Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc.

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc."


1 Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské praxi doc. RNDr. Ivan Mazura, CSc.

2 Historie forenzní genetiky

3 Alec Jeffreys a satelitní DNA 1980 Ray White popisuje první polymorfní RFLP marker 1985 Alec Jeffreys objevuje první VNTR multilokusové polymorfismy 1985 PCR reakce popsána 1988 FBI poprvé používá DNA analýzu pro případ s kriminálním podtextem 1990 první zmínka o short tandem repeats polymorfismech v odborné literatuře 1996 zpráva FBI pro kongres USA hovoří o přínosu DNA analýzy, jak pro potvrzení pachatele, tak pro včasné vyloučení osob z podezření

4 Forenzní případy sledované zahraničními médii Alec Jeffreys řeší případy identifikace emigrantů a krátce poté i případ dvojnásobné vraždy pomocí VNTR polymorfismů 1988 opakovaná znásilnění mladých žen potvrzena genetickou analýzou v případu Tommy Lee Andrews vs. Stát Florida dvojnásobná vražda mladé ženy a mladého muže s vyšetřováním podezřelé osoby, hráče amerického fotbalu a neúspěšného herce O.J.Simpsona

5 Současná laboratorní praxe forenzní genetiky 3 etapy identifikace vzorku

6 Biologie

7 Izolovaná kvalitní DNA jako nutná podmínka úspěšné forezní analýzy

8 Lidský genom a jeho variabilita Sekvenční polymorfismy používány méně často, ale také v ojedinělých případech mohou pomoci Délkové polymorfismy používány v každodenní rutinní praxi jako nástroj identifikační genetiky

9 Satelitní Minisatelitní - Mikrosatelitní DNA Satelitní DNA dnes již nepoužívána (repet.motiv do 1000 bp) Minisatelitní DNA dnes používána jako doplněk mikrosatelitních polymorfismů (repet.motiv do 100 bp) Mikrosatelitní DNA dnes používána jako běžný identifikační zdroj (repet.motiv do 10 bp)

10 Co jsou STR- /Short Tandem Repeats/ polymorfismy? STR sekvence-mikrosatelity Nejčastější opakování 2-6 nukleotidů Známo přes tetranukleotidových sekvencí STR Známo více než 1 milion všech STR polymorfismů STR polymorfismy zaujímají cca 3% celého lidského genomu

11 Určování pohlaví Gen pro Amelogenin Identifikační systém založený na 6 bp deleci v tomto genu lokalizovaném na chr. X Žena: XX 1 signál Muž:XY- 2 signály stejné velikosti Směs vzorků: 2 nestejnoměrné signály

12 Polymorfismy v mitochondriální DNA studium možností podrobněho využití některých oblastí mtdna pro forenzní účely a tvorbu haploskupin v populacích Výhoda analýz těchto molekul je jejich rozměr a kruhová struktura

13 Technologie

14 Schéma principu identifikace pomocí 3 polymorfních lokusů Schéma principu multi-plex PCR o 3 genetických lokusech Příprava systému 3 různě dlouhých amplifikátů s různými fluorescenčními značkami Detekce délkových polymorfismů pomocí kapilární elektroforézy

15 Schéma komerční soupravy pro forenzní identifikace

16 Příklad genetického STR - profilu jediného vzorku

17 CODIS systém Nutnost srovnávání stejných lokusů v různých zemích světa shoda na 13 základních STR markerech Nejprve 50 států USA a později i další země Evropy, Asie a Austrálie Počátek tvorby národních databází

18 Schéma rozložení chromozomálních pozic STR-polymorfismů Nezávislé genetické polymorfismy Pouze chromosom 5 má 2 polymorfní místa s vysokou informativitou Konkrétní geny např. Tyrosin hydroxyláza, von Willebrand antigen, či thyroid peroxidáza a další Amelogenin určující pohlaví jedince či vzorku

19 Příklady popisu dalších polymorfních míst

20 Inhibitory amplifikace Většinou jsou ztraceny některé alely či kompletní profil jedince Vazba inhibitorů do cílových primerových sekvencí Možnost odstranit ředěním či přidáním většího množství polymerázy, která se váže do inhibitorů a tím je inaktivuje

21 Genetika

22 Nutnost znalosti alelických frekvencí v dané populaci

23 Pokrevní příbuznost, její varianty - kosanguinita

24 Příklady směsných vzorků Klasické profily, které je možné vidět ve směsných vzorcích běžných případů forenzní genetiky Charakteristická je imbalance ve velikosti vrcholů X a Y alel v AME genu Stejně jako 3 či 4 vrcholy alel dalších autosomálních markerů

25 Single nucleotide polymorphisms SNP v budoucnosti významným nástrojem identifikace osob a vzorků Velkou výhodou pro degradované tkáně, kterých je ve forenzní genetice velké procento Možnost analýzy SNP na fenotypové znaky(např. rudá barva vlasů, modré oči atd.).

