Laboratoř Metalomiky a Nanotechnologií

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "Laboratoř Metalomiky a Nanotechnologií"


1 Laboratoř Metalomiky a Nanotechnologií PROTOKOL: Experimenty s deoxyribonukleovou kyselinou vykazující peroxidázovou aktivitu VYUČUJÍCÍ: Ing.Branislav Ruttkay-Nedecký, PhD., Ing. Lukáš Nejdl Anotace DNA obsahující na guanin bohaté sekvence se může sestavit do čtyřvláknových struktur známých jako G-kvadruplexy. Tyto útvary jsou tvořeny skládáním planárních guaninových tetrád (G-tetrád) nad sebe. G-tetráda je tvořena čtyřmi guaninovými bázemi, které jsou mezi sebou propojeny dvěma vodíkovými můstky Hoogsteenovými vazbami. G-kvadruplex tvoří několik těchto tetrád uspořádaných nad sebou. Udržení stability G-kvadruplexů napomáhá přítomnost iontů alkalických kovů, které se nacházejí uprostřed mezi dvěma G-tetrádami. Nejčastěji je tímto iontem kation draslíku. V lidském genomu, se tyto na guanin bohaté sekvence schopné tvořit G-kvadruplexy vyskytují v telomerách, i v promotorových oblastech některých onkogenů. G-quadruplexy mohou sloužit také jako ligandy pro kovové ionty a aptamery pro různé molekuly. Zajímavé je, že G-quadruplexy vykazují peroxidázou aktivitu ve spojení s aniontovým porfyrinem heminem. Komplexy G-kvadruplexů s heminem umožnily rozvoj citlivých technik pro detekci těžkých kovů. Postup vytvoření G-kvadruplexu Prvním krokem k zavedení metody pro detekci stříbrných iontů pomocí G-kvadruplexu je vytvoření G-kvadruplexu v přítomnosti draselných iontů a heminu. Postup byl převzat z publikace Zhou et al

2 Chemikálie Oligodeoxynukleotidy: ODN: 5 -GGGTACGCTCTTCAAAAGAAGA CCCTA- CCCAAAGGGTAGGGCGGGTTGGGA ODN se nejdříve rozpustily v ACS vodě na 100 µm koncentraci (106 µl) a z ní se ředěním s ACS vodou připravila 60 µm koncentrace (40 µl). Poté se ODN naředily 1:1 s 20 mm Tris acetátovým pufrem, ph 7 a byly připraveny v koncentraci 30 µm v 10 mm Tris-acetátového pufru ph 7.0 1) Pufr na ODN: 25 ml 20 mm Tris acetátového pufru, ph 7 se připravilo naředěním 25 mm Tris acetátového pufru ACS vodou 40 ml 25 mm Tris HAc pufru + 10 ml ACS vody 2) Pracovní pufr: 500 ml naváží se g Trisu, g octanu draselného, rozpustí v ACS vodě, přidá se 1 ml Tritonu X-100 a ph se upraví kyselinou octovou na 7.0 3) Zásobní roztok heminu (31.25 mm): naváží se g heminu a rozpustí v 1.25 ml DMSO a dále naředí na koncentraci µm pracovním pufrem (100 µl zásobního roztoku µl pracovního pufru) 4) Zásobní roztok ABTS(32 mm): naváží se g ABTS a rozpusí v 10ml pracovního pufru. 5) Zásobní roztok H 2 O 2 (20 mm): napipetují se 3 µl 30 % peroxidu vodiku a 997 µl pracovního pufru Obr.1: Chemikálie na přípravu G-kvadruplexů Pracovní postup 2 μl DNA ODN sondy (30 µm) bylo přidáno do 100 µl pracovního pufru (Obr.2) a směs se inkubovala 5 minut při 95 C, aby se odstranili agregáty (Obr.3).

3 Obr.2: Napipetování DNA ODN sondy do pracovního pufru Obr. 3: Inkubace ODN 5 minut při 95 C v termomixeru. Poté byl roztok pomalu schlazen na 25 C a dále inkubován při 25 C 20 minut. Dále bylo k němu přidáno 2 μl heminového roztoku a směs byla inkubována 60 minut při 25 C. Dále bylo přidáno 20 μl ABTS a 22 μl H 2 O 2 a 54 μl pracovního pufru přičemž výslední objem byl 200 μl. Po pěti minutách se vytvořil G-kvadruplex zelené barvy (Obr.4) změřilo VIS spektrum na spektrofotometru Specord 210 při pokojové teplotě (obr.5).

4 Obr.4: G-kvadruplex s heminem vytváří DNAzym s peroxidázovou aktivitou, která způsobuje, že se peroxid vodíku redukuje na vodu a oxiduje ABTS (2,2 -azinobis 3- ethylbenzothiazolin-6-sulfonová kyselina, bezbarevný roztok) na ABTS + radikál (roztok zelené barvy), který lze stanovit spektrofotometricky s absorpčním maximem při 420 nm (Obr.5-6). Obr.5: Měření VIS spektra G-kvadruplexu vytvořeného v přítomnosti draselných iontů a heminu s ABTS a peroxidem vodíku na spektrofotometru Specord 210 Obr.6: Záznam měření spektra vytvořeného G-kvadruplexu (zelený absorpční signál s absorpčním maximem při 420 nm) Literatura: Zhou, X.-H., D.-M. Kong, and H.-X. Shen, G-quadruplex hemin DNAzyme-amplified colorimetric detection of Ag+ ion. Analytica Chimica Acta, (1): p


Ing.Branislav Ruttkay-Nedecký, Ph.D., Ing. Lukáš Nejdl

Ing.Branislav Ruttkay-Nedecký, Ph.D., Ing. Lukáš Nejdl Název: Školitel: Vznik radikálů v přítomnosti DNA, heminu, peroxidu vodíku, ABTS, kovových iontů a jejich spektrofotometrická detekce Ing.Branislav Ruttkay-Nedecký, Ph.D., Ing. Lukáš Nejdl Datum: 11.10.2013


