, ph 7.4) and were incubated at 25 C for 15 min before the measurement. Optical characterization of liposomes. Absorbance and photoluminescence were examined using a Tecan Infinite 200 PRO multifunctional microplate reader (Tecan, Männedorf, Switzerland) in Costar UV-transparent 96-well microplates with flat bottoms (Corning Inc., Corning, NY, USA). To determine the surface modification, λ exc = 360 nm of FA was used. Determination of loading efficiency in the liposomes. Loading efficiency (LE%) was determined by measuring the concentration of unencapsulated free sarcosine and antisarabs in aqueous medium. For this purpose, 400 μ L of liposomes was centrifuged (10,000 rpm, 15 min, 4 C) in Amicon Ultra 0.5 ml centrifugal filters (Merck Millipore), and the concentration of free sarcosine was quantified using ion-exchange chromatography according to Heger et al. 6. The concentration of free antisarabs was examined using the Bradford assay 43. LE% was estimated with the following formula: (Cargo total Cargo supernatant )/Cargo total 100. Cells. The PC-3 human cell line, established from a grade 4 androgen-independent prostatic adenocarcinoma, was purchased from the Health Protection Agency Culture Collection (Salisbury, UK). The cells were grown in Ham s 12 medium with 7% fetal bovine serum (FBS) supplemented with penicillin (100 U/mL) and streptomycin (0.1 mg/ml). The PNT1A human cell line established by the immortalization of normal adult prostatic epithelial cells by transfection with a plasmid containing the SV40 genome with a defective replication origin was employed as a control model for microarray analyses (S1). The cells were cultured in RPMI-1640 medium with 10% FBS. The cells were maintained at 37 C in a humidified incubator (Sanyo, Moriguchi, Japan) with 5% CO 2. Determination of intracellular uptake of antisarabs@lip. To determine the intracellular uptake, antisarabs were fluorescently labeled with CdTe quantum dots (QDs) through a synthetic heptapeptide HWR linker prior to encapsulation, as described in our previously published studies 11,44. PC-3 cells were seeded onto a plate at a density of cells/well and were incubated for 24 h. Microscopy studies were performed using an Olympus IX 71S8F-3 inverted fluorescence microscope (Olympus, Tokyo, Japan) equipped with an HBO 50 W mercury arc lamp (Osram GmbH, Munich, Germany). The 545 and 580 nm excitation filters and the 610 nm emission filter were utilized. Images were acquired with an Olympus DP73 camera and processed using Stream Basic 1.7 software (Olympus) at a resolution of 1,600 1,200 pixels. To evaluate the competitive inhibitory effects of FA, various FA concentrations (final FA concentrations 2; 8 and 20 mm) were utilized for pre-treatment, followed by subsequent treatment with 10 μ M QD-labeled antisarabs@lip and incubation for 4 h. The cells were then washed with medium, trypsinized and harvested. The median QD fluorescence values were analyzed using a Tecan Infinite 200 PRO multifunctional microplate reader (Tecan, Maennedorf, Switzerland) using λ ex = 500 nm and λ em = 610 nm. Prostate tumor xenograft models. Five-week-old male nude athymic BALB/c nu/nu mice were used for xenograft studies. PC-3 cells ( ) were resuspended in 100 μ L of PBS with 20% Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) and were then implanted subcutaneously into the left flank regions of the mice under general anesthesia (1% Narkamon + 2% Rometar, 0.5 ml/100 g of weight). Growth in tumor volume was recorded using digital calipers, and tumor volumes were calculated using the formula: (π/6) (L W 2 ), where L is the length of tumor and W is the width. The use of the animals followed the European Community Guidelines as Scientific Reports 6:33379 DOI: /srep

61 accepted principles for the use of experimental animals. The experiments were performed with the approval of the Ethics Commission at the Faculty of Medicine, Masaryk University, Brno, Czech Republic. RNA isolation and reverse transcription. Tumors were crushed using a mortar and pestle under liquid nitrogen and were then mixed with 350 μ L of Tissue Lysis Buffer (Roche, Basel, Switzerland) in an Eppendorf tube. After 30 min incubation at 25 C, samples were centrifuged (13,000 g at 20 C for 2 min) using an Eppendorf 5402 microcentrifuge (Eppendorf, Hamburg, Germany). Next, 350 μ L of the lysate supernatant was pipetted into the sample tube, a component of the MagNA Pure Compact RNA Isolation Kit (Roche, Basel, Switzerland). The isolation steps were performed according to the manufacturer s instructions. The concentration of the RNA was quantified using an Infinite M200 PRO (Tecan). The RNA was converted to cdna using a PrimeScript One Step RT-PCR Kit (TaKaRa, Mountain View, CA, USA) with the following reaction profile: 25 C for 10 min, 37 C for 120 min and 85 C for 5 min. The cdna integrity was tested by PCR of β-actin with the following primers: forward 5 -CCTGAACCCTAAGGCCAACC-3 and reverse 5 -GCAATGCCTGGGTACATGGT-3. The resulting DNA fragment (600 bp) was visualized using agarose gel electrophoresis with ethidium bromide staining as previously described by Nejdl et al. 45. Electrochemical microarray analyses. Obtained cdna was biotinylated on its 3 end using the Biotin 3 End DNA Labeling Kit (Thermo Scientific, Waltham, MA, USA) following the manufacturer s instructions. The microarray was performed as previously described by Roth et al. 46. For hybridization, Human Cancer 3711 ElectraSense 4 2k array slides with 1,609 DNA probes (Custom Array, Bothell, WA, USA) were first pre-hybridized for 30 min at 50 C using 6 SSPE (0.9 M NaCl, 60 mm sodium phosphate, 6 mm EDTA), 5 Denhardt s solution and sonicated salmon sperm DNA (100 μ g/ml). Then, hybridization of biotin-labeled cdna was performed at 50 C for 18 h in 6 SSPE and salmon sperm DNA (100 μ g/ml). Array chips were rinsed with low ionic strength 3 SSPET (3 SSPE, 0.05% Tween-20) and PBST (2 phosphate-buffered saline, ph 7.4, 0.1% Tween-20) to remove weakly bound DNA. Subsequently, array chips were blocked with biotin blocking solution for 15 min. Chips were then incubated for 30 min with poly-horseradish peroxidase-streptavidin (1:1,000 in PBS containing 1% BSA and 0.05% Tween-20). Next, chips were rinsed three times with biotin wash solution and 3,3, 5,5 -tetramethylbenzidine (TMB) rinse solution, followed by incubation with TMB substrate. Measurements were performed using the ElectraSense detection kit (Custom Array). All post-hybridization processing steps were performed at 25 C. The expression levels of selected genes were validated through qrt-pcr using SYBR Green I Nucleic Acid Gel Stain (Invitrogen, Waltham, MA, USA) and the primers shown in Supplementary Table 1. Western blot analysis. Tumor tissue for detection of caspase-3, cleaved caspase-3 and β -actin was processed and analyzed according to previously published protocol 47. In brief, after the lysis, 50 μ g of proteins were separated by 12% (w/v) sodium dodecyl sulfate-polyacrylamide gel electrophoresis. After transfer onto polyvinylidene fluoride (PVDF) membranes and blocking with 5% (w/v) skim milk, the primary antibodies (Cell Signaling Technology, Danvers, MA, USA) were added overnight on the shaker at 4 C. Then PVDF membranes were incubated with horseradish peroxidase-conjugated secondary antibodies for 1 h at 25 C. The detection was carried out using 3-aminoethyl-9-carbazole in 0.5 M acetate buffer as substrate. Histological procedures. The samples were fixed in formaldehyde (10%) overnight, subsequently dehydrated in serial ethanol concentrations and embedded in paraffin wax. Sections were cut at 5 μ m, mounted on glass slides, deparaffinized and stained with hematoxylin-eosin. The microscopic observations were conducted using an Olympus IX 71S8F-3 (Olympus, Tokyo, Japan). Matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) imaging mass spectrometry (IMS) and peptide mass fingerprinting (PMF). Sections of excised tumors (thickness 10 μ m) were mounted onto ITO glass slides (Bruker Daltonik, GmbH). Deparaffinization and antigen retrieval were performed according to Casadonte and Caprioli 48. The glass slides were scanned with an Epson Perfection V500 (Epson Europe, Amsterdam, Netherland) with a resolution of 2,400 DPI. Subsequently, 2,5-dihydroxybenzoic acid (DHB) (30 mg/ml in 50% methanol and 0.2% trifluoroacetic acid) was sprayed using an ImagePrep vibrational sprayer system (Bruker Daltonik, GmbH). The experiments were performed on a MALDI-TOF/TOF Bruker ultraflextreme (Bruker Daltonik, GmbH). The scanning raster was set to 100 μ m. Analyses were performed in reflectron positive mode with a laser power of 65%. The mass spectra were typically acquired in the m/z range kda by averaging 1,600 sub spectra from a total of 1,600 laser shots per raster spot. After analyses, the mass spectra were automatically loaded into flexanalysis and processed (baseline subtraction). Pseudo-colored images of spatial distribution were generated using GIMP 2.8 ( Identification of proteins was performed using PMF with in situ trypsin digestion. First, trypsin (0.05 μ g/μ L in water) was deposited to cover the entire tissue surface. Subsequently, DHB (30 mg/ml in 50% methanol and 0.2% trifluoroacetic acid) was deposited using a vibrational sprayer system (Bruker Daltonik, GmbH). Identification of trypsinized proteins was achieved with conventional algorithms using the MASCOT server (Matrix Science, Boston, MA, USA). The following parameters were used for database searches: trypsin was used as the enzyme, zero or one missed cleavage was allowed, taxonomy was set to Homo sapiens, oxidation of methionine or/and N-term acetylation were added as variable modifications, peptide tolerance was set to ± 0.5 Da, and mass values were set as MH +. Preparation of tumor tissue to determine zinc content. Ten milligrams of tumor was digested in nitric acid (65% v/v) and hydrogen peroxide (30 v/v) at a ratio of 7:3 in a Microwave System 3000 (Anton Paar GmbH, Graz, Austria) using a MG-65 rotor. Microwave power was set to 100 W (30 min) at 140 C. Scientific Reports 6:33379 DOI: /srep

