1. Poloopice obývají a) Jižní Ameriku b) Madagaskar c) Austrálii d) Tasmánii

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "1. Poloopice obývají a) Jižní Ameriku b) Madagaskar c) Austrálii d) Tasmánii"


1 1. Poloopice obývají a) Jižní Ameriku b) Madagaskar c) Austrálii d) Tasmánii 2. Řád holobřiší je v našich vodách zastoupen a) mníkem jednovousým b) línem obecným c) úhořem říčním d) mihulí potoční 3. Skupina organismů získávajících energii ze stejné části potravní sítě v ekosystému se nazývá: a) biom b) ekologická nika c) populace d) trofická úroveň 4. V důsledku činnosti člověka vymřel: a) bizon americký b) holub stěhovavý c) lelek lesní d) drop velký 5. Který druh rostliny vytváří jarní a letní lodyhy? a) plavuň vidlačka b) kapraď samec c) přeslička rolní d) jahodník obecný 6. Genotyp je : a) soubor pozorovaných vnějších znaků b) soubor genů daného organismu c) soubor genů, které jsou uloženy v buněčném jádru d) soubor genů v populaci 7. Hyfy jsou: a) ovíjivé stonky liánovitých rostlin b) kořeny poloparazitických rostlin c) vlákna hub d) části stélky řas 8. Nedostatek vitamínu C způsobuje : a) chudokrevnost b) osteoporózu c) kurděje d) poruchy srážení krve

2 9. Předmět studia ekologie nejlépe vystihuje: a) ochrana životního prostředí b) vzájemný vztah organismů a jejich prostředí c) chování organismů d) vliv člověka na životní prostředí 10. Vejcorodým savcem je: a) vačice b) ptakopysk c) klokan d) koala 11. Mezi stopkovýtrusné houby nepatří: a) choroš b) holubinka c) smrž d) pýchavky 12. Pohlavní dvojtvárnost je výrazně vyvinuta u: a) ledňáčka říčního b) čolka velkého c) jezevce lesního d) zajíce polního 13. Pohlavním hormonem není: a) testosteron b) estrogen c) estragon d) progesteron 14. Podobnost tvaru, orgánů a chování u organismů, kteří žijí ve stejném životním prostředí, ale patří k rozdílným vývojovým liniím je důsledkem a) konvergentního vývoje b) divergentního vývoje c) hibernace d) symbiotických vztahů 15. Mechorostům chybí: a) rhizoidy b) pohyblivé samčí pohlavní buňky c) cévní svazky d) chlorofyl a 16. Podobnost určitého organismu k jinému druhu organismu či neživému předmětu, která poskytuje výhody v rámci přirozeného výběru označujeme jako: a) mykorhiza b) metamorfóza c) mimikry d) sukcese

3 17. Krokodýlové a) patří k nejprimitivnějším plazům b) se dožívají maximálně 10 let c) mají zuby umístěny v čelistních jamkách d) nežijí v Austrálii 18. Ptyalin: a) je vylučován žaludeční sliznicí b) tráví proteiny v tenkém střevě c) je vylučován již v dutině ústní d) podílí se na emulgaci lipidů 19. Mutace jsou: a) adaptivní buněčné změny b) dědičné změny genotypu c) nedědičné změny vyvolávající odchylky od standardu d) modifikační změny 20. Trombocyty: a) obsahují hemoglobin a podílejí se na přenosu kyslíku b) podílejí se na procesu srážení krve c) jsou velké buňky v procesu imunologické obrany organismu d) vznikají rozpadem erytrocytů 21. Vrápenci se řadí mezi: a) hmyzožravce b) letouny c) netopýry d) svišťouny 22. Mezi hlodavce patří: a) svišť horský b) zajíc polní c) rejsek obecný d) králík divoký 23. Gutace je: a) vylučování nektaru v květech b) utváření kapek rosy na listech c) způsob výdeje vody rostlinou d) výdej vody z listů ponořených vodních rostlin 24. Hygroskopické pohyby nevykonávají: a) šištice jehličnanů při vysychání b) obústí tobolky u mechorostů při uvolňování spór c) kořeny rostlin při růstu do míst zásobených vodou d) haptery přesliček