Potenciometrie. Obr.1 Schema základního uspořádání elektrochemické cely pro potenciometrická měření

Potenciometrie. Obr.1 Schema základního uspořádání elektrochemické cely pro potenciometrická měření Potenciometrie 1.Definice Rovnovážná potenciometrie je analytickou metodou, při níž se analyt stanovuje ze změřeného napětí elektrochemického článku, tvořeného indikační elektrodou ponořenou do analyzovaného



T7TVO05 ODŽELEZOVÁNÍ A ODKYSELOVÁNÍ PODZEMNÍ VODY PROVZDUŠOVÁNÍ A FILTRACÍ T7TVO05 ODŽELEZOVÁNÍ A ODKYSELOVÁNÍ PODZEMNÍ VODY PROVZDUŠOVÁNÍ A FILTRACÍ 5.1. Úvod V malých koncentrací je železo běžnou součástí vod. V povrchových vodách se železo vyskytuje obvykle v setinách až desetinách


Příprava vrstev metodou sol-gel

Příprava vrstev metodou sol-gel Příprava vrstev metodou sol-gel Návody pro laboratorní práce oboru restaurování památek Specializace: Sklo a keramika Vedoucí práce: Ing. Diana Horkavcová, A07, tel.: 4175 Zastupuje: Dr. Ing. Dana Rohanová,


Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie

Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie IZOLACE GENOMOVÉ DNA Deoxyribonukleová kyselina (DNA) představuje základní genetický materiál většiny


Praktický kurz Pokročilé biofyzikální přístupy v genomice a proteomice. 12.-13. května 2010

Praktický kurz Pokročilé biofyzikální přístupy v genomice a proteomice. 12.-13. května 2010 Oddělení funkční genomiky a proteomiky Ústav experimentální biologie, Přírodovědecká fakulta Masarykova univerzita Praktický kurz Pokročilé biofyzikální přístupy v genomice a proteomice


Atomová absorpční spektroskopie (AAS) spektroskopie (AAS) spektroskopie (AAS) r. 1802 Wolaston pozoroval absorpční čáry ve slunečním spektru

Atomová absorpční spektroskopie (AAS) spektroskopie (AAS) spektroskopie (AAS) r. 1802 Wolaston pozoroval absorpční čáry ve slunečním spektru tomová absorpční r. 1802 Wolaston pozoroval absorpční čáry ve slunečním spektru r. 1953 Walsh sestrojil první analytický atomový absorpční spektrometr díky vysoké selektivitě se tato metoda stala v praxi


Model mitózy Kat. číslo 103.7491

Model mitózy Kat. číslo 103.7491 Model mitózy Kat. číslo 103.7491 Mitóza Mitóza, nazývaná také nepřímé jaderné dělení nebo ekvační dělení, je nejvíce rozšířená forma rozmnožování buněk. Buňka (mateřská buňka) se přitom rozdělí na 2 dceřiné


ICT podporuje moderní způsoby výuky CZ.1.07/1.5.00/34.0717. Chemie laboratorní technika. Mgr. Dana Kňapová

ICT podporuje moderní způsoby výuky CZ.1.07/1.5.00/34.0717. Chemie laboratorní technika. Mgr. Dana Kňapová Název projektu ICT podporuje moderní způsoby výuky Číslo projektu CZ.1.07/1.5.00/34.0717 Název školy Gymnázium, Turnov, Jana Palacha 804, přísp. organizace Číslo a název šablony klíčové aktivity III/2



VYUŽITÍ TEPELNÉHO ZMLŽOVAČE V AAS 1 VYUŽITÍ TEPELNÉHO ZMLŽOVAČE V AAS JAN KNÁPEK Katedra analytické chemie, Přírodovědecká fakulta MU, Kotlářská 2, Brno 611 37 Obsah 1. Úvod 2. Tepelný zmlžovač 2.1 Princip 2.2 Konstrukce 2.3 Optimalizace



BIOKATALYZÁTORY I. ENZYMY BIOKATALYZÁTORY I. Obecné pojmy - opakování: Katalyzátory látky, které ovlivňují průběh katalyzované reakce a samy se přitom nemění. Dělíme je na: pozitivní (aktivátory) urychlující reakce negativní (inhibitory)


laboratorní technologie

laboratorní technologie Testování analyzátoru Premier Hb9210 TM Malášková L. Úvod Hemoglobin dospělého člověka je obvykle tvořen HbA (97 % z celkového množství), HbA 2 (2,5 %) a HbF (0,5 %). HbA se skládá ze čtyř polypeptidových


Monitorování hladiny metalothioneinu a thiolových sloučenin u biologických organismů vystavených působení kovových prvků a sloučenin

Monitorování hladiny metalothioneinu a thiolových sloučenin u biologických organismů vystavených působení kovových prvků a sloučenin Laboratoř Metalomiky a Nanotechnologií Monitorování hladiny metalothioneinu a thiolových sloučenin u biologických organismů vystavených působení kovových prvků a sloučenin Ing. Kateřina Tmejová, Ph. D.,


Voltametrie (laboratorní úloha)

Voltametrie (laboratorní úloha) Voltametrie (laboratorní úloha) Teorie: Voltametrie (přesněji volt-ampérometrie) je nejčastěji používaná elektrochemická metoda, kdy se na pracovní elektrodu (rtuť, platina, zlato, uhlík, amalgamy,...)