26 Identifikace ve forenzní mikrobiologii Teroristické útoky biologickými zbraněmi: Yersinia pestis (mor) testování několik set let starých kosterních fragmentů Mycobacterium tbc (tuberkulóza) Bacillus anthracis (anthrax) Salmonella typhimurium (těžké průjmové stavy)

27 Příklady využití identifikace lidské DNA v každodenní praxi Možnosti porovnání DNA profilů podezřelých osob s profily v databázích Testování otcovství a mateřství Analýza historické DNA Identifikace pohřešovaných osob Identifikace osob při hromadných neštěstích Identifikace osob v průběhu vojenských operací

28 Forenzní genetika v roce 2013 Genetickými identifikacemi se zabývá mnoho státních laboratoří V některých zemích jsou využívány rovněž laboratoře privátní Analyzovány jsou ročně desítky tisíc vzorků DNA Řada zemí Evropy a Asie má své vlastní forenzně genetické programy Objevují se další např. wild-life forenzně genetické laboratoře

Testování lidské identity

Testování lidské identity Testování lidské identity Brno, 2009 J.M.Butler Forensic DNA Typing workshop, 2006 Bryan Sykes Sedm dcer Eviných, 2005 Využití testování lidské identity Řešení trestních činů shoda mezi podezřelým a stopou


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí,

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí, Využití molekulárních markerů v systematice a populační biologii rostlin 12. Shrnutí, Přehled molekulárních markerů 1. proteiny isozymy 2. DNA markery RFLP (Restriction Fragment Length Polymorphism) založené


6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního


Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika


Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right


Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,



MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Určování a ověřování paternity u koní. Bakalářská práce Brno 2006 Vedoucí bakalářské


Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,


Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní



16.10.2011 KRIMINALISTICKÁ GENETIKA V ČESKÉ REPUBLICE. Praxe a legislativa KRIMINALISTICKÁ GENETIKA V ČESKÉ REPUBLICE Praxe a legislativa Genetické zkoumání v PČR Kriminalistická genetická analýza standardní kriminalistická znalecká metoda PČR zkoumá lidský biologický materiál



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série



DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit


polymorfní = vícetvarý, mnohotvárný

polymorfní = vícetvarý, mnohotvárný Genetický polymorfismus s Řeckyy morphos = tvar polymorfní = vícetvarý, mnohotvárný Genetický polymorfismus je tedy označení pro výskyt téhož znaku ve více tvarech, formách, přičemž tato mnohotvárnost


Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění



PRAKTIKUM Z OBECNÉ GENETIKY RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin


Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu Genetický olymorfizmus ois struktury oulací Tok GI v buňce Dr. Ing. Urban Tomáš ÚSTAV GEETIKY MZLU Brno htt:// Seminář doktorského grantu 53/03/H076 : Molekulárn


Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae).

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). Populační studie Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). American Journal of Botany 87(8): 1128


2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou


Genetické markery - princip a využití

Genetické markery - princip a využití Genetika a šlechtění lesních dřevin Genetické markery - princip a využití Doc. Ing. RNDr. Eva Palátová, PhD. Ing. R. Longauer, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010

Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010 Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem Milan Bartoš Forum veterinarium, Brno 2010 Vývoj farmakogenetické diagnostické soupravy pro stanovení genetických polymorfismů


Genotypování markerů užitkovosti a zdraví u skotu

Genotypování markerů užitkovosti a zdraví u skotu Mezinárodní odborný seminář Využití chovatelských dat onemocnění skotu pro management stád, šlechtění a pro racionální užívání antimikrobik. Genotypování markerů užitkovosti a zdraví u skotu Jitka Kyseľová


Vyhledávání a charakteristika genů zodpovědných za modré zabarvení obilky pšenice seté (Triticum aestivum L.)