4 25. Při křížení bělookého samečka octomilky s červenookou homozygotní samičkou dostaneme: a) červenooké samečky a bělooké samičky b) bělooké samičky a červenooké samečky c) všechno potomstvo červenooké d) polovinu potomků bělookých a polovinu červenookých bez ohledu na pohlaví 26. Bioindikátory využívané k monitorování znečištění prostředí by měly splňovat tuto vlastnost: a) úzká ekologická valence b) široká ekologická valence c) skrytý způsob života a nenápadnost d) velká pohyblivost a značná schopnost šíření 27. Gyneceum představuje a) soubor plodolistů b) květní obaly c) soubor tyčinek d) vaječné obaly 28. Komár má: a) jeden pár blanitých křídel b) dva páry blanitých křídel c) dva páry křídel krytých šupinkami d) jeden pár polokrovek 29. Lata je květenství čeledi: a) lipnicovité b) vstavačovité c) hluchavkovité d) miříkovité 30. Přepište informaci těchto kodonů DNA do kodonů mrna AGA-CAA-AAA-ATA-CGA-CTA: a) TCT-GTT- TTT- TAT- GCT- TAT b) TCT-GTT- TAT- TAT- GCT- GAT c) TCT-GTT- TTT- TUT- GCT- GAT d) TCT- GTT- TTT- TAT- GCT- GAT 31. Jako fytofága označíme: a) hrobaříka b) potápníka c) tesaříka d) střevlíka 32. Cibule je podzemní orgán: a) liliovitých b) lipnicovitých c) miříkovitých d) merlíkovitých

5 33. Uveďte, které znaky mohou být společné virům i baktériím: a) fotosyntéza, chromozóm, rozmnožování, možnosti léčby infekce, stavba a metabolismus b) počet chromozómů, životní cyklus, odpověď makroorganismu c) velikost, patogenita, cesty šíření infekce, odpověď makroorganismu d) buněčná struktura, metabolismus, rozmnožování, životní cyklus 34. Žraloci mají šupiny: a) ganoidní b) ktenoidní c) cykloidní d) plakoidní 35. Jednopohlavné květy má: a) vrba jíva b) kuklík městský c) mák vlčí d) prvosenka vyšší 36. Poslední stádium vývoje ekostystému, kdy se ekosystém dostává do stavu dynamické rovnováhy se nazývá: a) ekotop b) klimax c) biom d) ekoton 37. V ČR nežije: a) čolek karpatský b) blatnice skvrnitá c) mlok černý d) čolek velký 38. Chobotnatka je: a) mořský červ s chobotovitým ústním otvorem b) druh pijavice c) druh pláštěnců d) brouk s prodlouženou přední částí hlavy 39. Součástí gametofytní fáze výtrusných rostlin není: a) spóra b) spermatozoid c) zygota d) prothalium 40. Primáti mají srdce složené: a) z jedné předsíně a dvou komor b) ze dvou předsíní a jedné komory c) ze dvou předsíní a dvou komor d) z žilného splavu, předsíně a komory

Přijímací zkouška z biologie šk. r. 2003/2004 Studijní obor: Učitelství biologie SŠ. Skupina A

Přijímací zkouška z biologie šk. r. 2003/2004 Studijní obor: Učitelství biologie SŠ. Skupina A Katedra biologie a ekologie PřF OU Přijímací zkouška z biologie šk. r. 2003/2004 Studijní obor: Učitelství biologie SŠ Skupina A 1. Co vyrůstá ze spóry výtrusných rostlin? a) embryo b) vajíčko c) prvoklíček


Tématický plán Přírodopis 7. ročník 2014-2015

Tématický plán Přírodopis 7. ročník 2014-2015 Tématický plán Přírodopis 7. ročník 014-015 Téma /učivo/ Čas. dotace Opakování 1 do 7/9 BIOLOGIE ŽIVOČICHŮ Výstupy Pláštěnci Sumky, salpy Do 14/9 Porovná základní vnější a vnitřní stavbu vybraných živočichů