Název: Šumivá tableta

Název: Šumivá tableta Název: Šumivá tableta Výukové materiály Téma: Anorganické plyny Úroveň: střední škola Tematický celek: Látky a jejich přeměny, makrosvět přírody Předmět (obor): chemie Doporučený věk žáků: 15 17 let Doba


Úspěch mladých českých a slovenský vědců a techniků ve stratosféře - Experimentální stratosférická balónová platforma přinesla unikátní výsledky

Úspěch mladých českých a slovenský vědců a techniků ve stratosféře - Experimentální stratosférická balónová platforma přinesla unikátní výsledky Úspěch mladých českých a slovenský vědců a techniků ve stratosféře - Experimentální stratosférická balónová platforma přinesla unikátní výsledky Mladí čeští a slovenští vědci a technici vypustili po mnoha


Model dvanáctipulzního usměrňovače

Model dvanáctipulzního usměrňovače Ladislav Mlynařík 1 Model dvanáctipulzního usměrňovače Klíčová slova: primární proud trakčního usměrňovače, vyšší harmonická, usměrňovač, dvanáctipulzní zapojení usměrňovače, model transformátoru 1 Úvod


Modifikace uhlíkové pastové elektrody pro stanovení stříbrných iontů

Modifikace uhlíkové pastové elektrody pro stanovení stříbrných iontů Název: Školitel: Modifikace uhlíkové pastové elektrody pro stanovení stříbrných iontů Mgr. Dana Dospivová Datum: 24.2.212 Reg.č.projektu: CZ.1.7/2.3./2.148 Název projektu: Mezinárodní spolupráce v oblasti


Stanovení kyseliny mravenčí a citronové v kávě pomocí kapilární izotachoforézy

Stanovení kyseliny mravenčí a citronové v kávě pomocí kapilární izotachoforézy Stanovení kyseliny mravenčí a citronové v kávě pomocí kapilární izotachoforézy Úkol: Proveďte extrakci kyseliny mravenčí a citronové z reálného vzorku (káva). Pomocí kapilární izotachoforézy stanovte,


Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem ČR.

Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem ČR. Střední škola hospodářská a lesnická, Frýdlant, Bělíkova 1387, příspěvková organizace Název modulu Chemie Kód modulu Ch-M-1/1-10 Délka modulu 99 hodin Platnost 01.09.2010 Typ modulu povinný Pojetí teoretické


Uspořádání vaší fermentace

Uspořádání vaší fermentace Science in School Issue 24: Autumn 2012 1 Přeložila Zdena Tejkalová Uspořádání vaší fermentace Pro provedení následujících aktivit bude každá skupina potřebovat přibližně 200 ml zkvašeného moštu, 200 ml



STÍRÁNÍ NEČISTOT, OLEJŮ A EMULZÍ Z KOVOVÝCH PÁSŮ VE VÁLCOVNÁCH ZA STUDENA STÍRÁNÍ NEČISTOT, OLEJŮ A EMULZÍ Z KOVOVÝCH PÁSŮ VE VÁLCOVNÁCH ZA STUDENA ÚVOD Při válcování za studena je povrch vyválcovaného plechu znečištěn oleji či emulzemi, popř. dalšími nečistotami. Nežádoucí


VY_52_INOVACE_VK30. Datum (období), ve kterém byl VM vytvořen únor 2013. Ročník, pro který je VM určen. 8. ročník

VY_52_INOVACE_VK30. Datum (období), ve kterém byl VM vytvořen únor 2013. Ročník, pro který je VM určen. 8. ročník VY_52_INOVACE_VK30 Jméno autora výukového materiálu Věra Keselicová Datum (období), ve kterém byl VM vytvořen únor 2013 Ročník, pro který je VM určen Vzdělávací oblast, obor, okruh, téma Anotace 8. ročník


Dle tohoto postupu se vyšetřují vzorky drobných masných výrobků, měkkých salámů a trvanlivých masných výrobků.

Dle tohoto postupu se vyšetřují vzorky drobných masných výrobků, měkkých salámů a trvanlivých masných výrobků. Sledovaná složka potraviny Druh potraviny Způsob vyšetření vzorku Verze protokolu Protokol 09 Sojová bílkovina Masné výrobky Imunohistochemické vyšetření Plná verze 1 Popis vzorku Dle tohoto postupu se


Současné problémy trichomonózy v ČR

Současné problémy trichomonózy v ČR Současné problémy trichomonózy v ČR RNDr. Erich Pazdziora, CSc. Zdravotní ústav se sídlem v Ostravě Národní referenční laboratoř pro urogenitální trichomonózu Trichomonóza Sexuálně přenosné onemocnění





Praktický kurz Monitorování hladiny metalothioneinu po působení iontů těžkých kovů Vyhodnocení měření

Praktický kurz Monitorování hladiny metalothioneinu po působení iontů těžkých kovů Vyhodnocení měření Laboratoř Metalomiky a Nanotechnologií Praktický kurz Monitorování hladiny metalothioneinu po působení iontů těžkých kovů Vyhodnocení měření Vyučující: Ing. et Ing. David Hynek, Ph.D., Prof. Ing. René



POKYNY VLASTNOSTI LÁTEK POKYNY vypracuj postupně zadané úkoly, které ti pomohou získat základní informace o vlastnostech látek tyto informace pak použij na závěr při vypracování testu zkontroluj si správné řešení úkolů a odpovědi



NÁVOD K POUŽITÍ HOŘČÍK 600 A KATALOGOVÉ ČÍSLO 104 NÁVOD K POUŽITÍ HOŘČÍK 600 A KATALOGOVÉ ČÍSLO 104 POUŽITÍ Souprava Mg 600 A se používá ke kvantitativnímu stanovení koncentrace hořečnatých iontů v séru, v moči a v dalších biologických materiálech. SOUHRN


Nukleové kyseliny. Struktura DNA a RNA. Milada Roštejnská. Helena Klímová

Nukleové kyseliny. Struktura DNA a RNA. Milada Roštejnská. Helena Klímová ukleové kyseliny Struktura DA a RA Milada Roštejnská elena Klímová bsah Typy nukleových kyselin DA a RA jsou tvořeny z nukleotidů Jaký je rozdíl mezi nukleotidem a nukleosidem? Fosfodiesterová vazba Komplementarita


BÍLKOVINY. Autor: Mgr. Stanislava Bubíková. Datum (období) tvorby: 15. 2. 2013. Ročník: devátý

