Breviář forenzní genetiky

Rozměr: px
Začít zobrazení ze stránky:

Download "Breviář forenzní genetiky"

Transkript

1

2

3 Breviář forenzní genetiky Forenzní DNA analýza v otázkách a odpovědích Halina Šimková Tribun EU 2012

4

5 Breviář forenzní genetiky Forenzní DNA analýza v otázkách a odpovědích Halina Šimková recenzovali: doc. Jiří Drábek, Ph.D. Ing. Aleš Hořínek Mgr. Vlastimil Stenzl

6 Tato publikace je spolufinancována Evropským sociálním fondem a státním rozpočtem České republiky z projektu CZ.1.07/2.3.00/ n6gen vzdělávání v oblasti forenzní genetiky. Řešitelem uvedeného projektu je Československá společnost pro forenzní genetiku Publikace obsahuje řadu ilustrativních příkladů užití forenzně genetické expertízy v reálných situacích. Tyto příklady vycházejí ze skutečných případů, na nichž autorka v průběhu své praxe pracovala, či s nimiž se seznámila, jsou však oproti realitě zjednodušeny či pozměněny tak, aby co nejlépe sloužily jako modelové; jsou vynechána či zcela změněna všechna identifikační data týkající se jak osob, tak míst. Halina Šimková, 2012 Illustrations Halina Šimková, 2012 Cover illustrations Halina Šimková, 2012 This edition Tribun EU, 2012 ISBN

7 Obsah Seznam ilustrací... 7 Předmluva Forenzní genetika jako obor Biologické stopy a biologický materiál Obecné pojmy Tkáňový původ, druhový původ a původce biologického materiálu Využitelnost biologického materiálu pro forenzně genetickou analýzu Nakládání s biologickými stopami Vlastnosti a chování biologického materiálu ve stopách Důkazní potenciál stopy Seznámení s genetikou Základní fakta o DNA Základní principy fungování dědičné informace Forenzní potenciál genetické analýzy Individualita a identifikace Určení příbuznosti Predikce biogeografického původu a fenotypových znaků osoby Obecné principy forenzně genetické analýzy Principy identifikace Principy určení příbuznosti Principy predikce biogeografického původu a fenotypových znaků osoby Technologie forenzně genetické analýzy Základní kroky forenzně genetické analýzy Izolace (extrakce) DNA Kvantifikace (a případná charakterizace) DNA Amplifikace DNA Elektroforéza DNA

8 Analýza STR lokusů Analýza HVR mt DNA Analýza SNP lokusů Nakládání se stopami obsahujícími degradovanou DNA a/nebo malá množství DNA Interpretace forenzně genetických dat Obecné kroky a pravidla interpretace dat Spolehlivost dat technická kvalita dat Kvalita v laboratoři Vypovídací hodnota dat Zdroje chyb ve forenzně genetické expertíze Uchovávání zdrojů genetických informací Banky (archivy, depozity) biologického materiálu Banky izolátů DNA DNA databáze Non human forenzní analýza živočišné, rostlinné a mikrobiální DNA Forenzní analýza živočišné DNA Forenzní analýza rostlinné DNA Forenzní analýza mikrobiální DNA Doslov O autorce Doporučená literatura a informační zdroje Rejstřík

9 Seznam ilustrací Obrázek 1 Charakteristiky biologické stopy...20 Obrázek 2 Degradace DNA příčiny...32 Obrázek 3 Odběr biologického materiálu...34 Obrázek 4 Kontaminace stopy...36 Obrázek 5 Primární a sekundární přenos biologického materiálu...44 Obrázek 6 Struktura jednořetězcové DNA...51 Obrázek 7 Struktura dvouřetězcové DNA...52 Obrázek 8 Karyotyp...53 Obrázek 9 Genetický kód...55 Obrázek 10 DNA v lidské buňce...57 Obrázek 11 Variabilita lokusů v DNA...60 Obrázek 12 Meióza (redukční dělení)...62 Obrázek 13 Oplození...63 Obrázek 14 Dědičnost autozomálních lokusů...64 Obrázek 15 Dědičnost Y chromozomálních lokusů...66 Obrázek 16 Dědičnost X chromozomálních lokusů...67 Obrázek 17 Dědičnost mitochondriální DNA...68 Obrázek 18 Genetický profil osoby...71 Obrázek 19 Genetická informace jednovaječných dvojčat...74 Obrázek 20 Genetická informace dvouvaječných dvojčat...76 Obrázek 21 Genetická informace chimérického jedince...78 Obrázek 22 Rodokmen stupeň příbuznosti...87 Obrázek 23 Rodokmen dědičnost autozomálních lokusů...88 Obrázek 24 Rodokmen dědičnost X chromozomálních lokusů...89 Obrázek 25 Rodokmen dědičnost Y chromozomálních lokusů...90 Obrázek 26 Rodokmen dědičnost mitochondriální DNA...91 Obrázek 27 Rodokmen konsangvinita a incest...93 Obrázek 28 Rodokmen mnohotný incest...94 Obrázek 29 Struktura krátké tandemové repetice (STR) Obrázek 30 Alely STR lokusu standardní a mikrovariantní Obrázek 31 Srovnání genotypu stopy a osoby Obrázek 32 Struktura jednonukleotidového polymorfismu (SNP) Obrázek 33 Struktura mitochondriální DNA (mtdna) Obrázek 34 Určení pohlaví

10 Obrázek 35 Základní kroky technologického zpracování stopy Obrázek 36 Princip organické extrakce DNA Obrázek 37 Princip vyvázání enzymatických kofaktorů Obrázek 38 FTA karty Obrázek 39 Vazba DNA na siliku Obrázek 40 Diferenciální lýza Obrázek 41 Laserová mikrodisekce (LCM) Obrázek 42 Spektrofotometrická kvantifikace Obrázek 43 Fluorimetrická kvantifikace Obrázek 44 Specifická kvantifikace princip Obrázek 45 Specifická kvantifikace slot blot hybridizace Obrázek 46 Složení PCR směsi a denaturační fáze PCR Obrázek 47 Anelační a elongační fáze PCR Obrázek 48 Princip elektroforézy DNA Obrázek 49 Princip kapilární elektroforézy Obrázek 50 Monoplexová a multiplexová analýza STR lokusů Obrázek 51 Sekvenace asymetrickou PCR Obrázek 52 Monoplexová a multiplexová analýza SNP lokusů Obrázek 53 Mechanismy degradace DNA Obrázek 54 Klasická a ministr analýza Obrázek 55 Stochastické jevy Obrázek 56 Základní kroky procesu práce s daty Obrázek 57 Možné formy uchovávání zdrojů genetických informací

11 9

12 Motto: Cílem vědy není otvírat dveře nekonečné moudrosti, nýbrž vytknout meze nekonečnému omylu. Eugen Berthold Friedrich Brecht Děkuji recenzentům za všechny cenné připomínky, výtky a postřehy, které nemalou měrou přispěly ke zkvalitnění této publikace. Své rodině pak děkuji za neutuchající podporu, vstřícnost a pochopení. Věnováno mému gymnaziálnímu profesorovi biologie Petru Pačovskému, jehož expresívní líčení tajného vnitřního života buněk, jakož i ostatních mystérií živé přírody, bylo zcela neodolatelné. 10

13 Předmluva, která by neměla zůstat nepřečtena Forenzně genetický posudek bývá silným argumentem jak v oblasti trestního práva, tak v rámci práva občanského. Jako každý takto mocný nástroj může při správném použití velmi účinně pomáhat k nastolení spravedlnosti a práva, při nesprávném použití však může napáchat nesmírné škody. Umět správně vnímat a posoudit výsledky jakékoliv genetické analýzy znamená rozumět alespoň základům věci, principům, které se v genetice uplatňují, a jejich logickým důsledkům. Pro člověka bez přírodovědného vzdělání je ovšem velmi těžké, ba až nemožné porozumět všem zákonitostem, postupům a závěrům tohoto oboru na základě samostudia. Musí to tedy být znalec, kdo se pokusí objasnit všechny aspekty forenzní genetiky řečí srozumitelnou a přístupnou. Tento breviář je proto psán jako populárně naučné pojednání, primárně zaměřené na čtenáře, který má o genetice a forenzní genetice jen základní představu, ale rád by do oboru pronikl hlouběji; rozebírány jsou především univerzálně platné odborné aspekty forenzní genetiky, přičemž publikace se současně záměrně úzkostlivě vyhýbá právním aspektům forenzně genetických zkoumání. Mou snahou bylo podat někdy i poměrně obtížnou problematiku co nejsrozumitelněji, což se místy neobešlo bez určitého vědomého zjednodušování (proto v publikaci najdete řadu příslovcí zpravidla, často, obvykle atd., odkazujících, že zde popsané není jediné možné). Věřím, že takový postup je ku prospěchu věci. Podrobnější informace jsou dohledatelné v odborných publikacích, 11

14 přičemž tipy na některé z nich najde čtenář v závěrečné Doporučené literatuře. Mým přáním je, aby čtenář, ač sám zcela jiného odborného zaměření, pročítal tento breviář s porozuměním a získal díky němu vhled do forenzní genetiky jako oboru možná v detailech složitého, avšak jako celku nesmírně krásného a logického. ve východních Čechách, květen 2012 autorka 12

15 Forenzní genetika jako obor Co je to genetika? Termín genetika pochází z řeckého genetíkos, odvozeného od genesis původ, počátek. V nejširším pojetí je genetika nauka o dědičnosti a proměnlivosti živých organismů a o buněčných základech této dědičnosti, tj. o dědičné informaci nesené v DNA. Co je to forenzní? Termín forenzní pochází z lat. forensis, odvozeného od forum náměstí. Na náměstí v antickém Římě se konala veřejná soudní jednání a slovo forenzní dnes používáme ve významu týkající se soudu či dokazování. Co je to forenzní genetika? Forenzní genetika, též označovaná jako forenzní DNA analýza, je v nejširším pojetí věda zabývající se genetickým zkoumáním pro potřeby dokazování a objasňování v trestních i civilních řízeních před státními orgány, ale též pro potřeby posuzování hypotéz mimo tato řízení např. v rámci jiných vědních oborů nebo v soukromých záležitostech fyzických osob. Jaká jsou hlavní aplikace forenzní genetiky? Základními aplikacemi forenzní genetiky jsou: kriminalistika, identifikace a posuzování biologické příbuznosti jedinců. Tyto směry pochopitelně nejsou striktně oddělené a často se vzájemně prolínají. Kriminalistická genetika zabývá genetickým zkoumáním biologických stop a srovnávacích vzorků osob v rámci vyšetřování a dokazování trestných činů či jiných kriminalisticky relevantních 13

16 událostí. Hlavním účelem těchto zkoumání zpravidla bývá určení původce příslušných biologických stop. Identifikační genetika se zabývá genetickou identifikací osob živých (imigrační řízení, ověřování totožnosti atd.) či mrtvých (nálezy neznámých mrtvol, hromadná neštěstí, oběti válečných konfliktů v hromadných hrobech atd.). Posuzování biologické příbuznosti jedinců zahrnuje zejména paternitní zkoumání v případech, kdy je třeba určit otce dítěte, ale též posuzování jiných biologických příbuzenských vztahů pro nejrůznější účely (dědická řízení, genealogická zkoumání atd.). Jaké další aplikace forenzní genetika má? Forenzně genetická analýza se uplatňuje dále v chovatelství, zemědělství a potravinářství (zkoumání pravosti rostlinných a živočišných produktů, identifikace zvířecích jedinců, rodokmenové studie chovných zvířat, identifikace rostlinných odrůd a živočišných plemen atd.). V archeologii se uplatňuje forenzní genetice velmi blízká archeogenetika neboli analýza starodávné DNA adna (angl. ancient DNA), užívaná ke zkoumáním archeologického biologického materiálu, jako jsou lidské i zvířecí kosterní nálezy, ale též tkáně mumií, rostlinný materiál atd. Rovněž některé okruhy lékařské genetiky jsou s forenzní genetikou metodicky téměř totožné; spadají sem například identifikace buněčných linií, průkaz ztráty heterozygozity nebo mikrosatelitové nestability (u pacientů s nádorovým onemocněním), průkaz monozygozity dvojčat (v případech závažného dědičného onemocnění u jednoho z dvojčat), průkaz či vyloučení paternity (v případě neočekávaného výsledku popírajícího základní pravidla genetiky při nepřímé DNA 14

17 diagnostice v rodině postižené dědičným onemocněním) nebo určování chromozomálních odchylek plodu analýzou plodové vody, choriových klků či fetální krve. Kdy poprvé byla forenzně genetická analýza použita? Poznatky genetiky jsou v rámci forenzních zkoumání uplatňovány již několik desítek let. Typickým příkladem je posuzování příbuznosti osob na základě znalosti principů dědičnosti krevních skupin. Tyto postupy však nepracují přímo s rozborem DNA, pouze se znalostmi dědičnosti určitých znaků. Zásadním milníkem v historii forenzní genetiky se stal převratný objev, který učinil v roce 1984 britský vědec Alec John Jeffreys, genetik působící na univerzitě v Leicesteru. Při studiích věnovaných zkoumání variability genových rodin mimochodem nalezl metodu, kterou bylo možno zobrazit genetickou jedinečnost každého člověka. Tuto metodu nazval DNA fingerprinting, tedy genetický otisk prstu. První reálný případ, v němž byl užit DNA fingerprinting k identifikaci pachatele, byly vraždy a znásilnění Lyndy Mann ( 1983) a Dawn Ashworth ( 1986) v hrabství Leicestershire. Biologické stopy, zajištěné v obou případech, byly analyzovány roku 1987 Alecem Jeffreysem jeho metodou DNA fingerprintingu a posléze úspěšně ztotožněny s konkrétním mužem místním pekařem Colinem Pitchforkem. V našem prostředí byla forenzně genetická analýza poprvé použita v čerstvě porevolučním Československu; v červnu 1990 byla na dámském WC Pedagogické fakulty Masarykovy univerzity v Brně brutálně napadena a ubodána devatenáctiletá studentka Jana Krkošková. Na místě činu byly mimo jiné zajištěny krevní kapky, které mohly vzniknout otřepáním poraněné ruky. Krátce nato byl 15

18 zadržen podezřelý již dříve pro sexuální napadení trestaný Milan Lubas. Průlomový znalecký posudek, který jasně ztotožnil krevní kapky z místa činu s tímto podezřelým a naopak krevní stopy z jeho oděvu se zavražděnou, zpracoval Doc. RNDr. Vladimír Ferák, CSc., vedoucí katedry genetiky a molekulární chemie Přírodovědecké fakulty Univerzity Komenského v Bratislavě. První expert Kriminalistického ústavu Praha a rovněž velmi významný průkopník oboru, RNDr. Jaroslav Brouček, CSc., začal na kriminálních případech pracovat roku 1992, kdy byl také vyškolen u FBI. Jak se obor změnil od dob prvních analýz? Přestože původní Jeffreysova metoda byla ve své době zcela převratná, měla některá omezení: především k úspěšné analýze bylo třeba relativně velké množství biologického materiálu, obsahujícího nedegradovanou či jen málo degradovanou DNA, a rovněž získaná data nebylo možno jednoduše databázovat a vzájemně ve větším objemu porovnávat. Další vývoj tedy směřoval k práci se vzorky degradovanými a s malým množstvím využitelné DNA, přičemž původní Jeffreysova metoda byla zcela opuštěna a nahrazena metodami založenými na amplifikaci, tj. zmnožování DNA ve vzorku. Tyto nové metody navíc poskytují data snadno převoditelná do digitální podoby, a tudíž mnohem vhodnější pro elektronické databázové zpracování. Kam nyní forenzní genetika směřuje? Hlavními vytýčenými současnými směry rozvoje jsou zrychlení a automatizace analýz včetně získání výsledků v reálném čase přímo na místě činu, práce s vysoce problematickými vzorky (včetně snížení hranice detekčního limitu pří zachování kvality analýz) a rozšíření potenciálu oboru na prediktivní analýzy (tj. stanovování 16

19 určitých tělesných charakteristik osob ze stop na místě činu). Pozornost oboru se též obrací k metodám umožňujícím určovat a tkáňový původ stopy molekulárně genetickými metodami a též určovat stáří stopy. 17

20 Biologické stopy a biologický materiál Obecné pojmy Co je to biologický materiál? Jako biologický materiál obecně označujeme vše, co bylo či je součástí nebo produktem živého organismu. Biologický materiál tak může mít nesmírně mnoho podob: může jím být sušená bylinná čajová směs stejně jako prázdná motýlí kukla, ohryzek jablka, moč v toaletě, modřínové prkno, krev na náplasti v odpadkovém koši, koňský trus, zkumavka s virem Eboly, cukrářské droždí, hovězí steak, kožešinový límec atd. Co je to biologická stopa? Biologický materiál, který je zajištěn například na místě trestného činu a stane se předmětem znaleckého zkoumání, je označován jako biologická stopapřestože z výše uvedeného příkladmého seznamu se znalec zcela jistě nejpravděpodobněji setká s krvavou náplastí, v určitých zvláštních situacích mohou být předmětem jeho zkoumání i ostatní uvedené materiály. Obecně tedy lze jen velmi obtížně vymezit, jaký typ biologického materiálu může být forenzně zkoumán. Vždy to záleží na konkrétní situaci. Kdy by kupříkladu připadalo v úvahu forenzně biologické a genetické zkoumání hovězího steaku? Třeba tehdy, pokud by skot v daném státě byl zasažen určitou infekční chorobou, například kravskou chřipkou (taková nemoc sice zatím neexistuje, ale média ji jistě dříve nebo později objeví...). Příslušná veterinární správa v této situaci často nařídí likvidaci zasažených chovů. Pokud by se objevilo podezření, že někdo z chovatelů nařízení nedodržel a zvířata z porážky neskončila v kafilérii, nýbrž na stolech nic netušících strávníků, lze v principu 18

21 forenzně genetickou analýzou dohledat přesný původ takového podezřelého masa. V praxi se velmi často setkáme s tím, že stopa je jako biologická označena už kriminalistickým technikem při zajištění. To ovšem může být někdy zavádějící: pouze a jedině znalec totiž může určit, zda stopa má skutečně povahu biologického materiálu či nikoli. Zatímco někdy je tato biologická povaha stopy zjevná, a to i laikovi (např. červenohnědá hmota na dámské hygienické vložce, mléčně bělavá vazká hmota uvnitř použitého prezervativu atd.), jindy je přítomnost biologického materiálu ve stopě pouze suspektní (kupříkladu nedopalek cigarety sice biologický materiál obsahuje často, ale ne vždy; světlejší červenohnědé skvrny na oděvu mohou a nemusejí být krví, a to dokonce i tehdy, reagují li pozitivně na orientační testy, o nichž budeme mluvit později; atd.). V případu obchodování s bílým masem byly postupně na různých místech činu zajišťovány nedopalky cigaret, a to vždy několika značek; analýza byla bezproblémová, pouze u jedné konkrétní značky cigaret se nikdy nepodařilo izolovat detekovatelné množství DNA a určit genetický profil osoby, což bylo zvláštní. Po vyřešení případu se příčina vyjasnila: jedna z pachatelek nosila s oblibou dámské rukavičky a cigarety kouřila s použitím cigaretové špičky, takže nedošlo ke kontaktu cigarety se rty. Tkáňový původ, druhový původ a původce biologického materiálu U biologických stop nás obvykle nejvíce zajímá, jaký tkáňový původ biologický materiál má, z jakého organismu pochází (tzv. druhový původ) a kdo je jeho konkrétním původcem. 19

22 Obrázek 1 Charakteristiky, které zpravidla chceme znát u biologické stopy: tkáňový původ, druhový původ a původce. Co je to tkáňový původ (též označovaný jako druh) biologického materiálu? Tkáňovým původem (druhem) biologického materiálu rozumíme typovou podstatu materiálu tedy zda se jedná o krev, sperma, sliny, moč, výkaly, poševní materiál, povrchové epitelie kůže atd. Určení se provádí především mikroskopickými, biochemickými a imunologickými zkouškami, v relativně blízké budoucnosti pak lze v této oblasti očekávat rovněž nástup molekulárně genetické diagnostiky. 20

23 Jaký je rozdíl mezi orientační a specifickou zkouškou tkáňového původu biologického materiálu? Orientační a specifické zkoušky se liší svou vypovídací hodnotou, cenou a rychlostí provedení. Pozitivní výsledek orientační zkoušky indikuje, že by se mohlo (ale nemusí!) jednat o daný materiál (např. pozitivní výsledek orientačního testu přítomnosti krve znamená, že testovaná skvrna by mohla být krev; může se však jednat i např. o ovocnou šťávu). Orientační zkoušky bývají zpravidla levné a rychlé, s nízkou frekvencí falešně negativních výsledků a s vyšší frekvencí falešně pozitivních výsledků. Bývají zaměřeny na detekci přítomnosti určitých chemických látek či enzymů, nebo jsou to zkoušky fyzikální povahy užití alternativních světelných zdrojů. Naproti tomu pozitivní výsledek specifické zkoušky prokazuje, že se s určitostí jedná o daný materiál (např. pozitivní výsledek specifického testu přítomnosti spermatu znamená, že testovaná skvrna je s určitostí sperma). Specifické zkoušky bývají obvykle zaměřeny na detekci přítomnosti specifických bílkovin, hormonů a podobně. Nutno však mít na paměti, že i nejspecifičtější zkouška může s určitou velmi malou pravděpodobností poskytovat falešně pozitivní výsledek. Kdy má smysl tkáňový původ biologického materiálu stanovovat? Stanovení tkáňového původu materiálu je důležité zejména tehdy, kdy nám tato informace poslouží k potvrzení či vyvrácení našich hypotéz. 21

24 Zatímco v některých případech je typ biologického materiálu irelevantní, jindy může zásadně změnit pohled na hodnotu DNA profilování a důkazu jako takového. V případu znásilnění byly ke zkoumání předloženy dvě věcné stopy: domácí telefon a parafínová svíce. Poškozená uváděla, že pachatel jí do pochvy nejprve zasouval svíčku, poté na ní vykonal soulož s ejakulací do pochvy a nakonec jí do pochvy zasouval sluchátko domácího telefonu. Obviněný toto popíral. Biologickou a genetickou analýzou byla na svíci zjištěna přítomnost většího množství poševních epitelií poškozené, na sluchátku telefonu byla zjištěna přítomnost směsi poševních epitelií poškozené a spermatu obviněného. Tato zjištění významně podpořila pravdivost výpovědi poškozené. Bez stanovení tkáňového původu biologického materiálu by v tomto případě důkazní hodnota stop značně klesla (samotné genetické zkoumání by se omezilo na konstatování, že na svíci se nachází neurčený biologický materiál poškozené a na sluchátku směs neurčených biologických materiálů poškozené a obviněného, kteří oba mohli telefon používat k jeho původnímu účelu). Kdy nemá smysl tkáňový původ biologického materiálu stanovovat? Zatímco ve výše uvedeném příkladu je určení tkáňového původu biologického materiálu zcela zásadní, jindy je tato analýza nadbytečná až zbytečná a někdy může být i ke škodě věci. Především u stop s předpokládaným malým až velmi malým obsahem biologického materiálu je vhodné vždy pečlivě uvážit, jak moc je stanovení tkáňového původu materiálu přínosné a potřebné, neboť toto stanovení téměř vždy znamená odebrání určitého množství materiálu ze stopy. Typickou situací je požadavek na průkaz slin a lidské bílkoviny v nedopalku spojený s požadavkem na stanovení genetického 22

25 profilu osoby. Poměrně často totiž po provedení zkoušky na přítomnost slin a lidské bílkoviny již pro genetickou analýzu zbývá tak málo materiálu, že se nepodaří požadovaný genetický profil stanovit v potřebné kvalitě. Přitom detekce slin a lidské bílkoviny je zde ve své podstatě bezpředmětná, jelikož sama o sobě nemá žádnou důkazní hodnotu: pokud se v nedopalku nachází biologický materiál, pak to v drtivé většině případů jsou lidské sliny a epitelie ústní sliznice či pokožky rtů, případně s malou příměsí krve (např. při zánětu dásní, oparu atd.); s případem, kdy by se v nedopalku nacházelo například prasečí sperma či kočičí moč, se pokud je mi známo žádný znalec dosud nesetkal. Dříve tyto testy mohly najít své opodstatnění jako jakési síto k oddělení stop nepoužitelných pro genetické zkoumání (kupříkladu u zmíněných nedopalků nepřítomnost slin a lidské bílkoviny indikovala nemožnost stanovit genetický profil). V dnešní době je už tento přístup ale překonán, neboť jednak forenzní genetika disponuje mnohem přesnějšími metodami posouzení obsahu využitelného biologického materiálu ve stopě, jednak i z nedopalků s negativním výsledkem testu na přítomnost slin lze někdy stanovit relevantní genetický profil. Co je to určení druhového původu a průkaz lidského původu? Určení druhového původu materiálu, tedy zjištění, z jakého rostlinného či živočišného druhu stopa pochází, hraje (na rozdíl od určení druhu biologického materiálu) obvykle roli zásadní, přičemž nejčastěji jde o průkaz lidského původu daného materiálu. Lze jej provést samostatně imunologickými metodami (reakcí lidské bílkoviny se specifickou protilátkou), častěji ale tento průkaz lidského původu vyplyne samovolně, jako vedlejší produkt z výsledku genetického zkoumání. Většina forenzně genetických testů užívaných k analýzám lidského biologického materiálu totiž 23

26 poskytuje standardní pozitivní výsledek právě jen a pouze u lidského materiálu říkáme, že tyto testy jsou druhově specifické. Tedy: poskytne li analýza stopy pozitivní výsledek, lze zpětně konstatovat, že stopa obsahovala s jistotou lidský biologický materiál. Z tohoto důvodu se od imunologického průkazu lidské bílkoviny většinou upouští, a to zejména u stop s předpokládaným malým či velmi malým množstvím využitelného biologického materiálu (důvody jsou obdobné jako u již zmiňovaného určování druhu biologického materiálu). Na policii se dostavila žena, živící se jako prostitutka, a vypověděla, že předchozího dne měla konflikt se zákazníkem, který vyvrcholil tím, že muž jí začal vyhrožovat zabitím. Jako důkaz, že svá slova míní vážně, ji odvedl ke kufru auta a ukázal jí v něm ležící mrtvolu muže. Poté odjel. Podle popisu byl tento zákazník v relativně krátké době nalezen, přičemž v kufru jeho auta byly skutečně zjištěny krevní otěry. Podezřelý se hájil tím, že se jedná o krev zvířecí, jelikož je členem mysliveckého svazu. Jak imunologická, tak genetická analýza však toto tvrzení jednoznačně vyvrátily bylo potvrzeno, že se jedná o krev lidskou, a genetickou analýzou byl stanoven genetický profil osoby mužského pohlaví. Podezřelý k věci odmítl dále vypovídat. Pokud je mi známo, mrtvola muže nebyla dosud nalezena a nebyla ani zjištěna jeho možná totožnost. Lze prokázat i jiný než lidský původ? Ve zvláštních případech je třeba specificky prokázat i jiný než lidský původ například psí, králičí atd. Zde je nejčastěji využíváno imunologické analýzy, založené na reakci s určitým specifickým sérem. Genetické analýzy se v tomto směru v České republice využívají spíše omezeně, nicméně v principu platí totéž, co bylo řečeno u průkazu lidského původu: pozitivní výsledek určitého druhově specifického genetického zkoumání je současně potvrzením, že stopa byla tvořena biologickým materiálem daného 24

27 druhu. Genetickým analýzám jiného než lidského biologického materiálu je věnována samostatná kapitola na konci tohoto breviáře. Co je to určení původce biologické stopy? Pomyslnou nejvyšší metou, jíž lze forenzně genetickým zkoumáním dosáhnout, je určení zdroje, původce stopy, tedy konkrétního jedince, jehož biologickým materiálem je stopa tvořena tedy např. Karel Novák, r.č /7890, pes Haryk majitele Františka Flinty atd. Jednoznačné určení původce stopy nazýváme individuální identifikace. Využitelnost biologického materiálu pro forenzně genetickou analýzu Jaký biologický materiál je pro forenzně genetickou expertízu vhodný? Obecně je forenzní analýza úspěšně aplikovatelná na jakýkoli materiál, obsahující DNA v množství a kvalitě dostatečné k jejímu provedení, což je, přiznejme si, definice kruhem (bohužel však jediná vystihující podstatu věci). Úsloví, pocházející dle Oxford Dictionary of Citations snad už z počátku 14. století, říká: Zda je puding k jídlu, to se pozná při jedení! ( The proof of the pudding is in the eating! ) Stejně tak my můžeme říci: Zda je materiál analyzovatelný, to se pozná při analýze! Je nějaký zásadní rozdíl ve využitelnosti biologických materiálů analyzovaných v rámci jednotlivých aplikací forenzní genetiky? V praxi je velmi podstatný principiální rozdíl mezi analýzami biologických stop a analýzami řízeně odebraných vzorků osob 25

28 (např. při určování příbuznosti). Kriminalistické analýzy biologických stop jsou charakteristické tím, že znalec nemá žádnou možnost volby, výběru biologického materiálu, musí pracovat s tím, co je; navíc se jedná o vzorky často velice nestandardní co do kvantity i kvality obsažené DNA. Stejně problematické mohou být i materiály z těl vysokého stupně rozkladu či kosterních nálezů. Naproti tomu řízené odběry srovnávacích vzorků umožňují obvykle vybrat nejvhodnější materiál pro danou expertízu, zaručující dostatečné množství kvalitní DNA pro její provedení. Jaké materiály jsou zajišťovány jako srovnávací vzorky osob? V současnosti nejběžnějším srovnávacím vzorkem biologického materiálu je bukální stěr, což je otěr sliznice vnitřní strany tváře (tedy v ústech) na odběrový tampón či kartáček. Odběr je rychlý, nebolestivý a neintimní, může ho provádět osoba sama či libovolný k tomu pověřený pracovník, navíc odebraný materiál se následně velmi dobře a nenáročně uchovává, a to i po dlouhou dobu. Dříve běžně odebíraným, dnes již spíše opouštěným srovnávacím vzorkem je periferní žilní krev, zajišťovaná nejčastěji klasicky odběrem ze žíly v loketní jamce, případně u novorozenců a kojenců ze žíly na hlavičce (stejně, jako při běžných zdravotnických vyšetřeních). Odběr je rovněž rychlý, avšak spojený s jistou dávkou diskomfortu (bolest, nepříjemné pocity) a za současného narušení integrity těla včetně nenulového (byť nepatrného) rizika infekce, musí ho provádět zdravotnický personál a vzorky se o něco náročněji uchovávají. Pro forenzně genetickou analýzu mohou být principiálně použity i krevní vzorky zajištěné pro jiný účel (např. ke zdravotnickému vyšetření), záleží však na způsobu zajištění, zejména na použitém protisrážlivém médiu, a též na způsobu nakládání se vzorkem před předáním k forenzní analýze. Na tom lze 26

29 demonstrovat, jak neostré jsou hranice mezi zdravotnickými a forenzními aplikacemi. Jednoho vlahého večera zastavila policie mladého řidiče a po kontrole dokladů jej podrobila dechové zkoušce na alkohol. Vzhledem k tomu, že test byl pozitivní, byl řidič převezen do zdravotnického zařízení na odběr krve, který původní podezření jednoznačně potvrdil. Kauza se tak dostala do roviny trestní, ovšem majitel osobního dokladu pan Karel před soudem argumentoval, že to nebyl on, kdo řídil, a že na místě trestního činu v té době vůbec nebyl. Byl proto ustanoven soudní znalec v oboru DNA analýzy, jehož úkolem bylo pouze odpovědět na v podstatě jednoduchou otázku byl pan Karel opravdu oním řidičem, kterému byla odebrána krev na alkohol? Po porovnání profilu pana Karla a profilu z testované krve bylo již na první pohled jasné, že pan Karel oním řidičem nebyl, neboť dané profily se jednoznačně lišily. Tím vše mohlo skončit a kauza mohla být uzavřena. Pozorný znalec si však všimnul, že ve velké části testovaných lokusů měl pan Karel s neznámým řidičem jednu alelu shodnou, což napovídalo hypotéze o existenci biologického příbuzenského vztahu. DNA obou byla proto navíc ještě přetestována na haplotyp Y chromozómu, neboť pokud by muži byli příbuzní po paternální linii, musel by být haplotyp Y chromozomu naprosto shodný, což se následně opravdu potvrdilo. Neznámý však nemohl být otec pana Karla, neboť ve třech autozomálních lokusech byl jako jeho otec vyloučen (vzorky neměly společné alely). Jako nejpravděpodobnější byla znalcem označena hypotéza, že se jedná o bratry, čemuž by napovídal i podobný věk a podoba neznámého. Jak jest patrno, vzorek původně odebraný pro toxikologické vyšetření byl následně použit k identifikaci (tedy v oblasti forenzní analýzy) a ještě později se zkoumání přesunulo do sféry určení biologické příbuznosti. Ve zvláštních případech mohou být zajišťovány i jiné typy srovnávacích vzorků živých osob, například odstřižené nehty či 27

30 kožní seškraby; děje se tak například při genetických výzkumech lidských přírodních populací, u nichž by se odběr jiného typu vzorku nesetkal s porozuměním. Pro vyšetření dosud nenarozených dětí (embryí či plodů) může být použita plodová voda odebraná amniocentézou (AMC), choriové klky odebrané choriocentézou (CVS) či pupečníková krev plodu odebraná kordocentézou (CC); některé genetické testy mohou být provedeny i analýzou fetální DNA, která je přítomna v krvi matky. Zde je třeba důrazně upozornit, že odběr plodové vody, choriových klků i pupečníkové krve jsou invazivní metody spojené s nezanedbatelným rizikem pro plod (udávané riziko potratu po odběru je cca 0,5 1%) a mohou být provedeny pouze ze zdravotních důvodů k potvrzení či vyloučení závažné genetické odchylky plodu (např. Downův syndrom). Zbytková část materiálu z takového odběru může být použita pro forenzní účely (např. určení otcovství), pro čistě forenzní účel však nelze tento odběr z etických důvodů nařídit, požadovat ani doporučovat (s analýzou je potom třeba počkat až po narození dítěte). Vyvraťme zde jeden hluboce zakořeněný mýtus, který stále přetrvává, totiž tvrzení, že paternitní analýzu lze provést až v jednom roce věku dítěte. Pro to neexistují žádné odborné ani právní důvody. Analýza je technicky proveditelná již v okamžiku narození dítěte a jak se lze dočíst v předchozím odstavci v případě, že je dostupný materiál plodu, pak už v průběhu těhotenství. Komerční novinkou jsou dokonce paternitní testy plodu z krve matky, které je možno provést již od cca týdne těhotenství. V případě potratu (spontánního nebo při umělém ukončení těhotenství) může být k analýze použit plodový materiál zajištěný z dutiny děložní; zde je třeba upozornit, že u velmi raných fází těhotenství je velikost embrya velmi malá (v 5. týdnu těhotenství cca 4 5 mm) a rozpoznání embryonální tkáně ve směsi s dalším 28

31 odsátým materiálem děložní sliznice může být dosti problematické. V pozdějších stádiích již rozpoznání embrya problém nečiní. U mrtvých osob je škála srovnávacích vzorků mnohem pestřejší: dle stavu rozkladu těla mohou být odebrány krev, svalová tkáň, kůže, nehty, zuby, tkáň některých orgánů nebo kost. Tyto srovnávací vzorky mohou být zejména u těl ve vyšším stupni rozkladu kvůli degradaci již poměrně náročné na získání analyzovatelné DNA, a tedy se často svým charakterem blíží spíše stopám. U pohřešovaných či již dříve zemřelých osob jsou za srovnávací vzorky považovány materiály nejrůznější povahy, které lze s velkou pravděpodobností osobě přisoudit, například materiál v jejím zubním kartáčku, materiál z jejích osobních předmětů či materiál zajištěný a deponovaný pro zdravotní účely (parafínem fixované tkáně z biopsií, mikroskopické preparáty atd.). Všechny tyto vzorky jsou co do kvality a kvantity DNA opět spíše povahy stop, a tak je s nimi také nakládáno. Nevhodnými srovnávacími vzorky jsou odstřižené či vypadlé vlasy a chlupy, které obsahují jen velmi malá množství jaderné DNA. Nakládání s biologickými stopami Biologické stopy mohou být velmi cennými, často i rozhodujícími důkazy o vině či nevině. Aby takto mohly posloužit, je ale nezbytné s nimi správně nakládat, tedy je třeba dodržovat určité postupy a zásady, popsané níže. Nevhodné zajištění, nesprávné uchovávání, neopatrná manipulace to vše může stopu částečně nebo úplně znehodnotit nebo v horším případě dokonce změnit tak, že genetická analýza poskytne zcela falešný výsledek. 29