Země živá planeta Vznik Země. Vývoj Země. Organické a anorganické látky. Atmosféra Člověk mění složení atmosféry. Člověk mění podnebí planety

Země živá planeta Vznik Země. Vývoj Země. Organické a anorganické látky. Atmosféra Člověk mění složení atmosféry. Člověk mění podnebí planety Vyučovací předmět Přídopis Týdenní hodinová dotace 2 hodiny Ročník Prima Roční hodinová dotace 72 hodin Výstupy Učivo Průřezová témata, mezipředmětové vztahy Žák porozumí rozdělení nebeských těles ve vesmíru


Zvyšování kvality výuky technických oborů

Zvyšování kvality výuky technických oborů Zvyšování kvality výuky technických oborů Klíčová aktivita V.2 Inovace a zkvalitnění výuky směřující k rozvoji odborných kompetencí žáků středních škol Téma V.2.18 Dřeviny Kapitola 2 Rozmnožování rostlin


vznik života na Zemi organické a anorganické látky a přírodními jevy ekosystémy, živé a neživé složky přírodního prostředí

vznik života na Zemi organické a anorganické látky a přírodními jevy ekosystémy, živé a neživé složky přírodního prostředí prima Země a život Ekologie vysvětlí vznik země a vývoj života na Zemi diskutuje o různých možnostech vzniku vývoje života na Zemi rozliší, co patří mezi organické a anorganické látky, a vysvětlí jejich


orientuje se v přehledu vývoje organismů a rozliší základní projevy a podmínky života

orientuje se v přehledu vývoje organismů a rozliší základní projevy a podmínky života Přírodopis ZŠ Heřmánek vnímá ztrátu zájmu o přírodopis na úkor pragmatického rozhodování o budoucí profesi. Náš názor je, že přírodopis je nedílnou součástí všeobecného vzdělání, především protože vytváří


Rozmnožování rostlin Rodozměny Rostliny nižší, výtrusné, nahosemenné

Rozmnožování rostlin Rodozměny Rostliny nižší, výtrusné, nahosemenné Rozmnožování rostlin Rodozměny Rostliny nižší, výtrusné, nahosemenné Rodozměna označuje kombinaci pohlavního a nepohlavního rozmnožování, kdy se střídá... generace gametofyt a... generace... Pokud nelze


I. Sekaniny1804 Přírodopis

I. Sekaniny1804 Přírodopis Přírodopis Charakteristika vyučovacího předmětu Obsahové, organizační a časové vymezení Vyučovací předmět Přírodopis je součástí vzdělávací oblasti Člověk a příroda. Vzdělávání v předmětu Přírodopis směřuje


Přírodopis - 6. ročník Vzdělávací obsah

Přírodopis - 6. ročník Vzdělávací obsah Přírodopis - 6. ročník Časový Téma Učivo Ročníkové výstupy žák podle svých schopností: Poznámka Září Příroda živá a neživá Úvod do předmětu Vysvětlí pojem příroda Příroda, přírodniny Rozliší přírodniny


- oddělení Rhyniofyta (+protracheophyta, zosterophyllophyta, trimerophyta)

- oddělení Rhyniofyta (+protracheophyta, zosterophyllophyta, trimerophyta) Otázka: Vyšší rostliny Předmět: Biologie Přidal(a): Lucka J. SYSTÉM - Vývojová větev vyšší rostliny (není to taxon): 1. Vývojový stupeň psilofytní rostliny - oddělení Rhyniofyta (+protracheophyta, zosterophyllophyta,


Základní škola Fr. Kupky, ul. Fr. Kupky 350, 518 01 Dobruška 5.6 ČLOVĚK A PŘÍRODA - 5.6.3 PŘÍRODOPIS - Přírodopis - 7. ročník

Základní škola Fr. Kupky, ul. Fr. Kupky 350, 518 01 Dobruška 5.6 ČLOVĚK A PŘÍRODA - 5.6.3 PŘÍRODOPIS - Přírodopis - 7. ročník OBECNÁ BIOLOGIE A GENETIKA RVP ZV Obsah 5.6 ČLOVĚK A PŘÍRODA 5.6.3 PŘÍRODOPIS Přírodopis 7. ročník RVP ZV Kód RVP ZV Očekávané výstupy ŠVP Školní očekávané výstupy ŠVP Učivo P9101 rozliší základní projevy