BÍLKOVINY. Autor: Mgr. Stanislava Bubíková. Datum (období) tvorby: 15. 2. 2013. Ročník: devátý BÍLKOVINY Autor: Mgr. Stanislava Bubíková Datum (období) tvorby: 15. 2. 2013 Ročník: devátý Vzdělávací oblast: Člověk a příroda / Chemie / Organické sloučeniny 1 Anotace: Žáci se seznámí s oblastmi chemického


Zvyšování kvality výuky technických oborů

Zvyšování kvality výuky technických oborů Zvyšování kvality výuky technických oborů Klíčová aktivita V. 2 Inovace a zkvalitnění výuky směřující k rozvoji odborných kompetencí žáků středních škol Téma V. 2.3 Polovodiče a jejich využití Kapitola


Příprava materiálu byla podpořena projektem OPPA č. CZ.2.17/3.1.00/33253

Příprava materiálu byla podpořena projektem OPPA č. CZ.2.17/3.1.00/33253 Příprava materiálu byla podpořena projektem OPPA č. CZ.2.17/3.1.00/33253 Část 7 Vlastnosti solventů (rozpouštědel) Přehled organických rozpouštědel Tabulka níže shrnuje velký počet solventů v pořadí stoupající


Dotace na výrobu tvarovaných biopaliv

Dotace na výrobu tvarovaných biopaliv Dotace na výrobu tvarovaných biopaliv Dotační program podporující nové výstavby a modernizace zařízení na výrobu tvarovaných biopaliv. Výše dotace 45 % pro malé podniky (méně než 50 zaměstnanců, roční


Vítkovice výzkum a vývoj technické aplikace s.r.o. Pohraniční 693/31, 706 02 Ostrava Vítkovice, Česká republika

Vítkovice výzkum a vývoj technické aplikace s.r.o. Pohraniční 693/31, 706 02 Ostrava Vítkovice, Česká republika Něktteré ttechnollogiicko mettallurgiické ssouviissllossttii na ellekttriických iindukčníích ssttředoffrekvenčníích pecíích ss kyssellou,, neuttrállníí a zássadiittou výdusskou Čamek, L. 1), Jelen, L.


Laboratorní příručka

Laboratorní příručka F a k u l t n í n e m o c n i c e K r á l o v s k é V i n o h r a d y, Š r o b á r o v a 5 0, P r a h a 1 0 Ústav soudního lékařství Laboratorní příručka ÚSTAV SOUDNÍHO LÉKAŘSTVÍ Toxikologická laboratoř


Konference WITNESS 2006 Čejkovice, 1.-2.6.2006. Klíčová slova: PowerSim, průmyslové inženýrství, simulace, Witness,

Konference WITNESS 2006 Čejkovice, 1.-2.6.2006. Klíčová slova: PowerSim, průmyslové inženýrství, simulace, Witness, ZAČLENĚNÍ VÝUKY WITNESS PRO PRŮMYSLOVÉ INŽENÝRY NA UTB ZLÍN Ing. Roman Žůrek Ústav managementu výroby průmyslového inženýrství,fakulty managementu a ekonomiky Univerzity Tomáše Bati ve Zlíně Anotace: V


Měření změny objemu vody při tuhnutí

Měření změny objemu vody při tuhnutí Měření změny objemu vody při tuhnutí VÁCLAVA KOPECKÁ Katedra didaktiky fyziky, Matematicko-fyzikální fakulta Univerzity Karlovy v Praze Anotace Od prosince 2012 jsou na webovém portálu publikovány


ČÁST PRVNÍ Základní ustanovení Čl. 1 Povaha a cíl Fyzikální olympiády

ČÁST PRVNÍ Základní ustanovení Čl. 1 Povaha a cíl Fyzikální olympiády Organizační řád Fyzikální olympiády Č.j.: 22 125/2005-51 dne 8. 11. 2005 Ministerstvo školství, mládeže a tělovýchovy v souladu s 3 odst. 5 vyhlášky č. 55/2005 Sb., o podmínkách organizace a financování


Biogeochemické cykly vybraných chemických prvků

Biogeochemické cykly vybraných chemických prvků Biogeochemické cykly vybraných chemických prvků Uhlík důležitý biogenní prvek cyklus C jedním z nejdůležitějších látkových toků v biosféře poměr mezi CO 2 a C org - vliv na oxidačně redukční potenciál


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tématická Odborná biologie, část biologie Společná pro



KOMPLEXOMETRIE C C H 2 Úloha č. 11 KOMPLEXOMETRIE Princip Při komplexotvorných reakcích vznikají komplexy sloučeniny, v nichž se k centrálnímu atomu nebo iontu vážou ligandy donor-akceptorovou (koordinační) vazbou. entrální



WAXOYL AG, BASEL / SWITZERLAND TECHNICAL BULLETIN WAXOYL PROFESSIONAL 120-4 Využití: Dlouhodobá ochrana dutin osobních vozidel, dodávkových vozů, strojních zařízení, potrubních rozvodů, atd. Výrobek je založen na bázi upravených vosků


CZ.1.07/1.5.00/34.0581 VY_32_INOVACE_OAD_3.AZA_20_SNIZOVANI EMISI. Opravárenství a diagnostika

CZ.1.07/1.5.00/34.0581 VY_32_INOVACE_OAD_3.AZA_20_SNIZOVANI EMISI. Opravárenství a diagnostika Číslo projektu CZ.1.07/1.5.00/34.0581 Číslo materiálu VY_32_INOVACE_OAD_3.AZA_20_SNIZOVANI EMISI Název školy Střední odborná škola a Střední odborné učiliště, Dubno Autor Ing. Pavel Štanc Tematická oblast


Studie proveditelnosti návrhu

Studie proveditelnosti návrhu Veřejná knihovna v Průhonicích Studie proveditelnosti návrhu Verze: Vytvořil: Poslední aktualizace: 0.2 - úvodní draft Mgr. Vítězslav Praks, PhD. 2011-03-01 Veřejná knihovna v Průhonicích 1.1 Úvod Obsahem



ODŮVODNĚNÍ VEŘEJNÉ ZAKÁZKY DLE 156 ZÁKONA 137/2006 Sb., O VEŘEJNÝCH ZAKÁZKÁCH ODŮVODNĚNÍ VEŘEJNÉ ZAKÁZKY DLE 156 ZÁKONA 137/2006 Sb., O VEŘEJNÝCH ZAKÁZKÁCH ZADAVATEL Ústav makromolekulární chemie AV ČR, v.v.i. Sídlem Heyrovského nám. 2, 16206, Praha 6 IČ: 61389013 Jednající: RNDr.