32 Jak se vyhledávají stopy? Lakonicky řečeno: aby mohla stopa posloužit jako důkaz, je třeba ji nejprve najít. To se zdá být samozřejmé, avšak ve skutečnosti to někdy může představovat zdlouhavou a vyčerpávající činnost. Stopy můžeme z tohoto hlediska rozdělit do několika kategorií: 1. stopy markantní, viditelné okem i při zběžném pohledu 2. stopy viditelné okem při podrobném ohledání 3. stopy okem neviditelné, avšak detekovatelné zvláštními testy 4. stopy zcela latentní Do první kategorie spadají nepřehlédnutelné stopy, jako jsou tratoliště krve a další velké krevní stopy, velké skvrny spermatu (na oděvu, ložním prádle apod.), lejno atd. Vyhledání těchto stop nečiní potíž ani naprostému laikovi a stopy lze obvykle snadno zajistit. Do druhé kategorie lze zařadit drobné biologické stopy, jako jsou kupříkladu krevní kapky a otěry, zaschlý nosní sekret, vlasy, stopy slin na skleničkách atd. Kvůli malé velikosti může být jejich vyhledání někdy obtížnější, avšak stále jsou zjistitelné pouhým okem. Třetí kategorii tvoří stopy neviditelné, které ale lze odhalit s použitím speciálních pomůcek či postupů. Těmi mohou být například monochromatické forenzní světelné zdroje (forenzní baterky ), které dle použité vlnové délky pomohou zviditelnit určitý konkrétní druh biologického materiálu. Obecně známé pak je vyhledávání velmi zředěných (a tudíž okem neviditelných) krevních stop pomocí chemických činidel světélkujících při kontaktu s krví (např. Luminol, FastBlue). 30

33 Latentní stopy, tvořící čtvrtou kategorii, nemohou být detekovány ani okem, a prozatím ani pomocí screeningových testů. Typickým příkladem takové stopy jsou povrchové kožní buňky ulpivší na telefonním sluchátku. Tyto stopy se tudíž zajišťují naslepo : jsou odebírány v místech, kde výskyt biologického materiálu předpokládáme. Úspěšnost při jejich zajišťování tak závisí především na dobrém odhadu a zkušenostech toho, kdo je zajišťuje. Často ke zkoumání předkládanou věcnou stopou bývá pokrývka hlavy, kterou pachatel ztratil na útěku. Zkušený znalec odebírá stěry najisto u okraje v oblasti záuší, kde pokrývka nejtěsněji přiléhá k hlavě a při nošení dochází k drobným pohybům, při nichž se odírají buňky pokožky. Velmi cenným vodítkem při vyhledávání stop mohou být i výpovědi aktérů události. Oběť znásilnění, ke kterému došlo v lednu v noci za opuštěnou vlakovou zastávkou, vypověděla, že pachatel ejakuloval volně mimo její pochvu; podle přesného popisu míst, kde se při tom oběť a pachatel nacházeli, se kriminalistickému technikovi podařilo najít ve sněhu malou proláklinu, která mohla být způsobena dopadem teplého spermatu. Stopu proto po konzultaci se znalcem zajistil uválením do tvaru sněhové koule o průměru cca 30 cm a takto byla transportována do laboratoře. Ve stopě byla po rozpuštění prokázána přítomnost spermatu a byl stanoven genetický profil, který byl posléze ztotožněn s natipovaným podezřelým. Bez použití informací z výpovědi poškozené by tato stopa zřejmě nebyla nikdy nalezena. Jaká jsou pravidla zajišťování stop? Zajišťování biologických stop pro forenzně genetické zkoumání je nezbytné provádět tak, aby: 31

34 1. nedošlo k degradaci stopy (zničení biologického materiálu) 2. bylo odebráno co možná největší množství biologického materiálu (toto neplatí jen u rozsáhlých stop, jako jsou například krevní tratoliště) 3. nedošlo ke kontaminaci stopy (vnesení cizorodého biologického materiálu). Jak zabránit degradaci stopy? Poškození či úplné zničení biologického materiálu, spojené s poškozením v něm přítomné DNA tzv. degradací DNA, hrozí tehdy, když stopu vystavíme nevhodným fyzikálním, chemickým či biologickým vlivům. Obrázek 2 Řada přírodních činitelů může způsobit nevratné poškození molekul DNA ve stopě; tento proces označujeme jako degradaci DNA. 32

35 Blíže se o tom zmíníme později, zde pouze stručně: rozkladné procesy jsou urychlovány vysokou teplotou a vlhkem, jež podporují rychlý růst bakterií; nevratné chemické změny v dvoušroubovici DNA způsobuje UV záření tedy např. přímo dopadající sluneční paprsky, stejně jako působení některých chemikálií. Degradaci DNA lze zabránit pouze vytvořením správných předpisů týkajících se zajišťování stop a následným dodržením v nich uvedených postupů. Jak zajistit dostatek materiálu ze stopy? Dostatečné množství zajištěného biologického materiálu zvyšuje naději na pozitivní výsledek analýzy. Je důležité i proto, že někdy se objeví potřeba stopu reanalyzovat (například při požadavku na vypracování revizního posudku superposudku). Nejvhodnější je vždy dopravit stopu do laboratoře i s podkladem či přímo předmětem, na němž se nachází. V některých případech to ovšem není technicky možné (stopy na velmi rozměrných předmětech, stopy na těle atd.) potom musí odběr biologického materiálu provést na místě kriminalistický technik nebo musí být znalec povolán na místo činu. V praxi je většina latentních (dotykových stop) zajišťována na místě trestného činu stěrem místa s předpokládaným výskytem biologického materiálu. Pro zajištění kriminalistických stop již existují specializované pomůcky, které mimo jiné zaručují, že ze stopy bude odebráno velké množství materiálu. Kupříkladu speciální forenzní nylonové mikrokartáčky, jimiž se provádějí stěry, dokážou materiál zachytit mnohonásobně efektivněji než běžné vatové tampóny. To má význam zejména u latentních stop minimálních rozměrů. Nutno ovšem říci, že pořizovací cena těchto pomůcek bývá zpravidla také mnohonásobně vyšší, a jejich plošné používání tak v praxi naráží na nedostatek financí ve státním sektoru. Jak bude na příkladu ukázáno níže, někdy se šetření projeví jako nemístné škudlilství. 33

36 Obrázek 3 Užitím speciálních odběrových pomůcek pro forenzní účely můžeme zajistit z biologické stopy významně větší množství biologického materiálu (a tedy izolovat více DNA) než při užití běžného zdravotnického tampónu. Jak zabránit kontaminaci stopy? Vnesení nepůvodního biologického materiálu do stopy tzv. kontaminace stopy je z hlediska svých důsledků nejzávažnější chybou při zajišťování. Zdrojem cizorodé DNA přitom může být jiná stopa, zajišťovací pomůcka kupříkladu nevhodný odběrový tampón, osoba manipulující se stopou nebo (což je zcela jistě největší noční můrou) srovnávací vzorek osoby zasílaný spolu se stopami. Těmto chybám se lze vyhnout pouze striktním dodržením několika zásad: 1. Je li zajišťováno více stop, je nutno s nimi manipulovat odděleně, a to až do momentu, kdy jsou řádně zabaleny a označeny. 2. Používat tzv. DNA free (=neobsahující DNA) zajišťovací pomůcky, především odběrové tampóny a vodu. Někdy jsou za vhodné mylně považovány pomůcky STERILNÍ. Ovšem: sterilní znamená, že pomůcka neobsahuje 34

37 infekční agens (živé bakterie, viry, plísně, kvasinky apod.). Pro odběr stop je ale třeba, aby pomůcka neobsahovala žádnou DNA, zejména ne lidskou. Němečtí kriminalisté se jen pomalu a obtížně vzpamatovávají z fatálního omylu, který proslul jako Fantom z Heilbronnu. Od roku 1993 zajistili v celkem 40 trestných činech včetně šesti vražd biologické stopy vykazující jeden a týž genetický profil, náležející neznámé ženě. Sekvenací mitochondriální DNA a analýzou evolučního původu bylo určeno, že tato žena monstrum může velmi pravděpodobně pocházet z východní Evropy. Skutky páchala na území celého Německa, dokonce i v Rakousku a Francii, nikdy však v Bavorsku. Policie po mnoha letech neúspěšného pátrání dokonce vypsala odměnu 300 tisíc euro za informace vedoucí k dopadení této pachatelky. Obrat nastal, když byl její genetický profil zjištěn i na spáleném těle prokazatelně mužského žadatele o azyl ve Francii. Vzniklo podezření, že DNA tajemné ženy se do odběrových tampónů dostala již během jejich výroby. Všechny tampóny použité v případech připisovaných Fantomovi totiž pocházely od jediné firmy, rakouské Greiner Bio One International AG, a byly určeny pro užití ve zdravotnictví. Proto byly po zabalení sterilizovány, což v nich sice zahubilo všechny bakterie, ovšem neodstranilo DNA. Kvůli příznivé ceně byly ve velkém nakupovány i policejními laboratořemi, které je používaly k odběrům stop na místě činu. Pouze bavorská policie užívala tampóny od jiného dodavatele, a tak se v Bavorsku Fantom nikdy neobjevil. Greiner Bio One zaměstnával ve výrobě i řadu dělnic původem z východní Evropy. Tato rozsáhlá blamáž konečně hlasitě upozornila kriminalisty v řadě zemí, že investování do speciálních pomůcek určených přímo pro forenzní odběry má své opodstatnění. 3. Osoby zajišťující stopy musí používat dostatečné osobní ochranné pomůcky rukavice, roušky, případně celotělové 35

38 overaly. Kýchající, kouřící, pijící či dokonce stravující se osoba nemá na místě činu co dělat. Nebezpečí kontaminace stop technikem na místě činu je často podceňováno. Přitom některé v zahraničí provedené studie jasně ukazují, že i při používání ochranných pomůcek dochází v nemalém procentu k nechtěné kontaminaci. Z technického hlediska nejvhodnější cestou je proto jednak povinná výměna rukavic mezi sběrem jednotlivých stop a vytvoření databáze genetických profilů techniků a dalších osob manipulujících se stopami, aby takováto kontaminace mohla být včas rozpoznána. Obrázek 4 Možnými zdroji kontaminace mohou být jak jiné stopy, tak i odběrové pomůcky či osoby manipulující se stopami. Proti těmto všem zdrojům je třeba se účinně bránit. 36

39 4. Srovnávací vzorky osob je naprosto nezbytné zajišťovat odděleně od ohledání místa činu, nejlépe jinde a s časovým odstupem. Jak dlouho je možné stopy uchovávat? Čím dříve jsou stopy předány ke zpracování do laboratoře, tím lépe. I u té nejlépe zajištěné stopy není vyloučena pozvolná degradace, proto je včasná analýza jedinou zárukou, že stopa nebude znehodnocena ještě před získáním potřebných dat. Týká se to především stop, u nichž degradace započala už před zajištěním. Na druhou stranu, řada stop si uchovává biologický materiál v analyzovatelném stavu i po mnoho desítek let. Takto stabilní bývají obvykle například zaschlé materiály (krev, sliny, sperma). Vlastnosti a chování biologického materiálu ve stopách Chceme li si na základě výsledků genetické analýzy udělat obrázek o dění na místě činu, je nezbytné mít alespoň základní představu o vlastnostech a chování biologického materiálu jako takového. V této oblasti panuje řada mylných domněnek, uveďme je tedy nyní na pravou míru! Kde se biologický materiál ve stopách bere? Lidské tělo je dynamický systém pohybujeme se, dýcháme, jíme a vylučujeme, naše buňky se stále dělí, nové vznikají a staré umírají. To vše je spojeno s produkcí velkého množství biologického materiálu, z nějž část naše tělo opouští a dostává se do jeho bližšího či vzdálenějšího okolí. Mohou to být: 37

40 1. přirozeně odcházející tělní tekutiny, sekrety a exkrementy menstruační krev, moč, stolice, pot, slzy, nosní sekret, sperma, sliny, zvratky 2. přirozeně odcházející buňky kůže a kožní deriváty vlasy, chlupy, nehty, odumřelé kožní epitelie (povrchové buňky) 3. přirozeně odcházející buňky sliznice poševní epitelie (např. při pohlavním styku), povrchové epitelie pohlavního údu (při pohlavním styku či jiné manipulaci s ním), epitelie dutiny ústní a krku (při ústní hygieně, jídle, líbání, orálním styku apod.), epitelie trávicího traktu (např. sliznice střeva uvolňovaná do stolice), epitelie dýchacích cest (při kašli, smrkání, kýchání, dýchání, řeči), epitelie močových cest (při zánětu uvolňované do moči) atd. 4. materiály uvolňované nepřirozeně, a to v důsledku nemoci, zranění, lékařského zákroku krev, kůže jako celek, svalová tkáň, tuková tkáň, při velmi hrubém poranění (včetně chirurgického úkonu) i jakékoli další tkáně (mozková tkáň, kost, tkáně orgánů dutiny břišní atd.). Lze určit, jaký byl mechanismus vzniku stopy? Rozhodnout o tom, jak stopa vznikla, bývá často velmi obtížné. Forenzní věda se o takové zkoumání pokouší alespoň u krevních stop; podle jejich tvaru a rozmístění lze někdy usuzovat, zda vznikly otěrem, odkapáváním, stříkáním (např. po úderu) atd. Tyto analýzy však nespadají do oboru forenzní genetiky, nýbrž do oboru biomechaniky, a nebudeme je tedy blíže rozvádět. U ostatních druhů biologického materiálu se analýza mechanismu vzniku stopy pohybuje obvykle už čistě v rovině spekulací (neexistují relevantní studie, ze kterých by bylo možno vycházet). V případu pohlavního zneužívání byly předloženy lůžkoviny z gauče, na němž ke skutku mělo dojít, a byl mimo jiné vznesen tento požadavek: Na základě tvaru a rozmístění skvrn (spermatu a 38

41 poševního sekretu) určete, v jaké sexuální poloze k pohlavnímu styku došlo. Relevantně, bez srovnávacích pokusů a jisté dávky spekulací na takovou otázku prakticky nelze odpovědět. Samozřejmě každý dospělý normálně sexuálně aktivní člověk si v principu umí představit, kde přibližně se mohou uvedené biologické materiály při styku v té které poloze ocitnout, nicméně taková představa může být i velmi ošidná (třeba proto, že nepostihneme všechny aspekty, které mohly mít v daný moment vliv), a nelze ji proto zaměňovat za odborně relevantní znalecké posouzení. Lze z množství biologického materiálu ve stopě usuzovat na nějaké okolnosti skutku? Souvislost mezi množstvím biologického materiálu ve stopě a mechanismem jejího vzniku sice existuje, ale jen ve velmi hrubém měřítku. Tedy: pokud je v bytě nalezeno tratoliště krve o metrovém průměru a majitelka tvrdí, že se tam manžel řízl při holení, je její tvrzení přinejmenším krajně podezřelé. Pokud ale jsou nalezeny drobné krevní kapky a otěry, může se jednat jak o stopy po říznutí při holení, tak o stopy po brutálním útoku řeznickým nožem. Jinak řečeno, nález extrémně velkého množství biologického materiálu vylučuje vznik stopy při drobné události, ale nález malého množství biologického materiálu nevylučuje vznik stopy při velké události, například násilném útoku. Často je tento problém diskutován při nálezu biologického materiálu osoby A za nehty osoby B, neboť vždy vyvstává otázka, zda je takový nález důkazem násilného kontaktu nebo ne. Obecně lze říci, že u osob, které spolu nežijí, nepracují nebo nejsou jinak v blízkém kontaktu, se zpravidla navzájem biologický materiál za nehty nevyskytuje vůbec nebo jen v nepatrném měřítku (např. zcela miniaturní množství přenesená v důsledku podání ruky, použití stejného madla v tramvaji atd.). Naproti tomu u osob, které v blízkém kontaktu jsou, může být množství biologického materiálu 39

42 za nehty toho druhého značné. V normálně fungující společně žijící rodině tak běžně má žena za nehty materiál manžela i dětí, dítě materiál sourozence i rodičů atd. Z toho vyplývá důležitý fakt: u osob žijících společně nebo jsoucích v úzkém kontaktu nelze nález biologického materiálu osoby A za nehty osoby B považovat za důkaz násilného kontaktu. Stejně tak nelze velké množství materiálu vyloučit tam, kde došlo (třeba i jednorázově) k intenzivnímu fyzickému kontaktu, tedy např. mezi masérem a masírovaným, prostitutkou a klientem, zdravotníkem a pacientem apod. Jak se stopa mění od okamžiku svého vzniku do zajištění a analýzy? Biologický materiál může být tvořen živými či mrtvými buňkami, jejich zbytky a/nebo organickými, případně anorganickými látkami produkovanými živými organismy. Velká část těchto komponentů ihned po opuštění těla snadno podléhá nejrůznějším typům rozkladných procesů, které souhrnně označujeme jako biodegradace. (Jak takový proces ve své vrcholné fázi vypadá, to si umí představit každý, kdo uprostřed července zapomněl v kufru auta dva dny na parkovišti nákupní tašku s půlkilem vepřových jater.) Rychlost biodegradace a její podoba závisejí především na podmínkách, v nichž se stopa nachází. Z hlediska genetického zkoumání je ovšem podstatné především to, v jaké míře je ve stopě degradována DNA. Ta může být zasažena několika typy vlivů: 1. fyzikálními činiteli UV zářením, radioaktivním zářením, extrémně vysokou teplotou 2. chemickými činiteli oxidačními činidly, silnými kyselinami a zásadami 40

43 3. biologickými činiteli bakteriemi, plísněmi, ale i enzymatickou sebedegradací (autolýzou) a jejich kombinacemi. V praxi se zdaleka nejčastěji setkáváme s bakteriální degradací stopy: vlhko a teplo (20 40 C) jsou podmínkami optimálními pro růst bakterií a stopa může být v tomto prostředí degradována velmi rychle. V parku byla kolem desáté hodiny večerní cestou domů z jednání brutálně napadena mladá žena: pachatel jí opakovaně udeřil tyčí do zátylku a oblasti krku a zad, takže jí způsobil četná silně krvácející poranění, poté jí odcizil kabelku a mobilní telefon a z místa činu utekl. Celou noc drobně pršelo. Těžce zraněná žena byla nalezena pejskařem až brzy ráno; muž zavolal záchrannou službu, ta po příjezdu při poskytování pomoci ženu svlékla ze zakrváceného a deštěm promočeného oděvu a tento uložila do igelitového pytle. Pytel byl policii předán až o dva dny později: rozsáhlé krevní skvrny na oděvu již byly hnědozelené barvy, silně zapáchající, a analýza neprokázala v žádné ze skvrn přítomnost analyzovatelné DNA. Za daných okolností tedy nejenže nebylo reálné najít na oděvu stopy DNA pachatele, ale nebylo již možno kvůli pokročilé bakteriální degradaci stanovit ani DNA oběti. (Pachatel byl přesto vypátrán a usvědčen díky stopám na tyči, kterou odhodil poblíž místa činu; žena útok přežila, zůstává však trvale ochrnutá). Dalším z důležitých faktorů, které rozhodují o tom, zda bude stopa později snadno či hůře analyzovatelná, případně zcela neanalyzovatelná, je přítomnost tzv. inhibitorů. Souhrnně tak označujeme látky, které negativně ovlivňují průběh dalších analýz, zejména blokují namnožení vybraných úseků DNA metodou označovanou jako PCR (polymerázová řetězová reakce), a bude o nich pojednáno v části věnované technologii. 41

44 Moderní forenzně genetická laboratoř ovšem již disponuje jednak metodami na zjištění přítomnosti inhibitorů ve vzorku, jednak izolačními postupy schopnými ve většině případů tyto inhibitory účinně odstranit. Muž v době nepřítomnosti své manželky brutálně znásilnil a zavraždil své dvě nevlastní dcery (14 a 16 let), poté jejich krví popsal zeď v domě. Vzorky odebrané z této vápnem vybílené zdi obsahovaly extrémně vysoká množství vápenatých iontů a analyzovat se je podařilo až po dlouhé dekalcifikaci pomocí chelatačního činidla (činidlo vyvazující dvojmocné ionty). Existuje nějaká časová hranice, kdy už stopu s jistotou nelze analyzovat? Žádná pevně definovatelná hranice neexistuje. Za určitých podmínek jak už bylo řečeno může stopa podlehnout zkáze velmi rychle, pokud se ale dostane do stabilního prostředí, může zde vydržet v dobrém stavu celou věčnost, což dokládají kupříkladu pozitivní analýzy z některých historických či archeologických nálezů včetně analýz mumií. Je zřejmé, že pro potřeby forenzní nám postačuje mnohem kratší časový úsek řádově maximálně desítky let. Správně zajištěné a uchovávané stopy tak umožňují znovu otevřít některé sporné případy a posoudit je na základě nových analýz. Lze určit, kdy biologická stopa vznikla? Určení stáří biologické stopy není při současných znalostech forenzní genetiky možné. Je sice známo, že u stopy dochází k degradaci materiálu a ke změně v zastoupení a struktuře některých složek, ovšem převést tyto vcelku obecné poznatky na relevantní výpočet stáří stopy zatím nelze ani forenzně genetickými, 42

45 ani jinými metodami; je to však předmětem zájmu forenzně genetického výzkumu. Je možné, že osoba s předmětem manipuluje, a přitom na něm její materiál neulpí? Velmi zajímavou a často diskutovanou otázkou je, jak velká množství biologického materiálu po sobě člověk zanechává. Zejména se to týká povrchových epitelií kůže, které ulpívají na předmětech přicházejících do kontaktu s nechráněnou pokožkou (šperky, hodinky, brýle, psací potřeby, telefonní sluchátka a mobily, volant a řadicí páka auta, kliky, zápisníky atd.). Studie ukázaly, že toto množství je značně individuální: někdo je dobrý donor, zanechávající svůj materiál i při letmém kontaktu, někdo je naopak donor extrémně špatný, u něhož i po dlouhodobém kontaktu zůstává na předmětech materiálu jen velmi málo. Tato vlastnost je pravděpodobně dědičná a souvisí jednak s rychlostí obnovy pokožky (tedy jak rychle se stará pokožka odlupuje a nová zespoda dorůstá), jednak se soudržností jednotlivých buněk v pokožce. Je možné, že materiál jedné osoby je ve stopě detekovatelný, i když se stopou už manipulovala další osoba/y? Ano, a to zcela běžně. Lze při nálezu biologického materiálu více osob na témže předmětu určit, kdo s předmětem manipuloval poslední? Jednou z dosti rozšířených, leč mylných představ je, že na předmětech dochází k vrstvení biologického materiálu a že tak lze říci, čí materiál na něm ulpěl jako poslední. Biologický materiál však takto až na výjimečné situace nefunguje a určení posledního 43

46 manipulujícího tudíž není možné ve stopě se nachází směsný biologický materiál, u něhož nelze analýzou DNA určit, kdy došlo k přispění jednotlivých donorů. Co je to primární přenos biologického materiálu? Primárním přenosem rozumíme nanesení biologického materiálu z těla původce na primární nosič (předmět či osobu). Typickými příklady primárního přenosu mohou být zakrvácení čepele nože při bodnutí, vstříknutí spermatu do prezervativu při ejakulaci, nanesení kožních buněk na sluchátko při telefonování atd. Co je to sekundární přenos biologického materiálu? Sekundárním přenosem rozumíme nanesení biologického materiálu z primárního nosiče na nosič sekundární. Typickými příklady sekundárního přenosu mohou být otření zakrvácené čepele nože o oděv, vytečení spermatu z prezervativu na koberec, přenesení kožních buněk prvního telefonujícího na rukáv druhého telefonujícího při užití téhož sluchátka atd. Obrázek 5 Primární přenos biologického materiálu (zde krev) může být následován přenosem sekundárním. 44

47 V hotelovém pokoji byla jako stopa zajištěna šmouha ze stropu. V tomto vzorku byla zkoumáním prokázána přítomnost spermatu. Později bylo objasněno, že šmouha vznikla tak, že hotelový host si po souloži s partnerkou sejmul prezervativ, napnul ho a vystřelil proti stropu. Velmi specifickým jevem je sekundární přenos vektorem např. krvesajným hmyzem (komár, blecha atd.) Nasátá krev obsahuje po určitou dobu (než je strávena) DNA v analyzovatelném stavu, a tudíž kupříkladu zabitím komára klasickou metodou prudké rány polštářem může na stěně či textilu vzniknout krevní stopa identifikovatelná s konkrétní osobou. Je přitom prokázáno, že tento hmyz má dosti velký akční rádius, a krev osoby tak může být přenesena na poměrně vzdálené místo. Existují ovšem i jiné, bizarnější mechanismy přenosu biologického materiálu vektorem. Ve státě New York byl řešen kuriózní případ paternity: dívka otěhotněla a porodila dítě poté, co její partner použil při styku prezervativ, který předtím vytáhnul použitý z odpadkového koše a před nasazením na penis převrátil naruby, aby se neznečistil. Otcem dítěte se tak stal mladík, který s dotyčnou dívkou nikdy neměl pohlavní styk. Sekundární přenos je z forenzního hlediska značně komplikujícím jevem, neboť ve svém důsledku může vést k tomu, že: na předmětu se vyskytuje biologický materiál osoby, která s ním nemanipulovala (např. muž A si odplivne na lavičku a odejde, nic netušící žena si do sekretu sedne, později se stane obětí znásilnění a vraždy na jejím oděvu je zjištěna markantní biologická stopa a stanoven profil 45

48 muže A, ale ten s ní ve skutečnosti vůbec nepřišel do kontaktu); na místě činu se vyskytuje biologický materiál osoby, která tam nikdy nebyla (v hotelu na pokoji č. 27 komár nasaje krev spícího hosta A, poté vyletí oknem a vletí do pokoje č. 59, kde je bdícím hostem B zabit, následně je ovšem neznámým pachatelem zabit host B na stěně je nalezena krev a stanoven profil hosta A, ale ten na pokoji č. 59 nikdy nebyl). Existence sekundárního přenosu biologického materiálu jako taková ovšem rozhodně není důvodem zpochybnění důkazů postavených na analýze DNA. Je ovšem vždy absolutně nezbytné posuzovat DNA důkaz v kontextu ostatních zjištění a zvážit i další možné hypotézy. Co je to nepravý sekundární přenos biologického materiálu? Za jakýsi nepravý sekundární přenos lze považovat situaci, kdy je přenesen biologický materiál s celým předmětem, a to jak náhodně, tak úmyslně (muž A zapomene v restauraci zapalovač, vezme si ho muž B, který později vykrade rekreační chatu, přičemž tam zapalovač ztratí zapalovač je zajištěn jako stopa a je v něm zjištěn genetický profil muže A, který ale v chatě nikdy nebyl). Důkazní potenciál stopy Co je důkazní potenciál? Podstatou každého dokazování je zvážení pravděpodobnosti jednotlivých hypotéz o skutku ve světle faktů (svědectví, znaleckých zkoumání atd.). Nejinak je tomu u důkazů prostřednictvím analýzy DNA: po úspěšném provedení analýzy se 46

49 obvykle určitá hypotéza začne jevit pravděpodobnější, zatímco jiná méně pravděpodobná až zcela nepravděpodobná. Krátce po nočním vloupání do obchodu zadržela policie na nedaleké tramvajové zastávce muže. Na rozbité výloze obchodu byla zajištěna krev, na levé ruce zadrženého muže bylo zjištěno řezné poranění. V tento moment existují dvě základní hypotézy: 1)původcem krve na výloze je zadržený muž, nebo 2) původcem krve na výloze je někdo jiný a to, že zadržený má pořezané zápěstí, je jen shoda okolností. Analýza DNA následně razantně jednu z těchto hypotéz posílí a druhou oslabí. Čím více je jedna hypotéza analýzou stopy podpořena na úkor ostatních, tím větší má stopa důkazní potenciál. Důkazní potenciál stopy pramení ze dvou základních složek: z apriorní těsnosti vazby stopy ke skutku a z očekávané rozdílnosti výsledku příslušného znaleckého zkoumání za platnosti jednotlivých zvažovaných hypotéz. Co je apriorní těsnost vazby stopy ke skutku? Tímto pojmem rozumíme míru naší jistoty, že stopa vznikla v souvislosti se skutkem. Určité stopy mohou být již předem považovány za velmi silně vázané ke skutku: například biologický materiál plodu získaný při interrupci u čtrnáctileté dívky je prakticky s naprostou jistotou vázán k pohlavnímu zneužívání této poškozené. Naproti tomu u celé řady ve forenzní praxi běžně analyzovaných stop je jejich vazba ke skutku nejistá: nedopalek zajištěný na chodníku před vraty garáže, z níž bylo odcizeno auto, může a nemusí mít vztah k tomuto skutku. 47

50 Co je očekávaná rozdílnost výsledku příslušného znaleckého zkoumání za platnosti jednotlivých zvažovaných hypotéz? Aby zkoumání mělo smysl, musí existovat předpoklad, že analýza poskytne jiný výsledek za platnosti hypotézy 1 než za platnosti hypotézy 2, 3 atd. U výše uvedeného příkladu případ nočního vloupání očekáváme, že při platnosti hypotézy 1 (původcem krve na rozbité výloze je zadržený muž) analýza zjistí shodu profilu ze stopy a srovnávacího vzorku muže, zatímco při platnosti hypotézy 2 (původcem krve na rozbité výloze je někdo jiný) budou tyto genetické profily různé. V jakých situacích má stopa z principu nízký či nulový důkazní potenciál? Za určitých okolností lze již předem (tj. bez provedení analýzy) vyhodnotit, že daná biologická stopa jako důkaz posloužit nemůže, nebo jen ve velmi omezené míře říkáme, že má nízký či nulový apriorní důkazní potenciál. Sem patří: situace, kdy je malá těsnost vazby stopy ke skutku, neboli vztah zajištěného biologického materiálu a skutku je velmi sporný až vyloučitelný Pachatel loupežného přepadení odhodil při útěku kuklu do křoví, ta byla zajištěna jako stopa, z nepochopitelných důvodů byla zajištěna i značně degradovaná použitá dámská menstruační vložka, která ležela v křoví opodál; vztah této stopy ke skutku je z logiky věci nulový. situace, kdy u zvažovaných hypotéz očekáváme totožný výsledek analýzy 48

51 Byl oznámen případ znásilnění mezi manželi, kdy žena tvrdila, že manžel ji znásilnil, ten tvrdil, že mezi nimi došlo k dobrovolnému pohlavnímu styku. Ke zkoumání byl předložen poševní stěr poškozené. Zkoumání je v tomto případě irelevantní, neboť u obou hypotéz lze očekávat zjištění přítomnosti manželova spermatu v poševním stěru manželky. Znalci nepřísluší rozhodovat o právních otázkách ani o tom, jak má být při vyšetřování postupováno. Nicméně, na tomto místě se přimlouváme za to, aby kompetentní osoby vždy pečlivě zvažovaly, jaký bude reálný přínos znaleckého zkoumání dané stopy pro vyšetřování. 49

52 Seznámení s genetikou Základní fakta o DNA Co je to DNA? DNA neboli deoxyribonukleová kyselina je jednou z funkčních makromolekul, které se vyskytují v buňce. Označení kyselina poukazuje na některé její chemické vlastnosti (ve vodném roztoku odštěpuje protony a stává se záporně nabitou, což je jedna z charakteristik kyselin), avšak rozhodně si ji nelze představovat jako klasické kyseliny není to žádná leptající kapalina, nýbrž vláknitá makromolekula. Čistá DNA není ve vodném roztoku vidět je rozpuštěná. Lze ji ovšem určitými postupy vysrážet a tím zviditelnit : například v silně koncentrovaném etanolu bude velké množství DNA patrné jako bělavé vláknité chomáčky. Jakou má DNA strukturu? Základní struktura DNA je velmi jednoduchá: jednotlivé vlákno DNA (říkáme mu jednořetězcová DNA) vzniká řetězením stavebních kamenů tzv. nukleotidů lineárně za sebou (jako do řetízku vzájemně slepené korálky). Nukleotid sestává ze tří funkčních částí trifosfátu, cukru deoxyribózy a tzv. báze. Zatímco deoxyribóza i trifosfát jsou ve všech nukleotidech stejné, báze se vyskytuje v DNA ve 4 různých verzích nazýváme je adenin, guanin, cytozin a tymin a označujeme A, G, C a T. Existují tedy čtyři základní typy nukleotidů podle toho, kterou bázi nesou (jako bychom měli čtyři různé barvy korálků ). 50

53 Sled nukleotidů ve vlákně tzv. sekvence nukleotidů vytváří jednoduchý lineární kód o čtyřech znacích. (Obdobně například naše písmo latinka je lineární kód, užívající ovšem podstatně více znaků v anglické abecedě 26, v té české dokonce 37 a to počítáme pouze písmena, nikoli interpunkční a jiná znaménka!). Obrázek 6 Základní struktura jednořetězcové DNA. DNA je lineárním polymerem nukleotidů, každý nukleotid sestává z trifosfátu, cukru deoxyribózy a báze. V genetickém světě zapisujeme sekvenci nukleotidů v DNA pomocí zmíněných čtyř písmen, označujících jednotlivé báze, tedy například: ACCAGTGAGATCCCAATATAGTACACACACTGCTGCTACTTCTAGAGG CAAACTTAGT Vlákno DNA může za určitých okolností existovat v popsané jednořetězcové formě, běžněji se ale v buňce setkáváme s dvouřetězcovou DNA. Ta je tvořena dvěma řetězci nukleotidů, 51

54 které jsou navzájem propojeny pomocí vazeb mezi bázemi. Tento komplex je prostorově svinutý do tvaru známé dvoušroubovice. Při vzniku dvouřetězcové DNA se uplatňuje zásadní pravidlo, kterému říkáme princip (pravidlo) komplementarity: každý typ báze páruje pouze s jediným jiným typem báze. A páruje vždy s T (a logicky T s A) a C páruje vždy s G (a logicky G s C). Oba řetězce pak označujeme jako vzájemně komplementární. Obrázek 7 Struktura dvouřetězcové DNA. Dvě vlákna spolu párují prostřednictvím bazí. Vezměme si krátký úsek jednořetězcové DNA, jehož sekvence je AGGTAC. Při vzniku druhého řetězce se uplatní princip komplementarity a dvouřetězec tedy bude vypadat: AGGTAC TCCATG V běžné tělní lidské buňce je DNA o celkové délce cca 6,6 miliardy nukleotidů, což de facto představuje dvoušroubovici o délce zhruba 2 metry. Velikost lidské buňky je však dramaticky menší například 52

55 bílé krvinky mají průměr řádově pouhých 0,00001 metru. Jedinou možností, jak vtěsnat něco tak dlouhého do něčeho tak malého, je mnohonásobně to smotat. DNA je proto v buňce velmi složitě uspořádána do vyšších a vyšších stupňů: dvoušroubovicové vlákno se ovíjí kolem bílkovinných klubíček histonů, takto navinuté vytváří smyčky uchycené na bílkovinné lešení a celá tato struktura se spirálovitě stáčí a vytváří tzv. chromatinové vlákno. Co jsou chromozómy? Vzhledem ke zmíněné značné délce DNA by i toto chromatinové vlákno bylo neúměrně dlouhé a buňka by s ním mohla jen obtížně pracovat. Proto je rozděleno na kusy, kterým říkáme chromozómy, podobně jako třeba Ottův slovník naučný je rozdělen do svazků. Soubor chromozómů v jádře nazýváme karyotyp. Obrázek 8 Karyotyp neboli soubor chromozómů v jádře. 53

56 Biologické druhy mají různý počet chromozómů např. člověk má 23 párů chromozómů, kočka 18 párů chromozómů, damašská růže 28 chromozómů atd. Vyšší počet chromozómů však neznamená, že daný druh má delší DNA: pouze ukazuje, do kolika svazků je tato DNA rozdělena. V lidských buňkách najdeme za normálních okolností 1 pár chromozómů, které určují, jaké bude pohlaví jedince říkáme jim proto chromozómy pohlavní neboli gonozómy a označujeme je X a Y. Zatímco muži mají jeden chromozóm X a jeden Y, ženy mají dva chromozómy X. Zbylých 22 párů chromozómů se na určení pohlaví nijak nepodílí říkáme jim proto chromozómy nepohlavní neboli autozómy a označujeme je čísly Hovoříme zde o párech chromozómů to proto, že od každého chromozómu najdeme v běžné tělní buňce dvě kopie, z nichž jedna pochází od matky, druhá od otce. Celý princip bude popsán dále v kapitole o podstatě dědičnosti. Jak je v DNA zapsána informace? Vlastní funkční uspořádání DNA je nesmírně složité, omezíme se proto pouze na velmi zjednodušující popis. V DNA lze nalézt úseky, které nesou informaci o struktuře buněčných bílkovin. Těmto úsekům říkáme obecně geny. Ostatní úseky, které takovou informaci nenesou, označujeme termínem extragenová DNA. V genech je využíván tzv. univerzální genetický kód. Tak jako je DNA řetězcem nukleotidů, je bílkovina řetězcem aminokyselin, kterých existuje 21 druhů. Každá trojice nukleotidů v genu tzv. triplet představuje kód pro konkrétní aminokyselinu. Například 54

57 úsek DNA s kódem TCCAAAGGT znamená, že v bílkovině mají být za sebou serin alanin glycin, neboť TCC je kód pro aminokyselinu serin, AAA pro alanin a GGT pro glycin. Obrázek 9 Genetický kód: trojice nukleotidů (triplety) kódují konkrétní aminokyseliny zařazované do struktury bílkoviny. Vlastní exprese (tj. vyjádření informace) genu probíhá tak, že podle příslušného vlákna DNA je dle výše zmíněného pravidla komplementarity syntetizováno vlákno RNA (ribonukleová kyselina, velmi podobná DNA) tomuto procesu říkáme transkripce, tedy přepis. Vlákno RNA je po úpravách použito jako předloha, podle níž se zařazují aminokyseliny do vznikající bílkoviny tento proces se nazývá translace, tedy překlad, nebo též proteosyntéza neboli syntéza bílkoviny. Na rozdíl od genů, extragenová DNA tímto způsobem překládána není a informaci o struktuře bílkovin nenese. (Mezi námi, není to úplně pravda i v extragenové DNA se vyskytují kódující oblasti či jejich zbytky; nicméně buňka je aktivně nevyužívá, spíše je jimi 55