Vyhledávání a charakteristika genů zodpovědných za modré zabarvení obilky pšenice seté (Triticum aestivum L.) Předběžná oponentura disertační práce Vyhledávání a charakteristika genů zodpovědných za modré zabarvení obilky pšenice seté (Triticum aestivum L.) Školitel: Prof. RNDr. Ladislav Havel, CSc. Doktorandka:


Právní a kriminalistické aspekty identifikačních analýz DNA

Právní a kriminalistické aspekty identifikačních analýz DNA Univerzita Karlova v Praze Právnická fakulta Jiří Kožina Právní a kriminalistické aspekty identifikačních analýz DNA Rigorózní práce Konzultant: prof. JUDr. Jan Musil, CSc. Trestní právo hmotné a procesní


Zahrnutí alelického dropoutu

Zahrnutí alelického dropoutu Sémantická interoperabilita v biomedicíně a zdravotnictví Mgr. Dalibor Slovák Oddělení medicínské informatiky a biostatistiky, ÚI AV ČR školitelka: Prof. RNDr. Jana Zvárová, DrSc. Ústav hygieny a epidemiologie,



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


PhD. České Budějovice

PhD. České Budějovice PhD. České Budějovice Sledování a využívání poznatků o genetické biodiverzitě mezi populacemi hospodářských zvířat Dvořák Josef prof. Genetiky živočichů Ústavu genetiky MZLU v Brně Pro seminář doktorského


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o.

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o. Genetické markery ve šlechtění skotu pro masnou produkci Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Genetické markery Polymorfní místa v DNA, které vykazují asociaci na sledované znaky Příčinné


Genetické mapování. v přírodních populacích i v laboratoři

Genetické mapování. v přírodních populacích i v laboratoři Genetické mapování v přírodních populacích i v laboratoři Funkční genetika Cílem je propojit konkrétní mutace/geny s fenotypem Vzniklý v laboratoři pomocí mutageneze či vyskytující se v přírodě. Forward


14. přednáška z BIOLOGIE pro Bakaláře studující fyzioterapii, optometrii a pro nutriční terapeuty M.Gabriel, BÚ LF MU

14. přednáška z BIOLOGIE pro Bakaláře studující fyzioterapii, optometrii a pro nutriční terapeuty M.Gabriel, BÚ LF MU 14. přednáška z BIOLOGIE pro Bakaláře studující fyzioterapii, optometrii a pro nutriční terapeuty Genová diagnostika. 4. 1. 2012 M.Gabriel, BÚ LF MU Pojem alela. Geny existují v různých formách a mohou


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)


Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů

Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů Registrační číslo: CZ.1.07/1.1.00/14.0016 Proces forenzní identifikace pomocí


Genetická kartografie

Genetická kartografie Genetická kartografie Vazba U klasického dihybridismu podle Johanna Gregora Mendela segregují různé alely dvou genů nezávisle. Rekapitulace dihybridismu je na obrázku 8.1. Toto schéma platí jen pro lokusy


Populační genetika II

Populační genetika II Populační genetika II 4. Mechanismy měnící frekvence alel v populaci Genetický draft (genetické svezení se) Genetický draft = zvýšení frekvence alely díky genetické vazbě s výhodnou mutací. Selekční vymetení


DVOJČATA. Jednovaječná či dvojvaječná?

DVOJČATA. Jednovaječná či dvojvaječná? DVOJČATA Jednovaječná či dvojvaječná? 18 Jednovaječná či dvojvaječná? Proč a jak to zjišťujeme A jsou jednovaječná? To je jedna z nejčastějších otázek, se kterou se maminka dvojčat setká. Bohužel ne každý



ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů



TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy



EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence



MOLEKULÁRNÍ TAXONOMIE - 4 MOLEKULÁRNÍ TAXONOMIE - 4 V této přednášce si představíme metody, které získávají molekulární znaky bez použití sekvenace. Všechny tyto metody je teoreticky možné sekvenací nahradit. Oproti sekvenaci celých


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Analýza transkriptomu Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s moderními metodami komplexní


Verze: 2011-2012 Platí od: 14.10.2011 Vypracoval: Ing. Aleš Hořínek, Mgr. Anastassiya Zidkova doc. Mgr. Jiří Drábek, PhD.