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 LRR/OBBC LRR/OBB Obecná biologie Orgány rostlin II. Mgr. Lukáš Spíchal, Ph.D. Cíl přednášky Popis anatomie, morfologie a funkce


Tematický plán učiva BIOLOGIE

Tematický plán učiva BIOLOGIE Tematický plán učiva BIOLOGIE Třída: Prima Počet hodin za školní rok: 66 h 1. POZNÁVÁME PŘÍRODU 2. LES 2.1 Rostliny a houby našich lesů 2.2 Lesní patra 2.3 Živočichové v lesích 2.4 Vztahy živočichů a rostlin


BIOLOGIE. Gymnázium Nový PORG

BIOLOGIE. Gymnázium Nový PORG BIOLOGIE Gymnázium Nový PORG Biologii vyučujeme na gymnáziu Nový PORG jako samostatný předmět od primy do tercie a v kvintě a sextě. Biologii vyučujeme v češtině a rozvíjíme v ní a doplňujeme témata probíraná


Základní škola Náchod Plhov: ŠVP Klíče k životu

Základní škola Náchod Plhov: ŠVP Klíče k životu ákladní škola Náchod Plhov: ŠVP Klíče k životu VDĚLÁVACÍ OBLAST: VDĚLÁVACÍ OBOR: PŘEDMĚT: ČLOVĚK A PŘÍRODA PŘÍRODOPIS PŘÍRODOPIS 7. ROČNÍK Téma, učivo Rozvíjené kompetence, očekávané výstupy Mezipředmětové


Rozmnožování rostlin

Rozmnožování rostlin Rozmnožování rostlin 1) Mechorosty: (http://bcs.whfreeman.com/thelifewire/content/chp29 /29020.html) - sporofyt je závislý na gametofytu, ten převládá - z výtrusů (A) vyrůstá prvoklíček protonema (B) a


TEORETICKÁ ČÁST test. 4. Podtrhni 3 kořenové poloparazity: ochmet, světlík, černýš, kokotice, jmelí, raflézie, kokrhel, podbílek

TEORETICKÁ ČÁST test. 4. Podtrhni 3 kořenové poloparazity: ochmet, světlík, černýš, kokotice, jmelí, raflézie, kokrhel, podbílek TEORETICKÁ ČÁST test 1. Vyber příklad mimeze: a) delfín podobající se tvarem těla rybě b) skunk produkující v ohrožení páchnoucí výměšek c) strašilka napodobující větvičku d) kuňka s výrazně zbarvenou


1. Chloroplasty jsou: a. v buňkách rostlin b. v buňkách živočichů c. v buňkách bakterií

1. Chloroplasty jsou: a. v buňkách rostlin b. v buňkách živočichů c. v buňkách bakterií 1. Chloroplasty jsou: a. v buňkách rostlin b. v buňkách živočichů c. v buňkách bakterií 2. Rostlinná buňka je: a. autotrofní b. heterotrofní c. schopna fagocytózy 3. Splynutím pohlavních buněk vzniká:


REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce?

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce? REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince Co bylo dřív? Slepice nebo vejce? Rozmnožování Rozmnožování (reprodukce) může být nepohlavní (vegetativní, asexuální) pohlavní (sexuální;


Oligobiogenní prvky bývají běžnou součástí organismů, ale v těle jich již podstatně méně (do 1%) než prvků makrobiogenních.

Oligobiogenní prvky bývají běžnou součástí organismů, ale v těle jich již podstatně méně (do 1%) než prvků makrobiogenních. 1 (3) CHEMICKÉ SLOŢENÍ ORGANISMŮ Prvky Stejné prvky a sloučeniny se opakují ve všech formách života, protože mají shodné principy stavby těla i metabolismu. Např. chemické děje při dýchání jsou stejné


Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je L. Sinkulová

Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je L. Sinkulová 1/7 pokračování rodu - rozeznáváme pohlavní a nepohlavní /střídají se v průběhu života každé rostliny/ - samčí a samičí buňky splynou /oplození/ = zygota, vzniká nová rostlina uložená v semeni


UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku)

UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) B I O L O G I E 1. Definice a obory biologie. Obecné vlastnosti organismů. Základní klasifikace organismů.