58 sama někdy zneužívána, a pro potřeby této publikace zcela postačí zjednodušující tvrzení, že v extragenové DNA kódující oblasti nejsou.) Co je to gen, lokus, marker? Protože v užívání těchto pojmů nepanuje přílišná jednota ani mezi samotnými odborníky, pokusme se je nyní blíže vyspecifikovat a správně definovat. Jako gen označujeme funkční úsek DNA, jehož určitá část je překládána do struktury bílkovin a ostatní části se tohoto překladu nějakým způsobem účastní. Pokud slovně specifikujeme, o jaký gen se jedná, nejčastěji použijeme název příslušné bílkoviny, která podle něj vzniká. Tedy: gen pro beta podjednotku alkoholdehydrogenázy 1, gen pro alfa podjednotku ATP syntázy atd. Na tomto místě vyvraťme jednu oblíbenou novinářskou floskuli, zaplevelující stránky novin i internetových portálů s pozoruhodnou životaschopností: neexistuje nic jako gen pro nemoc. Titulek Vědci objevili gen rakoviny prostaty je nesmyslný. Každý gen v naší buňce totiž má svou významnou pozitivní roli a přispívá k fungování buňky jako celku. Sama přítomnost jakéhokoli genu nemá negativní vliv na buňku. To, co vědci objevili v našem příkladu, je vadná forma onoho genu; právě špatné fungování genu totiž má za následek určitou nemoc organismu. (Nemluvě o tom, že asociativní vztah mezi prostatou a formou genu je jen pravděpodobnostní.) Řekněme to ještě jinak, obrazněji: to, že parašutista má ve své výbavě padák, mu smrt nezpůsobí, naopak. Fatální pro něj bude, pokud má nefungující padák. Jako lokus označujeme libovolný adresný úsek DNA či místo v DNA. Lokus DNA lze považovat za vůbec nejobecnější pojem můžeme 56

59 jím myslet celý gen i jednotlivý nukleotid naprosto kdekoli, v genové i extragenové oblasti lidského genomu. Jako marker označujeme úsek DNA (ať už v genu či extragenové DNA), který je předmětem testování. Kde v buňce je DNA obsažena? Kompletní sada 23 párů chromozómů se u živých lidských buněk nachází v tzv. jádře (lat. nucleus), membránové organele, která je informačním centrem buňky. Tuto DNA proto označujeme termínem jaderná DNA (ndna). Kromě jádra se ještě velmi specifická DNA nachází v dalším typu buněčných organel v tzv. mitochondriích; říkáme jí proto mitochondriální DNA (mtdna). Obrázek 10 DNA se v lidské buňce vyskytuje jednak v jádře, jednak v buněčných organelách zvaných mitochondrie. Kompletní genetickou informaci buňky (organismu) nazýváme genom, genetickou informaci v jádře nukleom a genetickou informaci v mitochondrii mitom. 57

60 U rostlin najdeme ještě další organely, obsahující DNA plastidy, z nichž laikům asi nejznámější jsou chloroplasty organely, kde rostlinné buňky zachycují sluneční záření do fotonových pastí fotosyntetizují. Souboru genetické informace v plastidech říkáme plastidom. Kde v těle je DNA obsažena? Kompletní genetická informace, tedy příslušných 23 párů chromozómů, se nachází téměř ve všech typech lidských tělních buněk (říkáme, že genetická výbava všech tělních buněk je uniformní). Výjimku tvoří červené krvinky (erytrocyty) a krevní destičky (trombocyty), které neobsahují DNA vůbec, a buňky pohlavní (gametocyty), tedy spermie a vajíčka (oocyty), které obsahují pouze polovinu této dědičné informace od každého chromozómu pouze jednu kopii. Proč tomu tak je se dozvíte v následující pasáži o dědičnosti. Základní principy fungování dědičné informace Jak vznikají viditelné či měřitelné rozdíly mezi lidmi? Už při prostém pohledu kolem sebe vidíme, že lidé se navzájem liší v řadě znaků barvě očí, vlasů, tvaru obličeje, krevní skupině, snášenlivosti alkoholu, temperamentu Téměř neexistuje nic, v čem by všichni lidé byli zcela uniformní. Tomu, jak nějaký znak u dané osoby konkrétně vypadá, říkáme fenotyp. Tato výsledná podoba znaku je dána obvykle společným vlivem dvou faktorů: vlivu prostředí a dědičné informace. Existují znaky, které jsou založeny téměř výhradně na dědičné informaci, a žádný vliv prostředí je nemůže změnit; říkáme, že jsou silně geneticky determinované. Takovým znakem je například krevní skupina. 58

61 Naproti tomu existují znaky, kde hraje prostředí významnou roli a daný znak jím může být silně ovlivněn; genetická informace se u nich uplatňuje pouze jako jakýsi velmi tvárný základ, nebo chceme li, dispozice. Říkáme, že tyto znaky jsou slabě geneticky determinované. Typickým příkladem budiž tělesná hmotnost. Co je polymorfismus? Všichni lidé mají stejné geny, přičemž odhadem je genů kolem 23 tisíc. Některé geny však existují ve více verzích říkáme, že jsou variabilní, polymorfní, a daný jev označujeme jako polymorfismus. Jednotlivé verze genu nazýváme alely. Lidé mají tedy stejné geny, ale nemají stejné alely. K tomuto základnímu principu se přidává ještě další, neméně významný: i zcela stejná varianta genu (alela) může být u dvou osob využívána buňkami různě často a různě intenzivně; takovým rozdílům říkáme epigenetické. Představit si to lze kupříkladu takto: všechny restaurace mají ve své obrovské spíži prakticky tytéž suroviny mouku, česnek, med, mléko, rajský protlak, red curry, vajíčka, jablka, olivový olej, atd. celkem několik tisíc přísad. Každá tato surovina se ale vyskytuje ve více verzích, takže zatímco jedna restaurace nakupuje levný česnek z Číny, jiná má k dispozici řízný česnek od farmáře z Vysočiny. Stejně tak existují desítky různých odrůd jablek, rozličné druhy medu atd. Přičteme li k tomu ještě rozdíly v postupu přípravy (jeden kuchař používá více, jiný méně pepře, jeden do salátu dává raději konopný olej, zatímco druhý směs olivového a palmového), bude ve výsledku totéž jídlo v každé restauraci trochu jiné (a někdy i hodně jiné). Jak polymorfní jsou jednotlivé lokusy v DNA? Velmi zhruba můžeme říci, že co do variability najdeme v lidské DNA tři typy lokusů: 59

62 1. lokusy nepolymorfní, tedy zcela minimálně variabilní (říkáme jim též vysoce konzervativní sekvence); obvykle jsou to nějaké zásadní funkční úseky, bez nichž se buňka neobejde a které musejí mít určitou přesnou sekvenci, jinak svou funkci ztratí; 2. lokusy nízce až středně polymorfní, vyskytující se v populaci v několika variantách; sem spadají především geny; 3. lokusy vysoce polymorfní (multialelické), vyskytující se typicky v mnoha variantách, jejichž počet může jít i do mnoha desítek; najdeme je především v určitých oblastech nekódující (extragenové) DNA; Obrázek 11 Variabilita lokusů v DNA může být velmi rozdílná. Největší rozdíly mezi osobami budou z logiky věci právě u posledně jmenovaných vysoce polymorfních lokusů. Především na ně se tudíž bude zaměřovat identifikační analýza DNA. Lidský genom má 2 x 3,3 miliardy nukleotidů, ale jen 2 x cca 3 milióny z nich jsou variantní. To znamená, že dvakrát nukleotidů nás činí lidmi a složení zbývajícího jednoho promile počtu nukleotidů nás činí originálním člověkem. 60

63 Mimochodem, když genetici porovnali kompletní sekvenci lidského a šimpanzího genomu, zjistili fascinující věc: 98,4 % této sekvence je shodné, jinak řečeno, od šimpanze se lišíme v pouhém 1,6 % své dědičné informace. Je téměř neuvěřitelné, že tak málo postačuje k tomu, abychom byli tak velmi odlišní. Co jsou mutace? Termínem mutace souhrnně označujeme změny v sekvenci DNA. Pro účely této publikace se stran mutací omezme jen na pár základních informací: Co do svého rozsahu mohou být mutace zcela nepatrné jednobodové, spočívající v záměně jediného nukleotidu v sekvenci (např. ATTACCGTT se změní na ATTTCCGTT), přes mutace spočívající v přesunu, vymazání nebo naopak připsání části sekvence až po mutace obrovského rozsahu, spočívající v přestavbách celých chromozómů či dokonce změnách počtu chromozómů či jejich sad. Sám rozsah mutace ovšem není úměrný účinku na organismus: jednobodová mutace v kritickém místě nějakého genu může mít zcela fatální důsledky, zatímco některé přestavby chromozómů nemají žádný viditelný účinek a odhalíme je až náhodně při genetickém vyšetření. Svým původem mohou být mutace spontánní (laicky řečeno: změnu sekvence způsobí chyba ve vnitřních buněčných pochodech) nebo indukované (k mutaci dojde vlivem nějakého biologického, fyzikálního či jiného činitele). K mutacím dochází jak v tělních buňkách pak mluvíme o mutacích somatických, tak v zárodečných buňkách, z nichž vznikají buňky pohlavní takové mutace nazýváme gametické (nebo též mutace v germinální linii). 61

64 Jak je genetická informace přenášena z rodičů na děti? Potomci dědí vlastnosti svých rodičů to bylo známo už antickým myslitelům. Dnes víme, že je to proto, že dítě získá od obou rodičů kopii části jejich dědičné informace v podobě DNA. Jak jsou děděny lokusy na nepohlavních chromozómech? Lokusy na autozómech (nepohlavních chromozómech) jsou děděny tzv. mendelovskou dědičností (princip objevil J. G. Mendel). Člověk má v tělních buňkách dvě sady autozómů, a tedy dvě kopie každého autozomálního lokusu. Tyto dvě kopie však nemusejí být zcela identické mohou to být dvě různé varianty daného lokusu, tedy dvě různé alely. Obrázek 12 Meióza neboli redukční dělení je mechanismus tvorby pohlavních buněk, při němž se redukuje dědičná informace na polovinu. 62

65 Při tvorbě pohlavních buněk se dědičná informace složitým mechanismem nazývaným meióza redukuje na polovinu a do zralé pohlavní buňky se dostane pouze jedna kopie každého autozomálního lokusu, tedy jedna alela daného lokusu. Záleží víceméně na náhodě, která z obou alel to bude. Spojením spermie otce a vajíčka matky vznikne znovu jediná buňka (zygota, oplozené vajíčko) nesoucí dvě kompletní sady chromozómů, a tedy dvě kopie každého autozomálního lokusu. Obrázek 13 Při oplození nese každá z pohlavních buněk genetickou informaci redukovanou na polovinu. Splynutím vajíčka a spermie tak vzniká prvotní buňka (zygota) s normálním množstvím genetické informace. Co je to heterozygot a homozygot? Již několikrát jsme zde zmínili, že každý autozomální lokus má člověk ve výbavě svých tělních buněk dvakrát jednu kopii od 63

66 matky, druhou od otce. Pokud jsou obě kopie identické (jsou to dvě stejné alely), říkáme, že daný lokus je v homozygotním stavu a daný člověk je v tomto lokusu homozygot (homozygotní). Naproti tomu pokud je na každém párovém chromozómu v daném lokusu jiná alela, říkáme, že daný lokus je v heterozygotním stavu a daný člověk je v tomto lokusu heterozygot (heterozygotní). Tedy: v případě homozygotního stavu zdědil v daném lokusu jedinec od matky a otce dvě stejné alely. V případě heterozygotního stavu zdědil od matky a otce dvě různé alely. Obrázek 14 Dědičnost autozomálních lokusů se řídí tzv. Mendelovými zákony. Dědičná informace dítěte je zkombinována z části dědičné informace matky a části dědičné informace otce. 64

67 Prosím povšimněte si, že homozygozita či heterozygozita je vlastností konkrétního lokusu na nepohlavních chromozómech, nikoli genetické informace jako celku! Tedy: každý z nás je v řadě svých lokusů heterozygotem a v řadě homozygotem. Sám termín má původ v řeckém homo /hetero (= stejno /různo ) a zygós (pohlavní buňka). U homozygotního lokusu totiž všechny pohlavní buňky dané osoby ponesou stejnou alelu tohoto lokusu (jiná není k dispozici), zatímco u heterozygotního lokusu nese zhruba polovina pohlavních buněk jednu alelu původem z prvního párového chromozómu a zbytek (tj. druhá polovina) druhou alelu původem z druhého párového chromozómu. Jak jsou děděny lokusy na pohlavních chromozómech? Dědičnost lokusů na gonozómech (pohlavních chromozómech) je různorodější existují zde oblasti, ve kterých je sekvence X i Y chromozómu velmi podobná nazýváme je oblasti pseudoautozomální, a dále oblasti, v nichž se X a Y chromozóm zásadně liší. Pseudoautozomální oblasti obsahují na chromozómu X i Y tytéž lokusy, jež jsou děděny mendelovsky, tak jak bylo popsáno výše. Ostatní oblasti pohlavních chromozómů X a Y se chovají jinak. Chromozóm Y je přítomen v jedné kopii u mužů a dědí se paternálně (patrilineárně, po meči). Lokusy jsou předávány v nezměněném stavu jako balík tzv. haplotyp z otce na syny. Jediný mechanismus, kterým se může dědičná informace v této části Y chromozómu za normálních okolností změnit, je mutace. 65

68 Obrázek 15 Dědičnost Y chromozomálních lokusů. Dědičná informace syna pochází pouze od otce. Chromozóm X je přítomen ve dvou kopiích u žen a v jedné kopii u mužů (tam je druhým pohlavním chromozómem Y). U žen se tedy i X lokusy vyskytují ve dvou kopiích, zatímco u mužů jen v jedné. Žena předává potomkovi vždy jeden ze svých X chromozómů. Muž předá potomkovi buď svůj chromozóm X pak to bude děvče, nebo svůj chromozóm Y pak to bude syn. Na tomto místě nelze nepoznamenat, že ženy byly po dlouhá staletí obviňovány z neschopnosti dát manželovi syna a někdy za to i zaplatily životem (že, Jindřichu VII.?!) Objevy v oblasti genetiky ovšem ukázaly, že je to spermie muže, která nese příslušný chromozóm (X nebo Y), a tudíž je zodpovědná za to, zda dítě bude děvče či chlapec. Načež další objevy v oblasti fyziologie početí ukazují, že je to vajíčko, které důmyslnými mechanismy vybírá, kterou spermii pustit dovnitř. 66

69 Ergo, ač se mi to neříká lehce, původní nařčení byla minimálně částečně opodstatněná Obrázek 16 Dědičnost X chromozomálních lokusů. Dědičná informace dcery je zkombinována z části dědičné informace matky a části dědičné informace otce, dědičná informace syna pochází pouze od matky. Co je to hemizygot? Pokud se určitý lokus nachází pouze v polovině pohlavních buněk daného člověka, zatímco ve druhé polovině zcela chybí, říkáme, že tento člověk je v daném lokusu hemizygot (hemizygotní). To nastává u lokusů lokalizovaných na X chromozómu: zatímco ženy mají standardně dva X chromozómy a jsou v X lokusech buď homozygotní, nebo heterozygotní, muži mají pouze jeden chromozóm X (a jeden chromozóm Y) a v X lokusech jsou hemizygotní. Stejně tak za hemizygotní můžeme považovat u mužů lokusy lokalizované na Y chromozómu. (Obé konstatování se týká 67

70 lokusů mimo pseudoautozomální oblasti, jejichž dědičnost byla zmíněna výše). Jak je děděna mitochondriální DNA? U člověka a celé řady dalších živočišných i rostlinných druhů byla prakticky prokázána tzv. striktní matroklinita mitochondriální DNA, tedy dědičnost po přeslici : potomek (dcera i syn) dědí mitochondriální DNA výhradně po matce, a má s ní tudíž shodný tzv. mitotyp. Obrázek 17 Dědičnost mitochondriální DNA. Dědičná informace dětí pochází pouze od matky. Mimochodem některé výzkumy ukazují, že striktní matroklinita nemusí u člověka vždy platit. V přírodě navíc existují druhy, u nichž je DNA děděna jinak než po přeslici, například oblíbené ovoce kiwi (Actinidia) má paternální dědičnost mtdna, tedy po meči. Inu, příroda je ráda komplikovaná 68

71 Forenzní potenciál genetické analýzy Z forenzního hlediska lze genetickou analýzou získat informace, které nám pomohou identifikovat původce biologického materiálu pomohou určit typ biologického vztahu mezi osobami (biologickou příbuznost) pomohou predikovat některé biologické charakteristiky původce biologického materiálu jinak pomohou posílit/oslabit naše hypotézy, přičemž prvý bod dominuje stávající kriminalistické genetice, druhý zase občansko právním řízením o určení otcovství. Individualita a identifikace Co je to identifikace? Identifikací ve forenzní genetice rozumíme určení shodného původu dvou vzorků biologických materiálů např. stopy a srovnávacího vzorku. V praxi to znamená, že posuzujeme určité variabilní znaky v DNA a zjišťujeme, zda oba materiály vykazují v takto variabilních znacích shodu. Některé z metod principiálně umožňují identifikaci až na úroveň konkrétního jedince s vysokou mírou spolehlivosti (blížící se jistotě) potom mluvíme o individuální identifikaci. Jiné metody už ze svého principu takovou rozlišovací schopnost nemají sem patří například analýzy mitochondriální DNA a haplotypu Y chromozómu; přesto mají tyto analýzy ve forenzní praxi své nezastupitelné místo a bude o nich též pojednáno v samostatných kapitolách. 69

72 Co je to genetický profil osoby? Termínem genetický profil (syn. DNA profil) označujeme obecně set genotypů několika polymorfních lokusů dané osoby; v praxi je tak nejčastěji označován set genotypů autozomálních STR lokusů. Genetický profil osobu částečně či zcela identifikuje. Co je to genetické individuum? Každý lidský jedinec vzniká mechanismem pohlavního rozmnožování, tj. proniknutím otcovy spermie do matčina vajíčka; tento děj nazýváme oplození. Po oplození dojde uvnitř vajíčka ke splynutí jeho prvojádra s prvojádrem spermie do jediného celku, nazývaného synkaryon, čímž je vytvořen zcela jedinečný soubor genů a extragenové DNA genetická informace nového, unikátního jedince. Tato první buňka s kompletním jádrem se nazývá zygota. Všechny buňky, vzniklé jejím dělením, nesou prakticky totožnou genetickou informaci a tvoří genetické individuum, nazývané odborně geneta. Jakékoli prohlášení o shodě či neshodě dvou biologických materiálů se vždy a bezvýhradně týká pouze toho, zda tyto materiály mohou či nemohou pocházet z téže genety. To je zcela zásadní atribut forenzního testování a je třeba jej mít vždy na paměti. Jak se dozvíme později, ne vždy je totiž jedinec genetický totožný s jedincem fyzickým. Co je to fyzické individuum? Fyzickým individuem rozumíme konkrétního, prostorově ohraničeného jedince; odborně jej v biologii nazýváme rameta. U lidí je tedy rametou konkrétní člověk a v běžném životě je tak rameta vnímána jako základní forma individua, která je jednotkou sociálních interakcí ve společnosti i jednotkou v právním smyslu slova (fyzickou osobou). 70

73 Obrázek 18 Typický genetický profil osoby: set genotypů autozomálních STR lokusů a amelogeninu (bližší vysvětlení, o jaké lokusy se jedná a proč je testujeme, najdete v dalších částech knihy). 71

74 Jaký je vzájemný vztah genety a ramety? Člověk patří spolu s dalšími obratlovci mezi tzv. unitární organismy ty se vyznačují tím, že z oplozeného vajíčka se postupně vyvíjí jedinec s poměrně striktně daným uspořádáním těla, prochází nejprve fází růstu, potom plodným obdobím a jeho život je zakončen stářím a smrtí. Jedna geneta se tak stává jednou rametou. V přírodě se můžeme setkat ještě s jiným rozšířeným modelem s tzv. modulárními organismy, jakými jsou například rostliny. Ty mají naopak velmi proměnlivou a přizpůsobivou podobu těla, které sestává z opakujících se částí modulů (např. listy, květy), jejich vývoj není nikdy ukončený (jejich tělo stále roste) a jednotlivé moduly mohou dát za příznivých podmínek vzniknout dalšímu fyzickému jedinci. Jedna geneta se tak může stát mnoha rametami. Tedy, souhrnně řečeno: u člověka a dalších unitárních organismů je rameta v drtivé většině případů totožná s genetou; jeden jedinec genetický se vyvine v jediného jedince fyzického. U rostlin a dalších modulárních organismů naopak může jeden jedinec genetický existovat ve formě i mnoha desítek jedinců fyzických. Až půjdete kolem stánku s květinami, povšimněte si některé z váz s kyticí nádherných růží, které jsou jedna jako druhá: můžete si být téměř jisti, že ačkoli byly před pár hodinami nastříhány kdesi v holandské pěstírně z mnoha desítek růžových keřů, jedná se o jediného genetického jedince. 72

75 Může u člověka existovat i jiný vzájemný vztah genety a ramety? Ano. Existuje hned několik situací, kdy výše zmíněné pravidlo jedinec genetický = jedinec fyzický neplatí. To je z hlediska identifikace nesmírně závažné a je nutné mít při hodnocení případu tyto potenciální situace vždy na paměti, neboť jak již bylo řečeno, identifikace analýzou DNA se vždy týká genety. Těmito výjimečnými situacemi jsou především: jednovaječná dvojčata, vrozený tetragametický chimérismus, směna buněk mezi dvojvaječnými dvojčaty, maternální a fetální mikrochimérismus a trvalý posttransplantační chimérismus. (Prosím čtenáře, aby nepropadal panice všechny tyto pojmy si v následujících odstavcích jeden po druhém objasníme). Jak se vzájemně liší jednovaječná dvojčata? První a nejčetnější výjimečnou situací jsou jednovaječná (identická, monozygotní) dvojčata, případně vícerčata. Už sám jejich název napovídá, že jsou původem z jednoho vajíčka a že jsou v určitém ohledu stejná identická. Vznikají tak, že dělící se oplozené vajíčko se v určité velmi rané fázi rozvolní na dvě (nebo i více) skupin buněk a každá tato skupina se zanoří do děložní sliznice samostatně a dá pak vzniknout samostatnému jedinci dítěti. Jednovaječná dvojčata (vícerčata) jsou tedy jednou genetou, ale více rametami. Díky svému společnému původu se proto jednovaječná dvojčata prakticky neliší svou dědičnou informací; jediný mechanismus, který může dát vzniknout rozdílům v jejich DNA, jsou mutace. Pozorovatelné či měřitelné rozdíly jsou u jednovaječných dvojčat ovšem častěji způsobeny nestejným vlivem prostředí např. rozdílná tělesná hmotnost, rozdílná barva pokožky, jiné rozložení 73

76 mateřských znamének, rozdílné IQ v důsledku špatného okysličování jednoho z dvojčat v těhotenství atd. Obrázek 19 Genetická informace jednovaječných dvojčat je prakticky identická. Pro forenzní genetickou analýzu má tato skutečnost jeden zásadní důsledek: v drtivé většině případů zatím nelze standardními identifikačními metodami mezi jednovaječnými dvojčaty rozlišit, tj. nelze kupříkladu říci, zda původcem biologické stopy z místa činu je dvojče A nebo dvojče B. Stejně tak nelze říci, zda otcem dítěte je muž A nebo jeho jednovaječné dvojče muž B. Tento závažný nedostatek, totiž neschopnost spolehlivě rozlišit mezi jednovaječnými dvojčaty, je významnou vadou na kráse forenzní DNA analýzy. Proto se genetici snaží hledat metody, které 74

77 by dokázaly k rozlišení identických dvojčat využít těch změn v DNA, k nimž dochází až po vzniku samostatných embryí v jejich tělních buňkách. Přestože některé postupy se jeví jako nadějné, dosud nebyla nalezena a v odborných časopisech publikována žádná validní metoda, kterou by bylo možno s velkou spolehlivostí použít jako důkazní nástroj. Na rozdíl od analýzy DNA, jiné identifikační obory např. daktyloskopie, forenzní odontologie atd. rozlišení mezi jednovaječnými dvojčaty umožňují. Je to proto, že kupříkladu otisky prstů vznikají sice na základě dědičné informace, ale na jejich přesnou výslednou podobu má určitý vliv i prostředí, které není u obou dvojčat zcela stejné (byť sdílejí tutéž dělohu). Otisky prstů jednovaječných dvojčat se proto v malé míře liší. Jak se vzájemně liší dvojvaječná dvojčata? Původ dvojvaječných dvojčat (vícevaječných vícerčat) je zcela odlišný: vznikají v důsledku vícečetného oplození, tj. při ovulaci se uvolní více vajíček a každé toto vajíčko je samostatně oplozeno. V některých případech nenastává ovulace současně, ale vajíčka se uvolní a jsou oplozena s určitým časovým odstupem, někdy i několikatýdenním. Jednoduše lze říci, že dvojvaječná (fraternální, dizygotní) dvojčata jsou normálními biologickými sourozenci, ovšem počatými v témže okamžiku (či s velmi krátkým časovým odstupem) a sdílejícími tudíž během prenatálního vývoje tutéž dělohu. Díky tomu lze mezi nimi analýzou DNA rozlišit stejně jako mezi biologickými sourozenci. Protože dvojvaječná dvojčata vznikají dvěma nezávislými oplozeními, vstupuje do hry ještě další možnost, totiž že biologickým otcem každého z nich je jiný muž. Tento jev se odborně 75

78 nazývá heteropaternální superfekundace a, jak dokládá báje o dvojčatech Héraklovi a Ífiklovi, jeho existence je lidstvu známa již nejméně od dob starého Řecka. Obrázek 20 Genetická informace dvouvaječných dvojčat se liší stejně jako genetická informace běžných sourozenců. Co je to chimérismus? Jako chimérismus označujeme stav, kdy je jeden fyzický jedinec tvořen buňkami původem z více zygot, neboli více genetami (genetickými jedinci). Rozložení obou buněčných linií v organismu může být nesmírně různorodé, závisí na způsobu vzniku chimérismu i na řadě dalších faktorů včetně náhody. Principiálně existuje více mechanismů, jak k chimérismu může dojít. 76

79 Co je to vrozený tetragametický chimérismus? Tetragametický chimérismus je jakýmsi pomyslným opakem jednovaječných dvojčat. Zatímco u jednovaječných dvojčat se jedna geneta rozdělí na dvě ramety, u tetragametického chimérismu se dvě genety spojí do jediné ramety. V těle ženy tedy dojde k oplození dvou vajíček dvěma spermiemi, která by za normálních okolností dala vzniknout dvojvaječným dvojčatům. Tato oplozená dělící se vajíčka se však cestou vejcovodem přiblíží k sobě natolik, že se navzájem slepí a do děložní sliznice zanoří jako jeden celek. Následně dají vzniknout jedinému fyzickému jedinci, který ale je tvořen buňkami dvojího, sourozeneckého původu (celkem dvěma vajíčky a dvěma spermiemi, tedy čtyřmi pohlavními buňkami odtud název tetragametický). Tetragametický chimérismus je velmi často nepozorovatelný, skrytý (kryptický). Na osobě často nejsou patrné žádné fyzické ani jiné odlišnosti, které by nám napověděly, že se může jednat o chiméru. Jinak řečeno, chimérou může být kdokoli z nás, aniž to tuší. Nicméně nutno konstatovat, že je to jev velmi řídký dosud popsané případy se čítají řádově na desítky osob. Je to však jev forenzně nesmírně zajímavý a se zásadními důsledky pro oblast identifikace a určení biologické příbuznosti analýzou DNA. U tetragametické chiméry totiž neplatí, že všechny tkáně daného jedince vykazují identický DNA profil, neboť každá z obou sourozeneckých buněčných linií nese profil jiný. Záleží tedy na tom, jakým způsobem jsou tyto linie v těle rozmístěny: může například nastat situace, kdy krev dotyčné osoby vykazuje jiný DNA profil než její sperma. 77

80 Obrázek 21 Genetická informace chimérického jedince vzniklého splynutím zárodků je dvojího typu; takový jedinec je vlastně spojením dvou sourozenců do jediného těla. Co je to vzájemná směna buněk mezi dvojvaječnými dvojčaty? U dvojvaječných dvojčat může v některých případech dojít k částečnému (byť třeba velmi malému) propojení jejich krevních oběhů. Krevní buňky jednoho dítěte tak mohou putovat krevním řečištěm druhého, a naopak. Mezi těmito buňkami jsou i buňky krvetvorné, které se mohou uhnízdit v kostní dřeni dvojčete a dát tam natrvalo vzniknout celé skupině krvetvorných buněk, z nichž vznikají krvinky a krevní destičky. Ve výsledku se tedy v kostní dřeni jednoho z dvojčat nachází malá část kostní dřeně 78

81 druhého dvojčete, která produkuje bílé krvinky nesoucí DNA tohoto dvojčete. Někdy je tento jev jednostranný (cizorodá linie buněk je pouze v jednom dvojčeti), někdy vzájemný (cizorodou linii mají obě dvojčata). Z forenzního hlediska je to jev méně významný, protože množství cizorodých krvinek je v poměru k množství vlastních krvinek nepatrné a ve výsledku tato příměs nijak zásadně neovlivňuje identifikaci analýzou DNA. Co je to maternální a fetální mikrochimérismus? Pod tímto neprůhledným pojmem se skrývá další z mechanismů vzniku chimérismu. Do embrya se během nitroděložního vývoje mohou implementovat a trvale v něm přežívat buňky matky a naopak, buňky plodu mohou v tomto období trvale kolonizovat tělo matky. Odborné studie prokázaly přetrvávání fetálních buněk v těle matky i po více než 50 letech od porodu. Uvedené mechanismy tedy prokazatelně existují, avšak jejich přesné příčiny, principy a též dopady na organismus jsou zatím předmětem zkoumání. Z forenzně genetického hlediska má maternální/fetální mikrochimérismus jen omezený význam. Experimentálně bylo například potvrzeno, že v některých případech lze díky tomuto jevu zjistit haplotyp chromozómu Y určitého muže rozborem krve jeho matky. Ve standardní praxi se však tyto analýzy nepoužívají. Může chimérismus vzniknout uměle? Ano. Vznik chimérického jedince je důsledkem některých moderních lékařských zákroků, při nichž jsou do organismu pacienta vpraveny živé buňky jiného člověka. Trvale chiméričtí jedinci vznikají v důsledku transplantací orgánů od dárce (ať už biologického příbuzného, či osoby zcela nepříbuzné). Výběr vhodného dárce se řídí tzv. tkáňovou kompatibilitou, tedy shodou 79

82 v tkáňových antigenech. Ty nemají nic společného s genetickým profilem užívaným k forenzně genetické identifikaci, a dárce a příjemce se tak genetickým profilem liší. Z forenzního hlediska nejzávažnější důsledky má bezesporu transplantace kostní dřeně, při níž jsou pacientovi vpraveny krvetvorné buňky kostní dřeně od dárce. Taková osoba potom má jiný genetický profil v krvi a prokrvených orgánech než kupříkladu v bukálním stěru či spermatu. To může např. vést k falešnému vyloučení osoby jako původce krevní stopy, je li porovnávána se vzorkem bukálního stěru. A naopak: taková stopa může být nesprávně ztotožněna s osobou, která byla dárcem kostní dřeně. Určení příbuznosti Co je to biologická příbuznost? Biologickou příbuzností dvou osob ve forenzní genetice rozumíme jednak stav, kdy jedna z těchto osob je přímým předkem druhé, nebo stav, kdy tyto dvě osoby mají blízkého společného předka. V prvém případě se typicky jedná o dvojice rodič dítě, prarodič vnouče, případně praprarodič pravnouče. Ve druhém případě jsou to nejčastěji dvojice sourozenecké a polovičně sourozenecké, a dále dvojice strýc/teta synovec/neteř, dvojice bratranecké, sestřenické a dvojice bratranec sestřenice. Co je to stupeň příbuznosti? Stupněm příbuznosti dvou osob vyjadřujeme, jak velké procento autozomální genetické informace těchto osob je shodného původu. Absolutní příbuznost představuje stav, kdy 100 % autozomální genetické informace je shodného původu. V absolutní příbuznosti jsou teoreticky pouze identická (jednovaječná dvojčata). 80

83 První stupeň příbuznosti představuje stav, kdy polovina, tj. 50 % autozomální genetické informace je shodného původu. V prvním stupni příbuznosti jsou dvojice rodič dítě a úplné sourozenecké dvojice. Druhý stupeň příbuznosti představuje stav, kdy čtvrtina, tj. 25 % autozomální genetické informace je shodného původu. Ve druhém stupni příbuznosti jsou dvojice prarodič vnouče, poloviční sourozenecké dvojice a dvojice biologický strýc/biologická teta synovec/neteř. Třetí stupeň příbuznosti představuje stav, kdy osmina, tj. 12,5 % autozomální genetické informace je shodného původu. Ve třetím stupni příbuznosti jsou dvojice praprarodič pravnouče, dvojice poloviční biologický strýc/ poloviční biologická teta synovec/neteř a dvojice bratranecké, sestřenické a dvojice bratranec sestřenice. Jaké genetické znaky jsou pro určení příbuznosti používány? K posouzení příbuznosti osob užíváme v zásadě čtyř skupin DNA lokusů: 1. lokusy autozomální, děděné dle mendelovských pravidel, tj. z matky i z otce na všechny děti 2. X chromozomální haplotyp, děděný z matky na všechny děti a z otce pouze na dcery 3. Y chromozomální haplotyp, děděný výhradně z otce na syny 4. mitotyp (lokusy mtdna), děděný z matky na všechny děti. Jak je vidět, každá z těchto čtyř skupin lokusů se dědí podle jiných pravidel. Vhodné lokusy pro testování vybíráme tedy na základě toho, jaký příbuzenský vztah chceme ověřit či vyvrátit. 81

84 Jak lze předpokládaný biologický vztah ověřit? Máme li určitou konkrétní hypotézu, tj. předpokládáme li mezi dvěma osobami určitý konkrétní biologický vztah (např. otec syn), víme, jakou měrou by se u něj měly shodovat jednotlivé výše zmíněné typy DNA lokusů. Provedeme analýzu a posoudíme, jak dobře zjištěná míra shody odpovídá míře očekávané. Někdy nemáme o příbuzenství dvou osob jen jednu, ale hned dvě či více alternativních hypotéz. Například: paní Novákové se narodil syn Adam, jehož otcem může být manžel paní Novákové Jiří Novák nebo jeho bratr Jindřich Novák nebo soused Novákových pan Josef Svoboda. O dvojici Adam Novák Jiří Novák tedy můžeme říci, že mohou být a) otec a syn, b) strýc a synovec nebo c) nepříbuzné osoby. V takovém případě opět posoudíme, jak zjištěná míra shody odpovídá míře očekávané u jednotlivých hypotéz. V extrémních případech nemáme o povaze biologického vztahu mezi dvěma osobami žádnou informaci, pouze nás zajímá, zda jsou tyto osoby biologicky příbuzné či nikoli. Zde je třeba upozornit, že na jisté úrovni jsou samozřejmě navzájem biologicky příbuzní všichni žijící lidé, a dotaz po vzájemné příbuznosti je tedy nutné omezit jen na určitý okruh možných příbuzenství tedy např. na příbuzenství do třetího stupně příbuznosti. V takovém případě tedy postupujeme tak, že testováním ověříme všechny biologické vztahy, které připadají u dané dvojice v úvahu. Jaká je očekávaná shoda u vybraných příbuzenských dvojic? Následující odstavce nejsou plným výčtem, ale představují nejběžnější posuzované biologické vztahy a příslušnou shodu znaků DNA. 82

85 matka dcera 50 % autozomální DNA je shodné původem obě mají po dvou X chromozómech, z toho jeden je shodný původem mitotyp je shodný původem matka syn 50 % autozomální DNA je shodné původem matka má dva X chromozómy, syn jeden, a to shodný původem s jedním z matčiných X chromozómů mitotyp je shodný původem otec dcera 50 % autozomální DNA je shodné původem dcera má dva X chromozómy, otec jeden, a to shodný původem s jedním z dceřiných X chromozómů mitotyp není shodný původem otec syn 50 % autozomální DNA je shodné původem otec i syn mají po jednom X chromozómu, tyto nejsou shodné původem otec i syn mají po jednom Y chromozómu, tyto jsou shodné původem mitotyp není shodný původem sestra sestra v průměru 50 % autozomální DNA je shodné původem obě mají po dvou X chromozómech, jeden nebo oba jsou shodné původem mitotyp je shodný původem 83