EURO-ŠARM SPOL. S R.O. Přehled produktů s návody k použití

EURO-ŠARM SPOL. S R.O. Přehled produktů s návody k použití EURO-ŠARM SPOL. S R.O. Přehled produktů s návody k použití 8.4.2013 Stránka 1 z 14 Obsah A) Desinfekce bazénové vody... 2 A1. Chlorové tablety, 200 g: TCCA... 3 A2. Multifunkční tablety, 200 g: TCCA +



KOMPLEXNÍ VÝŽIVOVÝ SYSTÉM GU HYDRATACE, ENERGIE A REGENERACE KOMPLEXNÍ VÝŽIVOVÝ SYSTÉM GU HYDRATACE, ENERGIE A REGENERACE Výživový systém GU byl pečlivě sestaven a vytvořen tak, aby podpořil výkon sportovce dostatečnou hydratací, kvalitní energií a následnou regenerací


Nabídky služeb zkušebního centra VUZ ve Velimi

Nabídky služeb zkušebního centra VUZ ve Velimi Pavel Janoušek 1 Nabídky služeb zkušebního centra VUZ ve Velimi Klíčová slova: zkušební centrum, velký zkušební okruh, malý zkušební okruh, dynamický zkušební stav, hala na přípravu zkoušek, akreditovaná


Analytické metody využívané ke stanovení chemického složení kovů. Ing.Viktorie Weiss, Ph.D.

Analytické metody využívané ke stanovení chemického složení kovů. Ing.Viktorie Weiss, Ph.D. Analytické metody využívané ke stanovení chemického složení kovů. Ing.Viktorie Weiss, Ph.D. Rentgenová fluorescenční spektrometrie ergiově disperzní (ED-XRF) elé spektrum je analyzováno najednou polovodičovým


Cytologie cvičení č. 6

Cytologie cvičení č. 6 Cytologie cvičení č. 6 Téma: Enzymy Úkol 1: Závislost aktivity enzymů na ph prostředí. Stanovte optimální ph amylázy Chemikálie a materiál: Destilovaná voda, 1% roztok škrobu, Lugolův roztok, 0,2 mol roztok


Příloha č. 1 - Technické podmínky Rukavicové boy s nosnou konstrukcí pro práci v inertní atmosféře

Příloha č. 1 - Technické podmínky Rukavicové boy s nosnou konstrukcí pro práci v inertní atmosféře Příloha č. 1 - Technické podmínky Rukavicové boy s nosnou konstrukcí pro práci v inertní atmosféře 1. Kupující vzadávacím řízení poptal dodávku zařízení vyhovujícího následujícím technickým požadavkům:


Obsah Protein Gel Electrophoresis Kitu a jeho skladování

Obsah Protein Gel Electrophoresis Kitu a jeho skladování Obsah Protein Gel Electrophoresis Kitu a jeho skladování Protein Gel Electrophoresis Kit obsahuje veškerý potřebný materiál provádění vertikální polyakrilamidové gelové elektroforézy. Experiment provádějí


SACHARIDY. Autor: Mgr. Stanislava Bubíková. Datum (období) tvorby: 29. 1. 2013. Ročník: devátý

SACHARIDY. Autor: Mgr. Stanislava Bubíková. Datum (období) tvorby: 29. 1. 2013. Ročník: devátý SACHARIDY Autor: Mgr. Stanislava Bubíková Datum (období) tvorby: 29. 1. 2013 Ročník: devátý Vzdělávací oblast: Člověk a příroda / Chemie / Organické sloučeniny 1 Anotace: Žáci se seznámí s základními živinami


vylučování odpadních látek (tělo by bylo schopno samo sebe otrávit) vylučování odpadu v těle

vylučování odpadních látek (tělo by bylo schopno samo sebe otrávit) vylučování odpadu v těle Ledviny Odpadní látky vylučování odpadních látek (tělo by bylo schopno samo sebe otrávit) vylučování odpadu v těle kůže (soli a minerální látky) plíce (CO 2, H 2 O v podobě páry) vnitřnosti nestrávené


Orientační průvodce mateřstvím a rodičovstvím v zadávacích dokumentacích poskytovatele

Orientační průvodce mateřstvím a rodičovstvím v zadávacích dokumentacích poskytovatele Orientační průvodce mateřstvím a rodičovstvím v zadávacích dokumentacích poskytovatele Z důvodu ulehčení, snazší orientace, poskytnutí jednoznačných a široce komunikovatelných pravidel v otázkách mateřství


Vítězslav Bártl. březen 2013

Vítězslav Bártl. březen 2013 VY_32_INOVACE_VB08_K Jméno autora výukového materiálu Datum (období), ve kterém byl VM vytvořen Ročník, pro který je VM určen Vzdělávací oblast, vzdělávací obor, tematický okruh, téma Anotace Vítězslav


Projekt 438 Vytvoření studijních oborů Řešitel: prof. Ing. Václav Janda, CSc.

Projekt 438 Vytvoření studijních oborů Řešitel: prof. Ing. Václav Janda, CSc. Projekt 438 Vytvoření studijních oborů Řešitel: prof. Ing. Václav Janda, CSc. 1 Původní cíle projektu Cílem projektu bylo připravit podmínky pro akreditaci dvou bakalářských studijních oborů uskutečňovaných


Součástí cvičení je krátký test.