62 Atomic absorption spectrometry of zinc. Measurements were performed on a 280Z atomic absorption spectrometer (Agilent, Technologies, Santa Clara, CA, USA) with electrothermal atomization and Zeeman background correction. Zinc was measured on the primary wavelength Zn nm (spectral bandwidth 0.5 nm, lamp current 10 ma) in the presence of a Pd chemical modifier. Preparation of tumor tissue to determine total protein and MT amounts. Tumors were frozen with liquid nitrogen and homogenized using a SONOPLUS mini20 ultrasonic homogenizer (Bandelin Electronic, Berlin, Germany). Subsequently, 1 ml of 0.2 M phosphate buffer (ph, 7.0) was added, and the sample was homogenized for 5 min. The homogenates were further centrifuged using a Microcentrifuge 5417R (Eppendorf, Hamburg, Germany) at 15,000 g, 4 C for 15 min. Finally, the supernatant was filtered through a membrane filter (0.45 μ m nylon filter disk; Millipore, Billerica, MA, USA) and analyzed. Determination of total protein content. The total protein concentrations were utilized for results normalization and were quantified using a SKALAB CBT 600T kit (Skalab, Svitavy, Czech Republic) according to manufacturer instructions with a BS-400 automated spectrophotometer (Mindray, Schenzhen, China). Determination of amount of total MTs. MT was quantified using differential pulse voltammetry (747 VA Stand, connected to a 693 VA processor and 695 Autosampler, Metrohm, Herissau, Switzerland) with the conditions used in our previous study 49. Descriptive statistics. Results are expressed as the mean ± standard deviation unless noted otherwise. Differences between groups were analyzed using the paired t-test and analysis of variance (ANOVA). Unless noted otherwise, the threshold for significance was p < Statistica 12 software (StatSoft, Tulsa, OK, USA) was employed for analyses. References 1. Siegel, R. L., Miller, K. D. & Jemal, A. Cancer Statistics, CA-Cancer J. Clin. 65, 5 29 (2015). 2. Abate-Shen, C. & Shen, M. M. Molecular genetics of prostate cancer. Genes Dev. 14, (2000). 3. Sreekumar, A. et al. Metabolomic profiles delineate potential role for sarcosine in prostate cancer progression. Nature 457, (2009). 4. Cao, D. L. et al. Efforts to resolve the contradictions in early diagnosis of prostate cancer: a comparison of different algorithms of sarcosine in urine. Prostate Cancer Prostatic Dis. 14, (2011). 5. Cao, D. L. et al. A Multiplex Model of Combining Gene-Based, Protein-Based, and Metabolite-Based With Positive and Negative Markers in Urine for the Early Diagnosis of Prostate Cancer. Prostate 71, (2011). 6. Heger, Z. et al. Determination of common urine substances as an assay for improving prostate carcinoma diagnostics. Oncol. Rep. 31, (2014). 7. Lucarelli, G. et al. Serum sarcosine increases the accuracy of prostate cancer detection in patients with total serum PSA less than 4.0?ng/ml. Prostate 72, (2012). 8. Jentzmik, F. et al. Sarcosine in Urine after Digital Rectal Examination Fails as a Marker in Prostate Cancer Detection and Identification of Aggressive Tumours. Eur. Urol. 58, (2010). 9. Khan, A. P. et al. The Role of Sarcosine Metabolism in Prostate Cancer Progression. Neoplasia 15, (2013). 10. Cernei, N. et al. Effect of sarcosine on antioxidant parameters and metallothionein content in the PC-3 prostate cancer cell line. Oncol. Rep. 29, (2013). 11. Heger, Z. et al. Paramagnetic Nanoparticles as a Platform for FRET-Based Sarcosine Picomolar Detection. Sci Rep 5, 1 7 (2015). 12. Leamon, C. P. Folate-targeted drug strategies for the treatment of cancer. Curr. Opin. Investig. Drugs 9, (2008). 13. Pollock, S. et al. Uptake and trafficking of liposomes to the endoplasmic reticulum. Faseb J. 24, (2010). 14. Heger, Z. et al. 17 beta-estradiol-containing liposomes as a novel delivery system for the antisense therapy of ER-positive breast cancer: An in vitro study on the MCF-7 cell line. Oncol. Rep. 33, (2015). 15. Hattori, Y. & Maitani, Y. Folate-linked nanoparticle-mediated suicide gene therapy in human prostate cancer and nasopharyngeal cancer with herpes simplex virus thymidine kinase. Cancer Gene Ther. 12, (2005). 16. Zhao, D. M. et al. Preparation, characterization, and in vitro targeted delivery of folate-decorated paclitaxel-loaded bovine serum albumin nanoparticles. Int. J. Nanomed. 5, (2010). 17. Bahrami, B. et al. Folate-conjugated nanoparticles as a potent therapeutic approach in targeted cancer therapy. Tumor Biol. 36, (2015). 18. Nelson, W. G., De Marzo, A. M. & Isaacs, W. B. Mechanisms of disease: Prostate cancer. N. Engl. J. Med. 349, (2003). 19. Chen, C. et al. Structural basis for molecular recognition of folic acid by folate receptors. Nature 500, (2013). 20. Chaudhury, A. & Das, S. Folate Receptor Targeted Liposomes Encapsulating Anti-Cancer Drugs. Curr. Pharm. Biotechnol. 16, (2015). 21. Sabharanjak, S. & Mayor, S. Folate receptor endocytosis and trafficking. Adv. Drug Deliv. Rev. 56, (2004). 22. Maeda, H. Macromolecular therapeutics in cancer treatment: The EPR effect and beyond. J. Control. Release 164, (2012). 23. Talmadge, J. E., Singh, R. K., Fidler, I. J. & Raz, A. Murine models to evaluate novel and conventional therapeutic strategies for cancer. Am. J. Pathol. 170, (2007). 24. Chames, P., Van Regenmortel, M., Weiss, E. & Baty, D. Therapeutic antibodies: successes, limitations and hopes for the future. Br. J. Pharmacol. 157, (2009). 25. Cernei, N. et al. Sarcosine as a Potential Prostate Cancer Biomarker-A Review. Int. J. Mol. Sci. 14, (2013). 26. Trudel, D., Fradet, Y., Meyer, F., Harel, F. & Tetu, B. Significance of MMP-2 expression in prostate cancer: An immunohistochemical study. Cancer Res. 63, (2003). 27. Peng, B. et al. AP-1 Transcription Factors c-fos and c-jun Mediate GnRH-Induced Cadherin-11 Expression and Trophoblast Cell Invasion. Endocrinology 156, (2015). 28. Kaukoniemi, K. M. et al. Epigenetically altered mir-193b targets cyclin D1 in prostate cancer. Cancer Med. 4, (2015). 29. Adams, S. J., Aydin, I. T. & Celebi, J. T. GAB2-a Scaffolding Protein in Cancer. Mol. Cancer Res. 10, (2012). 30. Ding, C. B., Yu, W. N., Feng, J. H. & Luo, J. M. Structure and function of Gab2 and its role in cancer (Review). Mol. Med. Rep. 12, (2015). 31. Mignard, V., Lalier, L., Paris, F. & Vallette, F. M. Bioactive lipids and the control of Bax pro-apoptotic activity. Cell Death Dis. 5, 1 8 (2014). 32. Schmid, M. et al. The role of biomarkers in the assessment of prostate cancer risk prior to prostate biopsy: Which markers matter and how should they be used? World J. Urol. 32, (2014). Scientific Reports 6:33379 DOI: /srep