86 sestra bratr v průměru 50 % autozomální DNA je shodné původem sestra má dva X chromozómy, bratr jeden, tento může a nemusí být shodný původem s jedním ze sestřiných X chromozómů mitotyp je shodný původem bratr bratr 50 % autozomální DNA je shodné původem oba mají po jednom X chromozómu, tyto mohou a nemusí být shodné původem oba mají po jednom Y chromozómu, tyto jsou shodné původem mitotyp je shodný původem babička z matčiny strany vnučka v průměru 25 % autozomální DNA je shodné původem obě mají po dvou X chromozómech, z toho jeden může a nemusí být shodný původem mitotyp je shodný původem babička z matčiny strany vnuk v průměru 25 % autozomální DNA je shodné původem babička má dva X chromozómy, vnuk jeden, tento může a nemusí být shodný původem s jedním z babiččiných X chromozómů mitotyp je shodný původem dědeček z matčiny strany vnučka v průměru 25 % autozomální DNA je shodné původem vnučka má dva X chromozómy, dědeček jeden, tento může a nemusí být shodný původem s jedním z vnuččiných X chromozómů mitotyp není shodný původem dědeček z matčiny strany vnuk v průměru 25 % autozomální DNA je shodné původem 84

87 oba mají po jednom X chromozómu, tyto mohou a nemusí být shodné původem oba mají po jednom Y chromozómu, tyto nejsou shodné původem mitotyp není shodný původem babička z otcovy strany vnučka v průměru 25 % autozomální DNA je shodné původem obě mají po dvou X chromozómech, z toho jeden je shodný původem mitotyp není shodný původem babička z otcovy strany vnuk v průměru 25 % autozomální DNA je shodné původem babička má dva X chromozómy, vnuk jeden, tento není shodný původem ani s jedním z babiččiných X chromozómů mitotyp není shodný původem dědeček z otcovy strany vnučka v průměru 25 % autozomální DNA je shodné původem vnučka má dva X chromozómy, dědeček jeden, tento není shodný původem ani s jedním z vnuččiných X chromozómů mitotyp není shodný původem dědeček z otcovy strany vnuk 25 % autozomální DNA je shodné původem oba mají po jednom X chromozómu, tyto nejsou shodné původem oba mají po jednom Y chromozómu, tyto jsou shodné původem mitotyp není shodný původem nevlastní sestry (společná matka) v průměru 25 % autozomální DNA je shodné původem obě mají po dvou X chromozómech, z toho jeden nebo žádný je shodný původem 85

88 mitotyp je shodný původem nevlastní sestry (společný otec) v průměru 25 % autozomální DNA je shodné původem obě mají po dvou X chromozómech, z toho jeden je shodný původem mitotyp není shodný původem nevlastní sestra a bratr (společná matka) v průměru 25 % autozomální DNA je shodné původem sestra má dva X chromozómy, bratr jeden, tento může a nemusí být shodný původem s jedním ze sestřiných X chromozómů mitotyp je shodný původem nevlastní sestra a bratr (společný otec) v průměru 25 % autozomální DNA je shodné původem sestra má dva X chromozómy, bratr jeden, tyto nejsou shodné původem mitotyp není shodný původem nevlastní bratři (společná matka) v průměru 25 % autozomální DNA je shodné původem oba mají po jednom X chromozómu, tyto mohou a nemusí být shodné původem oba mají po jednom Y chromozómu, tyto nejsou shodné původem mitotyp je shodný původem nevlastní bratři (společný otec) v průměru 25 % autozomální DNA je shodné původem oba mají po jednom X chromozómu, tyto nejsou shodné původem oba mají po jednom Y chromozómu, tyto jsou shodné původem mitotyp není shodný původem 86

89 Obrázek 22 Rodokmen ilustrující stupeň příbuznosti běžných biologických příbuzenských vztahů. Osobu, k níž se porovnání vztahuje, označujeme běžně termínem proband (tak použito i v dalších obrázcích). 87

90 Obrázek 23 Rodokmen zachycující dědičnost autozomálních lokusů. Každá osoba nese dvě kopie daného lokusu, přičemž se může jednat od stejné nebo různé alely. 88

91 Obrázek 24 Rodokmen zachycující dědičnost X chromozomálních lokusů. Osoby ženského pohlaví nesou vždy dvě kopie téhož lokusu, osoby mužského pohlaví pouze jednu. 89

92 Obrázek 25 Rodokmen zachycující dědičnost Y chromozomálních lokusů. Osoby ženského pohlaví nenesou žádnou kopii téhož lokusu, osoby mužského pohlaví nesou kopii jednu. 90

93 Obrázek 26 Rodokmen zachycující dědičnost mitochondriální DNA. Každá osoba nese určitý mitotyp (vyjma osob s tzv. heteroplazmíí, o nichž bude pojednáno později). 91

94 Existují nějaké situace, kde výše uváděné míry shody neplatí? Ano. Námi popsané míry shody jsou platné jen tehdy, když daná dvojice osob je právě a pouze v uvedeném vztahu a tyto osoby nejsou zároveň příbuzné ještě jinak. Co máme na mysli? V praxi se poměrně často setkáme s takzvaným příbuzenským křížením neboli inbreedingem, který má významný vliv na očekávané míry shody genetických znaků. Inbreeding zahrnuje celou škálu jevů: jeho nejtvrdší formou je incest, tj. příbuzenské křížení mezi otcem a dcerou, matkou a synem, dědem a vnučkou, babičkou a vnukem nebo mezi sourozenci. O něco mírnější formou inbreedingu je konsangvinita neboli pokrevní příbuznost typickým příkladem budiž manželství (a společné rodičovství) bratrance a sestřenice. Za nejmírnější stupeň inbreedingu pak můžeme považovat křížení osob vzdáleně příbuzných, tak jak k němu běžně docházelo po dlouhá staletí i na našem území, a to zejména v izolovanějších subpopulacích. Partner pro uzavření manželství byl obvykle vybírán v té samé vesnici nebo v okruhu několika málo vesnic, což při dlouhodobém systematickém uplatňování této strategie vedlo k významnému zvýšení koeficientu příbuznosti obyvatel daného regionu, zvlášť přičteme li k tomu ještě posilující efekt skrytě konsangvinních svazků (manželé mohli být často nevlastní sourozenci, aniž to tušili, v důsledku nevěry svých rodičů). Při konstruování možných hypotéz biologické příbuznosti a určování očekávané míry shody genetických znaků je tedy třeba vždy zohlednit případnou předpokládanou či přímo potvrzenou konsangvinitu, či dokonce incest. Správné určení očekávané míry shody může být u složitějších či vícestupňově konsangvinních hypotéz opravdu nelehkou úlohou. 92

95 Obrázek 27 Rodokmen ilustrující zvýšený stupeň příbuznosti osob v rodině, kde došlo jak ke konsangvinnímu sňatku bratrance a sestřenice (značen modrou úsečkou), tak k nechtěně incestnímu sňatku probanda s nevlastní sestrou (značen červenou úsečkou). 93

96 Byl posuzován případ možného incestního vztahu, kdy ze zjištěných údajů vyplývalo, že muž (68) měl se svojí sestřenicí dceru, s touto dcerou měl další dceru (tedy zároveň vnučku) a s touto dcerou vnučkou zplodil syna (tedy zároveň vnuka a pravnuka). Pomineme li trestně právní a sociální rozměr případu, je tato kauza z hlediska stanovení správných očekávání genetické shody velmi zajímavá. Obrázek 28 Rodokmen ilustrující extrémní stupeň příbuznosti osob u mnohotně incestního případu (popis případu viz žlutý box výše). 94

97 Predikce biogeografického původu a fenotypových znaků osoby Co je etnický původ? Pojem etnický původ používáme v souvislosti s pojmenováním příslušnosti konkrétního jedince k určitému lidskému subtypu, subpopulaci, skupině. Zcela zásadní skutečností, kterou je třeba si v této souvislosti uvědomit a ujasnit, je, že skupiny označované jako rasa, národ, etnikum jsou definovány primárně socio kulturně, nikoli antropologicky či biologicky. Zůstává ovšem zjevné, že mezi skupinami lidí na Zemi existují markantní biologické rozdíly osoba původem z Afriky má jiné biologické vlastnosti než osoba původem z Asie. V rámci biologie a antropologie proto používáme termín biogeografický původ osoby. Ten zahrnuje a vystihuje jak biologické (a tedy i genetické) rozdíly mezi jednotlivými populacemi, tak geografické rozmístění těchto populací. Co je predikce biogeografického nebo etnického původu analýzou DNA? Predikcí biogeografického původu molekulárně genetickými metodami rozumíme určení, do jaké lidské subpopulace osoba patří, na základě analýzy DNA. Vzhledem k tomu, že jak bylo řečeno o odstavec výše lidské subpopulace jsou obvykle definovány a tedy i označovány především na základě sociokulturních souvislostí, je praktický potenciál analýzy DNA v této oblasti limitovaný. Zřejmé je, že vysoce spolehlivých výsledků dosahujeme tehdy, pokud se snažíme o rozlišení v nejhrubším měřítku, tj. o určení, zda osoba je evropského, asijského, afrického původu. Čím jemnější rozlišení požadujeme, tím větší statistickou chybou je analýza 95

98 zatížena a tím méně se lze na její výsledek spoléhat. Kupříkladu rozlišení mezi jednotlivými blízkými národy (Čech vs. Slovák) je prakticky nemožné, přestože statisticky mezi nimi jisté drobné rozdíly existují. Současně je potenciál této analýzy významně ovlivněn dvěma dalšími faktory: zaprvé mírou mobility obyvatelstva (např. pohyb obyvatelstva v Evropě je významně menší než v USA) a zadruhé podílem smíšených partnerství, tedy partnerství osob z původně geneticky výrazně vzdálených a odlišných populací typicky např. žena Nativní Američanka (my bychom ji označili jako Indiánku) a muž Afroameričan (my bychom jej označili jako černocha) opět je podíl těchto partnerství v Evropě významně nižší než v USA. Národ je typickou socio kulturně a geopoliticky definovanou skupinou příslušníci národa sdílejí především jazyk, kulturu, území a historii; pochopitelně řada z nich sdílí i biogeografický původ, ovšem toto kritérium není pro národ primární a určující. Zatímco u národů obývajících dlouhodobě významně izolovaná teritoria (např. ostrovy) je společný biogeografický původ silný, u jiných tomu tak není; kupříkladu my Češi jsme typickým národem dlouhodobě obývajícím průchozí území, což se odráží v našem genofondu: lakonicky řečeno, v různých obdobích naší historie do něj přispěl významně kde kdo (Slované, Hunové, Kelti, Turci, Švédové, Italové, Francouzi, Němci) a hledat tak dnes jakési genetické češství je beznadějné. Co je fenotypový znak? Fenotypovým znakem rozumíme libovolnou vlastnost organismu v tomto případě člověka, která je zjevná nebo zjistitelná (např. biochemickou analýzou). Můžeme sem zahrnout znaky tělesné (výška, váha, tvar lebky, barva vlasů, barva očí atd.), znaky biochemické a fyziologické (krevní skupina, rychlost spalování 96

99 glukózy atd.) i třeba znaky neurologické a psychické (svalové napětí, motorika chůze, temperament, inteligence atd.). Co je predikce fenotypu analýzou DNA? Predikcí fenotypu molekulárně genetickými metodami rozumíme určení, jak daný znak u osoby vypadá, na základě analýzy DNA. To je pochopitelně nesmírně zajímavé především z investigativního hlediska moci z biologické stopy získat popis osoby, která ji zanechala, je snem všech kriminalistů. Jaké znaky jsou pro takovouto predikci nejvhodnější? Především ty, které 1. jsou stálé v čase, tj. relativně neměnné (např. tělesná výška je u dospělé osoby mnohem stálejší znak než tělesná hmotnost) 2. jsou zjevné i při běžném kontaktu s osobou, a lze je tedy zjistit bez složitých vyšetření, a často dokonce bez vědomí dotyčné osoby (např. barvu očí zjistíme pouhým pohledem, zatímco krevní skupinu osoby musíme vyšetřit sérologicky či geneticky) 3. jsou dostatečně variabilní, díky čemuž můžeme na základě daného znaku osoby rozlišit na ty, které se se stopou shodují, a ty, které ne (např. barva očí je mnohem variabilnější znak než počet očí) 4. jsou silně geneticky determinované a mohou být analýzou DNA predikovány s vysokou spolehlivostí (např. již zmíněná barva očí je mnohem snáze predikovatelný znak než tvar a rozměry úst). 97

100 Co tedy lze v současnosti z biologické stopy s relativně velkou spolehlivostí predikovat? 1. Pohlaví (prakticky s jistotou); 2. Biogeografický původ v hrubém měřítku; 3. Přirozenou barvu očí (v hrubém rozlišení např. modrá/ hnědá); 4. Přirozenou barvu vlasů (v hrubém rozlišení např. blond/rezavá/tmavá); 5. Přirozenou barvu pokožky (v hrubém rozlišení např. velmi světlá/velmi tmavá); Vyjma určení pohlaví což je rutinní záležitost byly dosud ve světě tyto predikce provedeny přímo z forenzních vzorků jen v několika málo kriminálních případech a příslušné metody jsou zatím spíše vyvíjeny a ověřovány. Problematice se v minulých letech intenzivně věnovala americká společnost DNAprint Genomics, sídlící na Floridě, která vytvořila první komerčně dostupné testy predikce etnicity a fenotypových znaků; po určité době však tyto své původně nadějné projekty revidovala, nabízené produkty stáhla a v roce 2009 ukončila svou činnost. Které forenzně zajímavé fenotypové znaky dosud nelze ze stopy věrohodně predikovat? Dosud zůstávají zcela nepredikovatelné či velmi nespolehlivě predikovatelné například stáří osoby, tělesná výška a rysy obličeje. 98

101 Obecné principy forenzně genetické analýzy Principy identifikace Na základě analýzy jakých lokusů v DNA lze osobu identifikovat? Pro identifikace jsou užívány lokusy polymorfní až vysoce polymorfní, tedy ty, u nichž existuje v populaci několik (často i desítky) možných variant alel. Právě díky existenci mnoha variant se osoby v populaci navzájem velmi často liší tím, kterou konkrétní alelu či alely ve své DNA nesou. Co jsou repetitivní sekvence DNA? Jedněmi z nejpolymorfnějších lokusů lidské (a nejen lidské) DNA jsou tzv. repetitivní sekvence. Jsou to takové sekvence, které se v genomu nevyskytují pouze jednou, ale opakovaně. Tedy určitý motiv (určitá přesná sekvence) se v genomu objevuje vícekrát. Pokud jsou jednotlivé motivy v DNA zařazeny těsně za sebou v tandemu, nazýváme takový úsek DNA tandemová repetice. Pokud se jednotlivá opakování motivu vyskytují rozptýleně na různých místech genomu, a to třeba i na různých chromozómech, mluvíme o repetici rozptýlené. Které repetitivní sekvence jsou forenzně využívány pro identifikaci? V počátcích forenzní genetiky byly k identifikačním analýzám užívány tzv. dlouhé tandemové repetice s variabilním počtem opakování, označované jako VNTR (angl. Variable Number of Tandem Repeats) neboli minisatelity. V současnosti jsou pro 99

102 identifikaci zdaleka nejužívanějšími lokusy tzv. krátké tandemové repetice, označované jako STR (angl. Short Tandem Repeats) neboli mikrosatelity. Co jsou minisatelity neboli VNTR? Minisatelity neboli VNTR (angl. Variable Number of Tandem Repeats) čili dlouhé tandemové repetice s variabilním počtem opakování jsou repetitivní sekvence s typickou délkou základního motivu nukleotidů; tento motiv se vyskytuje na určitém místě DNA v jednotkách až stovkách opakování těsně za sebou. Jednotlivé alely minisatelitu se liší počtem opakování základního motivu, a tedy délkou. Dejme tomu, že určitá VNTR repetice lidského genomu má délku základního motivu 17 nukleotidů, přičemž motiv se může opakovat krát. Nejkratší alela této repetice je tedy dlouhá 1190 nukleotidů a nejdelší alela 7650 nukleotidů. VNTR lokusy se vyskytují na mnoha místech genomu a byly prvními, které byly pro účely identifikace využity. Dnes už jsou postupy založené na jejich analýze překonány a pro identifikace se od poloviny 90. let 20. století prakticky neužívají, a proto se jim nebudeme již podrobněji věnovat. Co jsou mikrosatelity neboli STR? Mikrosatelity neboli STR (angl. Short Tandem Repeats) čili krátké tandemové repetice (označované někdy též SSR angl. Simple Sequence Repeat) jsou repetitivní sekvence s typickou délkou základního motivu 2 9 nukleotidů; tento motiv se vyskytuje na určitém místě DNA v jednotkách až desítkách opakování těsně za sebou. Jednotlivé alely mikrosatelitu se tak stejně jako u minisatelitů liší počtem opakování základního motivu, a tedy 100

103 délkou, nicméně celková délka repetice je u STR výrazně kratší než u VNTR. Dejme tomu, že určitá STR repetice lidského genomu má délku základního motivu 4 nukleotidy, přičemž motiv se může opakovat 8 15krát. Nejkratší alela této repetice je tedy dlouhá 32 nukleotidů a nejdelší alela 60 nukleotidů. (Prosím srovnejte s délkami nejkratší a nejdelší alely typické VNTR, uvedenými v textu o něco výše). Obrázek 29 Struktura krátké tandemové repetice (STR) neboli mikrosatelitu. STR lokusy se vyskytují na všech lidských chromozómech včetně pohlavních chromozómů X a Y, nenajdeme je pouze v mitochondriální DNA. Jsou jich známy tisíce a tvoří cca 3 % 101

104 lidského genomu, nicméně zdaleka ne všechny tyto mikrosatelity jsou variabilní. Jak mikrosatelity (STR lokusy) a jejich alely klasifikujeme? Jednotlivé mikrosatelity mohou mít systematická i vžitá (triviální) označení. Obecně mikrosatelity objevené a k analýzám užívané již dávno mají spíše označení triviální, vycházející obvykle z názvu blízké genové sekvence např. TPOX, FGA, vwa apod. Lokusy novější jsou označovány systematickým názvem např. D21S11, D19S433 či D5S818, ne však vždy (např. relativně nově užívané pětinukleotidové lokusy jsou známy pod názvem Penta E a Penta D). Jak již bylo řečeno výše, mikrosatelity mohou mít délku základního motivu 2 9 nukleotidů, a právě podle ní klasifikujeme jednotlivé mikrosatelity na di, tri, tetra, penta, hexa, hepta, okta a nonanukleotidové. Pro forenzní analýzy lidí jsou využívány prakticky výhradně STR lokusy tetra nebo pentanukleotidové, tedy ty se základním motivem dlouhým 4 nebo 5 nukleotidů. U repetic s kratším motivem (2 či 3 nukleotidy) může při analýze docházet ve velké míře k těžko odstranitelnému nežádoucímu jevu, zvanému stuttering (prokluz polymerázy, jev je podrobněji popsán v kapitolách pojednávajících o technologii forenzně genetické analýzy), repetice s delším motivem (6 9 nukleotidů) jsou již zase celkově dosti dlouhé (čtyřnukleotidová repetice s 20 opakováními motivu měří 80 nukleotidů, zatímco osminukleotidová repetice se stejným počtem opakování měří 160 nukleotidů), což může vést k problémům s jejich analýzou u vzorků s degradovanou DNA. Jednotlivé alely STR lokusů označujeme číslem vyjadřujícím počet opakování základního motivu u této konkrétní alely. Tedy alela 7 představuje takovou variantu daného STR lokusu, v níž se základní motiv opakuje 7krát. 102

105 Některé alely však nejsou tvořeny celým počtem opakování základního motivu: lokus je tvořen například 7 celými opakováními čtyřnukleotidového motivu, za nimiž následují ještě dva nukleotidy z osmého opakování (tj. osmé opakování motivu není celé, ale v repetici jsou z něj přítomny jen dva nukleotidy). Takové alely označujeme jako mikrovarianty a značíme je počtem úplných opakování základního motivu, za nímž následuje tečka a počet nadbytečných nukleotidů v našem příkladu tedy 7.2. Obrázek 30 Alely STR lokusu standardní a mikrovariantní. Jak byly vybrány konkrétní STR lokusy (mikrosatelity) pro forenzní testování? Pro potřeby forenzního testování byly zvoleny takové lokusy, které mají kromě již výše zmíněné vhodné délky základního motivu (4 103

106 nebo 5 nukleotidů) také velkou variabilitu, tj. co největší počet existujících alel, a pokud možno vyvážené frekvence těchto alel. Nutno říci, že ne všechny z testovaných lokusů tuto podmínku splňují a v základním setu testovaných lokusů zůstávají zejména z historických důvodů. Další důležitou podmínkou je, aby jednotlivé testované lokusy nebyly v tzv. genetické vazbě laicky řečeno, aby v DNA nebyly příliš blízko sebe. Ideálně jsou vybírány do testování STR lokusy lokalizované na různých chromozómech, a pokud už jsou na témže chromozómu, pak dostatečně daleko od sebe. (Tento princip neplatí u STR lokusů na pohlavních chromozómech X a Y, o kterých bude později pojednáno samostatně). Principiálně je důležité, aby po celém světě byly pro forenzní analýzy používány pokud možno stejné lokusy jedině tak lze data získaná v různých laboratořích vzájemně srovnávat (u dvou vzorků např. stopy a srovnávacího vzorku lze porovnat vždy pouze výsledky analýzy stejných lokusů). V současné době existuje pro identifikaci několik oficiálně doporučených setů autozomálních STR lokusů, které se v mnoha zařazených lokusech shodují. Jsou to: The CODIS STR Loci 13 STR lokusů jako základní standardní set pro oblast USA; The Expanded U.S. Core Loci 18 STR lokusů (13 původních + 5 nových) jako rozšířený standardní set pro oblast USA; The European Standard Set (ESS) 7 STR lokusů jako základní standardní set pro Evropu; je totožný s The Interpol Standard Set of Loci (ISSOL); The Extended European Standard Set (extended ESS) 12 STR lokusů (7 původních + 5 nových) jako rozšířený standardní set pro Evropu. 104

107 Pro analýzu Y chromozomálních STR lokusů rovněž existují doporučené sety těchto markerů hovoříme o tzv. minimálním a rozšířeném Y STR haplotypu. Minimální haplotyp označovaný minht zahrnuje 8 Y STR lokusů, rozšířený pak dalších 8 Y STR lokusů. Pro analýzu X chromozomálních STR lokusů tak významná doporučení neexistují, v rámci forenzních analýz je otestováno celkem cca 33 různých X STR a výběr závisí především na rozhodnutí dané laboratoře. Jak vypadá genotyp STR lokusu konkrétního jedince? U STR lokusu, který se nachází na nepohlavních chromozómech (autozómech), má konkrétní jedinec dvě kopie daného lokusu, a může tedy být buď heterozygotní (např. 11/12 tj. má jednu alelu 11 a jednu 12), nebo homozygotní (např. 13/13 tj. má dvě kopie alely 13). U STR lokusu, který se nachází na X chromozómu, je muž vždy hemizygotní má pouze jeden X chromozóm, a tedy pouze jednu kopii daného lokusu (např. alelu 12), zatímco žena má dva X chromozómy, a může tedy být heterozygotní (např. 12/14) nebo homozygotní (např. 11/11). U STR lokusu, který se nachází na Y chromozómu, je daný lokus přítomen pouze u muže, a to v jedné kopii (má např. alelu 12). Toto konstatování však neplatí u některých Y STR lokusů, jež jsou na Y chromozómu duplikovány (zdvojeny), přičemž každá ze dvou kopií může obsahovat jinou alelu a muž pak má genotyp např. 11/14 (nejedná se však o heterozygozitu). 105

108 Obrázek 31 Možné varianty srovnání genotypu stopy a osoby: neshoda, náhodná shoda nebo zákonitá shoda genotypu. Jak probíhá identifikace (určení shody) pomocí analýzy autozomálních STR lokusů? Pokud mají dva biologické vzorky (např. krevní stopa a srovnávací vzorek) téhož původce neboli stejný zdroj, pak bude forenzně genetickou analýzou určitého STR lokusu v obou vzorcích stanoven identický genotyp tohoto lokusu; tedy kupříkladu je li ve stopě zjištěn genotyp 11/15, pak i v bukálním stěru jejího původce bude stanoven genotyp 11/15. (Bohužel, toto tvrzení nemusí být vždy pravdivé a vzácně se objeví i situace, kdy se genotyp dvou vzorků nemusí shodovat, přestože mají stejného původce; jednou z nich je již dříve popsaný chimérismus, dále se může jednat o tzv. mozaicismus mutaci přítomnou pouze v některých buňkách dané osoby.) 106

109 Naproti tomu, pokud mají dva biologické vzorky různého původce, pak forenzně genetickou analýzou bude v poměrně velkém procentu případů zjištěn rozdílný genotyp (např. stopa 11/15 a srovnávací vzorek 12/15). Může nicméně nastat situace, kdy i u takovýchto vzorků s různým původcem bude zjištěn stejný genotyp tedy např. u obou 13/14), a to proto, že oba původci se koincidencí, náhodou shodují v genotypu testovaného lokusu. Je tedy zřejmé, že testování jediného STR lokusu nám nepomůže otázku na společný respektive rozdílný původ obou vzorků spolehlivě zodpovědět. Proto je při forenzně genetické analýze současně testován větší počet STR lokusů (v ČR obvykle typicky 15 autozomálních STR lokusů), čímž se náhodná shoda dvou osob stává extrémně nepravděpodobnou a testování má vysokou vypovídací hodnotu. Analýza setu autozomálních STR lokusů (a současně s ní prováděná analýza pohlaví) je nejfrekventovanějším postupem současné kriminalistické a identifikační forenzní genetiky. Své uplatnění nachází v nejrůznějších typech kriminálních případů či identifikačních úkonů a může v principu vést až k individuální identifikaci zůstavitele biologického materiálu. Jak probíhá identifikace (určení shody) pomocí analýzy X chromozomálních STR lokusů? Pokud mají dva biologické vzorky téhož původce neboli stejný zdroj, pak se u nich bude shodovat i genotyp X chromozomálních STR lokusů; pro přímou identifikaci se ovšem analýza X chromozomálních markerů prakticky nevyužívá, neboť nepřináší žádný benefit. Je však velmi zajímavým nástrojem při určování některých typů biologických vztahů viz část věnovaná principům určení příbuznosti. 107

110 Jak probíhá identifikace (určení shody) pomocí analýzy Y chromozomálních STR lokusů? Pokud mají dva biologické vzorky téhož původce neboli stejný zdroj, pak se u nich bude shodovat i haplotyp Y chromozomálních STR lokusů; opět ovšem nelze vyloučit možnost existence drobné odchylky, způsobené mutací. Y chromozóm je předáván z otce na všechny syny, a to v nezměněné podobě, proto tuto analýzu samu o sobě nelze použít k individuální identifikaci osoby. Při identifikacích tedy tuto analýzu užíváme v některých specifických situacích, kdy je analýza autozomálních STR neinformativní: typicky je to analýza stopy tvořené ženským biologickým materiálem s malou příměsí materiálu mužského, kdy analýza autozomálních STR zpravidla není schopna detekovat alely minoritní složky směsi, tj. alely muže. Takovými typickými vzorky jsou 1. poševní stěr po znásilnění, při němž nedošlo k ejakulaci pachatele do pochvy poškozené (anebo je pachatel azoospermický, tj. nemá v ejakulátu spermie), 2. vzorek materiálu zpoza nehtů ženy fyzicky napadené mužem. Analýzou Y STR v těchto případech sice nedosáhneme individuální identifikace pachatele, ale v případě neshody haplotypů můžeme podezřelou osobu prakticky s jistotou vyloučit. Jaké další lokusy kromě repetic jsou forenzně využívány pro identifikaci? Dalšími lokusy, které lze využít pro identifikaci, jsou tzv. jednonukleotidové polymorfismy, označované jako SNP (angl. Single Nucleotide Polymorphisms). Konečně v určitých specifických případech je pro skupinovou identifikaci osob užívána analýza tzv. 108

111 hypervariabilních oblastí mitochondriální DNA, označovaných jako HVR mtdna (angl. Hypervariable Region of mitochondrial DNA). Co jsou jednonukleotidové polymorfismy neboli SNP? Jednonukleotidové (bodové) polymorfismy jsou ve své podstatě nejjednodušším možným polymorfismem, jaký může v DNA existovat. V určitém konkrétním místě DNA se u jedné osoby vyskytuje jiný nukleotid než u druhé. Kupříkladu: zatímco osoba A má v určitém místě sekvenci AATGGATA, osoba B má v tomtéž místě sekvenci AATGGGTA; vidíme, že šestý nukleotid této sekvence je u obou osob různý, a dané místo je tedy polymorfní. Protože tento polymorfismus spočívá ve změně jediného nukleotidu sekvence, hovoříme o jednonukleotidovém polymorfismu. Obrázek 32 Struktura jednonukleotidového polymorfismu (SNP). 109

112 SNP se vyskytují po celém lidském genomu s četností cca 1 na 1000 nukleotidů u každého z nás lze tedy nalézt miliony takovýchto polymorfismů. Jak SNP lokusy a jejich alely klasifikujeme? Jednotlivé SNP lokusy jsou zpravidla specifikovány prostřednictvím svého referenčního čísla v databázi dbsnp, vedené NCBI (National Center for Biotechnology Information). Označení konkrétního SNP pak je kupříkladu rs Jednotlivé alely SNP lokusů označujeme písmenem označujícím příslušný nukleotid tj. A, C, G nebo T. Principiálně mohou u každého SNP lokusu existovat nanejvýše čtyři možné alely: A, C, T a G (více základních typů nukleotidů v DNA není). Valná část SNP lokusů je však tzv. bialelických to znamená, že v populaci se vyskytují pouze dvě varianty (alely) tohoto SNP; například větší procento populace má v daném místě nukleotid C, menší procento pak nukleotid A. Při popisu příslušného SNP užíváme zápis rs C>A nebo rs C/A, kterým vyjadřujeme, jaké alely se v tomto SNP vyskytují a která z nich je frekventovanější. Nutno však říci, že nomenklatura SNP není v tomto směru zcela jednotná a existují i jiné způsoby zápisu. Jak vypadá genotyp SNP lokusu konkrétního jedince? U SNP lokusu, který se nachází na nepohlavních chromozómech (autozómech), má konkrétní jedinec dvě kopie daného lokusu, a může tedy být buď heterozygotní (např. AT tj. má jednu alelu A a jednu T), nebo homozygotní (např. TT tj. má dvě kopie alely T). U SNP lokusu, který se nachází na X chromozómu, je muž vždy hemizygotní má pouze jeden X chromozóm, a tedy pouze jednu kopii daného lokusu (např. alelu C), zatímco žena má dva X 110

113 chromozómy, a může tedy být heterozygotní (např. CG) nebo homozygotní (např. GG). U SNP lokusu, který se nachází na Y chromozómu, je daný lokus přítomen pouze u muže, a to v jedné kopii (má např. alelu T). Jak probíhá identifikace (určení shody) pomocí analýzy SNP lokusů? Princip identifikace pomocí SNP je prakticky shodný s principem identifikace u STR: pokud předpokládáme, že dva vzorky mají téhož původce, měl by v nich být stanoven i stejný genotyp SNP lokusu. Mají li různého původce, může a nemusí být v nich stanovený genotyp shodný. Poměrně podstatným rozdílem oproti STR, který si musíme uvědomit, je malá alelická škála SNP lokusu: zatímco u typického STR jsme hovořili o desítkách možných alel, u SNP mohou z podstaty věci existovat nanejvýše čtyři alely, ale v praxi jsou dokonce zpravidla užívány již zmíněné lokusy bialelické, tedy s pouhými dvěma alelami. Důsledkem je podstatně větší pravděpodobnost náhodné shody osoby se vzorkem, jehož původcem je někdo jiný. Abychom tento efekt malé alelické škály vyvážili, je pro dosažení potřebné míry spolehlivosti do testování třeba zařadit mnohem více SNP lokusů, než tomu bylo u STR, a to až desítky. Přestože analýza SNP má prakticky stejný identifikační potenciál jako analýza STR, v praxi je mnohem méně využívána. Hlavními příčinami jsou zejména 1. Nutnost převést laboratoř (včetně celé metodiky a systému kvality) na analýzu SNP, někdy i částečně převybavit laboratoř technologicky (analýza základních forenzních SNP je 111

114 proveditelná na zařízeních používaných pro STR analýzu, celá řada SNP aplikací je však založena na odlišných technologiích) 2. Nekompatibilita dat (pokud jsou v databázích uloženy STR profily, pak SNP profil není s nimi porovnatelný, jedná se o jiný identifikační údaj) 3. Problematičtější použitelnost pro analýzu směsí biologických materiálů 4. Souvislost mnohých SNP s dědičnými chorobami. Pro svůj velmi zajímavý potenciál v oblasti predikce biogeografického původu a fenotypových znaků (viz dále) však pravděpodobně budou v budoucnu SNP lokusy stále vyhledávanějším cílem forenzně genetické analýzy. Co jsou hypervariabilní oblasti mitochondriální DNA neboli HVR mtdna? Mitochondriální DNA (mtdna) je velmi specifickou částí dědičné informace v buňce. Je to jednoduchá kruhová molekula DNA (nemá tedy podobu chromozómu) a typově je stejná jako DNA bakterií. Současné teorie předpokládají, že mitochondrie mají skutečně svůj původ v bakteriích, které se postupně začlenily do pokročilých eukaryotních buněk a staly se jejich nedílnou součástí. MtDNA je z velké části tvořena kódujícími sekvencemi (geny), extragenové DNA zde najdeme relativně velmi málo. Výjimkou je oblast tzv. D kličky (smyčky) (angl. D loop), zvaná též kontrolní (řídící) oblast (angl. control region). Zhruba uprostřed této oblasti leží tzv. ori H místo, odkud se mtdna kopíruje, a po jeho obou stranách se nacházejí nekódující úseky, v nichž najdeme velký počet variabilních míst; proto tyto úseky označujeme jako hypervariabilní a značíme HVR (angl. Hypervariable Region). 112

115 V lidské mtdna rozlišujeme dvě hlavní hypervariabilní oblasti (HV1 a HV2) a jednu vedlejší (HV3): 1. HV1 (též HVR1 či HVI) je standardně dlouhá 341 nukleotidů 2. HV2 (též HVR2 či HVII) je standardně dlouhá 267 nukleotidů 3. HV3 (též HVR3 či HVIII) je standardně dlouhá 136 nukleotidů Při analýzách jsou zpravidla sekvenovány především HV1, která je delší, ale o něco méně polymorfní, a HV2, která je kratší, ale polymorfnější; zahrnutí analýzy HV3 je spíše doplňkovou záležitostí. Obrázek 33 Struktura mitochondriální DNA (mtdna) a jejích hypervariabilních oblastí HV1, 2 a

116 Jak vypadá HVR mtdna konkrétního jedince, jak popisujeme jednotlivé alely HVR mtdna? Pokud porovnáme sekvenci hypervariabilní oblasti mtdna dvou osob, najdeme zde zpravidla několik drobných rozdílů, kterými mohou být: 1. Drobné záměny jednotlivých nukleotidů (tedy vlastně SNP) tzv. nukleotidové substituce: např. osoba A má v pozici nukleotid T, zatímco osoba B má v téže pozici nukleotid C. 2. Drobné délkové změny inzerce (vřazení) či naopak delece (vypadnutí) jednoho, dvou či tří nukleotidů: například osoba A má v určitém místě HVR sekvenci AAACCCCTCCAT, osoba B sekvenci AAACCCCTTCCAT a osoba C naopak jen AAACCCTCCAT Popsat stav hypervariabilní oblasti konkrétní osoby bychom samozřejmě mohli tím, že bychom uvedli její kompletní sekvenci; takový zápis by však byl pro svou délku a nepřehlednost značně nepraktický. Postupujeme tedy tak, že zjištěnou sekvenci konkrétní osoby srovnáme s referenční sekvencí, kterou označujeme jako rcrs (angl. revised Cambridge Reference Sequence), a zapíšeme odchylky od této sekvence, a to takto: 1. U substitucí uvedeme nukleotid, který je na dané pozici přítomen místo standardního nukleotidu referenční sekvence, tedy kupříkladu 16126C (= na pozici je u vyšetřované osoby nukleotid C ). 2. U delecí uvedeme pozici a d, del nebo, tedy kupříkladu 315d respektive 315del či 315 (= u vyšetřované osoby nukleotid na pozici 315 chybí ). 114

117 3. U inzercí uvedeme poslední standardní pozici, tečku, pořadí inzertovaného nukleotidu a typ nukleotidu, tedy kupříkladu 211.1A (= u vyšetřované osoby je za standardní pozicí 211 navíc začleněn nukleotid A ). 4. Za určitých okolností může být některý z nukleotidů analýzou opakovaně nečitelný (nelze zjistit, který nukleotid v dané pozici je) potom užijeme označení N například 16143N (= u vyšetřované osoby nebylo možno určit typ nukleotidu v pozici ). Ve valné většině případů mají všechny tkáně i jednotlivé buňky osoby stejnou sekvenci hypervariabilních oblastí mtdna. Nicméně, neplatí to vždy; relativně vzácně se můžeme setkat s jevem, označovaným jako heteroplazmie. Je to jednak stav, kdy některé skupiny buněk v rámci téže tkáně mají jinou sekvenci HVR než jiné, a jednak stav, kdy se mitochondrie s rozdílnou sekvencí HVR nacházejí společně přímo v rámci jednotlivých buněk. Zpravidla se obě linie liší jediným zaměněným nukleotidem danou pozici pak zapíšeme např C/T, někdy se lze setkat i s označením 16126Y (Y se použije pro heteroplazmii C/T, R se použije pro heteroplazmii A/G). Jak probíhá identifikace (určení shody) pomocí analýzy HVR mtdna? Při porovnávání dvou vzorků vycházíme opět z předpokladu, že mají li tyto vzorky společného původce, měly by mít i stejnou sekvenci hypervariabilních oblastí. Porovnáme tedy námi zjištěné odchylky od standardní sekvence obou vzorků. Zde je třeba znovu konstatovat a zdůraznit, že sekvence HVR mtdna nejsou z logiky věci markery individuálně identifikující: jsou děděny v nezměněné podobě v maternální linii (po přeslici) a 115