2.1 2.2. Testový sešit neotvírejte, počkejte na pokyn!

2.1 2.2. Testový sešit neotvírejte, počkejte na pokyn! BIOLOGIE DIDKTICKÝ TEST BIM0D11C0T02 Maximální bodové hodnocení: 100 bodů Hranice úspěšnosti: 33 % 1 Základní informace k zadání zkoušky Didaktický test obsahuje 46 úloh. Časový limit pro řešení didaktického


CZ.1.07/1.5.00/34.0880 Digitální učební materiály www.skolalipa.cz. III/ 2- Inovace a zkvalitnění výuky prostřednictvím ICT

CZ.1.07/1.5.00/34.0880 Digitální učební materiály www.skolalipa.cz. III/ 2- Inovace a zkvalitnění výuky prostřednictvím ICT Název školy: Číslo a název projektu: Číslo a název šablony klíčové aktivity: Označení materiálu: Typ materiálu: Předmět, ročník, obor: STŘEDNÍ ODBORNÁ ŠKOLA a STŘEDNÍ ODBORNÉ UČILIŠTĚ, Česká Lípa, 28.



6. VYŠŠÍ ROSTLINY - CHARAKTERISTIKA VÝTRUSNÝCH A NAHOSEMENNÝCH ROSTLIN 6. VYŠŠÍ ROSTLINY - CHARAKTERISTIKA VÝTRUSNÝCH A NAHOSEMENNÝCH ROSTLIN A. Vývoj a význam soustavy pletiv vodivých a krycích B. Charakteristika a význam hlavních oddělení výtrusných rostlin C. Individuální


Maturitní témata Biologie MZ 2017

Maturitní témata Biologie MZ 2017 Maturitní témata Biologie MZ 2017 1. Buňka - stavba a funkce buněčných struktur - typy buněk - prokaryotní buňka - eukaryotní buňka - rozdíl mezi rostlinnou a živočišnou buňkou - buněčný cyklus - mitóza


Maturitní témata - BIOLOGIE 2018

Maturitní témata - BIOLOGIE 2018 Maturitní témata - BIOLOGIE 2018 1. Obecná biologie; vznik a vývoj života Biologie a její vývoj a význam, obecná charakteristika organismů, přehled živých soustav (taxonomie), Linného taxony, binomická


Přijímací zkouška z biologie šk. r. 2003/2004 Studijní obor: Učitelství biologie ZŠ. Skupina A

Přijímací zkouška z biologie šk. r. 2003/2004 Studijní obor: Učitelství biologie ZŠ. Skupina A Katedra biologie a ekologie PřF OU 1. Šešule patří mezi plody: a) dužnaté b) pukavé c) nepukavé d) poltivé 2. Sítkovice jsou: a) síťovité zluštěniny na stěnách cév b) složky síťovité nervatury listů c)


Škola: Gymnázium, Brno, Slovanské náměstí 7 III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Název projektu: Inovace výuky na GSN

Škola: Gymnázium, Brno, Slovanské náměstí 7 III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Název projektu: Inovace výuky na GSN Škola: Gymnázium, Brno, Slovanské náměstí 7 Šablona: III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Název projektu: Inovace výuky na GSN prostřednictvím ICT Číslo projektu: CZ.1.07/1.5.00/34.0940


VY_32_INOVACE_08.01 1/6 Botanika systém rostlin Botanika nauka o rostlinách

VY_32_INOVACE_08.01 1/6 Botanika systém rostlin Botanika nauka o rostlinách 1/6 Botanika nauka o rostlinách Cíl chápat význam systému rostlin - vysvětlit vývoj rostlin - používat osvojenou odbornou terminologii - vysvětlit přizpůsobení rostlin životu na souši - odvodit


Reálné gymnázium a základní škola města Prostějova Školní vzdělávací program pro ZV Ruku v ruce