Verze: 2011-2012 Platí od: 14.10.2011 Vypracoval: Ing. Aleš Hořínek, Mgr. Anastassiya Zidkova doc. Mgr. Jiří Drábek, PhD. Systém mezilaboratorního porovnávání forenzně genetických zkoušek (MPZ) pro aktivitu 5 projektu CZ.1.07/2.3.00/09.0080 4N6gen, Část paternity a příbuznost Verze: 2011-2012 Platí od: 14.10.2011 Vypracoval:


Genová vazba. Obr. č. 1: Thomas Hunt Morgan

Genová vazba. Obr. č. 1: Thomas Hunt Morgan Genová vazba Jednou ze základních podmínek platnosti Mendelových zákonů je lokalizace genů, které podmiňují různé vlastnosti na různých chromozómech. Toto pravidlo umožňuje volnou kombinovatelnost genů


Chromozomální aberace nalezené u párů s poruchou reprodukce v letech

Chromozomální aberace nalezené u párů s poruchou reprodukce v letech Chromozomální aberace nalezené u párů s poruchou reprodukce v letech 2000-2005 Jak přistupovat k nálezům minoritních gonozomálních mozaik? Šantavá A., Adamová, K.,Čapková P., Hyjánek J. Ústav lékařské


Využití DNA sekvencování v

Využití DNA sekvencování v Využití DNA sekvencování v taxonomii prokaryot Mgr. Pavla Holochová, doc. RNDr. Ivo Sedláček, CSc. Česká sbírka mikroorganismů Ústav experimentální biologie Přírodovědecká fakulta Masarykova univerzita,


Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


Změny sazebníku výkonů pro mikrobiologické obory

Změny sazebníku výkonů pro mikrobiologické obory Změny sazebníku výkonů pro mikrobiologické obory Ing. Hana Hrbáčková LTK CEM SZÚ 2011 - Původní návrh MZ Grant Evropského fondu pro regionální rozvoj Vítěznou nabídku na řešení Kultivace Seznamu zdravotních


Současnost a budoucnost identifikace člověka pomocí DNA

Současnost a budoucnost identifikace člověka pomocí DNA Současnost a budoucnost identifikace člověka pomocí DNA RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie Současnost


Aplikace molekulárně biologických postupů v časné detekci sepse

Aplikace molekulárně biologických postupů v časné detekci sepse Aplikace molekulárně biologických postupů v časné detekci sepse Mgr. Jana Ždychová, Ph.D. IKEM PLM - LLG Sepse je častou příčinou úmrtí během hospitalizace. Včasné nasazení odpovídající ATB terapie je


Pokročilé biofyzikální metody v experimentální biologii

Pokročilé biofyzikální metody v experimentální biologii Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 1/1 Proč biofyzikální metody? Biofyzikální metody využívají fyzikální principy ke studiu biologických systémů Poskytují kvantitativní


3) Analýza mtdna mitochondriální Eva, kdy a kde žila. 8) Haploskupiny mtdna a chromozomu Y v ČR

3) Analýza mtdna mitochondriální Eva, kdy a kde žila. 8) Haploskupiny mtdna a chromozomu Y v ČR Hledání našeho společného předkap 1) Jak to, že máme společného předka 2) Metodika výzkumu mtdna 3) Analýza mtdna mitochondriální Eva, kdy a kde žila 4) Problémy a názory proti 5) Analýza chromozomu Y


Pohled na DNA profilování v kriminalistice

Pohled na DNA profilování v kriminalistice Pohled na DNA profilování v kriminalistice doc. Mgr. Jiří Drábek, PhD. Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky 1 CV 1993 1999: konzultant pro určení


Studium genetické predispozice ke vzniku karcinomu prsu

Studium genetické predispozice ke vzniku karcinomu prsu Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání





Polymorfizmy detekované. polymorfizmů (Single Nucleotide

Polymorfizmy detekované. polymorfizmů (Single Nucleotide Polymorfizmy detekované speciálními metodami s vysokou rozlišovací schopností Stanovení jednonukleotidových polymorfizmů (Single Nucleotide Polymorphisms - SNPs) Příklad jednonukleotidových polymorfizmů


Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi


Ondřej Scheinost Nemocnice České Budějovice, a.s.