118 všechny osoby v této linii mají nedojde li k mutaci sekvence mtdna identické. Analýzou tedy nelze rozlišit např. mezi sourozenci (pokud mají společnou matku), mezi matkou a jejími dětmi, mezi vnukem a babičkou z matčiny strany atd. V případě zjištění shody sekvencí obou vzorků proto pouze společného původce obou vzorků nevyloučíme, ale rozhodně nepotvrdíme. Na druhou stranu, vzhledem k mnohonásobně vyšší mutační rychlosti DNA mitochondrií než má jaderná DNA, a též vzhledem k již zmíněné možnosti heteroplazmie existuje statisticky nenulová možnost, že i dva vzorky stejného původce se mohou lišit jedním nukleotidem. Proto teprve zjištění většího počtu rozdílů (2 a více) v HVR sekvenci obou vzorků nás opravňuje hypotézu společného původce vzorků vyloučit. Analýza mtdna, podobně jako analýza Y STR, není schopna osobu jednoznačně identifikovat. Své uplatnění v kriminalistické a identifikační forenzní genetice však nachází tam, kde je analýza jaderné DNA (autozomálních, X a Y chromozomálních lokusů) nemožná či velmi obtížná; těmito situacemi jsou zejména: 1. Analýza kosterního materiálu s vysoce degradovanou DNA 2. Analýza fragmentů vlasů a chlupů bez kořínku, tj. v katagenní či telogenní fázi vývoje, či pouhých vlasových fragmentů. Analýzou mtdna opět nedosáhneme individuální identifikace pachatele, ale v případě neshody HVR můžeme podezřelou osobu stejně jako u haplotypu Y chromozómu prakticky s jistotou vyloučit. Analýza mtdna je rovněž cenným nástrojem při posuzování příbuzenských vztahů (viz dále). 116

119 Principy určení příbuznosti Na základě analýzy jakých lokusů v DNA lze posuzovat biologickou příbuznost osob? Pro posouzení příbuznosti jsou stejně jako pro identifikace užívány lokusy polymorfní až vysoce polymorfní. V části Forenzní potenciál genetické analýzy jsme si již řekli, že k posouzení příbuznosti využíváme v zásadě čtyř typů DNA lokusů, a to: 1. lokusů autozomálních, děděných z matky i z otce na všechny děti; zde se zaměřujeme (stejně jako u identifikací) zejména na STR lokusy, 2. lokusů X chromozomálních, děděných z matky na všechny děti a z otce pouze na dcery; ve forenzní praxi jsou využívány téměř výhradně X STR lokusy (principiálně by bylo možno použít i X SNP lokusy, které se však užívají spíše v rámci evolučně migračních studií), 3. lokusů Y chromozomálních, děděných výhradně z otce na syny; ve forenzní praxi jsou využívány téměř výhradně Y STR lokusy (principiálně by bylo možno použít i Y SNP lokusy, které se však užívají spíše v rámci evolučně migračních studií), 4. lokusů mitochondriálních, děděných z matky na všechny děti; stejně jako u identifikací se zde analýza soustředí na hypervariabilní oblasti neboli HVR. Jak lze posoudit příbuznost osob na základě autozomálních STR lokusů? Základní pravidla, kterými se primárně řídí dědičnost autozomálních lokusů, jsme zde již zmínili, a lze je shrnout takto: 1. Rodič svému dítěti předá vždy jednu ze svých dvou alel. 117

120 2. O tom, která z obou rodičových alel bude předána, rozhoduje náhoda. 3. S určitou velmi malou pravděpodobností může v době předávání (tj. při vzniku vajíčka či spermie, z něhož posléze dítě vznikne) dojít k mutaci, která předávanou alelu pozmění (např. z alely 11 se stane alela 12). Dvě osoby (bez ohledu na to, zda jsou příbuzné či nikoliv) mohou nést tutéž alelu určitého lokusu např. jedna osoba má genotyp 11/12, druhá osoba je 12/14 shodně mají tedy obě alelu 12. Této alele pak říkáme alela shodná stavem. Osoby biologicky příbuzné mají některé své alely shodné původem; to znamená, že příslušná alela pochází od společného předka obou těchto osob, nebo dokonce že jedna z těchto osob je přímým předkem druhé osoby. Alely shodné původem mohou, ale nemusejí být shodné stavem (shodné nejsou, nastala li mezigenerační mutace). Alely shodné stavem mohou, ale nemusejí být shodné původem (lidé se náhodně shodují, ačkoli nejsou příbuzní). Pro lepší pochopení uveďme konkrétní případ: Pavel a Marie jsou manželé a pokud je jim známo nejsou nijak biologicky příbuzní. Pavel má v lokusu A genotyp 8/12, Marie genotyp 8/14. Alela 8 je u nich alelou shodnou stavem, nikoli však původem. Pavlovi a Marii se narodí syn David, který má v lokusu A genotyp 8/14. Je zřejmé, že David alelu 14 získal od matky Marie (je to tedy jeho maternální alela) a můžeme konstatovat, že alela 14 je u Davida a Marie shodná stavem i původem. Alelu 8 musel proto David získat od otce Pavla (je to tedy jeho paternální alela) a můžeme konstatovat, že alela 8 je u Davida a Pavla shodná stavem 118

121 i původem. Marie má také alelu 8, ovšem tu s jistotou Davidovi nepředala (neboť mu předala alelu 14), a můžeme tedy konstatovat, že alela 8 je u Davida a Marie shodná stavem, nikoli však původem. Po čase se Pavlovi a Marii narodí syn Lukáš, který má v lokusu A genotyp 11/14. Pavel se s Lukášem tedy neshoduje ani v jedné z alel. Analýza řady dalších lokusů prokáže, že příčinou není Mariina nevěra, ale mezigenerační mutace Pavlovy alely 12 na Lukášovu alelu 11. Můžeme tedy konstatovat, že Pavlova alela 12 a Lukášova alela 11 jsou shodné původem, nikoli však stavem. Jak již jsme konstatovali v části věnované obecným informacím o posouzení příbuznosti, každý typ biologického příbuzenského vztahu je charakterizován určitým podílem alel shodných původem. Při analýze ovšem tento podíl nedokážeme nikdy určit přímo, ale pouze zprostředkovaně pomocí vyhodnocení přítomnosti alel shodných stavem. Lze posoudit otcovství muže k dítěti i bez vzorku matky dítěte? Ano. Znalost DNA profilu matky umožňuje zpravidla identifikovat, která alela dítěte je paternálního původu, což zlepšuje statistické parametry zkoumání, není však v žádném případě nezbytnou podmínkou posouzení otcovství. K tomu stačí znalost profilu dítěte a znalost profilu potenciálního otce. Lze posoudit otcovství muže k dítěti i bez jeho vzorku? Za určitých okolností ano. Není li k dispozici přímo vzorek nařčeného (potenciálního otce), je možné použít ke srovnání vzorky jeho blízkých biologických příbuzných rodičů (tj. potenciální 119

122 babičky a dědečka dítěte), dalších biologických dětí nařčeného (tj. potenciálních sourozenců dítěte) apod. Vypovídací hodnota zkoumání pak výrazně závisí na příbuznosti a počtu takto dostupných nepřímých vzorků. Existuje zde ovšem riziko, že dostupné osoby nejsou ve skutečnosti v předpokládaném biologickém vztahu k nařčenému tj. například že jeho otec (tedy potenciální dědeček dítěte) není ve skutečnosti jeho biologickým otcem. Jak lze posoudit příbuznost osob na základě X chromozomálních DNA lokusů? Jak již bylo popsáno dříve, ženy mají ženy dva chromozómy X, zatímco muži mají jeden chromozóm X a jeden Y. U ženy se při tvorbě pohlavních buněk (meióze) dostává do vajíčka vždy jeden z jejích chromozómů X. (Mezi jejími dvěma chromozómy X může rovněž během meiózy dojít k vzájemné výměně částí DNA tzv. rekombinaci; do vajíčka se pak dostane jeden rekombinovaný chromozóm X, který je vlastně kombinací obou původních ženiných X chromozómů). U muže tento jev nenastává chromozóm X a Y spolu (vyjma pseudoautozomálních oblastí) nerekombinují; do poloviny spermií se dostane chromozóm X v nezměněné podobě, zatímco do druhé poloviny chromozóm Y, a to rovněž v nezměněné podobě (samozřejmě za předpokladu, že nenastane mutace). Výše uvedené má některé důležité důsledky pro posouzení příbuznosti. Obecně užíváme analýzu X chromozomálních lokusů spíše výjimečně, a to v případech, kdy analýza autozomálních lokusů nemá sama o sobě dostatečnou vypovídací hodnotu. Typickými situacemi jsou: 1. průkaz otcovství u páru otec dcera, kdy není k dispozici vzorek matky 120

123 2. průkaz otcovství dcery, kdy není k dispozici vzorek otce, ale pouze jeho matky (tj. analýza páru babička z otcovy strany vnučka) 3. průkaz mateřství u páru matka syn či matka dcera, kdy není k dispozici vzorek otce 4. průkaz polovičního sourozenectví sester, které mají společného otce 5. některé incestní situace; analýza X STR například může pomoci rozhodnout, zda dítě zplodil otec nebo bratr jeho matky. Jak lze posoudit příbuznost osob na základě Y chromozomálních DNA lokusů? Posouzení příbuznosti osob na základě analýzy Y chromozomálních lokusů je v principu velmi jednoduché: Y chromozóm se dědí v nezměněné podobě z otce na syny, tj. po meči. Jediným mechanismem změny genotypu Y chromozomálních lokusů jsou mutace. Při hodnocení možné příbuznosti dvou osob v paternální linii proto porovnáváme zjištěné haplotypy Y chromozómu u osob takto příbuzných by měly být identické, nanejvýše s nepatrným rozdílem způsobeným mezigenerační mutací. V případě zjištění více odchylek, které již nelze přičíst na vrub mutacím, příbuzenství v paternální linii vyloučíme. Tohoto jevu je hojně využíváno v geneticko genealogickém výzkumu. Jak lze posoudit příbuznost osob na základě lokusů mitochondriální DNA? Posuzování příbuznosti pomocí analýzy HVR mtdna je obdobou určení příbuznosti na základě analýzy Y chromozomálních markerů. MtDNA se dědí v nezměněné podobě z matky na všechny 121

124 její děti (dcery i syny), tj. po přeslici. Jediným mechanismem změny mtdna lokusů jsou mutace. Při hodnocení možné příbuznosti dvou osob v maternální linii proto porovnáváme zjištěné sekvence HVR mtdna u osob takto příbuzných by měly být identické, nanejvýše s nepatrným rozdílem způsobeným mezigenerační mutací. V případě zjištění více odchylek, které již nelze přičíst na vrub mutacím, příbuzenství v maternální linii vyloučíme. Principy predikce biogeografického původu a fenotypových znaků osoby Jak se pomocí analýzy DNA určuje pohlaví osoby? Určení pohlaví je založeno na skutečnosti, že ženské tělní buňky obsahují dva chromozómy X, zatímco mužské obsahují jeden chromozóm X a jeden Y. Historicky je pro DNA analýzu pohlaví nejdéle a nejčastěji využíván gen pro amelogenin, který se vyskytuje jak na chromozómu X, kde je plně funkční (dává vzniknout bílkovině zubní skloviny), tak na chromozómu Y, kde se nachází jeho nefunkční verze tzv. pseudogen. Mezi genem na X a pseudogenem na Y existuje několik drobných konstantních rozdílů; například určitý úsek tohoto genu je na X chromozómu o 6 nukleotidů kratší než tentýž úsek na Y chromozómu. Při vlastní analýze tedy tento úsek změříme (pochopitelně molekulárně genetickými metodami, nikoliv pravítkem): u žen zjistíme jedinou délku (tzn. jedinou alelu X o délce např. 104 bp), u mužů délky dvě (tzn. jednu alelu X o délce např. 104 bp a jednu alelu Y o délce 110 bp). 122

125 Obrázek 34 Určení pohlaví pomocí analýzy krátkého úseku DNA v genu pro amelogenin, který se nachází na X i na Y chromozómu. U muže detekujeme dva rozdílně dlouhé fragmenty, u ženy fragment jediný. Jinou možností určení pohlaví je analýza specificky mužských lokusů tedy těch, které leží na Y chromozómu (např. SRY). Pozitivní výsledek analýzy je potvrzením, že materiál obsahoval buňky mužského původu, u srovnávacího vzorku tedy, že patří muži. U ženy dostaneme negativní výsledek analýzy. V tom ovšem tkví i úskalí tohoto způsobu určení pohlaví při nesprávném provedení analýzy či při analýze degradovaného a/nebo inhibovaného materiálu můžeme dostat falešně negativní výsledek (tj. vzorek je mužský, ale analýza nedala pozitivní výsledek). Bránit tomu lze současnou analýzou nějakého kontrolního autozomálního lokusu, který by pozitivní výsledek měl poskytnout jak u mužského, tak u ženského vzorku. 123

126 Jak se pomocí analýzy DNA určuje biogeografický původ osoby? Jak bylo deklarováno již výše, je určování biogeografického původu osoby analýzou DNA zatím ve svých počátcích a není možné při těchto predikcích dosáhnout vysoké míry spolehlivosti (například srovnatelné se spolehlivostí identifikace pomocí STR). Principiálně při hledání biogeografického původu osoby můžeme užít analýzu mtdna, analýzu Y chromozómu a analýzu některých autozomálních lokusů, které mohou informovat o původu osoby. Mitochondriální DNA je, jak již zde bylo vícekrát konstatováno děděna po přeslici neboli maternálně. Nové linie mtdna vznikají s velmi malou frekvencí a náhodně mutací. Tedy matka předá svým dětem svou mtdna v nezměněné podobě, při vzniku jednoho jejího vajíčka však dojde k mutaci a jedno z jejích dětí obdrží mutovanou verzi mtdna; nová linie je založena. K další mutaci dojde v průměru za několik desítek generací (současné odhady rychlosti těchto mutací se však výrazně liší, proto neuvádíme žádné konkrétní číslo). Popsaný mechanismus spolu se způsobem, jakým moderní člověk postupně osidloval jednotlivé kontinenty, má velmi zajímavý důsledek: různé linie mtdna se vyskytují na různých kontinentech, nebo mají alespoň rozdílné frekvence výskytu. Kupříkladu některé mtdna linie nenajdeme jinde než v Asii, jiné zase téměř výhradně v Evropě a na Blízkém východě. Stanovením sekvence HVR mtdna linie tak můžeme odhadovat, odkud daná osoba pochází. Tento na první pohled půvabný princip je však problematizován dalšími faktory. Uveďme alespoň dva: Za prvé analýza umožňuje odhad jen v hrubším měřítku; dle mitotypu můžeme např. relativně spolehlivě určit, že osoba pochází 124

127 s velkou pravděpodobností z Evropy, avšak už nedokážeme určit, ze kterého státu. Za druhé informace z mtdna se týká výhradně již zmíněné linie po přeslici, ostatní předkové nejsou při této analýze zohledněni. Představme si například fiktivní čínskou dívku Fu Li, která se v době Marca Pola zamiluje do některého z evropských obchodníků, cestujících pro zboží do Asie, a odejde s ním do jeho slunné Itálie. Jejich společná dcera, která se po čase narodí, nese plně asijský mitotyp, který se bude dále předávat přes dcery do dalších generací. Jednoho dne roku 2011 si na univerzitě v Bologni studentka Fulvia udělá v rámci praktik forenzní genetiky sekvenaci HVR mtdna. S překvapením zjistí, že přísluší k tzv. haploskupině G, typické pro oblast severovýchodní a centrální Asie. Je to pro ni veliké překvapení ona je přece každým coulem Italka, nic asijského na sobě nikdy nepozorovala. Inu, není divu mezi ní a její maternální prapředkyní Fu Li, která pro lásku neváhala opustit navždy domov, leží přibližně 30 generací. Určení biogeografického původu osoby prostřednictvím analýzy haplotypu Y chromozómu je založeno na stejném principu jako prostřednictvím analýzy mtdna. Také různé Y chromozomální linie jsou geograficky více či méně specifické. Stejně jako u mtdna, i zde je metoda limitována malou rozlišovací schopností a tím, že nezohledňuje jinou než čistě paternální část dědičné informace. Velmi nadějnou metodou určení biogeografického původu je užití autozomálních SNP lokusů, označovaných jako AIMs (angl. Ancestry Informative Markers) tedy markery informující o původu. Princip této analýzy je opět jednoduchý: již jsme si uvedli, že u typického SNP existují zpravidla dvě alely, které mají v populaci určitou frekvenci. U AIMs je tato frekvence v různých populacích 125

128 různá. Kupříkladu: SNP rs má alely A a C; v rámci USA se alela A vyskytuje u Afroameričanů s frekvencí 23 %, u Asiatů s frekvencí 6 % a u europoidního typu s frekvencí 38 %. Jinak řečeno, alelu A najdeme čtyřikrát častěji u Afroameričanů než u Asiatů a více než šestkrát častěji u europoidního typu než u Asiatů. Analýza jednotlivého AIM není sama o sobě dostatečně informativní; pokud ale analyzujeme celý set takovýchto lokusů (zhruba kolem padesáti) a výsledky statisticky vyhodnotíme, již můžeme dostat informaci s relativně solidní vypovídací hodnotou. Navíc tato informace na rozdíl od mtdna a Y chromozomálního haplotypu zohledňuje genetický příspěvek všech předků testované osoby. Jak se pomocí analýzy DNA určují fenotypové znaky osoby? Opět je třeba zdůraznit a připomenout, co již bylo řečeno výše: predikce fenotypových znaků je v tuto chvíli ve svých počátcích a není zatím dostatečně spolehlivá. Dílčí úspěch však již přináší, a proto se o ní zde rovněž zmiňujeme. Analýza fenotypových znaků je založena na stanovení genotypu SNP, které se nacházejí v těsné blízkosti genů podmiňujících příslušný znak, případně přímo v těchto genech. V roce 2010 byl kupříkladu validován IrisPlex, test šesti SNP vázaných s geny ovlivňujícími pigmentaci oční duhovky. Tento test umí s relativně velkou spolehlivostí odlišit světlé (modré) oči od tmavých (hnědých). V roce 2011 pak byl validován další systém HIrisPlex, umožňující současnou predikci barvy vlasů i oční duhovky. 126

129 Technologie forenzně genetické analýzy Základní kroky forenzně genetické analýzy Jaké technologické postupy jsou využívány při forenzní analýze DNA? Spektrum užívaných metod je velmi široké a nelze ho nijak striktně omezit. Vzhledem k šíři záběru forenzní genetiky se zde v různých situacích uplatňuje celá řada specifických postupů, a jak se obor rozvíjí, stále další přibývají (a zastaralé jsou opouštěny). Žádná z těchto metod není uplatňována jen a pouze ve forenzní genetice, ale jsou užívány i jinými obory molekulární genetiky a DNA diagnostiky setkáme se s nimi v lékařské diagnostice, šlechtitelství, veterinární genetice a podobně. V následujících odstavcích budou popsány základní kroky a postupy, běžně uplatňované při forenzně genetickém zkoumání. Nejedná se o plný výčet, ten by ostatně ani nebyl vzhledem k výše uvedenému možný, ale o stručný přehled, který by měl čtenáři umožnit zorientovat se v základních otázkách technické stránky forenzní genetiky. S ohledem na zaměření této publikace jsou jednotlivé metody popisovány co nejjednodušeji, bez příliš technicistních detailů důraz je kladen na princip daného postupu. Jaké kroky zahrnuje forenzně genetická analýza? Po zajištění stopy a jejím uchování až do doby analýzy, kteréžto kroky byly popsány v první části, pojednávající o stopách, následuje již v laboratoři izolace neboli extrakce DNA (tyto pojmy jsou běžně používány jako synonyma izolace znamená oddělení, rozuměj DNA od ostatních látek, extrakce znamená vytažení, rozuměj DNA ze směsi látek). 127

130 Po extrakci může, ale nemusí následovat kvantifikace DNA, tedy určení množství DNA ve vzorku, často spojené s její charakterizací, tedy určením specifity (ve smyslu určení původu lidská, bakteriální apod.) a kvality (ve smyslu určení stupně degradace). Kvantifikace je často vynechávána u vzorků do značné míry standardních, jakými jsou například srovnávací vzorky (bukální stěr, krev). Naopak u vzorků velmi nejistých, což mohou být například plošné stěry, vzorky z těl ve vyšším stupni rozkladu apod., je kvantifikace zásadním krokem, který může podstatně ovlivnit finální úspěch analýzy. Izolace a kvantifikace jsou kroky do značné míry univerzální a provádíme je, ať už je naším záměrem dále analyzovat kterékoli lokusy v DNA. Další postup již se ovšem liší právě podle toho, které DNA markery jsou cílem analýzy. Popíšeme zde proto základní postup tří typově různých analýz: STR lokusů, HVR mtdna a SNP lokusů. Obrázek 35 Základní kroky technologického zpracování biologické stopy, neboli od stopy ke genetickým datům. Genotypizace může být založena na různých postupech; velmi často zahrnuje amplifikaci DNA (PCR) a elektroforetickou separaci fragmentů. 128

131 Jak dlouho trvá provedení forenzně genetické analýzy? Délka celé analýzy závisí na tom, které kroky jsou do ní zařazeny a jaká je jejich časová náročnost. Hlavním faktorem je bezesporu délka izolace DNA, která může být u různých typů izolovaného materiálu i řádově rozdílná kupříkladu izolace z kostí může být dle zvoleného postupu otázkou až dnů, naproti tomu izolace z bukálních stěrů může být redukována na pouhé minuty. Druhým rozhodujícím faktorem je doba potřebná k amplifikaci zájmových lokusů, která se může dle zvoleného postupu lišit o desítky minut. Zkrácení izolace i amplifikace je prioritou výzkumu a na trhu již se objevují komerční kity se zkrácenou délkou těchto kroků u amplifikace je to např. Identifiler Plus Kit, či PowerPlex 18D Kit. Izolace (extrakce) DNA Co je smyslem izolace DNA? V biologickém materiálu (stop i srovnávacích vzorků) je kromě DNA přítomno velké množství nejrůznějších dalších látek, např. bílkoviny, lipidy, polysacharidy atd. Řada z těchto látek v principu znemožňuje některé další kroky analýzy (patří mezi ně např. takzvané inhibitory, o nichž je pojednáno dále), a proto je třeba je ze vzorku odstranit. Navíc DNA v biologickém materiálu je často nestabilní a může být snadno poškozena ve stopě přítomnými látkami (např. enzymy původem z buněk vzorku či enzymy produkovanými mikroorganismy), je třeba ji tedy z tohoto ohrožení dostat. Ideální izolační postup je ten, který: má co nejvyšší separační účinnost, tj. v maximální možné míře odstraní ze vzorku všechny látky vyjma nukleových kyselin (tj. DNA a RNA) 129

132 má co nejvyšší výtěžnost, tj. získá z materiálu pokud možno veškerou přítomnou DNA; tato podmínka je důležitá především u vzorků s malým množstvím využitelného materiálu. Naopak, u vzorků bohatých na DNA často dáváme přednost takovému izolačnímu postupu, který nám izoluje DNA v určitém standardním množství (tj. víme, že na konci izolace budeme mít k dispozici roztok DNA o určité standardní koncentraci). převede DNA do stabilního stavu do roztoku či na pevnou fázi (nosič), které jsou bez problémů použitelné pro následující analýzy. Musí být izolace provedena vždy? Existují některé speciální postupy či přípravky, které u určitých typů vzorků umožňují celý izolační proces redukovat na minimum řadí se sem např. Prep n Go TM Buffer firmy Life Technologies či SwabSolution Kit firmy Promega. Jejich užití v rámci forenzní analýzy je možné, ale spíše jen při zpracování srovnávacích vzorků. Co je izolát? Izolátem DNA rozumíme finální produkt izolace DNA; obvykle je to vodný roztok DNA (tj. ředidlem je voda, v izolátu mohou být přítomny i další látky, např. soli). Pozor! Zatímco pojmy analýza DNA a genetická analýza jsou prakticky synonyma, pojem izolát DNA a genetický/genový izolát rozhodně ne: jako genetické/genové izoláty jsou označována teritoria, kde určitá subpopulace dlouhodobě žije do značné míry izolovaně např. některé odlehlé horské osady. Co jsou inhibitory? Jako inhibitory označujeme látky nejrůznější povahy, které mají negativní účinek na průběh jednoho ze zásadních kroků analýzy, 130

133 tzv. polymerázové řetězové reakce (PCR) viz dále. Jejich přítomnost ve vzorku může vést ke zhoršené kvalitě výsledků analýzy či k úplnému selhání analýzy. Inhibitory mohou mít svůj původ jednak přímo ve vzorku (tj. jsou přítomny už v původním biologickém materiálu, který je dodán do laboratoře ke zkoumání), nebo se mohou do vzorku dostat až v průběhu izolace z reagencií pro izolaci užívaných. K hlavním inhibitorům původem ze vzorku řadíme krevní barvivo hemoglobin, jeho rezidua heminy, indigový pigment z jeansoviny, huminové kyseliny z půdy, vlasový a kožní pigment melanin a mnoho jiných. Zanesení inhibitorů z reagencií je vždy důsledkem nesprávně zvoleného nebo nesprávně provedeného izolačního postupu. Typickými inhibitory tohoto původu jsou alkoholy, fenol či některé typy detergentů. Jak lze inhibitory odstranit? Některé inhibitory lze odstranit už během izolace, některé jsou odstranitelné specifickou purifikací izolátu (viz dále) a některé jsou odstranitelné jen velmi obtížně. U inhibitorů původem z krevních vzorků lze do jisté míry potlačit jejich negativní účinek až v průběhu samotné PCR, a to přidáním tzv. bovinního sérového albuminu. Co je purifikace DNA? Termínem purifikace DNA označujeme přečištění izolátu DNA, a to právě kvůli účinnému odstranění inhibitorů, případně dalších nežádoucích látek, které zůstaly ve vzorku přítomny i po izolaci. 131

134 Co je zkoncentrování izolátu DNA? Zkoncentrováním izolátu rozumíme snížení objemu izolátu při zachování veškeré DNA, čímž se roztok zahustí ; tento postup používáme zejména u vzorků s malým obsahem DNA. Zkoncentrování lze provést buď vyvázáním DNA z roztoku na pevnou fázi (např. oxid křemičitý) a její následné uvolnění do roztoku o menším objemu, nebo centrifugací pomocí tzv. mikrokoncentrátorů: roztok DNA je v mikrokoncentrátoru při centrifugaci hnán přes velmi husté sítko, které propustí pouze rozpouštědlo a drobné molekuly, makromolekuly DNA však ne ty v něm zůstanou zachyceny a opět mohou být uvolněny do roztoku o menším objemu, než měl původní izolát. Jaké jsou základní izolační mechanismy? Prvním krokem izolace je prakticky vždy lýza buněk, tedy jejich rozrušení a uvolnění buněčného obsahu do roztoku. Lýza je nejčastěji založena na osmóze: buňky v destilované vodě (případně lyzačním pufru) zvyšují svůj objem (molekuly vody pronikají přes buněčnou membránu dovnitř), až popraskají. Často je tento jednoduchý mechanismus podpořen zvýšenou teplotou, protřepáváním vzorku a přidáním některých enzymů, např. proteinázy, štěpící bílkoviny. Výsledkem je tzv. buněčný lyzát. Po lýze buněk může následovat několik základních typů izolačních postupů: Postupy založené na oddělení polárních a nepolárních látek Postupy založené na inaktivaci enzymatických kofaktorů Postupy založené na vazbě DNA na papírový (tj. celulózový) absorbent Postupy založené na vazbě DNA na pevnou fázi 132

135 Jak fungují postupy založené na oddělení polárních a nepolárních látek? Postupy založené na oddělení polárních a nepolárních látek tzv. organická extrakce patří k nejstarším a ve forenzní praxi dnes již v podstatě nepoužívaným. Jejich podstatou bylo přidání směsi fenolu a chloroformu k vodnému buněčnému lyzátu: po protřepání a samovolném oddělení zůstala ve vodné fázi rozpuštěná DNA, zatímco do organické fáze se rozpustily nepolární látky, např. lipidy. Bílkoviny, které mají polární i nepolární části, zůstaly na rozhraní obou fází. Pro dobré oddělení obou fází lze použít komerčně dodávané gely, které se do vzorku přidají při protřepávání a které podstatně zlepšují účinnost separace. Obrázek 36 Princip organické extrakce DNA. Tato metoda však již byla víceméně opuštěna; jednak proto, že do vodné fáze se v malém množství kromě DNA rozpouští též fenol, který následně může působit jako PCR inhibitor, především však proto, že používané reagencie jsou vysoce toxické a celý proces vyžaduje hodně času a kombinaci bystré oko/pevná ruka při odpipetování horní vrstvy. 133

136 Jak fungují postupy založené na inaktivaci enzymatických kofaktorů? Postupy založené na inaktivaci enzymatických kofaktorů jsou založeny na jednoduché lýze a následné separaci lyzovaných buněk pomocí centrifugace (případně s přidáním proteináz či proteáz k rozrušení bílkovin), po nichž následuje přidání tzv. chelatačních činidel látek, které jsou schopny vyvazovat na sebe některé typy iontů; v praxi je nejčastěji používán Chelex 100, iontoměničová pryskyřice, která vyvazuje dvojmocné ionty kovů. Při lýze buněk se do roztoku mimo jiné uvolní endonukleázy enzymy, které mohou napadat a rozrušovat molekuly DNA. Endonukleázy potřebují ke svému fungování kofaktory, kterými jsou hořečnaté ionty. Přidáním Chelexu 100 k lyzátu však dojde k vyvázání hořečnatých iontů z roztoku, takže tyto nemohou plnit funkci kofaktorů, a tudíž endonukleázy nemohou napadat DNA; tím je izolát stabilizován. Obrázek 37 Princip vyvázání enzymatických kofaktorů při extrakci DNA. Tento izolační postup je velmi jednoduchý, rychlý a velmi levný, nejsou však při něm z roztoku účinně odstraňovány inhibitory, a své uplatnění tak nachází především u vzorků s malým množstvím 134

137 inhibitorů plošné stěry, vzorky slin (např. cigaretové nedopalky), malé krevní vzorky apod. Je též velmi často používán pro izolace ze srovnávacích vzorků bukálních stěrů. Jak fungují postupy založené na vazbě DNA na papírový absorbent? Postupy založené na vazbě DNA na celulózový absorbent jsou reprezentovány především tzv. FTA papírem (FTA kartami). Podstatou tohoto absorbentu je papír, obsahující látky inaktivující nukleázy a látky bránící růstu bakterií. Na FTA papír může být nakápnut či natřen tekutý nebo rozpuštěný biologický materiál (krev, sliny apod.). U modernějších typů FTA karet je nanesení biologického materiálu okamžitě indikováno změnou barvy papírku v daném místě. Materiál nasákne do papíru a vyschne, čímž je DNA imobilizována a pevně v papíru ukotvena. V takovém stavu může být i neizolovaný vzorek při pokojové teplotě uchováván řadu měsíců. Obrázek 38 FTA karty slouží k imobilizaci a trvalému uchování DNA ve stabilním stavu. 135

138 Následná izolace se provádí tak, že z karty je mechanicky vyražen malý terčík, ten se vloží do zkumavky a jsou k němu přidány izolační reagencie; dojde k odstranění nežádoucích látek (např. vymytí inhibitorů), přičemž DNA stále zůstává fixována na papírovém terčíku. Jak fungují postupy založené na vazbě DNA na pevnou fázi? Postupy založené na vazbě DNA na pevnou fázi využívají toho, že DNA je molekula s parciálním (tj. částečným) záporným nábojem. Jako zmíněná pevná fáze je zpravidla užívána silika (polymerní oxid křemičitý), která je na povrchu rovněž záporně nabita. V čisté vodě se tak DNA a silika navzájem odpuzují. Pokud však do roztoku přidáme tzv. chaotropní soli, zafungují jako zprostředkovatel vazby mezi DNA a silikou. Touto vazbou je pak DNA pevně vázána k silice a může být spolu s ní transportována. Po změně složení roztoku (snížení koncentrace solí, změně ph z kyselého na zásadité) dojde ke zrušení vazby DNA na silikát a jejímu uvolnění do roztoku. V praxi jsou užívána dvě základní uspořádání tohoto izolačního postupu: za prvé tzv. silikátové kolonky, kde je DNA zachycena na kolonce během centrifugace (případně vakuovým odsátím) lyzátu, pak přečištěna a následně uvolněna do čistého elučního roztoku; za druhé tzv. magnetosilikové partikule, kde se DNA naváže na tyto paramagnetické kuličky, které mohou být manipulovány pomocí magnetu např. vyjmuty z roztoku, přeneseny do přečišťovacích roztoků a z nich nakonec do elučního roztoku, kde je DNA uvolněna. 136

139 Obrázek 39 Vazba DNA na siliku v magnetosilikových partikulích umožňuje manipulovat DNA v roztoku pomocí magnetického pole. Tyto postupy jsou vysoce efektivní co do odstranění nežádoucích látek z roztoku, mají velkou výtěžnost a mohou být automatizovány (izolace je pak prováděna roboticky), což z nich činí ideální izolační metody pro forenzní analýzu; nevýhodou je jejich relativně vysoká cena. Lze nějakým mechanismem oddělit biologický materiál jednotlivých přispěvatelů vzorku? Za určitých okolností ano. V této souvislosti je třeba zmínit dva postupy, a to diferenciální lýzu a laserovou mikrodisekci. Diferenciální buněčná lýza je velmi specifickým postupem užívaným u vzorků tvořených směsí ženských epiteliálních buněk a spermií typicky u vzorků poševních stěrů po znásilnění (název je zavedeným, leč poněkud otrockým překladem původního anglického termínu differential cell lysis slovo differential zde ovšem funguje ve významu odstupňovaný, založený na rozdílu, a asi vhodnější by tedy bylo užití termínu odstupňovaná buněčná 137

140 lýza). Smyslem tohoto postupu je oddělení ženské a mužské frakce vzorku, a tedy rozdělení původního smíšeného vzorku na separátní vzorky obou původců materiálu. Lze toho dosáhnout užitím měkčích a posléze tvrdších lyzačních podmínek: zatímco ženské epitelie podléhají lýze snadno, spermie jsou mnohem odolnější. Při diferenciální lýze jsou tedy nejprve v mírně lyzačním roztoku rozrušeny a spolu s roztokem odebrány ženské epitelie, a teprve poté jsou v silně lyzujícím roztoku rozrušeny spermie. Následuje samostatná izolace obou frakcí: v původním konceptu byla užívána organická extrakce (viz výše), v současnosti jsou k dispozici modernější metody, jako je Differex založený na vazbě DNA na siliku (viz výše). Obrázek 40 Diferenciální lýza rozdělení mužské a ženské složky poševního stěru. 138

141 Laserová mikrodisekce (LCM) (laser capture microdissection) je vysoce pokročilou technologií mikromanipulace, užívanou v nejrůznějších oborech pracujících s biologickým materiálem. Podstatou je vyhledání příslušných objektů (např. buněk) v mikroskopu, jejich oddělení od ostatního materiálu pomocí laserového paprsku a přenesení světelným pulzem do čisté zkumavky. V rámci forenzní analýzy mohou být takto odebrány např. jednotlivé spermie z poševního stěru, embryonální buňky z potratu apod. Další postupy dělení směsí jsou založené na dělení buněčného materiálu vzhledem k jeho odlišným imunologickým vlastnostem, ale v oblasti forenzního zkoumání nejsou běžně používané. Obrázek 41 Laserová mikrodisekce (LCM) umožňuje výběr jednotlivých buněk pro analýzu. 139

142 Kvantifikace (a případná charakterizace) DNA Co je to kvantifikace DNA a jak vyjadřujeme množství DNA? Kvantifikací rozumíme stanovení množství DNA ve vzorku. Toto množství může být vyjádřeno několika způsoby; nejčastěji je to tzv. hmotnostní koncentrace DNA ve vzorku, jejíž základní jednotka je kg/m 3 ( kilogram na metr krychlový ). Ve forenzní analýze, která pracuje s velmi malými objemy vzorků, však používáme odvozené jednotky ng/μl ( nanogram na mikrolitr ) a pg/μl ( pikogram na mikrolitr ). Platí, že 1 kg/m 3 = ng/μl = pg/μl. Jedna lidská tělní buňka obsahuje zhruba 6,6 pg DNA. Pokud bychom tedy měli čistý izolát ze 100 lidských buněk o objemu 1 μl, bude mít tento izolát hmotnostní koncentraci DNA 660 pg/μl neboli 0,66 ng/μl. A obráceně: mikrolitrový izolát o koncentraci 1,00 ng/μl obsahuje DNA ze zhruba 152 buněk. Množství DNA ve spermiích je poloviční 3,3 pg. Mikrolitrový izolát o koncentraci 1,00 ng/μl tedy obsahuje DNA ze zhruba 304 spermií. Jaký smysl má kvantifikace DNA? Stanovení množství DNA ve vzorku je důležité ze dvou důvodů: za prvé, na základě výsledků můžeme vzájemně porovnat účinnost několika izolačních postupů. Pokud například odebereme vždy ze stopy dva stejné vzorky, tyto izolujeme dvěma různými postupy A a B a izolát kvantifikujeme, můžeme zjistit, že izolační postup A nám systematicky poskytuje vyšší koncentrace DNA v izolátu než postup B, a je tedy zjevně účinnější izolační metodou. Za druhé, stanovení koncentrace DNA ve vzorku je důležité pro vyladění následně prováděné polymerázové řetězové reakce (PCR viz dále). Tato metoda je citlivá na správná vstupní množství 140