63 33. Tisman, G. & Garcia, A. Control of prostate cancer associated with withdrawal of a supplement containing folic acid, L-methyltetrahydrofolate and vitamin B12: a case report. J Med. Case Rep. 5, (2011). 34. Pan, T. J. et al. Elevated expression of glutaminase confers glucose utilization via glutaminolysis in prostate cancer. Biochem. Biophys. Res. Commun. 456, (2015). 35. Wang, Q. et al. Targeting Amino Acid Transport in Metastatic Castration-Resistant Prostate Cancer: Effects on Cell Cycle, Cell Growth, and Tumor Development. JNCI-. Natl. Cancer Inst. 105, (2013). 36. Beauchamp, E. M. & Platanias, L. C. The evolution of the TOR pathway and its role in cancer. Oncogene 32, (2013). 37. Hasumi, M. et al. Regulation of metallothionein and zinc transporter expression in human prostate cancer cells and tissues. Cancer Lett. 200, (2003). 38. Franklin, R. B. et al. hzip1 zinc uptake transporter down regulation and zinc depletion in prostate cancer. Mol. Cancer 4, 1 13 (2005). 39. Heger, Z. et al. Metallothionein as a Scavenger of Free Radicals - New Cardioprotective Therapeutic Agent or Initiator of Tumor Chemoresistance? Current Drug Targets In press (2015). 40. Vogel, C. & Marcotte, E. M. Insights into the regulation of protein abundance from proteomic and transcriptomic analyses. Nat. Rev. Genet. 13, (2012). 41. Leitao, R. G. et al. Study of human prostate spheroids treated with zinc using X ray microfluorescence Ieee International Symposium on Medical Measurements and Applications (Memea) (2014). 42. Song, Y. H., Shiota, M., Kuroiwa, K., Naito, S. & Oda, Y. The important role of glycine N-methyltransferase in the carcinogenesis and progression of prostate cancer. Mod. Pathol. 24, (2011). 43. Bradford, M. M. Rapid and sensitive method for quantification of microgram quantities of protein utilizing principle of protein-dye binding. Anal. Biochem. 72, (1976). 44. Heger, Z. et al. 3D-printed biosensor with poly(dimethylsiloxane) reservoir for magnetic separation and quantum dots-based immunolabeling of metallothionein. Electrophoresis 36, (2015). 45. Nejdl, L. et al. Interaction study of arsenic (III and V) ions with metallothionein gene (MT2A) fragment. Int. J. Biol. Macromol. 72, (2015). 46. Roth, K. M., Peyvan, K., Schwarzkopf, K. R. & Ghindilis, A. Electrochemical detection of short DNA oligomer hybridization using the CombiMatrix ElectraSense Microarray reader. Electroanalysis 18, (2006). 47. Kaushal, V., Herzog, C., Haun, R. S. & Kaushal, G. P. In Caspases, Paracaspases, and Metacaspases: Methods and Protocols Vol Methods in Molecular Biology (eds Bozhkov, P. V. & Salvesen, G.) (Humana Press Inc, 2014). 48. Casadonte, R. & Caprioli, R. M. Proteomic analysis of formalin-fixed paraffin-embedded tissue by MALDI imaging mass spectrometry. Nat. Protoc. 6, (2011). 49. Tmejova, K. et al. Structural effects and nanoparticle size are essential for quantum dots-metallothionein complex formation. Colloid Surf. B-Biointerfaces 134, (2015). Acknowledgements This research was carried out under the project CEITEC 2020 (LQ1601) with financial support from the Ministry of Education, Youth and Sports of the Czech Republic under the National Sustainability Programme II, and The financial support from GACR S is highly acknowledged. The authors wish to thank Renata Kensova, Lukas Richtera and Marketa Kominkova for their excellent technical assistance. Author Contributions Z.H. wrote the manuscript and performed the basic characterization of synthesized liposomes and folate targeting. H.P. treated and euthanized the animals and carried out the tumor excisions and measurements. M.A.M.R. performed electrochemical microarrays and PCR analyses. R.G. carried out MALDI-TOF analyses. P.Ku. performed TEM analyses. P.Ko. carried out whole synthesis of liposomes and quantum dots. M.M. participated on design of study and metallothionein and zinc measurements. T.E., M.S. and R.K. participated on design of study and helped with the results and discussion. V.A. designed experiments, discussed the results and submitted the manuscript. Additional Information Supplementary information accompanies this paper at Competing financial interests: The authors declare no competing financial interests. How to cite this article: Heger, Z. et al. Prostate tumor attenuation in the nu/nu murine model due to anti-sarcosine antibodies in folate-targeted liposomes. Sci. Rep. 6, 33379; doi: /srep33379 (2016). This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit The Author(s) 2016 Scientific Reports 6:33379 DOI: /srep