Ondřej Scheinost Nemocnice České Budějovice, a.s. Ondřej Scheinost Nemocnice České Budějovice, a.s. Nové technologie přelomové období principy technologií klinická použitelnost chips (arrays) sekvenační technologie Důležitost genetických informací i další





Hardy-Weinbergův princip

Hardy-Weinbergův princip 1) Modelová populace 2) Hardy-Weinbergův princip 3) Hardy-Weinbergův princip využití Testování HW poměru Stanovení četnosti heterozygotů při úplné dominanci Interpretace DNA profilů 4) Snyderovy podíly


V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)


Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné


Univerzita Pardubice. Fakulta chemicko-technologická. Využití NGS pro identifikaci jedinců- nástupce STR. Kostelníková Eva

Univerzita Pardubice. Fakulta chemicko-technologická. Využití NGS pro identifikaci jedinců- nástupce STR. Kostelníková Eva Univerzita Pardubice Fakulta chemicko-technologická Využití NGS pro identifikaci jedinců- nástupce STR Kostelníková Eva Bakalářská práce 2017 Prohlášení Prohlašuji, že jsem bakalářskou práci na téma: využití


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární


ANOTACE vytvořených/inovovaných materiálů

ANOTACE vytvořených/inovovaných materiálů ANOTACE vytvořených/inovovaných materiálů Číslo projektu Číslo a název šablony klíčové aktivity Tematická oblast Formát Druh učebního materiálu Druh interaktivity CZ.1.07/1.5.00/34.0722 III/2 Inovace a


Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka


Vytvořen. ení genetické databanky vybraných druhů savců ČR ití pro udržitelný rozvoj dopravy. Tomáš. Libosvár

Vytvořen. ení genetické databanky vybraných druhů savců ČR ití pro udržitelný rozvoj dopravy. Tomáš. Libosvár Vytvořen ení genetické databanky vybraných druhů savců ČR k využit ití pro udržitelný rozvoj dopravy Tomáš Libosvár TA02031259 Vytvořen ení genetické databanky vybraných druhů savců ČR k využit ití pro


Cíl lekce. Osnova přednášky. DNA analýza. Profilování DNA. Po této lekci byste měli: doc. Mgr. Jiří Drábek, PhD.

Cíl lekce. Osnova přednášky. DNA analýza. Profilování DNA. Po této lekci byste měli: doc. Mgr. Jiří Drábek, PhD. Profilování DNA doc. Mgr. Jiří Drábek, PhD. Laboratoř experimentální medicíny, Ústav molekulární a translační medicíny, LF UP a Fakultní nemocnice Olomouc Cíl lekce Po této lekci byste měli: znát vlastnosti



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.


Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková Diagnostika retrovirů Lentiviry - HIV Vladislava Růžičková VI. Třída RNA-viry se zpětnou transkriptázou RT Čeleď: Retroviridae (hostitelé: Obratlovci) Rody: Alpharetrovirus Betaretrovirus Gammaretrovirus


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA Cytogenetika telomera chromosom jádro centomera telomera buňka histony páry bazí dvoušroubovice DNA Typy chromosomů Karyotyp člověka 46 chromosomů 22 párů autosomů (1-22 od největšího po nejmenší) 1 pár


Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Biotechnologický kurz Biotechnologický kurz II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně Zemědělská





Cíl lekce. Historie. Osnova přednášky. DNA analýza. Lidský genom. Profilování DNA. Po této lekci byste měli: doc. Mgr. Jiří Drábek, PhD.

Cíl lekce. Historie. Osnova přednášky. DNA analýza. Lidský genom. Profilování DNA. Po této lekci byste měli: doc. Mgr. Jiří Drábek, PhD. Profilování DNA doc. Mgr. Jiří Drábek, PhD. Laboratoř experimentální medicíny, Ústav molekulární a translační medicíny, LF UP a Fakultní nemocnice Olomouc Cíl lekce Po této lekci byste měli: znát vlastnosti


Genetický screening predispozice k celiakii

Genetický screening predispozice k celiakii VETERINÁRN RNÍ A FARMACEUTICKÁ UNIVERZITA BRNO Farmaceutická fakulta Ústav humánn nní farmakologie a toxikologie Genetický screening predispozice k celiakii RNDr. Ladislava Bartošov ová,ph.d. 1, PharmDr.