143 DNA příliš malá, ale především příliš velká vstupní množství DNA mohou vést ke zhoršenému průběhu reakce nebo k její úplné inhibici. Kupříkladu je li optimální vstupní množství DNA do určité PCR reakce 1 ng, pak vstupní množství 10 ng DNA způsobí částečnou inhibici reakce a PCR proběhne velmi problematicky. Kvantifikace je tak nesmírně důležitá zejména u vzorků s těžko odhadnutelným obsahem DNA (plošné stěry, tkáně v rozkladu apod.) Co je to nespecifická a specifická kvantifikace DNA? Izolační postup zpravidla do výsledného izolátu převede veškerou DNA, přítomnou původně ve vzorku. U biologických stop tak může výsledný izolát obsahovat kromě lidské DNA též DNA zvířecí, rostlinnou, bakteriální apod. Mimochodem u srovnávacího vzorku to může platit též např. u vzorků bukálního stěru izolujeme kromě vlastní DNA buněk bukální sliznice též DNA bakterií přítomných v ústech, tvořících zubní plak. Kvantifikační postupy, které určí množství veškeré DNA ve vzorku bez ohledu na to, z jakého zdroje tato DNA pochází, označujeme jako nespecifické. Naproti tomu postupy, zaměřené na stanovení množství pouze určitého specifického druhu DNA (nejčastěji DNA lidské), označujeme jako specifické. Jaké jsou základní principy nespecifické kvantifikace DNA? Nejjednodušším a pro forenzní praxi nejméně vhodným postupem je spektrofotometrická kvantifikace DNA. Je založena na tom, že molekuly DNA silně absorbují elektromagnetické záření vlnové délky 260 nm (tj. ultrafialové záření); paprsek této vlnové délky se nechá procházet roztokem DNA (např. izolátem) a změří se pokles intenzity záření ten je tím větší, čím je roztok DNA 141

144 koncentrovanější. Metoda není vhodná pro forenzní účely (užívala se pouze v naprostých počátcích), neboť není příliš citlivá, tj. nezachytí malá množství DNA, spotřebovává se při ní velké množství vzorku a výsledek měření může být velmi silně ovlivněn přítomností některých dalších chemických látek ve vzorku, jako je fenol, bílkoviny apod. Výjimku tvoří mikrospektrofotometrické metody použitelné ve forenzní genetice především pro získání rychlé orientační informace o množství DNA ve vzorku. Obrázek 42 Spektrofotometrická kvantifikace je založena na měření poklesu intenzity světla procházejícího roztokem DNA. Pro forenzní účely vhodnější metodou je detekce nespecificky inkorporovaného fluorescenčního barviva. Pro tyto účely se užívají chemické sloučeniny barviva (např. ethidiumbromid, PicoGreen, OligoGreen), která se navážou na/do DNA, tím se změní jejich prostorové uspořádání a začnou být při dopadu světla určité vlnové délky silně fluorescenčně aktivní, tj. vyzařují světlo, jehož množství měříme fluorimetrem. Množství vyzářeného světla je tedy přímo úměrné množství navázaného barviva, a to je zase přímo úměrné množství DNA přítomné ve vzorku. Výhodou metody je 142

145 relativně vysoká citlivost a přesnost měření, malé nároky na spotřebu vzorku, možnost měření automatizovat a malá cena analýzy; nevýhodou zůstává nespecifita měření. Obrázek 43 Nespecifická kvantifikace založená na navázání fluorescenčního barviva do DNA. Měření se provádí pomocí fluorimetru. Jaké jsou základní principy specifické kvantifikace DNA? Při specifické kvantifikaci musí být dosaženo toho, že metoda zobrazí výlučně příslušnou specifickou DNA nejčastěji DNA lidskou. Toho dosahujeme použitím tzv. druhově specifických sond či druhově specifických primerů, což obojí jsou krátké jednořetězcové fragmenty DNA, které jsou komplementární (laicky 143

146 řečeno pasují ) pouze k určitému místu v DNA daného druhu či skupiny blízce příbuzných druhů (např. primátů) a u ostatních druhů komplementární nejsou, nepasují ). Obrázek 44 Specifická kvantifikace je založena na hybridizaci (spárování) sondy, tj. krátkého úseku DNA, s komplementární sekvencí v testované DNA. Historicky první kvantifikace specificky lidské DNA byly založeny na tzv. slot blot (štěrbinové) hybridizaci: DNA byla nejprve fixována pod tlakem přes štěrbinu na nylonovou membránu, poté hybridizována se specifickou sondou a následně byla tato sonda zobrazena chemiluminiscenčně nebo kolorimetricky čím intenzivnější byl signál sondy (záření, barva), tím větší množství lidské DNA bylo ve vzorku obsaženo. Tyto ve své době pokrokové 144

147 metody (nejznámější z nich byl QuantiBlot Human DNA Quantitation Kit) se dnes již prakticky neužívají. Obrázek 45 Takto vypadal výsledek kvantifikace specificky lidské DNA pomocí slot blot hybridizace: kvantita DNA v testovaných vzorcích se odhadovala porovnáním intenzity vybarvení s kalibrační řadou (tj. se vzorky známé koncentrace v obr. uvedena v ng). Dalším principem kvantifikace specificky lidské DNA byla luminometrická kvantifikace AluQuant Human DNA Quantitation System. Při ní byla DNA hybridizována se specifickou sondou, což v roztoku vedlo k sérii enzymatických reakcí až po finální oxidaci luciferinu enzymem luciferázou za vzniku viditelného světla, jehož množství bylo změřeno luminometrem. (Mimochodem, je to identická enzymatická reakce, kterou používají samečci světlušek). Čím více lidské DNA bylo ve vzorku přítomno, tím více sondy hybridizovalo a tím intenzivnější světlo v konečné fázi z roztoku zazářilo. Přestože tato metoda byla po mnoha stránkách pro forenzní účely vynikající, dnes už se prakticky neužívá, neboť byla vytlačena moderní metodou qpcr. Nejmodernějšími a v současnosti zdaleka nejužívanějšími metodami specifické kvantifikace jsou metody založené na polymerázové 145

148 řetězové reakci (viz níže) tzv. kvantitativní PCR (qpcr). Technicky může mít qpcr mnoho konceptů, jejichž popis a vysvětlení by šly nad rámec této knihy. Koncepty užívané ve forenzní analýze jsou nejčastěji založeny na v zásadě jednoduchém principu: je prováděna PCR, tj. cyklické kopírování vybraného malého úseku DNA, a současně je průběžně měřeno množství těchto nakopírovaných DNA fragmentů ve vzorku. Z toho, jakým způsobem během PCR toto množství rostlo, lze zpětně dovodit původní vstupní množství DNA ve vzorku (opět se kalibruje pomocí vzorků známé koncentrace). Metoda kvantitativní PCR nám ze všech kvantifikačních metod přináší nejvíce informací: je vysoce přesná, vysoce citlivá (zobrazí i velmi malá množství DNA), přísně specifická (poskytuje pozitivní výsledek prakticky pouze u daného druhu respektive velmi blízce příbuzných druhů) a detekuje i případnou přítomnost PCR inhibitorů a rozsah DNA fragmentace. Amplifikace DNA Co je to amplifikace DNA? Termín amplifikace označuje obecně zesílení nebo též rozmnožení (z lat. amplificare zvětšovat). V případě DNA tak označujeme řízené laboratorní mnohočetné kopírování DNA, jehož smyslem je získat ve větším počtu kopií DNA identickou s DNA původní. Amplifikace se téměř vždy zaměřuje na určitý konkrétní úsek DNA, který nás zajímá, a kopírování se týká právě pouze tohoto úseku (lokusu). Na jakém principu je amplifikace DNA prováděna? Obecně v molekulární genetice najdeme celou řadu postupů, kterými může být DNA namnožena. Zcela vůdčí metodou však je PCR polymerázová řetězová reakce (angl. Polymerase Chain 146

149 Reaction). PCR je prakticky jedinou amplifikační metodou, užívanou ve forenzní genetice, a to v řadě postupů; proto si ji zde blíže popíšeme. Co je PCR a jak probíhá? PCR neboli polymerázová řetězová reakce je cyklická enzymatická reakce, prováděná v laboratorních podmínkách (in vitro), která je ve své podstatě napodobením přirozeného kopírování DNA v buňkách (in vivo). PCR se provádí v zařízení zvaném thermocycler (termocyklér), což je de facto termoblok, do něhož se vloží zkumavky s reakční směsí a který je schopný v rychlém sledu měnit teplotu v těchto zkumavkách (proces je naprogramován a přesně řízen počítačovým čipem). Vstupní reakční směs obsahuje následující komponenty: 1. PCR pufr, tj. vodu obsahující ionty a další látky potřebné pro správný průběh reakce (Mg 2+, případně K +, NH 4 + apod.) 2. volné nukleotidy, označované jako dntps, což jsou stavební kameny DNA, z nichž budou tvořeny nově vznikající řetězce DNA; až na výjimky je pro PCR užívána vyvážená směs 4 základních dntp datp, dctp, dgtp a dttp. 3. primery krátké úseky DNA o délce cca nukleotidů, které slouží k nalezení specifického místa v DNA, jež má být kopírováno, a od nichž toto kopírování začíná; primery jsou navrženy tak, aby bezchybně párovaly právě pouze na začátek a konec zájmového úseku na každém z obou DNA vláken; (primery v páru pak označujeme jako F forward a R reverse. 4. DNA polymerázu enzym, který provádí vlastní kopírování; jsou užívány tzv. termostabilní polymerázy, které dobře snášejí vysoké teploty, kterým jsou během PCR vystaveny. 147

150 5. templátovou DNA neboli matriční DNA, což je vlastní předloha, podle níž má kopírování probíhat; nejčastěji se jedná o DNA izolovanou z nějakého biologického materiálu (stopy nebo srovnávacího vzorku). PCR probíhá formou cyklů, které se opakují 20 40krát (počet se liší dle aplikace). Jeden cyklus zahrnuje tři po sobě jdoucí fáze: 1. fázi denaturační, při níž vlivem vysoké teploty (cca 95 C) dojde k oddělení obou řetězců DNA (dvoušroubovice se rozplete na dvě samostatná vlákna); fáze trvá zpravidla několik desítek vteřin. Obrázek 46 Složení PCR směsi a první denaturační fáze PCR. 148

151 2. fázi hybridizační (anelační), při níž se teplota sníží (konkrétní teplota závisí na sekvenci a délce užitých primerů, pohybuje se nejčastěji kolem C) a dojde k nasednutí primerů na oba volné řetězce DNA v místech, kam bezchybně párují (tj. na začátek a konec úseku, který chceme kopírovat); tato fáze rovněž trvá několik desítek vteřin. Obrázek 47 Druhá anelační a třetí elongační fáze PCR. 3. fázi prodlužovací (extenzní, elongační), při níž se teplota mírně zvýší (na cca 72 C) a polymeráza začne od místa navázaného primeru připojovat na základě sekvence v matriční DNA komplementární nukleotidy (od primeru dále tedy vzniká podél jednořetězcové DNA druhé komplementární vlákno, a vytváří se tak dvoušroubovice; současně probíhá stejný proces 149

152 na komplementárním templátovém vláknu). Délka fáze závisí na rychlosti polymerázy a na tom, jak dlouhý úsek je třeba okopírovat, zpravidla se pohybuje v řádu desítek vteřin až několika minut. Po ukončení prodlužovací fáze ihned následuje denaturační fáze následujícího cyklu. Nově vzniklá vlákna se při ní oddělí od matriční DNA a v následující anelační fázi mohou sama posloužit jako matriční DNA. Tímto mechanismem narůstá exponenciálně počet nově nasyntetizovaných vláken DNA v roztoku; po několika desítkách cyklů tak PCR směs obsahuje miliardy kopií příslušného úseku DNA. Nutno ovšem upozornit, že PCR nemůže probíhat donekonečna: po určitém počtu opakování dojde reakce do tzv. fáze plató, kdy již nové řetězce nevznikají, a zvýšení počtu cyklů tak už nevede ke zvýšení množství amplifikované DNA. Čím může být PCR negativně ovlivněna? Negativní vliv ve smyslu snížení účinnosti amplifikace (někdy až k nule amplifikace neprobíhá) mají látky zvané PCR inhibitory, zmíněné již v kapitole týkající se izolací DNA. Účinnost amplifikace též může být snížena nesprávným složením PCR reakční směsi nedostatečnou koncentrací dntps, Mg 2+, primerů či DNA polymerázy. Naopak i příliš vysoká koncentrace Mg 2+ snižuje účinnost reakce, neboť brání úplné denaturaci (rozpletení dvoušroubovice). V praxi však je master mix většinou namíchán předem jako součást komerčního kitu. Účinnost snižuje i vyšší než optimální hybridizační teplota (ani specifické primery se neudrží ). Zásadní vliv na účinnost amplifikace má též vstupní množství templátové DNA, jak již jsme zmínili v kapitole o kvantifikaci DNA: příliš nízké množství templátové DNA vede k pomalejšímu náběhu 150

153 reakce a mohou se při něm snáze uplatnit některé náhodné (stochastické) efekty, jako je drop out, o nichž bude pojednáno v kapitole o interpretaci dat (nicméně PCR může zdárně proběhnout i pokud je ve vstupní reakci přítomna jedna jediná nepoškozená kopie cílového úseku DNA). Zcela fatální důsledky pro PCR však má příliš vysoké vstupní množství DNA, které může vést až k úplné inhibici reakce. Negativní vliv ve smyslu nesprávného kopírování (vznikající řetězec není zcela identický s předlohou nebo není identický vůbec) může být dán jednak nesprávným nasednutím primerů (jinam, než kam by měly), pak hovoříme o snížení specifity reakce, jednak chybami při činnosti polymerázy. Snížení specifity může být vyvoláno nesprávným složením PCR reakční směsi zejména příliš vysokou koncentrací Mg 2+, a též příliš nízkou anelační teplotou (v obou případech se primery mohou udržet i na místech, kam zcela nepárují). Základní chyby, k nimž dochází během činnosti polymerázy, je zařazení nesprávného nukleotidu a prokluz polymerázy. Frekvence zařazení nesprávného nukleotidu je dána přirozenou chybovostí té které polymerázy (nikdo nejsme dokonalý). Obecně menší chybovost mají tzv. polymerázy s korektorskou funkcí (angl. proofreading, někdy označované též jako HiFi polymerázy), které po sobě zařazený nukleotid zkontrolují. Prokluz polymerázy je specifickou chybou, k níž dochází při amplifikaci STR lokusů a jejímž důsledkem je vznik tzv. koktavého píku (angl. stutter peak), a bude blíže popsáno v kapitole o analýze LCN a degradované DNA. Co je monoplexová a co multiplexová PCR? Amplifikujeme li v rámci jedné reakční směsi (tj. v jedné zkumavce) s použitím jednoho páru primerů pouze jediný DNA lokus, hovoříme 151

154 o monoplexové PCR. Amplifikujeme li lokusů více, pak zpravidla používáme termín vystihující počet amplifikovaných lokusů duplexová PCR (= 2 lokusy), triplexová PCR (= 3 lokusy) atd., u většího počtu lokusů můžeme použít též obecný pojem multiplexová PCR (= mnoho lokusů). Co je symetrická a co asymetrická PCR? Pokud jsou oba primery v rámci primerového páru přidány do reakce ve stejném množství, hovoříme o symetrické PCR. U některých aplikací je však vhodné, aby bylo preferováno kopírování v jednom směru, a do reakce proto přidáváme příslušný primer ve větším množství pak hovoříme o asymetrické PCR. Její extrémní formou je PCR s použitím jediného primeru, s níž se setkáme např. při sekvenaci (popsána bude u analýzy HVR mtdna). Při použití jediného primeru neroste množství okopírovaných DNA fragmentů v roztoku exponenciálně, ale lineárně. Kde v rámci forenzně genetických technologií se amplifikace DNA pomocí PCR uplatňuje? Užití PCR ve forenzní genetice je široké a aplikací najdeme opravdu mnoho. Rámcově lze říci, že: 1. Účelem PCR může být pouhé namnožení zájmových lokusů před provedením dalších analýz (u SNP lokusů, HVR mtdna apod.). 2. PCR může být jedním z více kroků nějaké analýzy (mono či multiplexová PCR jako součást analýzy STR lokusů, asymetrická PCR jako součást sekvenace HVR mtdna apod.) 3. Na samotné PCR může být přímo založena určitá analýza (qpcr jako metoda specifické kvantifikace). 152

155 Elektroforéza DNA Co je elektroforéza? Elektroforézou nazýváme souhrnně separační metody založené na pohybu nabitých částic ve stejnosměrném elektrickém poli, přičemž různé částice mají různou elektroforetickou mobilitu (tj. pohybují se v poli s rozdílnou rychlostí). Na základě této rozdílné pohyblivosti tak dojde elektroforézou k separaci jednotlivých typů částic. Obecně je mobilita dána především velikostí elektrického napětí a fyzikálně chemickými vlastnostmi média, v němž separace probíhá. Existuje celá řada možných uspořádání elektroforézy např. zónová, kapilární, elektroforéza v plynné fázi atd. Jak funguje elektroforéza DNA? DNA je za běžných podmínek díky fosfátu ve své struktuře záporně nabitá molekula, a ve stejnosměrném elektrickém poli se proto pohybuje směrem ke kladné elektrodě (anodě). Pokud je tento pohyb prováděn v médiu, které ho částečně brzdí např. v gelu, dojde k postupnému rozdělení DNA fragmentů podle jejich elektroforetické mobility. Relativní elektroforetická mobilita je primárně dána délkou fragmentu DNA (s počtem bazí mobilita klesá, tj. čím delší fragment je, tím pomaleji se pohybuje) a případnou přítomností na DNA navázaných dalších molekul např. fluorescenčních značek (navázaná molekula zvyšuje molekulární hmotnost celého fragmentu, a tedy snižuje jeho mobilitu). Mobilitu ovšem ovlivňují též další faktory, například podíl C a G nukleotidů ve fragmentu (C a G nukleotidy jsou těžší než A a T nukleotidy) a též konformace molekul DNA. Nejčastěji jsou proto elektroforeticky separovány 153

156 lineární fragmenty DNA, kdy jejich mobilita není rozdílnou konformací ovlivněna. Elektroforéza nám v takovém případě pomůže přesně určit délku fragmentů DNA ve vzorku. Obrázek 48 Princip elektroforézy DNA. S jakými typy elektroforézy DNA se lze setkat při forenzně genetických zkoumáních? V rámci metod forenzní genetiky se užívají především dvě možná uspořádání elektroforézy klasická gelová elektroforéza (GE) a kapilární (gelová) elektroforéza (CE). Co je klasická gelová elektroforéza DNA? Při klasické gelové elektroforéze (GE) je vzorek DNA nanesen do malé jamky v gelovém plátu ponořeném v pufru mezi elektrodami 154

157 (plát může být umístěn vodorovně či svisle) a poté je na elektrody vloženo napětí. DNA ze vzorku se začne pohybovat gelem směrem k anodě, přičemž jak již bylo popsáno kratší fragmenty putují rychleji než delší. V praxi se nejčastěji lze setkat s užitím agarózového (AGE) či polyakrylamidového gelu (PAGE). Po určité době je elektroforéza ukončena a DNA v gelu je zobrazena (zobrazovacích metod je nepřeberné množství může to být např. pomocí fluorescenční barvy, radioaktivně atd.). Na gelu se objeví místa, v nichž se nachází DNA; často jsou to tzv. bandy proužky obsahující fragmenty stejné délky. Vzdálenost bandu od nanášecí jamky je tím větší, čím kratší fragmenty obsahuje. Aby bylo možno určit přesnou délku fragmentů v bandu, užívá se tzv. velikostní standard (žebříček), což je uměle připravená směs fragmentů několika známých délek (žebříček tedy např. obsahuje fragmenty o délce 50, 100, 150, 200, 300 a 400 bazí). Žebříček je nanesen vedle vzorku do sousední jamky a během elektroforézy se separuje za stejných podmínek a stejným způsobem jako vzorek. Po skončení elektroforézy a zobrazení DNA lze délku fragmentů v jednotlivých bandech vzorku zjistit srovnáním s polohou bandů žebříčku. V jakém přístroji je klasická gelová elektroforéza DNA prováděna? Klasická gelová elektroforéza nevyžaduje žádné vysoce specializované vybavení. Postačuje elektroforetická vana s lůžkem pro gel, a to v horizontální (AGE) či vertikální (PAGE) orientaci, a spolehlivý programovatelný zdroj napětí. Existuje i vysoce sofistikovaná a automatizovaná forma gelové elektroforézy automatický analyzátor, v němž je celý proces řízený počítačem a detekce fragmentů v gelu probíhá pomocí 155

158 fluorescenčního scanneru; v rámci molekulárně genetických technik je však tento přístroj vytěsňován genetickými analyzátory založenými na principu kapilární elektroforézy. Co je kapilární elektroforéza DNA? Při kapilární elektroforéze (CE) je vzorek elektrickým pulsem nabrán na začátek tenké skleněné kapiláry naplněné polymerem lineárního akrylamidu nebo polydimethylamidu. Na kapiláru je pomocí elektrod zanořených do pufru přivedeno napětí a vzorek začne putovat kapilárou, přičemž obdobně jako u klasické gelové elektroforézy dochází k separaci fragmentů na základě rozdílné mobility. V případě kapilární elektroforézy je detekce fragmentů prováděna v průběhu času: každý fragment je již před analýzou označen fluorescenční barvou (zpravidla začleněním označeného primeru v průběhu PCR). V koncové části kapiláry se nachází okénko, kterým prosvěcuje laserový paprsek; ten v okamžiku průchodu fluorescenčně značených fragmentů okénkem vybudí silnou fluorescenci (světelné záření), která je zaznamenána CCD detektorem (stejným, jako je v digitálních fotoaparátech). Ani kapilární elektroforéza se neobejde bez standardizace pomocí velikostního žebříčku. V tomto případě jej přidáváme přímo do analyzovaného vzorku, proto jej nazýváme vnitřní žebříček. Čím kratší fragment je, tím dříve doputuje k okénku v kapiláře: zatímco u zonální elektroforézy tedy určujeme délku neznámého fragmentu podle relativní vzdálenosti od nanášecí jamky, u kapilární elektroforézy ji určujeme podle relativní doby, kterou fragment potřebuje k dosažení okénka kapiláry (v obou případech na základě porovnání s velikostním standardem žebříčkem). 156

159 Obrázek 49 Princip kapilární elektroforézy fluorescenčně značených fragmentů DNA. V jakém přístroji je kapilární elektroforéza DNA prováděna? Kapilární elektroforéza je proces technicky velmi náročný, a proto je prováděn téměř výhradně pomocí automatizovaných genetických analyzátorů (často je pro ně užíván nepřesný leč vžitý slangový název sekvenátor). Nejrozšířenějšími jsou bezesporu analyzátory firmy Applied Biosystems (součást Life Technologies). Dnes již jsou laboratoře běžně vybaveny 4, 16 i 96kapilárovými verzemi tohoto přístroje, umožňujícími současnou analýzu příslušného počtu vzorků. 157

160 Analýza STR lokusů Jakými metodami jsou analyzovány STR lokusy? Přestože technicky existuje několik možností, jak analyzovat STR lokusy, forenzní praxi v současnosti dominuje jediná z nich: analýza založená na PCR amplifikaci a následném stanovení délky amplifikovaného fragmentu pomocí kapilární elektroforézy. Jak tato analýza teoreticky probíhá? Pro srozumitelnost popíšeme celý proces nejprve na analýze jediného STR lokusu. V prvém kroku je připraven PCR mastermix (viz popis PCR), který obsahuje jediný pár primerů; jeden z těchto primerů nasedá na známé místo v DNA těsně před a druhý těsně za náš zájmový STR lokus. Protože jsme předvídaví, je jeden z těchto primerů označen fluorescenční barvou tak, aby nám posléze umožnil detekci fragmentu. Poté je v thermocycleru provedena klasická PCR, přičemž vznikají fragmenty dlouhé přesně tolik párů bazí, kolik měří celý úsek ohraničený oběma primery. Protože polymorfismus STR lokusů jak již bylo vysvětleno dříve je polymorfismem délkovým, bude u různých alel našeho zájmového lokusu výsledný fragment různě dlouhý. Po skončení PCR proto potřebujeme stanovit délku vzniklých fragmentů; k tomu použijeme výše zmíněnou kapilární elektroforézu prováděnou v genetickém analyzátoru. Část amplifikátu, tj. produktu PCR, spolu s vnitřním žebříčkem napipetujeme do zkumavky s formamidem, který má silně denaturující účinek, a tedy zajišťuje, že fragmenty zůstanou v jednořetězcovém stavu. Poté již proces probíhá automaticky podle předem nastaveného programu vzorek je elektrokineticky 158

161 injikován do kapiláry, na kterou je následně vloženo napětí. Při průchodu DNA fragmentu okénkem kapiláry excituje laser fluorescenční barvičku, která je na fragmentu vázána, a ta následně emituje silné záření v určité oblasti spektra, což se projeví v elektroforetogramu (časovém záznamu elektroforézy) charakteristickým píkem určité barvy. Obrázek 50 Výsledek monoplexové a multiplexové analýzy STR lokusů. Srovnáním s píky vnitřního žebříčku software vypočte s vysokou přesností délku námi amplifikovaného fragmentu. Protože víme, kam přesně nasedaly primery a jak dlouhé jsou tedy konstantní úseky po obou stranách STR, odečteme jejich délku od stanovené délky fragmentu, čímž získáme vlastní délku repetice. Vydělením této hodnoty délkou základního motivu repetice zjistíme, kolikrát se v našem fragmentu tento motiv opakuje; toto číslo současně označuje příslušnou alelu. 159

162 Př.: Kapilární elektroforézou jsme změřili, že námi amplifikovaný fragment má délku 255 bp. Víme, že ohraničením pomocí primerů byly do amplifikace kromě vlastní STR též zahrnuty konstantní úseky po obou jejích stranách v celkové délce 167 bp. Délka samotné repetice je tedy = 88 bp. Víme, že tato repetice je tetranukleotidová, neboli že základní motiv má délku 4 bp. Jednoduše tudíž zjistíme, že v našem fragmentu je 88/4=22 opakování, a jedná se tedy o alelu 22. Jak je tato analýza prováděna v praxi? Oproti popisu v předchozích odstavcích se reálná analýza STR poněkud liší, a to především v následujícím: vyjma velmi specifických situací není prováděna analýza jediného lokusu, ale analyzuje se celý set lokusů najednou; k tomu slouží již dříve zmíněná multiplexová PCR, při níž je použito více párů primerů vždy jeden pár pro jeden lokus; veškeré komponenty potřebné pro analýzu jsou již předpřipraveny a ověřeny výrobcem a do laboratoře jsou dodávány ve formě tzv. kitu neboli soupravy. V českém prostředí hojně užívanými kity jsou např. PowerPlex 16, Identifiler, Identifiler Plus, MiniFiler, PowerPlex Y či Y filer; zejména pro analýzy příbuznosti jsou užívány kity s velkým počtem testovaných lokusů např. PowerPlex 21 a PowerPlex Y23; kromě primerů pro STR lokusy tyto kity zpravidla obsahují pár primerů pro amplifikaci specifického úseku v genu pro amelogenin, který je užíván ke zjištění pohlaví nositele analyzované DNA; celý proces na genetickém analyzátoru je již přednastaven, odečet délek fragmentů a jejich přepočet na číslo alely je prováděn automaticky pomocí software; znalec se do 160

163 procesu zapojuje jednak jako kontrolní entita (zda vše probíhá podle plánu), jednak jako ten, kdo vyhodnocuje nejednoznačné nebo komplikované výsledky lze ho tedy přirovnat k pilotovi dopravního letounu, který sice ve standardních situacích hojně využívá autopilota, avšak pro kontrolu průběhu letu a řešení situací nestandardních je jeho přítomnost absolutně klíčová. Dlužno podotknout, že stopy jsou zřídkakdy povahy standardního vzorku. Analýza HVR mt DNA Jakými metodami jsou analyzovány HVR v mitochondriální DNA? Polymorfismus hypervariabilních oblastí mtdna je sekvenční; k jeho zjišťování jsou proto užívány buď metody sekvenační, nebo metody založené na hybridizaci s tzv. alelově specifickou sondou (SSO) (angl. Sequence Specific Oligonucleotides). Jak je prováděna sekvenace mtdna? Sekvenací rozumíme stanovení pořadí nukleotidů v analyzovaném úseku DNA. Existuje mnoho konceptů a aplikací této metody, popíšeme zde velmi stručně pouze postup v rámci forenzní praxe v současnosti nejužívanější sekvenaci pomocí asymetrické PCR s tzv. terminátory. Při tomto postupu je HVR oblast nejprve namnožena pomocí jednoho páru primerů klasickou PCR. Poté následuje přečištění amplifikátu a též zpravidla kontrola úspěšnosti (detekce namnoženého fragmentu). Ten pak dále poslouží jako templát do následující, tentokráte asymetrické PCR reakce. 161

164 Při sekvenační reakci je v reakční směsi přítomen pouze jeden z páru primerů (F nebo R), a nové fragmenty tak vznikají pouze podle jednoho z obou komplementárních řetězců sekvenovaného fragmentu. Reakční směs dále obsahuje kromě obyčejných deoxyribonukleotidů (dntp), jež slouží jako stavební kameny nově vznikajících řetězců, též fluorescenčně značené dideoxyribonukleotidy (ddntp), nazývané pro svou úlohu v reakci terminátory: pokud je totiž do nově vznikajícího řetězce zařazen ddntp namísto standardního dntp, nemůže polymeráza na něj již připojit další stavební kámen, a syntéza řetězce tak končí. Je li poměr dntp a ddntp cca 100:1, dosáhneme stavu, kdy výsledný produkt této asymetrické PCR sestává z fragmentů různých délek, přičemž každý fragment má na konci fluorescenčně značený terminátor. Stejně jako dntp, jsou i ddntp v reakci přítomny 4 druhy (ddatp, ddctp, ddgtp a ddttp), každý značený jinou fluorescenční barvou. Produkt asymetrické PCR je následně elektroforeticky rozdělen (nejběžněji pomocí kapilární elektroforézy); na elektroforetogramu se délkově odlišné fragmenty zobrazí jako jednotlivé píky, přičemž barva píku odpovídá typu ddntp, který byl do fragmentu zařazen. Celý elektroforetogram pak tedy má charakter pík za píkem (každý následující pík představuje fragment o 1 bp delší) a převedením barvy píků na typ ddntp můžeme odečíst kompletní sekvenci. Velmi často se při této sekvenaci provádějí dvě paralelní asymetrické PCR, přičemž do každé je použit jiný z původního páru primerů (do jedné F, do druhé R); získané sekvence z obou reakcí musejí být komplementární. Postup se užívá především tehdy, pokud je z nějakého důvodu obtížné bezchybně přečíst celou délku zájmového úseku DNA s pomocí jednoho primeru; tímto důvodem může být např. velká délka úseku, malá koncentrace 162

165 templátové DNA nebo problematická sekvence, přes kterou polymeráza jen obtížně postupuje dále typické jsou úseky v mitochondriální DNA označované jako cytozinový pás (angl. C stretch), kde je v sekvenci zařazeno několik C za sebou (např. ATTGACCCCCCCATCCT). Obrázek 51 Kapilární elektroforéza fragmentů vzniklých sekvenační asymetrickou PCR. Jak je prováděna analýza HVR mtdna pomocí hybridizace s SSO? Hybridizace s SSO představuje rychlejší, levnější a méně informativní možnost analýzy HVR mtdna; nezískáme při ní kompletní sekvenci příslušné HVR, pouze informaci o několika 163

166 úsecích této HVR jako celku. Vybrány pro testování jsou úseky zahrnující nejpolymorfnější nukleotidy. Analýza pomocí SSO se uplatňuje především jako screeningová metoda při vyšetřování většího množství stop či osob. Podstata metody je velmi jednoduchá: pokud použitá SSO sonda je zcela komplementární k příslušnému úseku HVR mtdna ve vyšetřovaném vzorku, dojde k jejímu navázání (hybridizaci) na tento úsek, což je posléze detekováno nějakou vhodnou zobrazovací metodou. Pokud se však sekvence sondy a příslušného úseku liší byť v jediném nukleotidu, k hybridizaci nedojde. Získáme tak informaci, zda je tento úsek jako celek komplementární se sondou či nikoli. Pro analýzu lze užít i více různých sond pro stejný úsek, čímž se analýza stane informativnější. Analýza SNP lokusů Jakými metodami jsou analyzovány SNP lokusy? Existuje celá řada principů, na nichž může být zjištění genotypu jednonukleotidových polymorfismů založeno. Ve forenzní praxi se uplatňují především ty, které umožňují současnou genotypizaci velkého množství SNPs, které je třeba k dosažení potřebné vypovídací hodnoty analýzy. K základním patří minisekvenování například pomocí soupravy SNaPshot; jeho obliba tkví i v tom, že jej lze provádět se stejným laboratorním vybavením, jaké je užíváno pro analýzu STR lokusů. Jak je prováděna analýza SNPs minisekvenováním? Při minisekvenování je nejprve pomocí klasické PCR reakce namnožen úsek obsahující testovaný SNP. Poté je reakční směs vystavena působení enzymů, které rozloží zbytky nespotřebovaných primerů a zbylé volné dntp. 164

167 Po úvodní amplifikaci následuje krok označovaný jako prodloužení primeru: do reakce je přidán tzv. extenzní primer nasedající zcela těsně před testovaný SNP, a směs čtyř různou barvou fluorescenčně značených ddntp neboli terminátorů (týchž, jaké byly popsány v části věnované technologii sekvenování mtdna). Polymeráza poté na základě komplementarity s naším SNP připojí k primeru jediný ddntp (odtud název minisekvenování). Vzniklý fluorescenčně značený produkt je poté analyzován pomocí kapilární elektroforézy: barva detekovaného píku odpovídá typu terminátoru, který byl na základě komplementarity s testovaným SNP do fragmentu zařazen. Obrázek 52 Výsledek monoplexové a multiplexové analýzy SNP lokusů. Tato jednoduchá metoda může být úspěšně multiplexována, tj. je množeno a analyzováno více zájmových lokusů najednou; pro rozlišení příslušnosti jednotlivých píků k jednotlivým SNP je 165

168 používáno nejčastěji připojení různě dlouhých poly T řetězců (úsek tvořený pouze nukleotidy T) k extenzním primerům, což změní výslednou pozici jednotlivých píků v elektroforetogramu. Nakládání se stopami obsahujícími degradovanou DNA a/nebo malá množství DNA Co je degradovaná DNA? V části věnované biologickým stopám jsme se již podrobněji zmínili o jevu zvaném biodegradace včetně degradace DNA. Popsali jsme základní činitele, podílející se na degradaci, a možné důsledky pro analýzu. Obrázek 53 Dva základní mechanismy degradace DNA fragmentace a narušení struktury. Jako degradovanou DNA souhrnně označujeme DNA, která již není v původním nativním stavu (tj. taková, jaká byla v živé buňce), ale byla poškozena fyzikálními, chemickými či biologickými činiteli. 166

169 Toto poškození může mít charakter fragmentace, tj. rozštěpení na kratší úseky, a/nebo narušení struktury, tj. změny jednotlivých bází (např. v důsledku oxidace), výpadky bází apod. Uvedené změny mohou nastat v různé míře, proto mluvíme o různém stupni degradace DNA. Můžeme určit stupeň degradace DNA ve vzorku? Posoudit, do jaké míry je DNA ve vzorku poškozena a zda bude vhodná k námi zamýšlené analýze, není nemožné, stále však platí, že nejlepším testem, zda bude analýza fungovat, je analýza sama. Obvykle u vzorku možnou degradaci již předvídáme na základě nám dostupných informací (ať už získaných ze spisu, ohledáním biologického materiálu či prostou zkušeností s daným typem materiálu). Máme li analyzovat čerstvou krev, odebranou osobě den předem a uchovanou v ledničce, prakticky s jistotou očekáváme, že DNA nebude ani mírně degradovaná. U vzorku kosti z 18. století si naopak můžeme být vyšším stupněm degradace téměř jisti. Lze provést některé orientační analýzy stupně degradace například rozdělit izolovanou DNA elektroforeticky na agarózovém gelu a obarvit sloučeninou ethidiumbromid, která v UV světle září: pokud se na gelu objeví dlouhá rozplizlá šmouha v oblasti krátkých fragmentů, máme co do činění s velmi fragmentovanou DNA; pokud naopak intenzivně září pouze malá ohraničená skvrna v oblasti, kde očekáváme velmi dlouhé fragmenty, je naše DNA pravděpodobně velmi málo poškozena. Míra degradace může být hodnocena i dalšími postupy, jako je qpcr. Provedení takových testů sice nestojí příliš mnoho času, avšak spotřebovává se při něm část vzorku; u nepatrných stop s minimálním množstvím využitelné DNA si takové plýtvání dovolit nemůžeme, a musíme přistoupit přímo k pokusu o analýzu. 167