64 5.3 Vědecký článek III Guran, R.; Vanickova, L.; Horak, V.; Zitka, O.; Adam, V., MALDI MSI of MeLiM melanoma: search for diagnostic protein markers. PLOS ONE 2017 (odesláno do redakce) Celkový podíl autora Guran R.: 65 %. Melanom patří mezi nejagresivnější typy nádorů. Jen v Evropské unii je melanom zodpovědný za 1,2 % všech úmrtí způsobených nádory [120]. Určením změn v expresi proteinů, které nastaly díky přeměně melanocytu přes atypii, dysplazii až nakonec na melanom, lze charakterizovat daný melanom a díky tomu lze pak lépe diagnostikovat a léčit pacienty. Pro charakterizaci proteinových změn mezi normální kůží a melanomem je vhodné použít ověřený zvířecí model, jako jsou MeLiM miniaturní prasata (melanom nesoucí miniaturní prasata z Liběchova). U většiny MeLiM miniaturních prasat se projevuje spontánní regrese melanomů, které mají od narození. Cílem této studie bylo využít vzorky těchto melanomů a zdravé kůže z MeLiM miniaturních prasat pro MALDI-TOF MSI studium rozdílů v proteinových profilech melanomu a zdravé kůže a pro určení signifikantních proteinů, které mohou být potenciálními markery melanomu, případně jeho spontánní regrese. Druhotným cílem studie bylo navázat na naší předchozí publikaci [121], zabývající se studiem prostorové distribuce iontů kovů v melanomech z MeLiM miniaturních prasat, a posoudit možnou korelaci mezi distribucí iontů kovů a proteinů. Nakonec bylo detekováno 10 signifikantních (p < 0.001) m/z píků, které byly rozdílně exprimovány ve zdravé kůži a v melanomu. Byl detekován pík o m/z 6140, který byl signifikantně více exprimován v oblasti normálně rostoucího melanomu (GMT) než v oblastech brzké a pozdní spontánní regrese. To koreluje i se signifikantně vyšší koncentrací zinečnatých iontů ve stejné oblasti melanomu, jak bylo zjištěno v naší dřívější publikaci [121]. Tento pík byl předběžně identifikován jako metalothionein. Byly také tentativně identifikovány proteiny thymosin β-10 a S100-A6. 64

65 MALDI MSI of MeLiM melanoma: search for diagnostic protein markers Roman Guran 1,2, Lucie Vanickova 1, Vratislav Horak 3, Ondrej Zitka 1,2, Vojtech Adam 1,2* 1 Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Brno, Czech Republic 2 Central European Institute of Technology, Brno University of Technology, Brno, Czech Republic 3 Institute of Animal Physiology and Genetics, Academy of Sciences of the Czech Republic, v.v.i., Libechov, Czech Republic * Corresponding author vojtech.adam@mendelu.cz (VA) 65

66 Abstract Background Treatment of advanced cutaneous melanoma is still challenging, and new data on melanoma biology are required. The most widely accepted criteria for the prognostic evaluation of melanoma are histopathological and clinical parameters, and the identification of additional tumor markers is thus of paramount importance. Matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI MSI) plays a key role in cancer research and it is useful to unravel the molecular profile of melanoma. Methodology/Principal findings In this report, we used the Melanoma-bearing Libechov Minipigs, an unique animal model that allows observation of complete spontaneous regression of invasive cutaneous melanoma, to investigate i) differences between melanoma and healthy skin protein profiles and ii) proteins that could be involved in process of spontaneous regression. Multivariate statistical analyses revealed several potential biomarkers obtained from different tumor regions. These ion peaks were used for creation of mass ion images/maps and visualization of differences between tumor and healthy skin specimen. Conclusions/Significance Statistically significant mass ion peaks unique to cutaneous melanoma were determined here. A peak at m/z 6140, tentatively identified as metallothionein, was significantly (p < 0.05) higher expressed in normally growing melanoma regions than in regions with early and late spontaneous regression. Therefore this peak/protein has potential 66

67 to be used as a biomarker of growing melanoma. The study adds to the clinical utility of MALDI MSI for analysis of tissue cryosections at a molecular level. Key Words Melanoma, spontaneous regression, MeLiM, MALDI MSI, SCiLS Lab, PCA Introduction Melanoma remains one of the most aggressive forms of cancer, being responsible for 1.2 % of all cancer deaths in the European Union. Cancerous growth develops when unrepaired DNA damage to skin cells (most often caused by ultraviolet radiation from sunshine or tanning beds) triggers mutations that lead the skin cells to multiply rapidly and form malignant tumors [1]. Cancer cells and/or the surrounding microenvironment generate proteins and peptide of different types and in different concentrations than normal cells during the cancer development [2]. Protein changes associated with the transition from melanocyte to atypia or dysplasia and ultimately to melanoma could be used to aid in diagnosis or to screen high-risk patients. Proteins associated with pathophysiology and malignant properties could be used to further classify melanoma, stratifying patients by risk of recurrence in order to better select surgical and adjuvant treatments [3]. Beyond diagnostic and prognostic value in assessing melanoma progression, these protein signatures may provide valuable insights in the choice of optimal treatment strategies for individual patients. The most widely accepted criteria for the prognostic evaluation of melanoma are histopathological and clinical parameters, and the identification of additional tumor markers is thus of paramount importance. 67

68 Matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI MSI) is a label-free technique for spatially resolved molecular analysis of tissue sections [4, 5]. MALDI MSI has a high potential to support histopathological diagnosis [6], and an increasing research activity is aiming at establishing clinical applications of this technology [7]. Furthermore it is a valuable method for the identification of biomarkers and can complement histology, immunohistochemistry and molecular pathology in various fields of histopathological diagnostics, especially with regard to identification and grading of tumors [8]. Many studies have already demonstrated that MALDI MSI cannot only be used for biomarker discovery [9-11] but, more importantly, also for tumor classification [12, 13] and for the determination of the origin of the primary tumor [14]. Spontaneous animal tumors appear to be highly suitable models to study human oncology and cancer therapy [15]. The Melanoma-bearing Libechov Minipig (MeLiM) strain of miniature pigs with heritable cutaneous melanoma is an original animal cancer model with histopathological, biochemical and molecular biological similarities to human melanoma [16, 17]. The MeLiM strain allows observation of complete spontaneous regression of invasive cutaneous melanoma. Thus, it is an excellent model for search of biomarkers possibly involved in this process. Recent study focused on spatial mapping of metals in histologically specified regions in pig MeLiM melanoma applied laser ablation inductively coupled plasma mass spectrometry (LA ICP MS) [18]. The levels of Zn and Cu in given zones varied suggesting connection with the expression of metal binding proteins such as tyrosinase, Tyrp 2/Dct or metallothioneins [18]. The abnormal distribution of proteins in tissue can be analyzed by MALDI MSI and the patterns may help to identify cancer-specific changes (compared with controls) that may prove to be useful clinically [2]. 68

69 Goal of the present study was to compare the levels of expression of particular proteins/peptides in very small, histologically uniform and mutually distinct zones of melanoma samples, providing an efficient method for monitoring changes in protein levels during the process of spontaneous regression in the MeLiM model. Materials and Methods Materials Sinapinic acid (SA), 2,5-dihydroxybenzoic acid (DHB)and all solvents (HPLC grade) used were purchased from Sigma-Aldrich (St. Louis, MO, USA), unless otherwise noted. Conductive indium-tin oxide (ITO) one-side coated glass slides and peptide and protein calibration standards were purchased from Bruker Daltonik GmbH (Bremen, DE). Sample collection Two MeLiM minipigs (both 10 weeks old) with multiple skin nodular melanomas were used in this pilot experiment. One melanoma was excised from each animal under total anesthesia [premedication with intramuscular (i.m.) atropine 0.5 mg.minipig -1 (Hoechst-Biotika, Slovak Republic), followed by Stresnil 1 mg.kg -1 of body weight (Janssen Pharmaceutica N.V., Belgium) and Narcotan inhalation (Leciva, Czech Republic)]. Vetalgin (0.5 mg.kg -1 of body weight; Intervet International, Germany) was applied i.m. to control pain after tumor excision and wound suturing. This experimental treatment was performed in accordance with the Project of Experiment approved by the Animal Science Committee of the IAPG AS CR, v.v.i. (Libechov, Czech Republic), following the rules of the European Convention for the Care and Use of Laboratory Animals. 69