Biotechnologický kurz. III. letní škola metod molekulární biologie nukleových kyselin a genomiky

Biotechnologický kurz. III. letní škola metod molekulární biologie nukleových kyselin a genomiky Biotechnologický kurz Biotechnologický kurz III. letní škola metod molekulární biologie nukleových kyselin a genomiky 18. - 22. 6. 2012 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně


MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční



PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ 10 SEZNAM PŘÍLOH PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ PŘÍLOHA č. 2 MAPY Mapa 1 Lokalizace zájmového území (zdroj: Mapa 2 Místa odlovených nebo uhynulých kusů (zdroj:



JIHOČESKÁ UNIVERZITA V ČESKÝCH BUDĚJOVICÍCH ZEMĚDĚLSKÁ FAKULTA JIHOČESKÁ UNIVERZITA V ČESKÝCH BUDĚJOVICÍCH ZEMĚDĚLSKÁ FAKULTA Studijní program: Studijní obor: Zadávající katedra: Vedoucí katedry: B4131 Zemědělství Agroekologie Katedra zootechnických a veterinárních


HLA B27: molekulární marker Ankylozující spondylitidy. Peter Novota. 16.2.2016, Praha

HLA B27: molekulární marker Ankylozující spondylitidy. Peter Novota. 16.2.2016, Praha HLA B27: molekulární marker Ankylozující spondylitidy Peter Novota 16.2.2016, Praha HLA B součást MHC komplexu HLA I. třídy (chromosom 6) úsek značně polymorfní antigeny se vyskytují na povrchu buněk podílí


Mikročipy v mikrobiologii

Mikročipy v mikrobiologii Mikročipy v mikrobiologii doc. RNDr. Milan Bartoš, Ph.D. Přírodovědecká fakulta MU, 2014 Obsah přednášky 1) Charakteristika biočipů, DNA microarrays a DNA chip 2) Výroba čipů, charakteristika


Univerzita Karlova v Praze Přírodovědecká fakulta

Univerzita Karlova v Praze Přírodovědecká fakulta Univerzita Karlova v Praze Přírodovědecká fakulta Studijní program: Biologie MARIE ŘADOVÁ Stanovení sekvenčních variací mtdna v české populaci pro využití ve forenzní genetice Determination of mtdna sequence


Mezinárodní kongres Ohrožení biologickými a chemickými látkami

Mezinárodní kongres Ohrožení biologickými a chemickými látkami Mezinárodní kongres Ohrožení biologickými a chemickými látkami Berlin, 17. 18.5.2003, pořadatel: Deutsche Gesellschaft f. Katastrophenmedizin e.v. Ing. Vlasta Neklapilová, Informační středisko pro medicínu


Aplikovaná bioinformatika

Aplikovaná bioinformatika Aplikovaná bioinformatika Číslo aktivity: 2.V Název klíčové aktivity: Na realizaci se podílí: Implementace nových předmětů do daného studijního programu doc. RNDr. Michaela Wimmerová, Ph.D., Mgr. Josef


Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci


Algoritmus vyšetření HLA při vyhledávání dárce HSCT

Algoritmus vyšetření HLA při vyhledávání dárce HSCT Algoritmus vyšetření HLA při vyhledávání dárce HSCT 1. Primární zpracování vzorků a typizace HLA Izolace DNA ze dvou nezávislých primárních vzorků při diagnóze u všech pacientů potenciálně indikovaných


Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží


Nové technologie v mikrobiologické diagnostice a jejich přínos pro pacienty v intenzivní péči

Nové technologie v mikrobiologické diagnostice a jejich přínos pro pacienty v intenzivní péči B I O M E D I C AL Nové technologie v mikrobiologické diagnostice a jejich přínos pro pacienty v intenzivní péči Jaroslav Hrabák CHARLES UNIVERSITY IN PRAGUE Obsah prezentace ČSIM 2016 Mikrobiologická


Výskyt MHC molekul. RNDr. Ivana Fellnerová, Ph.D. ajor istocompatibility omplex. Funkce MHC glykoproteinů

Výskyt MHC molekul. RNDr. Ivana Fellnerová, Ph.D. ajor istocompatibility omplex. Funkce MHC glykoproteinů RNDr. Ivana Fellnerová, Ph.D. Katedra zoologie, PřF UP Olomouc = ajor istocompatibility omplex Skupina genů na 6. chromozomu (u člověka) Kódují membránové glykoproteiny, tzv. MHC molekuly, MHC molekuly


Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21

Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21 Glosář - Cestina alely aneuploidie asistovaná reprodukce autozomálně dominantní autozomálně recesivní BRCA chromozom chromozomová aberace cytogenetický laborant de novo Různé formy genu, které se nacházejí