170 Může být degradovaná DNA před analýzou nějak reparována? Zmínili jsme dva možné charaktery změn v degradované DNA fragmentaci a narušení struktury. Fragmentace je při současných znalostech a schopnostech molekulární genetiky poškození laboratorně nereparovatelné neexistuje laboratorní postup, kterým by bylo možno vyhledat a seřadit fragmenty tak, jak původně byly v DNA za sebou, a znovu je spojit (v jiných odvětvích molekulární genetiky se používají některé postupy skládání sekvence až v počítači, ve forenzní oblasti se však zatím neuplatňují.) Naproti tomu existují některé dílčím způsobem úspěšné postupy opravy narušené struktury DNA pomocí enzymatických koktejlů. Jejich užití ve forenzní genetice je však zatím spíše otázkou budoucnosti. Existují speciální postupy analýzy degradované DNA? Ano. Základním přístupem je maximalizace výtěžnosti izolačních technik (tj. nelze si dovolit ztráty) a minimalizace délky fragmentu potřebného k provedení příslušné analýzy (neboť je mnohem větší pravděpodobnost, že ve vzorku se bude nacházet několik nepoškozených zájmových fragmentů o délce 100 bp než o délce 300 bp). V rámci analýzy STR lokusů se v tomto směru uplatňuje především užití tzv. ministrs. Co jsou ministrs a jak se analyzují? Jako ministrs označujeme analýzy STR lokusů s pomocí primerů nasedajících těsně před a za danou repetici; tímto blízkým umístěním primerů se minimalizuje délka potřebného neporušeného fragmentu, a tedy i zvyšuje pravděpodobnost, že analýza bude úspěšná. Testování se zaměřuje na: 168

171 klasické autozomální STR lokusy, např. zahrnuté v CODIS Core Loci, u nichž jsou hledány pozice pro primery co nejbližší repeticím nově vytipované ministr lokusy, kde je sama repetice relativně krátká, avšak lokus je dostatečně polymorfní Obrázek 54 Nasedání primerů při klasické analýze a při ministr analýze. Zatímco u klasických autozomálních STR lokusů mohou být výsledky ministr analýzy porovnávány s výsledky standardních analýz tedy např. s profily v DNA databázi, výsledky analýzy specifických ministr lokusů takto srovnávány být nemohou a užívají se spíše k porovnání ad hoc (tedy např. v rámci konkrétního případu jsou stanoveny a porovnány genotypy specifických ministr ze stopy a srovnávacích vzorků osob, avšak nelze provést plošné prohledání DNA databáze, neboť standardně stanovované profily tyto specifické ministr lokusy neobsahují). 169

172 Co je LCN? Jako LCN (angl. Low Copy Number, malý počet kopií ) neboli LT DNA (angl. Low Template DNA) jsou souhrnně označovány vzorky s malým až velmi malým obsahem DNA využitelné pro analýzu. Existují speciální postupy analýzy LCN (LT DNA)? Pro analýzu LCN vzorků bylo až dosud vyvinuto a je užíváno několik specifických strategií, jejichž cílem je zvýšení citlivosti testování. Základními jsou zvýšení počtu PCR cyklů při amplifikaci, které může vést ke zvýšení množství výsledného produktu, avšak zvyšuje i riziko nespecifické amplifikace (tj. jevů typu drop in); užití tzv. nested PCR, kdy je nejprve lokus amplifikován s pomocí páru primerů nasedajících dále od sebe (tzv. vnější pár primerů) a poté s pomocí páru primerů nasedajících uvnitř prvního amplikonu blíže k sobě (tzv. vnitřní pár primerů), což může vést ke zvýšení množství výsledného produktu, avšak vzhledem k manipulaci se vzorkem se zvyšuje i riziko kontaminace; snížení objemu PCR reakce, tedy jakési zakoncentrování celé reakce; negativní efekt ovšem může mít současné zakoncentrování PCR inhibitorů; další snahy o vylepšení PCR, např. přidáním většího množství polymerázy apod. zvýšení objemu vzorku injektovaného do kapilární elektroforézy přečištění PCR produktu před injekcí do kapilární elektroforézy, což rovněž zvýší množství vzorku, který se nabere do kapiláry užití nadějnějších lokusů, např. mtdna, která je ve vzorku přítomna v několikařádově více kopiích než autozomální lokusy 170

173 Jak se degradace DNA a/nebo malé množství DNA projeví na analýze? K tomu, aby analýza poskytla pozitivní výsledek, je teoreticky třeba, aby ve vzorku byl přítomen minimálně jeden nepoškozený fragment DNA zahrnující celý testovaný úsek DNA v případě PCR technik je to celý úsek mezi F a R primerem včetně obou konců, kam tyto primery nasedají. V praxi je však pozitivní analýza vzorku s jedinou kopií zájmového lokusu značně nejistá, závisí významně na použité technologii a spolehlivých výsledků lze zpravidla dosáhnout až při řádově vyšším počtu kopií, např. 10. S postupující degradací DNA se počet nepoškozených fragmentů zahrnujících testovaný úsek ve vzorku snižuje, ve vzorcích typu LCN je rovněž počet nepoškozených fragmentů zahrnujících testovaný úsek velmi malý; tím se mohou během PCR více a více projevit tzv. stochastické efekty laicky řečeno vlivy náhody, které snižují spolehlivost získaných dat. Se snížením počtu nepoškozených fragmentů zahrnujících testovaný úsek rovněž dramaticky roste riziko, že se při analýze projeví přítomnost třeba i malého množství kontaminující DNA (neboli cizorodé DNA zanesené do vzorku). K jakým stochastickým efektům může docházet při analýze degradované DNA či LT DNA? Nejčastějšími stochastickými efekty jsou nerovnováha píků u heterozygota alelický drop out lokusový drop out zvýšení stutteringu (tj. tvorby koktavých píků) alelický drop in 171

174 Jako nerovnováhu píků u heterozygota označujeme stav, kdy oba píky reprezentující dvě alely heterozygotního lokusu nejsou stejně vysoké (tak, jak by u vzorku jediné osoby měly být), ale svou výškou se významně liší; pokud se výška jednoho z obou píků sníží až k nule (tj. pík není de facto přítomen), mluvíme o ztrátě alely neboli alelickém drop outu. Dojde li ke ztrátě obou alel lokusu (tj. žádný pík daného lokusu není de facto přítomen), mluvíme o ztrátě lokusu neboli lokusovém drop outu. Při amplifikaci lokusů typu STR dochází u čtyř a méněnukleotidových repetic k občasnému prokluzu polymerázy: polymeráza během kopírování repetice odpadne a znovu nasedne, přičemž v určitém procentu případů nasedne na templátovou DNA až o motiv dále než odpadla, takže výsledný produkt amplifikace je o motiv kratší. Tím vznikne určité množství fragmentů, které se v elektroforetogramu objeví jako menší pík předsazený před vlastní alelou o délku motivu, tedy kupříkladu o 4 bp. Tento jev nazýváme zadrhávání, koktání (stuttering) a zmíněný předpík označujeme jako koktavý pík (stutter). U standardních vzorků s dostatečným množstvím nepoškozené DNA se při klasické analýze autozomálních tetranukleotidových STR pohybuje míra stutteringu kolem %, u degradované DNA či LCN vzorků však může významně narůstat, což spolu s ostatními stochastickými jevy vede k nejistotě, zda daný pík představuje pouze zvýšený stutter, nebo se jedná o relevantní alelu. Vzhledem k malému obsahu templátové DNA v degradovaných či LCN vzorcích se při amplifikaci může projevit i sporadická kontaminace (kontaminace malými DNA rezidui), a to nejčastěji v podobě tzv alelických drop inů, tj. píků navíc. 172

175 Obrázek 55 Stochastické jevy, k nimž dochází při analýze degradované DNA a/nebo LT DNA. Lze stochastické efekty při analýze degradované DNA či LT DNA nějak omezit? Kromě výše popsaných principů, vedoucích ke zlepšení analýzy jako takové, se při práci s degradovanou či LT DNA hojně užívá jednoduchého principu, a to několikanásobného provedení analýzy téhož vzorku. Podstatou stochastických efektů je totiž to, že se neprojevují vždy, ale nahodile: opakováním PCR tak můžeme dostat několik ne zcela stejných výsledků, z nichž lze za určitých podmínek stanovit nejpravděpodobnější skutečný DNA profil tzv. konsenzuální profil. 173

176 Jaká hlavní rizika přináší užití vzorků s degradovanou DNA a/nebo LCN vzorků ve forenzní praxi? Jak již bylo naznačeno výše, analýza tohoto typu vzorků s sebou vždy přináší snížení spolehlivosti získaných dat: uplatňují se snáze stochastické efekty a roste riziko, že se projeví kontaminující DNA. Přes tato negativa mohou být degradované a LCN vzorky principiálně pro forenzní analýzu užity, pokud je s nimi správným způsobem nakládáno a z nich získaná data jsou správně a obezřetně interpretována. Na druhou stranu data velmi sporné kvality a původu již by neměla být referována jako relevantní a neměla by být pro jakékoli forenzní interpretace užívána. 174

177 Interpretace forenzně genetických dat Obecné kroky a pravidla interpretace dat Co si představit pod pojmem interpretace dat? Po vlastní analyzační fázi, tj. genetické analýze v laboratoři, nastupuje neméně důležitá fáze interpretační; jejím smyslem je zhodnotit získaná data, stanovit jejich spolehlivost a následně určit jejich vypovídací hodnotu, tj. převést získanou informaci z roviny úzce odborné do roviny reálného světa a života neboli říci, co vlastně výsledky analýzy v daném případě znamenají. Obrázek 56 Základní kroky procesu práce s daty neboli od dat k posudku. Z čeho vycházíme při hodnocení spolehlivosti dat? Abychom mohli odhadnout míru spolehlivosti dat (či naopak chcete li míru nejistoty), musíme především posoudit: 175

178 jak jsou získaná data technicky kvalitní, a jaká je tedy spolehlivost vlastního odečtu dat jak v principu spolehlivé jsou námi použité metody analýzy a jak je z hlediska možného ovlivnění výsledků bezpečný a vůči chybě odolný celý laboratorní proces jak logicky konzistentní jsou jednotlivá dílčí zjištění v procesu forenzně genetické analýzy navzájem (tj. zda si např. dva dílčí výsledky zkoumání téhož vzorku neodporují) jak dobře data odpovídají empirii (tj. zda jsou data v souladu se zkušeností znalce a uživatele dat soudce, či naopak zda z ní vybočují). Jakým způsobem posuzujeme vypovídací hodnotu dat? Další posouzení dat by mělo vždy být založeno na inferenci pravděpodobnostních jevů, tj. na vyjádření pravděpodobnosti daného výsledku za platnosti dvou či více alternativních hypotéz. Všechny ostatní způsoby posouzení dat (kategorické soudy, frekventistický přístup aj.), které jsou užívány v některých jiných forenzních oborech, jsou v rámci forenzně genetické analýzy nedostatečné či dokonce hrubě zkreslující a znalec by se jich měl vyvarovat. Spolehlivost dat technická kvalita dat Jakou podobu mají výstupní laboratorní data? Laboratorní data, která jsou výsledkem forenzně genetické analýzy, mohou v principu mít nejrůznější podobu; v praxi se ovšem nejčastěji setkáme s časovým záznamem změn fluorescence v průběhu kapilární elektroforézy (tzv. elektroforetogramem), a to jak u klasické identifikační STR analýzy, tak například při sekvenování mtdna či při minisekvenování SNP lokusů. 176

179 Co rozumíme pod pojmem technická kvalita laboratorních dat? Technickou kvalitou dat rozumíme to, jak zřetelně odečitatelná tato data jsou, tj. do jaké míry jednoznačně z nich lze určit konkrétní podobu studovaných polymorfismů DNA. Naše data mohou být od vysoce kvalitních, úplných a bez nejasností, přes středně kvalitní, neúplná a s určitými nejasnostmi až po zcela neinterpretovatelná. Jak hodnotíme technickou kvalitu laboratorních dat? Posouzení technické kvality dat spočívá v hodnocení celé řady parametrů, jako je výška a tvar píků, vzájemné poměry výšek píků, míra stutteringu, výška a charakter tzv. pozadí a podobně. Při hodnocení přitom vycházíme ze standardu, který představují data z validace (o validaci viz dále). Posouzení může být primárně svěřeno kvalitnímu vyhodnocovacímu softwaru, stále ovšem platí, že finální posouzení dat včetně jejich technické kvality je na expertovi a jeho cvičeném oku. Jak pracujeme s technicky středně a nízce kvalitními daty? Prvním krokem by vždy měla být snaha kvalitu dat zvýšit; v praxi tak často po první analýze vzorku následuje i několik dalších opakování s různými modifikacemi (změna vstupního množství DNA do PCR, změna parametrů PCR, změna parametrů kapilární elektroforézy atd.) Cílem je optimalizovat průběh celé analýzy tak, aby výsledná data byla co nejčitelnější. Na tomto místě zdůrazňuji, že se v žádném případě nejedná o snahu tak dlouho zkoušet analýzu, až konečně dostanu výsledek, jaký potřebuji; jde o snahu vyladit celou analýzu tak, aby poskytla co nejúplnější a co nejspolehlivější data. 177

180 V případě práce se silně degradovanou DNA a/nebo LCN vzorky, kde se silně uplatňují již dříve popsané stochastické jevy (alelický drop out, nevyváženost píků atd.), se můžeme setkat se sestavováním tzv. konsenzuálních profilů. Podstatou je opakovaná analýza téhož vzorku s pomocí několika nezávislých PCR a následné pomyslné spojení odečtených dat ze všech těchto analýz; tím lze do značné míry eliminovat právě stochastické jevy, které se objevují náhodně a pouze v některých PCR téhož vzorku. V případě, že ani opakované analýzy a modifikované postupy nevedou ke zkvalitnění dat, je třeba míru technické nekvality zohlednit při stanovení vypovídací hodnoty dat. V praxi tak můžeme například dospět k závěru, že: u určitého autozomálního lokusu, v němž byla stanovena pouze jediná alela (označme ji A), připouštíme možný drop out druhé alely; skutečný genotyp vzorku tudíž může být nejen AA, ale i AX, kde X je libovolná jiná alela; u určitého autozomálního lokusu byla jednoznačně stanovena alela A a dále alela B cca poloviční výšky na pozici odpovídající stutteru alely A, u níž vzhledem k technické kvalitě vzorku nelze jednoznačně rozhodnout, zda se jedná o stutter či o druhou relevantní alelu; skutečný genotyp vzorku tudíž může být jak AA, tak AB; u určitého autozomálního lokusu nebyla stanovena ani jedna alela; skutečný genotyp vzorku tudíž může být jakýkoli. U dat nízce kvalitních je často zdrojů nejistoty tak mnoho, že je již prakticky nelze jako důkaz použít. Správný postup v tomto případě neznamená snažit se i vysoce nekvalitní data interpretovat, ale naopak: nekvalitní data rozpoznat a označit je jako nehodnotitelná (nepoužitelná). 178

181 Kvalita v laboratoři Proč laboratoře zavádějí systémy řízení kvality? Řízení kvality ve forenzně genetických laboratořích sleduje několik základních cílů: prevence chyb ze známých zdrojů a prevence snížení kvality (např. prevence záměny vzorků, prevence poškození vzorků nevhodnou teplotou atd.) odhalování nových, neznámých zdrojů chybovosti a neznámých zdrojů snížení kvality (např. zjištění negativního vlivu určité látky na průběh analýz apod.) systémový přístup a standardizace analýz (se stejnými vzorky je nakládáno stejně) optimalizace laboratorních procesů z časového i ekonomického hlediska (snaha dosáhnout rychlého zpracování vzorků, snaha maximalizovat finanční efektivitu analýzy tj. množství informace získané ze vzorku za určitou jednotkovou částku) průběžné zkvalitňování analýz s ohledem na vývoj v oboru. Co jsou to certifikace a akreditace laboratoří? Jaký je mezi nimi rozdíl? Certifikací rozumíme dobrozdání (certifikát) certifikačního orgánu, že daný výrobek, postup nebo služba je ve shodě s předepsanou normou nebo jiným normativním dokumentem. V souvislosti s forenzně genetickou laboratorní praxí se nejčastěji setkáme s certifikací o shodě s normou ISO 9001:2008 (týká se systému managementu kvality). 179

182 Akreditací rozumíme dobrozdání akreditačního orgánu, že buď a) daný certifikační orgán je po stránce odborné i jiné (nezávislost, nestrannost atd.) způsobilý k certifikacím, nebo že b) daný subjekt je odborně i jinak způsobilý k provádění určité činnosti. V souvislosti s forenzně genetickou laboratorní praxí se nejčastěji setkáme s akreditací laboratoří dle normy ISO 17025:2005 (týká se všeobecných požadavků na způsobilost zkušebních a kalibračních laboratoří, pro akreditaci forenzních laboratoří bylo vydáno doporučení ILAC G19), případně okrajově s akreditací dle normy ISO 15189:1998 (týká se zvláštních požadavků na kvalitu a odbornou způsobilost zdravotnických laboratoří). V souvislosti s ohledáním místa činu se můžeme setkat s akreditací dle normy ISO 17020:1998 (týká se inspekce a inspektorů obecně, pro akreditaci ohledání místa činu bylo vydáno zvláštní doporučení EA 5/03). Souhrnně lze konstatovat, že mezi certifikací forenzní laboratoře dle ISO 9001:2008 a akreditací forenzní laboratoře dle ISO 17025:2005 je zásadní rozdíl: certifikace dle ISO 9001:2008 garantuje, že laboratoř má zaveden a uplatňuje systém řízení kvality, ovšem již nijak negarantuje odbornou způsobilost dané laboratoře k provádění příslušných zkoušek; naproti tomu akreditace dle ISO 17025:2005 garantuje jak zavedení a uplatňování systému managementu kvality, tak odbornou způsobilost laboratoře k provádění příslušných zkoušek. Znamená to tedy, že forenzně genetická laboratoř, která není akreditována dle ISO 17025:2005, není odborně způsobilá a produkuje špatná dat a? Nikoliv. I laboratoře neakreditované mohou být velmi kvalitní, mít vlastní systémy řízení kvality a kontroly správnosti dat a 180

183 produkovat vysoce validní data; tato jejich schopnost však není garantována žádnou akreditační autoritou a je pouze na uvážení zákazníka (v tomto případě např. orgánu činného v trestním řízení), jakou důvěryhodnost datům přikládá. V řadě oborů se již akreditace laboratoře stala dokonce právně zakotvenou nezbytnou podmínkou výkonu dané činnosti. Naproti tomu sama akreditace není absolutní zárukou validity dat, pokud nejsou laboratoří všechna pravidla důsledně uplatňována a naplňována. Jak laboratoř vybírá vhodné metody pro danou analýzu? Jak pozná, že metoda je v jejích podmínkách funkční? Při výběru metod pro analýzu se laboratoř řídí vědeckými poznatky ve svém oboru; relevantní metody jsou vždy popsány v odborné literatuře jako výstup vědeckých studií a zpravidla jsou mnohonásobně ověřeny dalšími nezávislými studiemi jiných odborných pracovišť. Řada metod je dnes dostupná komerční cestou v podobě tzv. analyzačních kitů; firmy produkující tyto kity garantují jejich funkčnost při dodržení stanoveného pracovního postupu kity jsou validované. Validací obecně rozumíme potvrzení prostřednictvím poskytnutí objektivních důkazů, že požadavky na specifické zamýšlené použití nebo na specifickou aplikaci byly splněny. I validovaný kit však musí být verifikován (tj. přezkoušen) přímo laboratoří, čímž je zaručeno, že funguje správně i v podmínkách tohoto konkrétního pracoviště (tzn. na jeho přístrojích atd.). Jak laboratoř průběžně ověřuje, že produkuje relevantní data? Jednou z nejspolehlivějších metod ověření kvality a správnosti dat produkovaných laboratoří je účast v tzv. okružních (proficienčních) testech. Ty spočívají v tom, že zadavatel testů 181

184 připraví testovací vzorky, rozešle je testovaným laboratořím, ty je analyzují a odešlou výsledky analýzy zpět zadavateli, který posoudí správnost výsledků. Úspěšné laboratoře získají certifikát; testy se opakují v určitých intervalech, kupříkladu jednou ročně. Tento systém mezilaboratorní kontroly kvality může být organizován jak na mezinárodní, tak i na národní úrovni. Vypovídací hodnota dat Jak funguje inferenční logika hodnocení dat? Inference neboli usuzování, odvozování jedné skutečnosti z druhé, je ve forenzní analýze založena na jednoduchém principu: některé hypotézy jsou při daném výsledku pravděpodobnější a jiné méně pravděpodobné; platí to tehdy, pokud jsou předpoklady hypotézy a výsledky analýzy jevy závislé. Pro porozumění si uveďme nejprve jednoduchý příklad zcela mimo forenzní obor: Na konzultaci k panu Petrovi má přijít žena, říkejme jí Marie, o níž Petr ví pouze to, že je jí právě 30 let. Klade si v duchu otázku, zda je svobodná či nikoli. V tuto chvíli mu vodítkem může být pouze nějaká obecná, předběžná (neboli apriorní) pravděpodobnost: dejme tomu, že celorepubliková statistika říká, že v ročníku třicetiletých je dosud svobodných zhruba 25 % žen. Z toho vyplývá, že i Marie bude svobodná s pravděpodobností 25 %. Poté však kolega Petrovi během řeči sdělí, že pokud je mu známo, vystudovala Marie práva. S novou informací se původní (apriorní) pravděpodobnost změní: v ročníku třicetiletých vysokoškolaček je totiž podle statistiky dosud svobodných plných 40 %. O několik minut později zaklepe Marie na Petrovu kancelář, a zatímco ji Petr vítá, všimne si, že na levém prsteníčku má Marie zlatý prsten bez kamenu: pravděpodobnost, že je svobodná, v tu chvíli dramaticky klesne. 182

185 Jak vidíme v našem příkladu, inferenční logika je založena na úpravě našich očekávání na základě získání nových dat (informací). Stejným způsobem funguje hodnocení síly důkazu ve forenzní oblasti opět si uveďme příklad: Manželé Novákovi ohlásili na policii, že jejich soused, pan Svoboda, pravděpodobně zneužívá svou nezletilou dceru Lucii. Je známo, že cca 50 % takovýchto podezření se posléze potvrdí, zatímco ve zbylých 50 % případů se obvinění ukáže jako účelové nebo nesprávné. Prvotní pravděpodobnost zneužívání Lucie (tj. ještě předtím, než kdokoli cokoli začne zjišťovat), je tedy cca 50 %. Při následném pohovoru s policejním psychologem si tento všimne, že Lucie si kouše nehty. Ze studií přitom vyplývá, že kousání nehtů lze zaznamenat u cca 80 % zneužívaných dětí a pouze u 10 % dětí nezneužívaných. Jinak řečeno: kousání nehtů je 8x pravděpodobnější u zneužívaného dítěte než u nezneužívaného. Na základě zjištění, že Lucie si kouše nehty, stoupne i pravděpodobnost, že je zneužívána. Jak funguje inferenční logika ve forenzní genetice? Inferenční logika se ve forenzní genetice vztahuje především ke třem typům hypotéz, a to: hypotéz o shodném/rozdílném původci dvou vzorků hypotéz o přítomnosti/nepřítomnosti biologického materiálu určité osoby ve smíšené stopě hypotéz o existenci/neexistenci určitého biologického příbuzenského vztahu mezi dvěma osobami V prvém případě nás zajímá především, jak významným důkazem o stejném původci je shoda genotypů (genetických profilů). Ve druhém případě nás zajímá, jak významně svědčí výsledek analýzy 183

186 smíšené stopy pro přítomnost biologického materiálu konkrétní osoby. Ve třetím případě nás zajímá, jak silně pro hypotézu či proti hypotéze o určitém příbuzenském vztahu svědčí zjištěné genotypy (genetické profily) obou osob. Jak konkrétně při určování vypovídací hodnoty forenzně genetického důkazu znalec postupuje? Vlastní interpretace dat je problematika nesmírně rozsáhlá a je záměrem realizačního týmu Československé společnosti pro forenzní genetiku vydat k tomuto tématu samostatnou podrobnou a názornou publikaci o rozsahu minimálně takovém, jako má tento breviář. Pro jeho potřeby se proto omezme na některá základní konstatování: znalec zvažuje výsledky analýzy za platnosti definovaných alternativních hypotéz a s ohledem na specifika případu, přičemž užívá tzv. bayesiánský přístup, založený na inferenční logice vychází z četnosti jednotlivých znaků v populaci a ze způsobu, jakým jsou děděny zohledňuje míru mutací, tj. změn v DNA, které mohou zasáhnout i testované lokusy hodnotí nejistotu měření neboli spolehlivost dat bere v potaz velikost a strukturu populace, počet možných pachatelů, míru příbuznosti osob v populaci atd. Co by mělo být zásadním výstupem forenzně genetické analýzy? Výstupem práce znalce je tzv. věrohodnostní poměr (LR) (angl. Likelihood Ratio) pro každou dvojici alternativních hypotéz; tento věrohodnostní poměr může být kombinován s věrohodnostním poměrem vzešlým jiných zkoumání (např. daktyloskopie) ke 184

187 stejné dvojici hypotéz nebo s dalšími i nevědeckými důkazy, např. očitým svědectvím. Vynásobením věrohodnostního poměru a apriorního podílu šancí získáváme aposteriorní podíl šancí (převeditelný na aposteriorní pravděpodobnost). Nutno říci, že praxe v tomto směru ještě stále zaostává za teorií: věrohodnostní poměr není dosud v rámci našeho soudnictví příliš vyžadován (soud obvykle volí jiný, mnohem intuitivnější přístup k hodnocení důkazů jako celku), a není tudíž ani bezvýhradně poskytován. Forenzně genetické posudky často obsahují jiné statistické parametry u identifikací to je pravděpodobnost náhodné shody (RMP), u paternitních analýz například pravděpodobnost otcovství (P) či síla vyloučení (PE). Tyto hodnoty nejsou zásadně nesprávné, pro budoucnost je však žádoucí, aby se systém hodnocení forenzních důkazů všech typů sjednotil a kodifikoval. Blíže o tom bude pojednáno v samostatné publikaci o interpretaci forenzních dat. Zdroje chyb ve forenzně genetické expertíze Je možné, aby při forenzně genetickém zkoumání došlo k chybě? Samozřejmě. Chybovost je přirozenou vlastností veškerých procesů, ať už prováděných člověkem, strojem nebo přírodou, a nevyhýbá se ani forenzně genetickému zkoumání (přestože bychom rádi byli neomylní, nejsme). Pro věc je podstatné umět poznat a popsat příčiny a mechanismy vzniku chyb a jejich důsledky, neboť jedině tak je můžeme eliminovat či alespoň snížit pravděpodobnost, že k nim dojde. 185

188 Kde v procesu forenzně genetické analýzy se chyby objevují? Prakticky kdekoli, ze statistik forenzních i jiných například klinických laboratoří však vyplývá, že chyby mnohem častěji vznikají mimo vlastní vědecké zkoumání a z jiných příčin než je neodbornost. Spadají sem chyby jako nesprávné označení vzorku, špatné přečtení označení vzorku (např. pro nečitelnost písma), umístění vzorku na nesprávné místo, záměna dvou podobných stop atd. Jaké jsou zdroje chyb při zkoumání? Četné příčiny chyb v laboratoři můžeme alespoň zhruba rozdělit takto: člověk vedený přímým úmyslem zkreslit či zcela změnit výsledek zkoumání (např. osoba k tomu finančně motivovaná pachatelem) člověk vedený nepřímým úmyslem, kterému nejde primárně o změnu výsledku, ale ví, že svým jednáním může takovou změnu způsobit, a je s tím srozuměn (např. osoba, která manipuluje s daty, aby zakryla svou chybu v pracovním postupu) člověk vědomě nedbalý, který ví, že svým jednáním může způsobit chybu, ale doufá, že se tak nestane (dříve všeobecně známo jako hřích opovážlivé spoléhání na milosrdenství Boží ; například osoba, která vědomě porušuje pracovní postup, aby si ulehčila práci, přičemž tuší, že to může způsobit chybu, ale doufá, že nezpůsobí) člověk nevědomě nedbalý, který neví, že může způsobit chybu, ale vědět by to měl (např. osoba manipulující s přístrojem bez řádného proškolení) 186

189 běžný lidský omyl (přestože to mnozí neradi slyší, je chybovost bez znaků nedbalosti integrální vlastností lidského mozku např. přepsání se v čísle, napipetování vzorku do nesprávné zkumavky, překouknutí atd.) technická chyba z očekávatelných příčin (počítačový virus, závada na přístroji, nekvalitní chemikálie pro analýzu atd.) technická chyba z neočekávatelných příčin (neodhalený negativně působící fyzikální, chemický či biologický faktor v minulosti byly takto dodatečně odhaleny např. pudrová tvářenka laborantky či pylová zrna jasanu ve dvoře objektu, které oboje velmi účinně blokovaly PCR). Jaké se chybám uvedených typů bránit? Pro jednotlivé zdroje chyb pochopitelně existují výrazně odlišné mechanismy prevence: v přímém či nepřímém úmyslu zkreslit či zcela změnit výsledek zkoumání lze pracovníku laboratoře zabránit poměrně obtížně, zejména je li to osoba důvěrně znalá prostředí a všech v něm fungujících procesů. Primárním opatřením je samozřejmě prověření osob předtím, než se pracovníky stanou; znesnadnit úmyslnou manipulaci lze primárně výběrem pracovníků s morálním kreditem, zavedením kontrolních bodů, jako jsou kontrolovaný pohyb osob (např. čipové karty, přístup jen do určitých prostor), kontrolovaný pohyb vzorku (uzamykatelné chladničky, mrazáky apod.), kontrolovaný přístup do počítačů, řídících jednotek přístrojů, databází (logování pomocí hesla, otisku prstu apod.). I tak ovšem může zručný insider najít slabá místa systému. v přímém či nepřímém úmyslu zkreslit či zcela změnit výsledek zkoumání lze osobě zvenčí zabránit obdobnými 187

190 mechanismy jako v předchozím případě; účinnost opatření bude u cizí osoby zcela jistě mnohem větší (osoba se nemůže v laboratoři pohybovat nenápadně, není tak dobře obeznámena s chodem laboratoře atd). Obecně je tendence zcela minimalizovat přístup cizích osob do laboratorních prostor (i proto, že tyto osoby mohou být zdrojem kontaminující DNA). nedbalostní jednání (ať už vědomé, či nevědomé) lze nejlépe eliminovat zavedením přesných pravidel práce v laboratoři a průběžnou kontrolou jejich dodržování jednotlivými pracovníky; dobrým pomocníkem v tomto směru může být software monitorující procesy v laboratoři, který umí indikovat problematický faktor mnohem dříve, než by si jej všiml člověk (např. identifikuje provázanost mezi častějšími špatnými výsledky a určitým konkrétním pracovníkem). je někdy snaha eliminovat běžný lidský omyl hrozbou trestu; to je ovšem opatření zcela neúčinné, ba co víc kontraproduktivní. Člověk nemůže přestat přirozeně chybovat jen proto, že mu hrozí trest; naopak často hrozba trestu způsobí, že osoby, která svůj omyl zjistí, se snaží na něj neupozorňovat, případně jej i zastřít. Jedinými účinnými opatřeními proti běžným chybám jsou zavedení kontrolních mechanismů (např. data odečítají nezávisle na sobě dva experti a musejí se shodnout, při pipetování jedna osoba kontroluje druhou atd.) a především automatizace procesů, která vyloučí lidský faktor ze hry (např. automatická izolace a amplifikace, kdy vše provádí robot a vzorky jsou v procesu značeny a identifikovány pomocí čárového či QR kódu) technické chyby jsou do značné míry eliminovatelné zavedením managementu kvality (zmíněné ISO17025), jehož součástí jsou standardní operační postupy, které zahrnují i pravidelné údržby, kalibrace a kontroly funkčnosti přístrojů, 188

191 kontroly kvality používaných chemikálií a laboratorního materiálu atd. Zásadním mechanismem, který nám pomáhá zvyšovat efektivitu preventivních opatření, je zjištění příčiny a mechanismu každé chyby, kterou v laboratoři odhalíme. Jedině tak můžeme identifikovat a průběžně odstraňovat slabá místa celého procesu. I tak ovšem zůstává pravděpodobnost chyby nenulová, a to i v té nejspolehlivější laboratoři. Pokud takové důvodné podezření existuje, je samozřejmě namístě pokud je to možné zpracování revizního posudku v jiné laboratoři. 189

192 Uchovávání zdrojů genetických informací Obrázek 57 Možné formy uchovávání zdrojů genetických informací. Banky (archivy, depozity) biologického materiálu Co je banka biologického materiálu? Základní možností, jak uchovat zdroj forenzně genetických informací, je deponovat samotnou stopu či její část (např. setřený biologický materiál). Bankou tedy rozumíme takovýto depozit; jednotlivé stopy (biologické materiály) jsou evidovány pod identifikačním kódem a k němu jsou vázána data údaje o typu stopy či materiálu, původu atd. Jaké výhody a nevýhody má banka biologického materiálu? Provozní banka biologického materiálu funguje v každé forenzně genetické laboratoři. Materiál je v ní uchováván po dobu provádění 190

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

16.10.2011 KRIMINALISTICKÁ GENETIKA V ČESKÉ REPUBLICE. Praxe a legislativa

16.10.2011 KRIMINALISTICKÁ GENETIKA V ČESKÉ REPUBLICE. Praxe a legislativa KRIMINALISTICKÁ GENETIKA V ČESKÉ REPUBLICE Praxe a legislativa Genetické zkoumání v PČR Kriminalistická genetická analýza standardní kriminalistická znalecká metoda PČR zkoumá lidský biologický materiál

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Vzdělávání v oblasti forenzní genetiky reg. č. CZ.1.07/2.3.00/09.0080

Vzdělávání v oblasti forenzní genetiky reg. č. CZ.1.07/2.3.00/09.0080 INVESTICE DO ROZVOJE VZDĚLÁVÁNÍ Vzdělávání v oblasti forenzní genetiky reg. č. CZ.1.07/2.3.00/09.0080 INVESTICE DO ROZVOJE VZDĚLÁVÁNÍ Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

http://www.vrozene-vady.cz

http://www.vrozene-vady.cz Prevence vrozených vad z pohledu genetika MUDr. Vladimír Gregor, RNDr. Jiří Horáček odd. lékařské genetiky, Fakultní Thomayerova nemocnice v Praze Genetické poradenství Klinická genetika se zabývá diagnostikou

Více

DVOJČATA. Jednovaječná či dvojvaječná?

DVOJČATA. Jednovaječná či dvojvaječná? DVOJČATA Jednovaječná či dvojvaječná? 18 Jednovaječná či dvojvaječná? Proč a jak to zjišťujeme A jsou jednovaječná? To je jedna z nejčastějších otázek, se kterou se maminka dvojčat setká. Bohužel ne každý

Více

A Co je HIV? HIV AIDS Co je AIDS? Co znamená být HIV pozitivní? HIV AIDS. HIV HIV AIDS HIV

A Co je HIV? HIV AIDS Co je AIDS? Co znamená být HIV pozitivní? HIV AIDS. HIV HIV AIDS HIV A Co je HIV? HIV (virus lidského imunodeficitu) je virus, který způsobuje ztrátu obranyschopnosti (imunity) člověka před nejrůznějšími infekcemi. Tento virus napadá zejména určitou skupinu bílých krvinek,

Více

Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi

Více

Číslo projektu: CZ.1.07/1.5.00/34.0036 Název projektu: Inovace a individualizace výuky Autor: Mgr. Martin Fryauf Název materiálu: Identifikace podle

Číslo projektu: CZ.1.07/1.5.00/34.0036 Název projektu: Inovace a individualizace výuky Autor: Mgr. Martin Fryauf Název materiálu: Identifikace podle Číslo projektu: CZ.1.07/1.5.00/34.0036 Název projektu: Inovace a individualizace výuky Autor: Mgr. Martin Fryauf Název materiálu: Identifikace podle vnějších znaků zjišťování totožnosti mrtvoly Označení

Více

Downův syndrom. Renata Gaillyová OLG FN Brno

Downův syndrom. Renata Gaillyová OLG FN Brno Downův syndrom Renata Gaillyová OLG FN Brno Zastoupení genetických chorob a vývojových vad podle etiologie 0,6 %-0,7% populace má vrozenou chromosomovou aberaci incidence vážných monogenně podmíněných

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://www.kardiobtl.cz/produkty/diag-ultrazvuky-ge/ge-vivid-7/ K l i n i c k á p r o p e d e u t i k a Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí,

Více

Vše co potřebujete vědět o hemoroidech. Rady pro pacienty

Vše co potřebujete vědět o hemoroidech. Rady pro pacienty Vše co potřebujete vědět o hemoroidech Rady pro pacienty CO? CO? JAK? JAK? KDY? KDY? PROČ? PROČ? CO CO jsou hemoroidy? je hemoroidální onemocnění? Anatomie řitního kanálu a konečníku Hemoroidy jsou přirozenou

Více

Bezpečnost a ochrana zdraví; Zdravotní pojištění, zdravotní péče Normy:

Bezpečnost a ochrana zdraví; Zdravotní pojištění, zdravotní péče Normy: Název předpisu: Vyhláška, kterou se stanoví podmínky pro zařazování prací do kategorií, limitní hodnoty ukazatelů biologických expozičních testů, podmínky odběru biologického materiálu pro provádění biologických

Více

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Strašák EBOLA TÝKÁ SE TAKÉ NÁS EVROPANY? Bc. Helena Marcinková

Strašák EBOLA TÝKÁ SE TAKÉ NÁS EVROPANY? Bc. Helena Marcinková Strašák EBOLA TÝKÁ SE TAKÉ NÁS EVROPANY? Bc. Helena Marcinková Ebola a Česká republika máme se bát? Jaké je riziko, že se Ebola dostane do České republiky a začne se tu šířit? Riziko pro turisty nebo obchodní

Více

Úřad pro ochranu osobních údajů Pplk. Sochora 27, 170 00 Praha 7 Zasláno na e-mail: posta@uoou.cz. v Praze dne 4.9.2013.