70 Sample preparation Tissue blocks were prepared following [18]. Serial cryosections (for histology and MALDI MSI) were prepared by Leica CM 1850-Cryostat (Leica, DE). Cryosections for MALDI MSI were mounted onto ITO (indium-tin oxide) glass slides (Bruker Daltonik GmbH, Bremen, DE) and stored at -80 C. Prior analysis, slides were warmed on hand and desiccated in vacuum for 15 min. Then, slides were washed in Coplin jar with grade ethanol (twice in 70% ethanol for 2 min, once in 100% ethanol for 2 min) followed by several washing in the cold ACS grade water (10 short dips) and subsequent washing by ethanol as indicated. Before matrix application samples were dried under vacuum for 15 min and positions of tissue slices were marked by three teaching marks with white pencil corrector. Afterwards, the glass slides were scanned by Epson Perfection V500 Office (Epson Europe B.V., Amsterdam, NL) with resolution 2400 DPI. Histology Haematoxylin-eosin staining was applied to observe tissue structure. Cryosections (8 μm thickness) were fixed with ethanol (20 min), washed with distilled water (three times, 5 min each) and treated with Weigert s haematoxylin (20 min) for nuclei staining. Then, the cryosections were washed with running tap water (20 min), followed by distilled water (three times, 5 min each). The cytoplasm was counterstained with 1% eosin alcoholic solution (1 min). After washing with distilled water (three times, 5 min each), the stained sections were embedded in glycerin jelly. Whole cryosections were scanned by a VS120 Olympus microscope with OlyVIA software (Olympus, Japan). GIMP 2.8 software ( was used to identify three and six histologically different zones of melanoma and healthy skin tissue in 70

71 the scanned pictures, respectively. Three to six rectangular areas of each zone per cryosection were chosen for comparison of protein maps to detect their local contents. Matrix application MALDI matrix was sprayed onto ITO glass slides applying ImagePrep TM standard programs (Bruker Daltonik GmbH, Bremen, DE). Following MALDI matrices were used: 10 mg.ml -1 SA in acetonitrile/water (60:40, v/v) with 0.2% trifluoroacetic acid (TFA) and 30 mg.ml -1 DHB in methanol/water (50:50, v/v) with 0.2% TFA. MALDI matrix mixtures were thoroughly vortexed and ultrasonicated using Bandelin 152 Sonorex Digital 10P ultrasonic bath (Bandelin electronic GmbH, Berlin, DE) for 2 min at 50% intensity at room temperature. The slides were ready for analysis after drying in vacuum desiccator for 15 min. MALDI MSI analysis The mass spectrometry imaging was performed on a MALDI-TOF/TOF mass spectrometer Bruker ultraflextreme (Bruker Daltonik GmbH, Bremen, DE). A total sample set spanned 12 ITO glass slides containing 24 tissue sections. Scanned images of tissue slices were loaded into FlexImaging 3.0 software (Bruker Daltonik GmbH, Bremen, DE) and MALDI adapter with two ITO glass slides was loaded into mass spectrometer. The position of MALDI adapter was taught according to white teaching marks on ITO glass slides. Regions of acquisition were highlighted by mouse pointer in FlexImaging and 50 μm raster width was chosen. Calibration was done externally using a peptide and protein standard mixture in the m/z range 1 20 kda. The intensity of each scan, over the entire mass range acquired, was mapped on the tissue section image, allowing the visualization of the location of each m/z value detected. These images were generated and visualized using SCiLS Lab 2014b software (SCiLS Bruker Daltonik 71

72 GmbH, Bremen, DE). A laser power was set to 85% for SA matrix and 80% for DHB matrix. MALDI MSI of proteins was performed in linear positive mode in the m/z range 1-20 kda. A total of 500 spectra were summed for each spot using the Random Walk raster pattern, with no evaluation criteria. Prior to this study, tissue thickness and laser shots per raster spot were optimized. Sections of various thickness (from 6 to 10 μm), raster of various dimensions (30 30, 50 50, and μm) and different number of laser shots per raster spot (300, 500, 1000 and 1200 laser shots per raster spot) were tested. Spectral processing and statistics MSI data from FlexImaging were converted and uploaded into SCiLS Lab software that was used for pipeline pre-processing, segmentation and statistical analysis, mainly principal component analysis (PCA), Anderson-Darling normality test and Kruskal-Wallis test. The preprocessing pipeline applied baseline removal using the iterative convolution algorithm with Sigma = 20 and iterations = 20. Subsequently, the TIC-normalization was performed to normalize the TIC (Total Ion Current) of every spectrum to one. At the same time, a mean spectrum was calculated. The segmentation pipeline applied resulting spectra group from preprocessing pipeline to find peaks using the orthogonal matching pursuit with Sigma estimated on the mean spectrum. It finds maximally 50 peaks per spectrum and is applied to every 15th spectrum. The consensus threshold is 1 %. Then, a peak alignment is applied on the resulting histogram peak list together with the mean spectrum. Finally, the denoising and segmentation pipeline is applied to the spectra group produced by the preprocessing pipeline and the peak list is produced by the peak alignment. The denoising level is the same as selected in the settings for the segmentation pipeline. 72

73 The Anderson-Darling normality test revealed that the distribution of MSI data was not normal (p < 0.001). Therefore, for all hypothesis tests was used Kruskal-Wallis test. The significance of differences of selected mass peaks intensities between healthy skin and melanoma, between each region of interest (ROI) of healthy skin and between each ROI of melanoma was tested. Principal component analysis (PCA) of MSI data of peaks selected in segmentation pipeline was performed. The spatial features and the spectral features resulting from a PCA were computed through an orthogonal transformation which led to uncorrelated components. The principle components were arranged so that the first principal component had the largest variance, and each succeeding component s variance was smaller than its preceding components. Unit variance scaling was used. Intensity box plot chart conveniently depicts intensities of a given m/z range in spots of a given region through their quartiles. Every box describes a single m/z range and a single region. Every plot consists of two parts, a box part and a cloud part. The box part contains a rectangle divided by a horizontal line, which represents a median intensity. The median intensity is defined such that the amount of spots with lower value than the median intensity is equal to the amount of spots with higher intensity. Lower and upper bounds of the box represent the second and the third quartile, which means that total amount of spots which intensities below these lines are one quarter and three quarters correspondingly. Lines extending vertically from the boxes (whiskers) represents lower and upper quantiles, by default they are 0.0% and 99.0%. The cloud part of the plot shows how spots of a given region are spread by intensity of a given m/z range. Blue dots represent the spots in which intensities of a given m/z range are between lower and upper quantiles. Red dots represent the spots which intensities are outside of these intensity intervals, so-called outliers. 73

74 MSI images preparation Final preparation of MSI images was made in SCiLS Lab. According to PCA and Kruskal- Wallis test, ion peaks with significant variability between melanoma and healthy skin tissues were used for the MSI images creation. Each m/z mass was displayed as m/z ± 1.5 Da. Final corrections and preparations of MALDI MSI images were made in GIMP 2.8. Results MALDI MSI analysis Fresh frozen melanoma tissues from two MeLiM minipigs were analyzed using MALDI MSI and data were compared with match healthy skin tissues stored under the same conditions. The samples were processed using a solvent washing step prior to peptide/protein MSI analysis. The MSI data were then imported into the SCiLS Lab software for post-processing and generation of proteomic profiles and specific ion maps. Tissue thickness of 8 and 10 μm was found to be suitable to obtain good sensitivity and also not influencing variability of a spatial distribution within a tumor. The MSI data were not significantly different whether SA or DHB matrix was used (p < 0.05). The optimal number of laser shots per raster spots was found to be at least 500 and raster spot dimension was μm. A schematic experimental workflow is provided in Fig 1. 74