Součástí cvičení je krátký test. 1 KVALITATIVNÍ ANORGANICKÁ ANALÝZA Laboratorní úloha č.3 KATIONTY TVOŘÍCÍ HYDROXIDY A AMFOTERNÍ HYDROXIDY DOMÁCÍ PŘÍPRAVA 1. Prostudujte si dále uvedený návod 2. Na základě informací ze skript (str. 15


Rozdělení metod tlakového odporového svařování

Rozdělení metod tlakového odporového svařování Rozdělení metod tlakového odporového svařování Podle konstrukčního uspořádání elektrod a pracovního postupu tohoto elektromechanického procesu rozdělujeme odporové svařování na čtyři hlavní druhy: a) bodové


1 Popis vzorku. 2 Detekční limit vyšetření. 3 Časová náročnost. 4 Zpracování vzorku. 4.1 Množství vzorku. 4.2 Odběr vzorků.

1 Popis vzorku. 2 Detekční limit vyšetření. 3 Časová náročnost. 4 Zpracování vzorku. 4.1 Množství vzorku. 4.2 Odběr vzorků. 1 Popis vzorku Podle tohoto postupu se vyšetřují vzorky různých druhů masných výrobků, ale také strojně odděleného masa. Pomocí histochemického barvení lze prokázat přítomnost kostních úlomků a na jejich


13. Sítě WAN. Rozlehlé sítě WAN. Počítačové sítě I. 1 (6) KST/IPS1. Studijní cíl. Představíme rozlehlé sítě typu WAN. Doba nutná k nastudování

13. Sítě WAN. Rozlehlé sítě WAN. Počítačové sítě I. 1 (6) KST/IPS1. Studijní cíl. Představíme rozlehlé sítě typu WAN. Doba nutná k nastudování 13. Sítě WAN Studijní cíl Představíme rozlehlé sítě typu WAN. Doba nutná k nastudování 2 hodiny Rozlehlé sítě WAN Uvedená kapitola vychází ze zdroje [1]. Rozlehlé sítě umožňují komunikaci (přenos dat,


9.4.2001. Ėlektroakustika a televize. TV norma ... Petr Česák, studijní skupina 205

9.4.2001. Ėlektroakustika a televize. TV norma ... Petr Česák, studijní skupina 205 Ėlektroakustika a televize TV norma.......... Petr Česák, studijní skupina 205 Letní semestr 2000/200 . TV norma Úkol měření Seznamte se podrobně s průběhem úplného televizního signálu obrazového černobílého


Cattletype BHV1 gb Ab. Verze 090724. 03-101/20 (20 x 96 testů)

Cattletype BHV1 gb Ab. Verze 090724. 03-101/20 (20 x 96 testů) erologická diagnostika specifických protilátek proti Bovinnímu herpesviru 1 metodou ELIA 480 nebo 1920 reakcí Cattletype BHV1 gb Ab Verze 090724 kat. číslo: 03-101/5 (5 x 96 testů) 03-101/20 (20 x 96 testů)


Název: Vypracovala: Datum: 7. 2. 2014. Zuzana Lacková

Název: Vypracovala: Datum: 7. 2. 2014. Zuzana Lacková Název: Vypracovala: Zuzana Lacková Datum: 7. 2. 2014 Reg.č.projektu: CZ.1.07/2.4.00/31.0023 Název projektu: Partnerská síť centra excelentního bionanotechnologického výzkumu MĚLI BYCHOM ZNÁT: informace,


Progesteron ELISA test pro kvantitativní stanovení progesteronu v lidském séru nebo plazmě

Progesteron ELISA test pro kvantitativní stanovení progesteronu v lidském séru nebo plazmě Progesteron ELISA test pro kvantitativní stanovení progesteronu v lidském séru nebo plazmě Obj. číslo: 55020 96 testů kompletní souprava Účel použití Progesteron (pregn-4-ene-3, 20-dion) je steroidní hormon


Číslo projektu: CZ.1.07/1.5.00/34.0290. Ročník: 1.

Číslo projektu: CZ.1.07/1.5.00/34.0290. Ročník: 1. Zlepšení podmínek pro vzdělávání na středních školách Operačního programu Vzdělávání pro konkurenceschopnost Název a adresa školy: Integrovaná střední škola Cheb, Obrněné brigády 6, 350 11 Cheb Číslo projektu:


Řízení kalibrací provozních měřicích přístrojů

Řízení kalibrací provozních měřicích přístrojů Řízení kalibrací provozních měřicích přístrojů Přesnost provozních přístrojů je velmi důležitá pro spolehlivý provoz výrobního závodu a udržení kvality výroby. Přesnost měřicích přístrojů narušuje posun


Soli. ph roztoků solí - hydrolýza

Soli. ph roztoků solí - hydrolýza Soli Soli jsou iontové sloučeniny vzniklé neutralizační reakcí. Např. NaCl je sůl vzniklá reakcí kyseliny HCl a zásady NaOH. Př.: Napište neutralizační reakce jejichž produktem jsou CH 3 COONa, NaCN, NH


Číslo projektu: CZ.1.07/1.5.00/34.0036 Název projektu: Inovace a individualizace výuky

Číslo projektu: CZ.1.07/1.5.00/34.0036 Název projektu: Inovace a individualizace výuky Číslo projektu: CZ.1.07/1.5.00/34.0036 Název projektu: Inovace a individualizace výuky Autor: Mgr. Martin Fryauf Název materiálu: Znalecké zkoumání Označení materiálu:vy_32_inovace_fry19 Datum vytvoření:


Název: O co nejvyšší věž

Název: O co nejvyšší věž Název: O co nejvyšší věž Výukové materiály Téma: Pevnost, stabilita, síly Úroveň: 1. stupeň ZŠ Tematický celek: Jak se co dělá Věci a jejich původ (Suroviny a jejich zdroje) Předmět (obor): prvouka a přírodopis


Validace a verifikace molekulárně biologických metod v analýze humánního a extrahumánního genomu