Úřad pro ochranu osobních údajů Pplk. Sochora 27, 170 00 Praha 7 Zasláno na e-mail: posta@uoou.cz. v Praze dne 4.9.2013. Úřad pro ochranu osobních údajů Pplk. Sochora 27, 170 00 Praha 7 Zasláno na e-mail: posta@uoou.cz v Praze dne 4.9.2013 Dobrý den, obracím se na vás jménem občanského sdružení Iuridicum Remedium s podnětem

Více

Imunologie krevní skupiny 109.3059

Imunologie krevní skupiny 109.3059 Imunologie krevní skupiny 109.3059 Strana 1 z 22 SIMULAČNÍ SOUPRAVA PRO AB0 & Rh TYPIZACI KRVE Strana 2 z 22 SOMERSET educational (Pty) LTD SIMULOVANÉ SOUPRAVY PRO STANOVENÍ KREVNÍ SKUPINY AB0 a Rh FAKTORU

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

PNEUMOKOKOVÉ INFEKCE A MOŽNOSTI PREVENCE aneb CO MŮŽE ZPŮSOBIT PNEUMOKOK

PNEUMOKOKOVÉ INFEKCE A MOŽNOSTI PREVENCE aneb CO MŮŽE ZPŮSOBIT PNEUMOKOK PNEUMOKOKOVÉ INFEKCE A MOŽNOSTI PREVENCE aneb CO MŮŽE ZPŮSOBIT PNEUMOKOK Očkování! Nejvýznamnější možnost prevence infekčních chorob! Lepší infekční chorobě předcházet než ji léčit! Významný objev v medicíně,

Více

VZDĚLÁVACÍ PROGRAM v oboru SOUDNÍ LÉKAŘSTVÍ

VZDĚLÁVACÍ PROGRAM v oboru SOUDNÍ LÉKAŘSTVÍ VZDĚLÁVACÍ PROGRAM v oboru SOUDNÍ LÉKAŘSTVÍ 1. Cíl specializačního vzdělávání Cílem specializačního vzdělávání v oboru soudní lékařství je získání specializované způsobilosti osvojením potřebných teoretických

Více

Pracovní listy pro žáky

Pracovní listy pro žáky Pracovní listy pro žáky : (Ne)viditelná DNA Úvod do tématu Přečtěte si následující tři odborné články a přiřaďte k nim názvy oborů, ve kterých se využívá metod izolace DNA: forenzní genetika, paleogenetika,

Více

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika

Více

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika 1/6 3.2.11.18 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost

Více

PŮSTEM KE ZDRAVÍ A ŠTÍHLÉ

PŮSTEM KE ZDRAVÍ A ŠTÍHLÉ 1 PŮSTEM KE ZDRAVÍ A ŠTÍHLÉ LINII Být štíhlý je přirozené, být zdravý je normální Martin Hyroš www.pustemkezdravi.cz 2 Ukázka knihy z internetového knihkupectví www.kosmas.cz U k á z k a k n i h y z i

Více

Číslo projektu: CZ.1.07/1.5.00/34.0036 Název projektu: Inovace a individualizace výuky

Číslo projektu: CZ.1.07/1.5.00/34.0036 Název projektu: Inovace a individualizace výuky Číslo projektu: CZ.1.07/1.5.00/34.0036 Název projektu: Inovace a individualizace výuky Autor: Mgr. Martin Fryauf Název materiálu: Kriminalistická chemie Označení materiálu:vy_32_inovace_fry14 Datum vytvoření:

Více

Variace Vývoj dítěte

Variace Vývoj dítěte Variace 1 Vývoj dítěte 21.7.2014 16:25:04 Powered by EduBase BIOLOGIE ČLOVĚKA VÝVOJ DÍTĚTE OPLOZENÍ A VÝVOJ PLACENTY Oplození K oplození dochází ve vejcovodu. Pohyb spermií: 3-6 mm za minutu. Životnost

Více

Projekt realizovaný na SPŠ Nové Město nad Metují

Projekt realizovaný na SPŠ Nové Město nad Metují Projekt realizovaný na SPŠ Nové Město nad Metují s finanční podporou v Operačním programu Vzdělávání pro konkurenceschopnost Královéhradeckého kraje Modul 02 Přírodovědné předměty Hana Gajdušková 1 Viry

Více

Mechanoskopie. Pojem:

Mechanoskopie. Pojem: Mechanoskopie Pojem: Mechanoskopie se zabývá posuzováním zákonitostí vzniku, trvání (existence) a zániku stop vytvořených nejrůznějšími nástroji a v řadě případů i identifikací nástrojů podle jimi vytvořených

Více

NEBUNĚČNÁ ŽIVÁ HMOTA VIRY

NEBUNĚČNÁ ŽIVÁ HMOTA VIRY NEBUNĚČNÁ ŽIVÁ HMOTA VIRY Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje 11.3.2011 Mgr.Petra Siřínková Rozdělení živé přírody 1.nadříše.PROKARYOTA 1.říše:Nebuněční

Více

Chromosomové změny. Informace pro pacienty a rodiny

Chromosomové změny. Informace pro pacienty a rodiny 12 Databáze pracovišť poskytujících molekulárně genetická vyšetření velmi častých genetických onemocnění v České republice (CZDDNAL) www.uhkt.cz/nrl/db Chromosomové změny Unique - Britská svépomocná skupina

Více

U S N E S E N Í. O d ů v o d n ě n í

U S N E S E N Í. O d ů v o d n ě n í Doručeno dne: 10. 2. 2016 6T 1/2002-1253 U S N E S E N Í Krajský soud v Hradci Králové rozhodl ve veřejném zasedání konaném dne 11. prosince 2015 v trestní věci odsouzeného Vlastimila P e c h a n c e,

Více

Hrozba epidemie, pandemie chřipka, HIV

Hrozba epidemie, pandemie chřipka, HIV Inovace a zkvalitnění výuky v oblasti přírodních věd Člověk a příroda 8.ročník červenec 2012 Hrozba epidemie, pandemie chřipka, HIV Anotace: Kód: VY_52_INOVACE_ Čap-Z 8.,9.26 Vzdělávací oblast: Autor:

Více

Zjišťování toxicity látek

Zjišťování toxicity látek Zjišťování toxicity látek 1. Úvod 2. Literární údaje 3. Testy in vitro 4. Testy na zvířatech in vivo 5. Epidemiologické studie 6. Zjišťování úrovně expozice Úvod Je známo 2 10 7 chemických látek. Prostudování

Více

Sérologická diagnostika chřipky možnosti a diagnostická úskalí

Sérologická diagnostika chřipky možnosti a diagnostická úskalí Sérologická diagnostika chřipky možnosti a diagnostická úskalí Martina Havlíčková, Radka Limberková, Pavla Růžičková, Helena Jiřincová NRL pro chřipku, Státní zdravotní ústav K historii vyšetřování sér

Více

NÁDOROVÁ RIZIKA. poznejme OBSAH

NÁDOROVÁ RIZIKA. poznejme OBSAH poznejme NÁDOROVÁ RIZIKA OBSAH Úvod... 3 Proč bychom se měli dozvědět o svých vlastních rizicích?... 4 Jaké jsou naše služby?... 4 Kdo by měl být vyšetřen?... 5 Jaký je postup při vyšetřování?... 6 Informace

Více

Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským

Více

Interpretace serologických výsledků. MUDr. Pavel Adamec Sang Lab klinická laboratoř, s.r.o.

Interpretace serologických výsledků. MUDr. Pavel Adamec Sang Lab klinická laboratoř, s.r.o. Interpretace serologických výsledků MUDr. Pavel Adamec Sang Lab klinická laboratoř, s.r.o. Serologická diagnostika EBV Chlamydia pneumoniae Mycoplasma pneumoniae EBV - charakteristika DNA virus ze skupiny

Více

Nebezpečí infekce. Zpracoval: Ondráček Zdeněk 2008

Nebezpečí infekce. Zpracoval: Ondráček Zdeněk 2008 Zpracoval: Ondráček Zdeněk 2008 Infekce je proces, při kterém se choroboplodné mikroorganismy (bakterie, viry, paraziti) dostávají do styku s hostitelským makroorganismem a vyvolávají jeho onemocnění.

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

Ing. Vladimír Bendák Datum vytvoření: 9. 11. 2012 Ročník: Autor:

Ing. Vladimír Bendák Datum vytvoření: 9. 11. 2012 Ročník: Autor: Autor: Ing. Vladimír Bendák Datum vytvoření: 9. 11. 2012 Ročník: 2. ročník nástavbové studium Tematická oblast: Přeprava nebezpečných věcí dle ADR Předmět: Technologie a řízení dopravy Klíčová slova: Toxické,

Více

Vzdělávací materiál projektu Zlepšení podmínek výuky v ZŠ Sloup

Vzdělávací materiál projektu Zlepšení podmínek výuky v ZŠ Sloup Kód: Vzdělávací materiál projektu Zlepšení podmínek výuky v ZŠ Sloup Název vzdělávacího materiálu AIDS a virus HIV Anotace Pracovní list obsahuje základní informace o AIDS a o možnostech jeho přenosu,

Více

Neinvazivní testování 2 roky v klinické praxi. Jaroslav Loucký, Darina Kostelníková, Michal Zemánek, Eva Loucká, Milan Kovalčík

Neinvazivní testování 2 roky v klinické praxi. Jaroslav Loucký, Darina Kostelníková, Michal Zemánek, Eva Loucká, Milan Kovalčík Neinvazivní testování 2 roky v klinické praxi. Jaroslav Loucký, Darina Kostelníková, Michal Zemánek, Eva Loucká, Milan Kovalčík Odkud pocházejí zdroje informací využívané ve screeningu? U těhotenství s

Více

Předmět Kriminalistika I. Ing. Jaroslav Kothánek, Ph.D.

Předmět Kriminalistika I. Ing. Jaroslav Kothánek, Ph.D. Předmět Kriminalistika I Ing. Jaroslav Kothánek, Ph.D. Předmět kriminalistiky a její vztah k jiným vědám Pojem kriminalistiky citace Kriminalistika ISBN:80-7179-878-9 : Kriminalistika je samostatný vědní

Více

KOTVA CZ.1.07/1.4.00/21.3537

KOTVA CZ.1.07/1.4.00/21.3537 KOTVA CZ.1.07/1.4.00/21.3537 Identifikátor materiálu EU: PRIR - 60 Anotace Autor Jazyk Vzdělávací oblast Vzdělávací obor PRIR = Oblast/Předmět Očekávaný výstup Speciální vzdělávací potřeby Prezentace žáka

Více

OPAKOVÁNÍ JE MATKOU MOUDROSTI ANEB JAK SPRÁVNĚ POJMOUT PREANALYTICKOU FÁZI A KVALITU PRÁCE. Kapustová Miloslava (Spoluautoři - odborná literatura)

OPAKOVÁNÍ JE MATKOU MOUDROSTI ANEB JAK SPRÁVNĚ POJMOUT PREANALYTICKOU FÁZI A KVALITU PRÁCE. Kapustová Miloslava (Spoluautoři - odborná literatura) OPAKOVÁNÍ JE MATKOU MOUDROSTI ANEB JAK SPRÁVNĚ POJMOUT PREANALYTICKOU FÁZI A KVALITU PRÁCE Kapustová Miloslava (Spoluautoři - odborná literatura) KVALITA LABORATORNÍ PRÁCE celé soustava zdravotnictvízákonodárných

Více

Střední průmyslová škola strojnická Olomouc, tř. 17. listopadu 49

Střední průmyslová škola strojnická Olomouc, tř. 17. listopadu 49 Střední průmyslová škola strojnická Olomouc, tř. 17. listopadu 49 Výukový materiál zpracovaný v rámci projektu Výuka moderně Registrační číslo projektu: CZ.1.07/1.5.00/34.0205 Šablona: III/2 Přírodovědné

Více

odpovědí: rizikové již při prvním užití, rizikové při občasném užívání, rizikové pouze při pravidelném užívání, není vůbec rizikové.

odpovědí: rizikové již při prvním užití, rizikové při občasném užívání, rizikové pouze při pravidelném užívání, není vůbec rizikové. TISKOVÁ ZPRÁVA Centrum pro výzkum veřejného mínění Sociologický ústav AV ČR, v.v.i. Jilská, Praha Tel.: 8 840 9 E-mail: jan.cervenka@soc.cas.cz Postoj veřejnosti ke konzumaci vybraných návykových látek

Více

Kouření vonných listů, kořeníči drog se vyskytuje v lidské společnosti tisíce let. Do Evropy se tabák dostal po roce 1492 v té době byl považován za

Kouření vonných listů, kořeníči drog se vyskytuje v lidské společnosti tisíce let. Do Evropy se tabák dostal po roce 1492 v té době byl považován za Mgr. Jakub Dziergas Střední škola, Havířov-Šumbark, Sýkorova 1/613, příspěvková organizace Tento výukový materiál byl zpracován v rámci akce EU peníze středním školám - OP VK 1.5. Výuková sada OBČANSKÁ

Více

HPV COLLEGE se na Vás obrací se žádostí o spolupráci. Prosíme věnujte několik minut svého času přečtením následujících informací.

HPV COLLEGE se na Vás obrací se žádostí o spolupráci. Prosíme věnujte několik minut svého času přečtením následujících informací. VÝZVA HPV COLLEGE Vážená paní doktorko, pane doktore, kolegové, HPV COLLEGE se na Vás obrací se žádostí o spolupráci. Prosíme věnujte několik minut svého času přečtením následujících informací. HPV je

Více

NEPLODNOST A ASISITOVANÁ REPRODUKCE

NEPLODNOST A ASISITOVANÁ REPRODUKCE NEPLODNOST A ASISITOVANÁ REPRODUKCE Problém dnešní doby http://www.ulekare.cz/clanek/ve-zkumavce-se-da-vypestovat-vajicko-i-spermie-13323 http://www.babyfrance.com/grossesse/fecondation.html Co tě napadne,

Více

V roce 1981 byly v USA poprvé popsány příznaky nového onemocnění, které později dostalo jméno AIDS /Acquired Immune Deficiency Syndrome/ neboli

V roce 1981 byly v USA poprvé popsány příznaky nového onemocnění, které později dostalo jméno AIDS /Acquired Immune Deficiency Syndrome/ neboli Lenka Klimešová V roce 1981 byly v USA poprvé popsány příznaky nového onemocnění, které později dostalo jméno AIDS /Acquired Immune Deficiency Syndrome/ neboli Syndrom získaného imunodeficitu. V roce 1983

Více

Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 I n v e s t i c e d o r o z v o j e v z d ě l á v á n í Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Kriminalistická identifikace Podstata:

Kriminalistická identifikace Podstata: Kriminalistická identifikace Podstata: Teorie kriminalistické identifikace je učením o obecných principech ztotožňování různých objektů podle jejich odrazů, a to za účelem získání trestně procesních a

Více

Zdravotní nauka 3. díl

Zdravotní nauka 3. díl Iva Nováková Zdravotní nauka 2. díl Učebnice pro obor sociální činnost Iva Nováková ISBN 978-80-247-3709-6 ISBN 978-80-247-3707-2 Grada Publishing, a.s., U Průhonu 22, 170 00 Praha 7 tel.: +420 234 264

Více

Toxikologická vyšetření - požadavky a možnosti. Válka I., Zedníková K. Ústav soudního lékařství FN Olomouc

Toxikologická vyšetření - požadavky a možnosti. Válka I., Zedníková K. Ústav soudního lékařství FN Olomouc Toxikologická vyšetření - požadavky a možnosti Válka I., Zedníková K. Ústav soudního lékařství FN Olomouc Toxikologická vyšetření Rezort MZ (klinická toxikologie) Rezort MV a MSp (forenzní toxikologie)

Více

PARLAMENT ČESKÉ REPUBLIKY Poslanecká sněmovna 2008 V. volební období. Vládní návrh. na vydání. zákona zákona o specifických zdravotních službách

PARLAMENT ČESKÉ REPUBLIKY Poslanecká sněmovna 2008 V. volební období. Vládní návrh. na vydání. zákona zákona o specifických zdravotních službách PARLAMENT ČESKÉ REPUBLIKY Poslanecká sněmovna 2008 V. volební období 689 Vládní návrh na vydání zákona zákona o specifických zdravotních službách - 2 - ZÁKON ze dne 2009 o specifických zdravotních službách

Více

Zákon o zdravotních službách Zákon o specifických zdravotních službách

Zákon o zdravotních službách Zákon o specifických zdravotních službách Zákon o zdravotních službách Zákon o specifických zdravotních službách 4.jarní konference prezidia ČAS Současná legislativa v českém zdravotnictví JUDr. Milada Džupinková, MBA Právní předpisy upravující

Více

SOUDNĚ-LÉKAŘSKÁ PROHLÍDKA MÍSTA NÁLEZU MRTVÉHO TĚLA

SOUDNĚ-LÉKAŘSKÁ PROHLÍDKA MÍSTA NÁLEZU MRTVÉHO TĚLA SOUDNĚ-LÉKAŘSKÁ PROHLÍDKA MÍSTA NÁLEZU MRTVÉHO TĚLA MUDr. L. Zátopková MUDr. P. Hejna, Ph.D., MBA Legislativa Vyhláška MZ ČSR č. 19/1988 Sb. O postupu při úmrtí a o pohřebnictví 1 Povinnost oznámit nález

Více

Daktyloskopie. identifikaci mrtvol neznámé totožnosti pokud ještě mají obrazce papilárních linií způsobilé k identifikaci,

Daktyloskopie. identifikaci mrtvol neznámé totožnosti pokud ještě mají obrazce papilárních linií způsobilé k identifikaci, Daktyloskopie Pojem : Daktyloskopie je vědný obor, který zkoumá obrazce papilárních linií na vnitřní straně posledních článků prstů rukou, na dlaních a prstech nohou a chodidlech z hlediska zákonitosti

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010

Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010 Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem Milan Bartoš Forum veterinarium, Brno 2010 Vývoj farmakogenetické diagnostické soupravy pro stanovení genetických polymorfismů

Více

IV. znalostní test zaměřený na kriminalistiku správné řešení

IV. znalostní test zaměřený na kriminalistiku správné řešení IV. znalostní test zaměřený na kriminalistiku správné řešení 1. Policisté ze služby kriminální policie a vyšetřování mají za úkol a) odhalovat skutečnosti nasvědčující tomu, že byl spáchán trestný čin,

Více

Vzdělávací materiál projektu Zlepšení podmínek výuky v ZŠ Sloup

Vzdělávací materiál projektu Zlepšení podmínek výuky v ZŠ Sloup Kód: Vzdělávací materiál projektu Zlepšení podmínek výuky v ZŠ Sloup Název vzdělávacího materiálu Pohlavně přenosné nemoci Anotace Pracovní list vede ke čtení s porozuměním, informuje žáka o druzích pohlavních

Více

Závěr č. 62 ze zasedání poradního sboru ministra vnitra ke správnímu řádu ze dne 26. 11. 2007. - Vymezení předmětu správního řízení

Závěr č. 62 ze zasedání poradního sboru ministra vnitra ke správnímu řádu ze dne 26. 11. 2007. - Vymezení předmětu správního řízení MINISTERSTVO VNITRA Poradní sbor ministra vnitra ke správnímu řádu Závěr č. 62 ze zasedání poradního sboru ministra vnitra ke správnímu řádu ze dne 26. 11. 2007 - Vymezení předmětu správního řízení I.

Více

Radiační patofyziologie. Zdroje záření. Typy ionizujícího záření: Jednotky pro měření radiace:

Radiační patofyziologie. Zdroje záření. Typy ionizujícího záření: Jednotky pro měření radiace: Radiační patofyziologie Radiační poškození vzniká účinkem ionizujícího záření. Co se týká jeho původu, ionizující záření vzniká: při radioaktivním rozpadu prvků, přichází z kosmického prostoru, je produkováno

Více

Klasifikace tělesných postižení podle doby vzniku

Klasifikace tělesných postižení podle doby vzniku VÝUKOVÝ MATERIÁL: VY_32_INOVACE_ DUM 1, S 20 JMÉNO AUTORA: DATUM VYTVOŘENÍ: 25.1. 2013 PRO ROČNÍK: OBORU: VZDĚLÁVACÍ OBLAST. TEMATICKÝ OKRUH: TÉMA: Bc. Blažena Nováková 2. ročník Předškolní a mimoškolní

Více

MUDr. Robin Šín. ZZS Plzeňského kraje Ústav sociálního lékařství LF UK v Plzni

MUDr. Robin Šín. ZZS Plzeňského kraje Ústav sociálního lékařství LF UK v Plzni Zásady povinné mlčenlivosti zdravotnických pracovníků III. konference portálu AKUTNĚ.CZ Brno, 19. 11. 2011 MUDr. Robin Šín ZZS Plzeňského kraje Ústav sociálního lékařství LF UK v Plzni Úvod - povinná mlčenlivost

Více

DUM VY_52_INOVACE_12CH33

DUM VY_52_INOVACE_12CH33 Základní škola Kaplice, Školní 226 DUM VY_52_INOVACE_12CH33 autor: Kristýna Anna Rolníková období vytvoření: říjen 2011 duben 2012 ročník, pro který je vytvořen: 9. vzdělávací oblast: vzdělávací obor:

Více

Poučení z japonského zemětřesení a tsunami v roce 2011

Poučení z japonského zemětřesení a tsunami v roce 2011 Poučení z japonského zemětřesení a tsunami v roce 2011 Abstrakt Dne 11. března 2011 zasáhlo východní pobřeží japonského ostrova Honšú zemětřesení následované mohutnou vlnou tsunami, která způsobila rozsáhlé

Více

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Níže uvedené komentáře by měly pomoci soutěžícím z kategorie B ke snazší orientaci

Více

Úvod do potravinářské legislativy Lekce 11: veterinární požadavky na výrobky a na hygienu potravin živočišného původu, dovozy a vývozy

Úvod do potravinářské legislativy Lekce 11: veterinární požadavky na výrobky a na hygienu potravin živočišného původu, dovozy a vývozy Úvod do potravinářské legislativy Lekce 11: veterinární požadavky na výrobky a na hygienu potravin živočišného původu, dovozy a vývozy Ústav analýzy potravin a výživy prof. ing. Vladimír Kocourek, CSc.

Více

Obsah. IMUNOLOGIE... 57 1 Imunitní systém... 57 Anatomický a fyziologický základ imunitní odezvy... 57

Obsah. IMUNOLOGIE... 57 1 Imunitní systém... 57 Anatomický a fyziologický základ imunitní odezvy... 57 Obsah Předmluva... 13 Nejdůležitější pojmy používané v textu publikace... 14 MIKROBIOLOGIE... 23 Mikroorganismy a lidský organismus... 24 Třídy patogenních mikroorganismů... 25 A. Viry... 25 B. Bakterie...

Více

Diagnostika infarktu myokardu pomocí pravidlových systémů

Diagnostika infarktu myokardu pomocí pravidlových systémů pomocí pravidlových systémů Bakalářská práce 2009 pomocí pravidlových systémů Přehled prezentace Motivace a cíle Infarkt myokardu, EKG Pravidlové systémy Výsledky Motivace Infarkt myokardu Detekce infarktu

Více

Název školy: Gymnázium Jana Nerudy, škola hl. města Prahy

Název školy: Gymnázium Jana Nerudy, škola hl. města Prahy Název: Dermatoglyfy Výukové materiály Autor: Mgr. Blanka Machová Název školy: Gymnázium Jana Nerudy, škola hl. města Prahy Předmět, mezipředmětové vztahy: Biologie Ročník: 4. a 5. (2. a 3. vyššího gymnázia)

Více

Číslo a název projektu Číslo a název šablony

Číslo a název projektu Číslo a název šablony Číslo a název projektu Číslo a název šablony DUM číslo a název CZ.1.07/1.5.00/34.0378 Zefektivnění výuky prostřednictvím ICT technologií III/2 - Inovace a zkvalitnění výuky prostřednictvím ICT SSOS_ZE_1.05

Více

Úplný přehled zkušebních okruhů

Úplný přehled zkušebních okruhů Úplný přehled zkušebních okruhů Zkušební okruhy teoretických znalostí pro zkoušku z odborné způsobilosti k zajišťování úkolů v prevenci rizik dle přílohy č. 1 k nařízení vlády č. 592/2006 Sb.: a) znalost

Více

ÚSTAV SOUDNÍHO LÉKAŘSTVÍ. LF UK a FN HK

ÚSTAV SOUDNÍHO LÉKAŘSTVÍ. LF UK a FN HK LABORATORNÍ PŘÍRUČKA ÚSTAV SOUDNÍHO LÉKAŘSTVÍ LF UK a FN HK Vypracoval H. Jindrová Jméno a příjmení, funkce Přezkoumal MUDr. M. Šafr Schválil MUDr. P. Hejna, Ph.D., MBA Platnost od: 1.6.2013 Podpis Datum

Více

PROBLEMATIKA ZAJIŠŤOVÁNÍ FYZICKÉ BEZPEČNOSTI NEMOCNIC, SOUČÁST PREVENCE KRIMINALITY VE MĚSTĚ A KRAJI

PROBLEMATIKA ZAJIŠŤOVÁNÍ FYZICKÉ BEZPEČNOSTI NEMOCNIC, SOUČÁST PREVENCE KRIMINALITY VE MĚSTĚ A KRAJI Upravené pojetí příspěvku vzhledem k rozsahu a závažnosti problematiky Ing. Petr Hartmann PROBLEMATIKA ZAJIŠŤOVÁNÍ FYZICKÉ BEZPEČNOSTI NEMOCNIC, SOUČÁST PREVENCE KRIMINALITY VE MĚSTĚ A KRAJI Jestliže si

Více

Vyšší odborná škola a Střední škola Varnsdorf, příspěvková organizace. Šablona 16 VY 32 INOVACE 0114 0316

Vyšší odborná škola a Střední škola Varnsdorf, příspěvková organizace. Šablona 16 VY 32 INOVACE 0114 0316 Vyšší odborná škola a Střední škola Varnsdorf, příspěvková organizace Šablona 16 VY 32 INOVACE 0114 0316 VÝUKOVÝ MATERIÁL Identifikační údaje školy Vyšší odborná škola a Střední škola, Varnsdorf, příspěvková

Více

VÁŽENÝ RESPONDENTE, PROSÍME VÁS O LASKAVÉ VYPLNĚNÍ DOTAZNÍKU, KTERÝ BUDE SLOUŽIT KE STUDIU VLIVU RIZIKOVÝCH FAKTORŮ NA VZNIK KARCINOMU VARLAT

VÁŽENÝ RESPONDENTE, PROSÍME VÁS O LASKAVÉ VYPLNĚNÍ DOTAZNÍKU, KTERÝ BUDE SLOUŽIT KE STUDIU VLIVU RIZIKOVÝCH FAKTORŮ NA VZNIK KARCINOMU VARLAT VÁŽENÝ RESPONDENTE, PROSÍME VÁS O LASKAVÉ VYPLNĚNÍ DOTAZNÍKU, KTERÝ BUDE SLOUŽIT KE STUDIU VLIVU RIZIKOVÝCH FAKTORŮ NA VZNIK KARCINOMU VARLAT. POKUD NA NĚKTEROU OTÁZKU BUDE ZNÁT ODPOVĚĎ, PROSÍM ODPOVÍDEJTE.

Více

Policejní prezidium ČR Ředitelství služby dopravní policie 16.6.2015

Policejní prezidium ČR Ředitelství služby dopravní policie 16.6.2015 Policejní prezidium ČR Ředitelství služby dopravní policie Fotografická dokumentace místa dopravní nehody pplk. Mgr. Lukáš Pavlík Fotografická dokumentace Fotografická dokumentace je nedílnou součástí

Více

VITAMIN D Z POHLEDU FUNKCE A VÝŽIVY

VITAMIN D Z POHLEDU FUNKCE A VÝŽIVY VITAMIN D Z POHLEDU FUNKCE A VÝŽIVY Mgr. Jitka Pokorná, Prof. MVDr. Jiří Ruprich, CSc. Státní zdravotní ústav, Centrum zdraví, výživy a potravin Palackého 3a, 612 42 Brno www.szu.cz, e-mail: pokorna@chpr.szu.cz

Více

Bezpečnostní informace pro zákazníka solária :

Bezpečnostní informace pro zákazníka solária : Provozní řád - solárium Provozovna : Bodypoint, Mirotická 929/12, Praha 4 Provozovatel: Jana Hejtmánková, Mirotická 17,Praha 4 IČO : 169 12 748 Tel.: 602 249 285 Instalovaný typ solárií: LUXURA V 5 ZÁSADY

Více

KOMENTÁŘ KE STATISTICKÉMU VYHODNOCENÍ ČINNOSTI PROBAČNÍ A MEDIAČNÍ SLUŽBY ZA ROK 2014. Základní definice

KOMENTÁŘ KE STATISTICKÉMU VYHODNOCENÍ ČINNOSTI PROBAČNÍ A MEDIAČNÍ SLUŽBY ZA ROK 2014. Základní definice č. j.: Spr 00562/2015-022 KOMENTÁŘ KE STATISTICKÉMU VYHODNOCENÍ ČINNOSTI PROBAČNÍ A MEDIAČNÍ SLUŽBY ZA ROK 2014 Základní definice Základní statistickou jednotkou v případě tohoto statistického vyhodnocení

Více

Předmět:: Přírodopis. anatomie a morfologie typických zástupců skupin živočichů funkce orgánů. vybraní zástupci různých skupin živočichů

Předmět:: Přírodopis. anatomie a morfologie typických zástupců skupin živočichů funkce orgánů. vybraní zástupci různých skupin živočichů 19 zhodnotí i pro 19 zhodnotí i pro funkce funkce ZÁŘÍ ŘÍJEN 19 zhodnotí i pro Obecná biologie a genetika 3 rozpozná, porovná a objasní funkci základních (orgánových soustav) rostlin i živočichů 20 určí

Více

MUDr. Stanislav Trèa, CSc. PLÁNOVANÉ RODIÈOVSTVÍ Nejlepší cesta k narození zdravého dítìte

MUDr. Stanislav Trèa, CSc. PLÁNOVANÉ RODIÈOVSTVÍ Nejlepší cesta k narození zdravého dítìte MUDr. Stanislav Trèa, CSc. PLÁNOVANÉ RODIÈOVSTVÍ Nejlepší cesta k narození zdravého dítìte Vydala Grada Publishing, a.s. U Prùhonu 22, 170 00 Praha 7 tel.: +420 220 386 401, fax: +420 220 386 400 www.grada.cz

Více

Příklad a posudek konkrétního telefonního podvodu

Příklad a posudek konkrétního telefonního podvodu Příklad a posudek konkrétního telefonního podvodu místo a čas trestného činu: Slovensko, podzim 2010 Ing. Ivo F i š e r, ředitel společnosti xphonet CZ s.r.o., www.xphonet.com ivo.fiser@xphonet.cz, +420

Více

- Novela zákona č. 20/1966 Sb. o péči o zdraví lidu provedená zákonem č. 260/2001 Sb.

- Novela zákona č. 20/1966 Sb. o péči o zdraví lidu provedená zákonem č. 260/2001 Sb. Název přednášeného tématu: Právní aspekty zdravotnické dokumentace: Souhrn: Novela zákona č. 20/1966 Sb. o péči o zdraví lidu provedená zákonem č. 260/2001 Sb. legislativně upravuje charakter zdravotnické

Více

VÝZNAM NĚKTERÝCH FAKTORŮ PREANALYTICKÉ FÁZE V MOLEKULÁRNÍ BIOLOGII

VÝZNAM NĚKTERÝCH FAKTORŮ PREANALYTICKÉ FÁZE V MOLEKULÁRNÍ BIOLOGII VÝZNAM NĚKTERÝCH FAKTORŮ PREANALYTICKÉ FÁZE V MOLEKULÁRNÍ BIOLOGII Plíšková L., Hrochová K., Kutová R. Ústav klinické biochemie a diagnostiky FN Hradec Králové PREANALYTICKÁ FÁZE V MOLEKULÁRNÍ BIOLOGII

Více

,, Cesta ke zdraví mužů

,, Cesta ke zdraví mužů PREZENTACE VÝSLEDKŮ ŘEŠENÍ PILOTNÍHO PROJEKTU PREVENTIVNÍ PÉČE PRO MUŢE,, Cesta ke zdraví mužů prim. MUDr. Monika Koudová GHC GENETICS, s.r.o.- NZZ, Praha Projekt byl realizován ve dvou etapách: I. etapa

Více

III. N á v r h ZÁKON

III. N á v r h ZÁKON III. N á v r h ZÁKON ze dne... 2015, kterým se mění zákon č. 154/2000 Sb., o šlechtění, plemenitbě a evidenci hospodářských zvířat a o změně některých souvisejících zákonů (plemenářský zákon), ve znění

Více

Odběry biologického materiálu. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Odběry biologického materiálu. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Odběry biologického materiálu Markéta Vojtová VOŠZ a SZŠ Hradec Králové Vyšetření biologického materiálu 1 Určení správné diagnozy a následné terapie Informace, které doplňují anamnestické údaje, fyzikální

Více

Smysl peer péče v organizaci - ZZS KHK. Mgr. Iveta Nováková Knížková

Smysl peer péče v organizaci - ZZS KHK. Mgr. Iveta Nováková Knížková Smysl peer péče v organizaci - ZZS KHK Mgr. Iveta Nováková Knížková SPIS v KHK Podpora všech zdravotníků,kteří prožívají profesně náročné a někdy i nadlimitně zátěžové situace. Zavedení - březen 2012 V

Více

VY_32_INOVACE_003. VÝUKOVÝ MATERIÁL zpracovaný v rámci projektu EU peníze školám

VY_32_INOVACE_003. VÝUKOVÝ MATERIÁL zpracovaný v rámci projektu EU peníze školám VY_32_INOVACE_003 VÝUKOVÝ MATERIÁL zpracovaný v rámci projektu EU peníze školám Registrační číslo projektu: CZ. 1.07. /1. 5. 00 / 34. 0696 Šablona: III/2 Název: Základní znaky života Vyučovací předmět:

Více

Hraniční výrobky v oblasti zdravotnických prostředků. Mgr. Karolína Peštová odbor farmacie oddělení zdravotnických prostředků 23.

Hraniční výrobky v oblasti zdravotnických prostředků. Mgr. Karolína Peštová odbor farmacie oddělení zdravotnických prostředků 23. Hraniční výrobky v oblasti zdravotnických prostředků Mgr. Karolína Peštová odbor farmacie oddělení zdravotnických prostředků 23. dubna 2014 Osnova prezentace co je hraniční výrobek kdo je oprávněný ke

Více

Bakteriologická analýza potravin

Bakteriologická analýza potravin Bakteriologická analýza potravin a. Souhrn Ve studii zaměřené na bakteriologickou analýzu potravin jsme sledovali výskyt vybraných patogenních agens v potravinách z tržní sítě. Výběr vyšetřovaných komodit

Více

Název: Viry. Autor: PaedDr. Pavel Svoboda. Název školy: Gymnázium Jana Nerudy, škola hl. města Prahy. Předmět, mezipředmětové vztahy: biologie

Název: Viry. Autor: PaedDr. Pavel Svoboda. Název školy: Gymnázium Jana Nerudy, škola hl. města Prahy. Předmět, mezipředmětové vztahy: biologie Název: Viry Výukové materiály Autor: PaedDr. Pavel Svoboda Název školy: Gymnázium Jana Nerudy, škola hl. města Prahy Předmět, mezipředmětové vztahy: biologie Ročník: 2. (1. vyššího gymnázia) Tematický

Více

VY_32_INOVACE_11.16 1/5 3.2.11.16 Nitroděložní vývin člověka

VY_32_INOVACE_11.16 1/5 3.2.11.16 Nitroděložní vývin člověka 1/5 3.2.11.16 Cíl popsat oplození - znát funkci spermie a vajíčka - chápat vývin plodu - porovnat rozdíl vývinu plodu u ptáků, králíka a člověka - uvést etapy, délku a průběh v matčině těle - charakterizovat

Více

CUKROVKA /diabetes mellitus/

CUKROVKA /diabetes mellitus/ CUKROVKA /diabetes mellitus/ CUKROVKA /diabetes mellitus/ Řadíme ji mezi neinfekční chronická onemocnění Na jejím vzniku se podílí nezdravý způsob života Významnou úlohu sehrává dědičnost Významným rizikovým

Více