75 Fig 1. Scheme of MALDI MSI of MeLiM healthy skin/melanoma tissue. Statistical analysis of MALDI MSI spectra MALDI MSI spectra obtained from tissue cryosections were submitted to SCiLS Lab software for comparing the average mass spectra of both tissues (Fig 2A). PCA visualized the variances between melanoma and healthy skin tissue sections and Kruskal-Wallis test revealed a series of significant (p < 0.001) ion peaks that account for the variation (Fig 2B, Table 1). 75

76 Fig 2. A) Average mass spectra and B) PCA scores plot of MeLiM melanoma (blue) and healthy skin (red) tissue cryosections. Table 1. Tentative identification of proteins with significant variation between MeLiM melanoma and healthy skin tissue. m/z Tentative identification Rating Kruskal-Wallis Melanoma Healthy skin 3044 <0.001 * < * Reference 4737 Thymosin beta-10 < * [19] 4967 < * 6011 Metallothionein <0.001 * Metallothionein <0.001 * < * 6985 < * 9258 < * S100-A6 <0.001 * - (*) Higher expression. UniProtKB P

77 Mass ion peaks with m/z 3044, 3458, 4737, 4967, 6011, 6140, 6654, 6985, 9258 and appeared in both MeLiM minipig tissues. These ion peaks have been used to generate MSI images and intensity box plots to visualize the differences between melanoma and healthy skin tissue sections (Fig 3, S1 and S2 Figs). Several mass ion peaks demonstrated distinction between the two types of the tissues and revealed the heterogeneity of melanoma tissue section. In particular, mass ion peaks at m/z 3044, 6011, 6140 and were overexpressed in melanoma and mass ion peaks at m/z 3458, 4737 and 6654 were pronounced in healthy skin tissue (Fig 3, Table 1). Fig 3. MALDI ion images of healthy skin (A) and melanoma (B) tissue from MeLiM minipig cryosections and intensity box plots (C) of particular m/z. Distribution of selected mass ion 77

78 peaks demonstrates the peaks at m/z 3044, 6011 and 6140 were overexpressed in melanoma and peaks at m/z 3458, 4737 and 6654 were pronounced in healthy skin tissue. (***) p < Each melanoma tissue section was split into different regions of interest (ROIs) according to histologically uniform and mutually distinct zones of normally growing melanoma tissue (GMT), early spontaneous regression (ESR) and late spontaneous regression (LSR) (Fig 4A). In the normal skin tissue section following ROIs were assigned epidermis, dermis, hair follicle, sweat gland, subcutaneous adipose tissue and subcutaneous muscle (Fig 4B). The total spectra of these ROIs were used in SCiLS Lab software for PCA and Kruskal-Wallis tests. Ion peaks with high variability were then used for the creation of the ion images and intensity box plots (S1 and S2 Figs). Fig 4. Histology, scan and MSI image of mass ion peak at m/z 6011 with specified regions of differentiated tissue sections (differences between MeLiM melanoma and healthy tissue). A) Three histologically differing zones identified in haematoxylin-eosin stained skin porcine 78

79 melanoma. Red GMT (normally growing melanoma tissue), violet ESR (early spontaneous regression), orange LSR (late spontaneous regression). B) Six regions of interest determined in healthy skin tissue: red epidermis, light blue dermis, violet hair follicle, dark blue sweat gland, orange subcutaneous adipose tissue, green subcutaneous muscle. Scores and loadings plots from PCA of tumor and healthy skin ROIs are presented in Fig 5. The PCA was partially able to differentiate LSR from GMT and ESR regions. Mass ion peak at m/z 3044 was the more distinct along the PC1 whereas the remaining m/z (3458, 4737, 4967, 6011, 6140, 6654, 6985, 9258, and 10180) were separated along the PC2 axis. The first two axes represented 99.51% of the total data variance. To further investigate the differences between the three histologically specified regions within melanoma tissue, Kruskal-Wallis test was applied (S1 Table). Ion peaks at m/z 3044, 3458, 4967 and vary significantly (p < 0.05) between the ESR and LSR regions. When compared GMT with ESR the most variable ion peaks were at m/z 3458 and 6140 while GMT and LSR differed significantly (p < 0.01) in expression of ion peaks at m/z 3044, 3458, 4737, 4967, 6140 and (Fig 5A and S1 Fig). Significant correlations were found between ion peaks at m/z 6011 and 6140 (p < 0.05, r = 0.79) and m/z 6984 and 6653 (p < 0.05, r = 0.72) (S3 Fig). It is probable that m/z peaks 6011 and 6140 belong to the same molecule, and m/z difference 129 could be one glutamic acid molecule. In the healthy skin tissue, PCA revealed separation of subcutaneous muscle (SM) region from those of hair follicle (HF), subcutaneous adipose tissue and dermis (Fig 5B). Ion peaks at m/z 3044, 6011, 6140 and were common for epidermis regions. The first two PC axes counted together for 91.94%. Ion peaks at m/z 3458, 4737, 4967, 6140, 6654, 6985, 9258 and varied significantly (p < 0.001) among the six histologically specified regions 79

80 within the healthy skin tissue. Notably, m/z 6011 did not express significant variation (p 0.05) in the healthy skin tissue (S2 and S3 Table). Fig 5. A) PCA scores and loadings plots of three histologically differentiated regions of the MeLiM melanoma (inset). Red GMT (normally growing melanoma tissue), violet ESR (early spontaneous regression), orange LSR (late spontaneous regression). B) PCA scores and loadings plots of Six regions of interest were determined in healthy skin tissue (inset). Red epidermis, light blue dermis, violet - hair follicle, dark blue sweat gland, orange subcutaneous adipose tissue, green subcutaneous muscle. 80

81 Discussion The protein signatures from melanoma and healthy skin exhibited different characteristics, which is in accordance with the previously published studies. Higher number of the differentially expressed proteins was observed at higher intensity in the healthy skin tissues, whereas a smaller number of proteins with higher intensities were expressed in MeLiM melanoma specimens. In total, ten ion peaks at m/z 3044, 3458, 4737, 4967, 6011, 6140, 6654, 6985, 9258 and were determined here as statistically significant when compared melanoma with healthy skin tissue. Three ion peaks at m/z 3044, 6011 and 6140 were more expressed in melanoma tissue. The molecular weight of cysteine-rich metalbinding proteins, metallothioneins (MTs), is around 6 7 kda, which correlates well with the characteristic mass peaks with m/z 6011 and 6140 observed here in MeLiM melanoma tissues. Furthermore, we found out that the m/z 6140 vary significantly when compared the ESR and LSR with GMT regions. It is overexpressed in GMT region together with m/z 6011 and Moreover, the overexpression of m/z 6011 and 6140 in GMT region is in good conformity with higher content of zinc ions found in the same region in our previous study [18]. These findings support the tentative identification of m/z peaks 6011 and 6140 as metallothionein. It is known that MT expression by tumor cells may have the capacity to increase the development of melanoma resulting in increased survival of tumors, and thus increased carcinogenesis. MT has the capacity to reduce tyrosinase activity and melanogenesis in melanocytes suggesting that the presence of MT prior to tumor initiation may be protective against tumor development [20]. It has been shown that MT overexpression was more significantly associated with tumor progression than the established surgical prognostic test based on 81