Reálné gymnázium a základní škola města Prostějova Školní vzdělávací program pro ZV Ruku v ruce 6 ČLOVĚK A PŘÍRODA UČEBNÍ OSNOVY 6. 3 Přírodopis Časová dotace 6. ročník 2 hodiny 7. ročník 2 hodiny 9. ročník 2 hodiny Celková dotace na 2. stupni je 6 hodin. Charakteristika: Obsah předmětu navazuje


"Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT ". Oplození

Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT . Oplození "Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT ". Oplození 1/66 Oplození = splynutí samčí pohlavní buňky s pohlavní buňkou samičí, při čemž vzniká diploidní zygota středa,


Otázky pro opakování. 6. ročník

Otázky pro opakování. 6. ročník Otázky pro opakování 6. ročník Vznik a vývoj Země 1. Jak vznikl vesmír? 2. Jak se nazývá naše galaxie a kdy pravděpodobně vznikla? 3. Jak a kdy vznikla naše Země? 4. Jak se následně vyvíjela Země? 5. Vyjmenuj


Školní výstupy Učivo Průřezová témata Mezipředmětové vztahy

Školní výstupy Učivo Průřezová témata Mezipředmětové vztahy PŘEDMĚT: BIOLOGIE ROČNÍK: PRIMA Školní výstupy Učivo Průřezová témata Mezipředmětové vztahy Ţák: porovná rozdíl v pozorování pouhým okem, lupou, mikroskopem pozoruje lupou, mikroskopem rozlišuje základní


Aplikovaná ekologie. 2.přednáška. Ekosystém, vztahy na stanovišti, vývoj

Aplikovaná ekologie. 2.přednáška. Ekosystém, vztahy na stanovišti, vývoj Aplikovaná ekologie 2.přednáška Ekosystém, vztahy na stanovišti, vývoj Životní prostředí ÚVOD základní pojmy životní prostředí, ekologie z čeho se skládá biosféra? ekosystém potravní závislosti, vztahy



KATALOG POŽADAVKŮ ZKOUŠEK SPOLEČNÉ ČÁSTI MATURITNÍ ZKOUŠKY. Centrum pro zjišťování výsledků vzdělávání KATALOG POŽADAVKŮ ZKOUŠEK SPOLEČNÉ ČÁSTI MATURITNÍ ZKOUŠKY platný od školního roku 2009/2010 BIOLOGIE Zpracoval: Schválil: Centrum pro zjišťování výsledků vzdělávání Ministerstvo školství, mládeže a tělovýchovy


KREV. Autor: Mgr. Anna Kotvrdová

KREV. Autor: Mgr. Anna Kotvrdová KREV Autor: Mgr. Anna Kotvrdová KREV Vzdělávací oblast: Somatologie Tematický okruh: Krev Mezioborové přesahy a vazby: Ošetřovatelství, Klinická propedeutika, První pomoc, Biologie, Vybrané kapitoly z


Kapraďorosty. Plavuně. Přesličky

Kapraďorosty. Plavuně. Přesličky Kapraďorosty = plavuně, přesličky a kapradiny jsou to rostliny výtrusné mají pravá pletiva největšího rozvoje dosahovaly v prvohorách (vysoké jako stromy) vznikla z nich ložiska černého uhlí Plavuně (chybný


PŘÍRODOPIS. 6. 9. ročník. Charakteristika předmětu. Obsahové, časové a organizační vymezení

PŘÍRODOPIS. 6. 9. ročník. Charakteristika předmětu. Obsahové, časové a organizační vymezení Charakteristika předmětu PŘÍRODOPIS 6. 9. ročník Obsahové, časové a organizační vymezení Předmět Přírodopis je vyučován jako samostatný předmět v 6., 7., 8., a 9., ročníku po 2 vyučovacích hodinách týdně.


Šablona č. 01.30 Přírodopis Savci opakování

Šablona č. 01.30 Přírodopis Savci opakování Šablona č. 01.30 Přírodopis Savci opakování Anotace: Opakování učiva o savcích. Autor: Ing. Ivana Přikrylová Očekávaný výstup: Pracovní list je vhodný k opakování učiva o savcích. Speciální vzdělávací


ŠKOLNÍ VZDĚLÁVACÍ PROGRAM. D. Kvasničková a kol.: Ekologický přírodopis pro 7. ročník ZŠ a nižší ročníky víceletých gymnázií, 1. a 2.