Validace a verifikace molekulárně biologických metod v analýze humánního a extrahumánního genomu Validace a verifikace molekulárně biologických metod v analýze humánního a extrahumánního genomu - hledání racionálního konsensu místo hry s čísly - P. Hložek 1, M. Sittová 1, M. Dendis 1, J. Mrázek 2


Objednací číslo Určení Ig-třída Substrát Formát EI 2192-9601 M Chlamydia pneumoniae IgM Ag-potažené mikrotitrační jamky

Objednací číslo Určení Ig-třída Substrát Formát EI 2192-9601 M Chlamydia pneumoniae IgM Ag-potažené mikrotitrační jamky Protilátky proti Chlamydia pneumoniae (IgM) Návod na použití ELISA testu Objednací číslo Určení Ig-třída Substrát Formát EI 2192-9601 M Chlamydia pneumoniae IgM Ag-potažené mikrotitrační jamky 96 x 01


23.1.2013 Úřední věstník Evropské unie L 20/35

23.1.2013 Úřední věstník Evropské unie L 20/35 23.1.2013 Úřední věstník Evropské unie L 20/35 PŘÍLOHA PŘÍLOHA VI METODY ZKOUŠENÍ PRO STANOVENÍ SLOŽEK ŽIVOČIŠNÉHO PŮVODU PRO ÚŘEDNÍ KONTROLU KRMIV 1. ÚČEL A ROZSAH Identifikace složek živočišného původu





Fyzikální chemie Ch53 volitelný předmět pro 4. ročník

Fyzikální chemie Ch53 volitelný předmět pro 4. ročník Fyzikální chemie Ch53 volitelný předmět pro 4. ročník Charakteristika vyučovacího předmětu Vyučovací předmět vychází ze vzdělávací oblasti Člověk a příroda, vzdělávacího oboru Chemie. Navazuje na učivo


Gymnázium Christiana Dopplera, Zborovská 45, Praha 5. ROČNÍKOVÁ PRÁCE Teoretické řešení střech

Gymnázium Christiana Dopplera, Zborovská 45, Praha 5. ROČNÍKOVÁ PRÁCE Teoretické řešení střech Gymnázium Christiana Dopplera, Zborovská 45, Praha 5 ROČNÍKOVÁ PRÁCE Teoretické řešení střech Vypracoval: Michal Drašnar Třída: 8.M Školní rok: 2015/2016 Seminář: Deskriptivní geometrie Prohlašuji, že



STATICKÁ ÚNOSNOST 3D MODELU SVĚRNÉHO SPOJE STATICKÁ ÚNOSNOST 3D MODELU SVĚRNÉHO SPOJE Autoři: prof. Ing. Petr HORYL, CSc., Katedra mechaniky, Fakulta strojní, VŠB TU OSTRAVA, e- mail: Ing. Hana ROBOVSKÁ, Ingersoll Rand Equipment


Technická zařízení za požáru. Doplněk k přednáškám ČVUT FEL Požárový jistič

Technická zařízení za požáru. Doplněk k přednáškám ČVUT FEL Požárový jistič Technická zařízení za požáru Doplněk k přednáškám ČVUT FEL Požárový jistič POŽÁROVÝ JISTIČ Nové ochranné přístroje AFDD (Arc Fault Detection Device) v severoamerickém prostoru označované AFCI (Arc Fault


Fraktální analýza tiskových struktur

Fraktální analýza tiskových struktur Fraktální analýza tiskových struktur O. Zmeškal, M. Nežádal, M. Buchníček, J. Fedák * Ústav fyzikální a spotřební chemie, FCH VUT Brno, Purkyňova 118, 612 00 Brno * Katedra polygrafie a aplikované fotochemie,



MODEL HYDRAULICKÉHO SAMOSVORNÉHO OBVODU tředoškolská technika 00 etkání a prezentace prací středoškolských studentů na ČVUT MODEL HYDRAULICKÉHO AMOVORNÉHO OBVODU třední škola technických oborů, Havířov-Šumbark, Lidická a/600, příspěvková organizace.


Měření fotometrických parametrů světelných zdrojů

Měření fotometrických parametrů světelných zdrojů D Měření fotometrických parametrů světelných zdrojů Úkoly : 1. Určete a porovnejte normované prostorové vyzařovací charakteristiky určených světelných zdrojů (žárovek a diod) pomocí fotogoniometru 2. Určete


OBSAH CELÉ DOKUMENTACE ZMĚNY Č. 3. I. Změna č. 3 Územního plánu obce Melč...1-2. II. Odůvodnění změny č. 3 Územního plánu obce Melč...

OBSAH CELÉ DOKUMENTACE ZMĚNY Č. 3. I. Změna č. 3 Územního plánu obce Melč...1-2. II. Odůvodnění změny č. 3 Územního plánu obce Melč... OBSAH CELÉ DOKUMENTACE ZMĚNY Č. 3 I. Změna č. 3 Územního plánu obce Melč...1-2 A. TEXTOVÁ A TABULKOVÁ ČÁST 3-11 B. GRAFICKÁ ČÁST.. 12 B01 - HLAVNÍ VÝKRES S KOMPLEXNÍM ŘEŠENÍM CELÉHO ÚZEMÍ OBCE, REGULACE


Experimenty se systémem Vernier

Experimenty se systémem Vernier Experimenty se systémem Vernier Podchlazená kapalina Petr Kácovský, KDF MFF UK Tyto experimenty vznikly v rámci diplomové práce Využívání dataloggerů ve výuce fyziky, obhájené v květnu 2012 na MFF UK v


M e t o d i c k ý materiál odboru dozoru a kontroly veřejné správy Ministerstva vnitra

M e t o d i c k ý materiál odboru dozoru a kontroly veřejné správy Ministerstva vnitra M e t o d i c k ý materiál odboru dozoru a kontroly veřejné správy Ministerstva vnitra Právní předpisy a jejich ustanovení související se zákonným zmocněním k vydávání obecně závazné vyhlášky obce, kterou