82 sentinel lymph node biopsy [21]. Positive correlation between MT expression and tumor thickness, invasive capacity, and higher risk of progression was previously reported [21-23]. Despite the significant potential for tissue-based or serological biomarkers to help diagnose early stage disease, tailor therapy, or detect recurrence, very few biomarkers are in clinical use. Several tissue markers are used to help distinguish melanoma from other types of cancers, including S100, MART-1, and gp100/hmb45. To date, however, there are no tissuebased biomarkers that are utilized clinically for prognostic classification [3]. One of the potential tissue biomarker, specifically expressed in melanoma, could be the cystein-rich metal binding protein, metallothionein (MT). Here we demonstrated that the expression of m/z 6011 positively correlates with the m/z 6140 suggesting the use of those proteins as potential biomarkers of melanoma growth. In histology-directed MALDI MSI profiling of human melanoma lymph node tissue, Hardesty and coworkers identified overexpression of several ion peaks e.g. at m/z 3744, 4737, 8963 or 10625, when compared with cancer-free lymph nodes [19]. They used the top-down approach for the identification of specific proteins that served for determination of the disease stage and inclusion of patients into either poor or favorable group for recurrence and survival. The proteins identified in the signatures were cytochrome c, s100-a6, histone H4 and cleaved forms of thymosin β-4, and thymosin β-10 (TYB-10-2AA). In the present study, the m/z 4737 that probably corresponds with the TYB-10-2AA was overexpressed in healthy skin tissue. The thymosin β proteins sequester actin monomers within the cell, inactivating polymerization until needed. S100 protein family, involved in Ca 2+ homeostasis, regulation of protein phosphorylation, cell growth and proliferation, was previously found to be expressed in early melanoma stages [24, 25]. The molecular weight of S100 proteins is around 10 kda, which 82

83 corresponds with the ion peak at m/z expressed here in ESR and GMT when compared with LSR regions of MeLiM melanoma tissue. A peak at m/z is probably S100-A6 protein according to UniProt database (UniProtKB - P06703). Conclusion This pilot study demonstrates that MALDI-TOF mass spectrometry imaging (MSI) is capable to successfully visualize spatial distribution of various proteins in melanoma and healthy skin tissue from MeLiM pigs. Using suitable MSI statistical software, in our case SCiLS Lab, the significant mass peaks were detected, and the differences between melanoma and healthy skin were visualized. In total, 285 GB of MSI data were statistically processed in considerably shorter time than would be possible using Bruker ClinProTools software that is more suitable for smaller data sets. MeLiM melanoma significantly (p < 0.001) overexpressed mass peaks at m/z 3044, 6011, 6140 and 10180; and MeLiM healthy skin significantly (p < 0.001) overexpressed mass peaks at m/z 3458, 4737, 4967, 6654, 6985 and The occurrence of peaks at m/z 6011 and 6140 correlated significantly (p < 0.05, r = 0.79). The peaks were tentatively identified as metal-binding metallothionein, not only because of molecular weight around 6 kda but also because their overexpression in normally growing melanoma tissue (GMT region). It was in good conformity with higher content of zinc ions found in the same MeLiM tissue region in our previous study [18]. Moreover, the significantly (p < 0.05) higher expression of peak at m/z 6140 in GMT region than in early and late spontaneous regression regions (ESR and LSR) suggests that this protein has potential to be a biomarker for melanoma growth. Peak at m/z was tentatively identified as S100-A6 protein according to the UniProtKB (P06703) 83

84 database. Peak at m/z 4737 was tentatively identified as thymosin beta-10 without two amino acids according to study of Hardesty and coworkers [19]. The exact identification of detected peaks by on-tissue trypsinization followed by MALDI-TOF/TOF analysis using LIFT cell was not feasible because of the limited amount of tissue samples in this pilot study. In future study, we will focus on exact identification of detected peaks either by MALDI-TOF/TOF using LIFT cell, or by extraction of proteins from homogenized melanoma samples and their separation by 2D PAGE and in-gel trypsinization followed by MALDI-TOF/TOF or HPLC-ESI-QqTOF MS. In conclusion, our results contributed to the basic knowledge on protein distribution in histologically specified regions in MeLiM tissues and will be used in further experiments aiming at elucidation of processes involved in the melanoma spontaneous regression. Funding This research has been financially supported by the Ministry of Education, Youth and Sports of the Czech Republic under the project CEITEC 2020 (LQ1601) and the National Sustainability Program (project No. LO1609), and RVO LV was supported by project 6SA17676 which received funding from the European Union s Horizon 2020 research and innovation programme under the Marie Skłodowska-Curie and which is co-financed by the South Moravian Region under grant agreement No

85 Author contributions Conceived and designed the experiments: RG LV OZ VA. Performed the experiments: RG LV VH. Analyzed the data: RG LV. Contributed reagents/materials/analysis tools: VH OZ VA. Wrote the paper: RG LV VH OZ VA. 85

86 References 1. Ferlay J, Steliarova-Foucher E, Lortet-Tieulent J, Rosso S, Coebergh JWW, Comber H, et al. Cancer incidence and mortality patterns in Europe: Estimates for 40 countries in Eur J Cancer. 2013;49(6): doi: /j.ejca PubMed PMID: WOS: Rodrigo MAM, Zitka O, Krizkova S, Moulick A, Adam V, Kizek R. MALDI-TOF MS as evolving cancer diagnostic tool: A review. J Pharm Biomed Anal. 2014;95: doi: /j.jpba PubMed PMID: WOS: Sabel MS, Liu Y, Lubman DM. Proteomics in melanoma biomarker discovery: great potential, many obstacles. International Journal of Proteomics. 2011;2011: Stoeckli M, Chaurand P, Hallahan DE, Caprioli RM. Imaging mass spectrometry: A new technology for the analysis of protein expression in mammalian tissues. Nat Med. 2001;7(4): doi: / PubMed PMID: WOS: Caprioli RM, Farmer TB, Gile J. Molecular imaging of biological samples: Localization of peptides and proteins using MALDI-TOF MS. Anal Chem. 1997;69(23): doi: /ac970888i. PubMed PMID: WOS:A1997YJ Aichler M, Walch A. MALDI Imaging mass spectrometry: current frontiers and perspectives in pathology research and practice. Lab Invest. 2015;95(4): doi: /labinvest PubMed PMID: WOS: Oetjen J, Lachmund D, Palmer A, Alexandrov T, Becker M, Boskamp T, et al. An approach to optimize sample preparation for MALDI imaging MS of FFPE sections using fractional factorial design of experiments. Anal Bioanal Chem. 2016;408(24): doi: /s PubMed PMID: WOS: Kriegsmann J, Kriegsmann M, Casadonte R. MALDI TOF imaging mass spectrometry in clinical pathology: A valuable tool for cancer diagnostics. Int J Oncol. 2015;46(3): doi: /ijo PubMed PMID: WOS: Elsner M, Rauser S, Maier S, Schone C, Balluff B, Meding S, et al. MALDI imaging mass spectrometry reveals COX7A2, TAGLN2 and S100-A10 as novel prognostic markers in Barrett's adenocarcinoma. J Proteomics. 2012;75(15): doi: /j.jprot PubMed PMID: WOS:

87 10. Rauser S, Marquardt C, Balluff B, Deininger SO, Albers C, Belau E, et al. Classification of HER2 Receptor Status in Breast Cancer Tissues by MALDI Imaging Mass Spectrometry. J Proteome Res. 2010;9(4): doi: /pr901008d. PubMed PMID: WOS: Pote N, Alexandrov T, Le Faouder J, Laouirem S, Leger T, Mebarki M, et al. Imaging Mass Spectrometry Reveals Modified Forms of Histone H4 as New Biomarkers of Microvascular Invasion in Hepatocellular Carcinomas. Hepatology. 2013;58(3): doi: /hep PubMed PMID: WOS: Veselkov KA, Mirnezami R, Strittmatter N, Goldin RD, Kinross J, Speller AVM, et al. Chemoinformatic strategy for imaging mass spectrometry-based hyperspectral profiling of lipid signatures in colorectal cancer. Proc Natl Acad Sci U S A. 2014;111(3): doi: /pnas PubMed PMID: WOS: Cazares LH, Troyer D, Mendrinos S, Lance RA, Nyalwidhe JO, Beydoun HA, et al. Imaging Mass Spectrometry of a Specific Fragment of Mitogen-Activated Protein Kinase/Extracellular Signal- Regulated Kinase Kinase Kinase 2 Discriminates Cancer from Uninvolved Prostate Tissue. Clin Cancer Res. 2009;15(17): doi: / ccr PubMed PMID: WOS: Casadonte R, Kriegsmann M, Zweynert F, Friedrich K, Bretton G, Otto M, et al. Imaging mass spectrometry to discriminate breast from pancreatic cancer metastasis in formalin- fixed paraffinembedded tissues. Proteomics. 2014;14(7-8): doi: /pmic PubMed PMID: WOS: Vincent-Naulleau S, Le Chalony C, Leplat JJ, Bouet S, Bailly C, Spatz A, et al. Clinical and histopathological characterization of cutaneous melanomas in the melanoblastoma-bearing Libechov minipig model. Pigm Cell Res. 2004;17(1): doi: /j x. PubMed PMID: WOS: Geffrotin C, Horak V, Crechet F, Tricaud Y, Lethias C, Vincent-Naulleau S, et al. Opposite regulation of tenascin-c and tenascin-x in MeLiM swine heritable cutaneous malignant melanoma. Biochim Biophys Acta-Gen Subj. 2000;1524(2-3): doi: /s (00) PubMed PMID: WOS: Borovansky J, Horak V, Elleder M, Fortyn K, Smit NPM, Kolb AM. Biochemical characterization of a new melanoma model the minipig MeLiM strain. Melanoma Res. 2003;13(6): doi: /01.cmr PubMed PMID: WOS: Anyz J, Vyslouzilova L, Vaculovic T, Tvrdonova M, Kanicky V, Haase H, et al. Spatial mapping of metals in tissue-sections using combination of mass-spectrometry and histology through image registration. Sci Rep. 2017;7. doi: /srep PubMed PMID: WOS:

88 19. Hardesty WM, Kelley MC, Mi DM, Low RL, Caprioli RM. Protein signatures for survival and recurrence in metastatic melanoma. J Proteomics. 2011;74(7): doi: /j.jprot PubMed PMID: WOS: Sasaki M, Kizawa K, Igarashi S, Horikoshi T, Uchiwa H, Miyachi Y. Suppression of melanogenesis by induction of endogenous intracellular metallothionein in human melanocytes. Exp Dermatol. 2004;13(8): doi: /j x. PubMed PMID: WOS: Weinlich G, Topar G, Eisendle K, Fritsch PO, Zelger B. Comparison of metallothioneinoverexpression with sentinel lymph node biopsy as prognostic factors in melanoma. J Eur Acad Dermatol Venereol. 2007;21(5): doi: /j x. PubMed PMID: WOS: Weinlich G, Eisendle K, Hassler E, Baltaci M, Fritsch PO, Zelger B. Metallothionein - overexpression as a highly significant prognostic factor in melanoma: a prospective study on 1270 patients. Br J Cancer. 2006;94(6): doi: /sj.bjc PubMed PMID: WOS: Sugita K, Yamamoto O, Asahi M. Immunohistochemical analysis of metallothionein expression in malignant melanoma in Japanese patients. Am J Dermatopathol. 2001;23(1): doi: / PubMed PMID: WOS: Maelandsmo GM, Florenes VA, Mellingsaeter T, Hovig E, Kerbel RS, Fodstad O. Differential expression patterns of S100A2, S100A4 and S100A6 during progression of human malignant melanoma. Int J Cancer. 1997;74(4): doi: /(sici) ( )74:4<464::aidijc19>3.3.co;2-g. PubMed PMID: WOS:A1997XU Donato R. Intracellular and extracellular roles of s100 proteins. Microsc Res Tech. 2003;60(6): doi: /jemt PubMed PMID: WOS:

89 Supporting information S1 Fig. Histology and MSI ion images with histologically specified regions of melanoma tissue from MeLiM minipig cryosections and intensity box plots of particular m/z. Red GMT (normally growing melanoma tissue), violet ESR (early spontaneous regression), orange LSR (late spontaneous regression). 89

90 S2 Fig. Histology and MSI ion images with histologically specified regions of healthy skin tissue from MeLiM minipig cryosections and box plots of particular m/z. Red epidermis, light blue dermis, violet - hair follicle, dark blue sweat gland, orange subcutaneous adipose tissue, green subcutaneous muscle. 90

91 S3 Fig. Correlation matrix of the ion peaks that account for variation between melanoma ROIs. S1 Table. Ion peaks of interest that account for the variation between three histologically differing zones identified in haematoxylin-eosin stained skin porcine melanoma. m/z [Da] LSR vs ESR ESR vs GMT LSR vs GMT ESR vs LSR vs GMT p Rating p Rating p Rating p Rating 5,22E-06 *** 0, ,86E-06 *** 3,53E-06 *** 1,45E-06 *** 0, *** 0, * 4,90E-07 *** 0, , , *** 0, ** 0, ** 0, , ** 0, ** 0, , , , , , <0.05 0, *** 0, *** 0, , , , , , , , , , , , , * 0, , ** 0, * GMT (normally growing melanoma tissue), ESR (early spontaneous regression), LSR (late spontaneous regression). Kruskal-Wallis test was used. Used rating: (*) p values < 0.05, (**) p values < 0.01, (***) p values <

92 S2 Table. Ion peaks of interest that account for the variation between six regions of interest (ROIs) in healthy skin porcine tissue. m/z [Da] All ROIs D vs E D vs HF D vs SAT D vs SM D vs SG E vs HF E vs SAT p Rating p Rating p Rating p Rating p Rating p Rating p Rating p Rating >= >= >= >= >= >= < >= *** 0 *** 0.59 >= *** 0 *** 0 *** 0 *** 0 *** *** 0 *** 0.15 >= >= *** 0.95 >= *** 0 *** *** ** 0 *** 0 *** 0 *** 0 *** 0 *** 0 *** >= >= >= >= >= >= >= >= * 0.47 >= >= >= * 0.77 >= * 0.41 >= *** 0.28 >= *** 0 *** 0 *** ** 0 *** 0 *** *** 0.14 >= *** 0 *** 0 *** 0 *** 0 *** 0 *** *** ** 0 *** 0 *** 0 *** 0 *** 0 *** 0 *** *** 0.31 >= * 0.31 >= < >= >= * E epidermis, D dermis, HF hair follicle, SG sweat gland, SAT subcutaneous adipose tissue, SM subcutaneous muscle. P-values << are marked as 0. Kruskal-Wallis test was used. Used rating: (*) p values < 0.05, (**) p values < 0.01, (***) p values <

93 S3 Table. Ion peaks of interest that account for the variation between six regions of interest (ROIs) in healthy skin porcine tissue. m/z [Da] E vs SM E vs SG HF vs SAT HF vs SM HF vs SG SAT vs SM SAT vs SG SM vs SG p Rating p Rating p Rating p Rating p Rating p Rating p Rating p Rating >= ** 0.33 >= >= >= >= >= >= *** 0 *** ** 0 *** 0 *** 0 *** 0.16 >= *** *** ** 0.32 >= ** 0 *** 0 *** 0.07 >= *** *** 0 *** 0 *** 0.36 >= *** 0 *** 0.36 >= *** >= >= >= >= >= >= >= >= *** 0.35 >= >= >= >= * 0.83 >= >= *** 0 *** 0.13 >= *** 0 *** 0 *** 0.03 * 0 *** *** 0 *** 0.13 >= *** 0 *** 0 *** 0.06 >= *** *** 0 *** 0.93 >= *** 0.57 >= *** 0.44 >= *** *** 0.89 >= ** 0 *** 0.44 >= >= >= *** E epidermis, D dermis, HF hair follicle, SG sweat gland, SAT subcutaneous adipose tissue, SM subcutaneous muscle. P-values << are marked as 0. Kruskal-Wallis test was used. Used rating: (*) p values < 0.05, (**) p values < 0.01, (***) p values <