Obecná škola (česká), Dasnice. EL NAD č.: 44-24 -

Obecná škola (česká), Dasnice. EL NAD č.: 44-24 - Obecná škola (česká), Dasnice 1926 1938 EL NAD č.: 44-24 - I. Vývoj původce archivního fondu Úvod Obecná škola s vyučováním v českém jazyku byla v Dasnicích zřízena výnosem ministerstva školství a národní


Komplexotvorné rovnováhy

Komplexotvorné rovnováhy Komplexotvorné rovnováhy ion kovu (analyt) + komplexotvorné činidlo (ligand) rozpustných komplexních sloučenin (koordinační sloučenina) podmínky vzniku: ligand obsahovat alespoň jeden nevazebný elektronový


SPOJE ŠROUBOVÉ. Mezi nejdůleţitější geometrické charakteristiky závitů patří tyto veličiny:

SPOJE ŠROUBOVÉ. Mezi nejdůleţitější geometrické charakteristiky závitů patří tyto veličiny: SPOJE ŠROUBOVÉ Šroubové spoje patří mezi nejstarší a nejpoužívanější rozebíratelné spoje se silovým stykem. Všechny spojovací součástky šroubových i ostatních rozebíratelných spojů jsou normalizované.


Projekt: Inovace oboru Mechatronik pro Zlínský kraj Registrační číslo: CZ.1.07/1.1.08/03.0009 OHYB SVĚTLA

Projekt: Inovace oboru Mechatronik pro Zlínský kraj Registrační číslo: CZ.1.07/1.1.08/03.0009 OHYB SVĚTLA Projekt: Inovace oboru Mechatronik pro Zlínský kraj Registrační číslo: CZ.1.07/1.1.08/03.0009 OHYB SVĚTLA V paprskové optice jsme se zabývali optickým zobrazováním (zrcadly, čočkami a jejich soustavami).


Test genotoxicity na cibuli (Allium cepa)

Test genotoxicity na cibuli (Allium cepa) Test genotoxicity na cibuli (Allium cepa) 1. Účel Test na cibuli (Allium cepa) je účinným pro screening chemických látek a in situ monitoring genotoxicity kontaminantů v životním prostředí. Test se hojně


Vítězslav Bártl. únor 2013

Vítězslav Bártl. únor 2013 VY_32_INOVACE_VB03_K Jméno autora výukového materiálu Datum (období), ve kterém byl VM vytvořen Ročník, pro který je VM určen Vzdělávací oblast, vzdělávací obor, tematický okruh, téma Anotace Vítězslav


Smyslová soustava člověka (laboratorní práce)

Smyslová soustava člověka (laboratorní práce) Zvyšování kvality výuky v přírodních a technických oblastech CZ.1.07/1.1.28/02.0055 Smyslová soustava člověka (laboratorní práce) Označení: EU-Inovace-Př-8-34 Předmět: přírodopis Cílová skupina: 8. třída



RSM WT-2013/ZA-26 TECHNICKÉ PODMÍNKY ROZTOK DUSIČNANU AMONNÉHO A MOČOVINY 1. PŘEDMĚT TECHNICKÝCH PODMÍNEK 1. PŘEDMĚT TECHNICKÝCH PODMÍNEK Předmětem technických podmínek je vodní roztok dusičnanu amonného a močoviny (typ hnojiva C.1.2. dle přílohy I k nařízení 2003/2003), ve kterém molární poměr dusičnanu amonného


N217019 - Laboratoř hydrobiologie a mikrobiologie

N217019 - Laboratoř hydrobiologie a mikrobiologie ÚSTAV TECHOLOGIE VODY A PROSTŘEDÍ 217019 - Laboratoř hydrobiologie a mikrobiologie ázev úlohy: Metody IDEXX využívající technologii definovaného substrátu Vypracováno v rámci projektu: Inovace a restrukturalizace


Výukové texty. pro předmět. Automatické řízení výrobní techniky (KKS/ARVT) na téma

Výukové texty. pro předmět. Automatické řízení výrobní techniky (KKS/ARVT) na téma Výukové texty pro předmět Automatické řízení výrobní techniky (KKS/ARVT) na téma Tvorba grafické vizualizace principu krokového motoru a jeho řízení Autor: Doc. Ing. Josef Formánek, Ph.D. Tvorba grafické


Faremní systémy podle zadání PS LFA s účastí nevládních organizací

Faremní systémy podle zadání PS LFA s účastí nevládních organizací Faremní systémy podle zadání PS LFA s účastí nevládních organizací TÚ 4102 Operativní odborná činnost pro MZe ZADÁNÍ MIMOŘÁDNÉHO TEMATICKÉHO ÚKOLU UZEI Č.J.: 23234/2016-MZE-17012, Č.Ú.: III/2016 Zadavatel:





Protokoly Transformace plasmidu do elektrokompetentních buněk BL21 Pracovní postup:

Protokoly Transformace plasmidu do elektrokompetentních buněk BL21 Pracovní postup: Protokoly Pracovní potřeby, pufry a chemikálie jsou uvedeny na konci protokolu. Pracovní postupy jsou odvozeny od těchto kitů: Champion pet160 Directional TOPO Expression Kit with Lumio Technology (Invitrogen)


205/2002 Sb. ZÁKON. ze dne 24. dubna 2002,

205/2002 Sb. ZÁKON. ze dne 24. dubna 2002, 205/2002 Sb. ZÁKON ze dne 24. dubna 2002, kterým se mění zákon č. 22/1997 Sb., o technických požadavcích na výrobky a o změně a doplnění některých zákonů, ve znění pozdějších předpisů, a některé další


Vyhrubování a vystružování válcových otvorů

Vyhrubování a vystružování válcových otvorů Vyhrubování a vystružování válcových otvorů Vyhrubováním se dosáhne nejen hladších povrchů otvorů, ale i jejich přesnějších rozměrů a správnějších geometrických tvarů než při vrtání. Vyhrubování je rozšiřování