ŠKOLNÍ VZDĚLÁVACÍ PROGRAM. D. Kvasničková a kol.: Ekologický přírodopis pro 7. ročník ZŠ a nižší ročníky víceletých gymnázií, 1. a 2. Vyučovací předmět : Období ročník : Učební texty : Přírodopis 3. období 7. ročník D. Kvasničková a kol.: Ekologický přírodopis pro 7. ročník ZŠ a nižší ročníky víceletých gymnázií, 1. a 2. část Očekávané


Název materiálu: Kapraďorosty - úvod

Název materiálu: Kapraďorosty - úvod Základní škola Nový Bor, náměstí Míru 128, okres Česká Lípa, příspěvková organizace e-mail: info@zsnamesti.cz; www.zsnamesti.cz; telefon: 487 722 010; fax: 487 722 378 Registrační číslo: CZ.1.07/1.4.00/21.3267


Vzdělávací obor Přírodopis - obsah 6.ročník

Vzdělávací obor Přírodopis - obsah 6.ročník 6.ročník Hlavní kompetence Učivo Navázání na dosažené kompetence Metody práce obor navázání na již zvládnuté ročník 1. OBECNÁ Kompetence k učení, k řešení problémů, 1.1 Vznik a vývoj života Vlastivěda


Střední průmyslová škola strojnická Olomouc, tř. 17. listopadu 49. Výukový materiál zpracovaný v rámci projektu Výuka moderně

Střední průmyslová škola strojnická Olomouc, tř. 17. listopadu 49. Výukový materiál zpracovaný v rámci projektu Výuka moderně Střední průmyslová škola strojnická Olomouc, tř. 17. listopadu 49 Výukový materiál zpracovaný v rámci projektu Výuka moderně Registrační číslo projektu: CZ.1.07/1.5.00/34.0205 Šablona: III/2 Přírodovědné


Biologie zadání č. 1

Biologie zadání č. 1 Biologie zadání č. 1 Otázky za 3 body 1. Pojmem vitální kapacita plic označujeme: a) objem vzduchu v horních dýchacích cestách b) objem vzduchu vydechnutý po maximálním nádechu c) objem vzduchu vydechnutý


Moravské gymnázium Brno s.r.o. RNDr. Monika Jörková. Tematická oblast. Biologie 22 Pletiva. Ročník 1. Datum tvorby 26.12.2012

Moravské gymnázium Brno s.r.o. RNDr. Monika Jörková. Tematická oblast. Biologie 22 Pletiva. Ročník 1. Datum tvorby 26.12.2012 Číslo projektu CZ.1.07/1.5.00/34.0743 Název školy Autor Tematická oblast Moravské gymnázium Brno s.r.o. RNDr. Monika Jörková Biologie 22 Pletiva Ročník 1. Datum tvorby 26.12.2012 Anotace -pro učitele -stavba


Škola: Gymnázium, Brno, Slovanské náměstí 7 III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Název projektu: Inovace výuky na GSN

Škola: Gymnázium, Brno, Slovanské náměstí 7 III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Název projektu: Inovace výuky na GSN Škola: Gymnázium, Brno, Slovanské náměstí 7 Šablona: III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Název projektu: Inovace výuky na GSN prostřednictvím ICT Číslo projektu: CZ.1.07/1.5.00/34.0940


Environmentální výchova základní podmínky života, ekosystémy, lidské aktivity a problémy životního prostředí, vztah člověka k prostředí

Environmentální výchova základní podmínky života, ekosystémy, lidské aktivity a problémy životního prostředí, vztah člověka k prostředí Předmět: PŘÍRODOPIS Vzdělávací oblast: ČLOVĚK A PŘÍRODA Charakteristika předmětu Časové a organizační vymezení předmětu Průřezová témata Metody a formy práce Předmět vede žáky k seznámení s živou i neživou



ŽIVÁ A NEŽIVÁ PŘÍRODA ŽIVÁ A NEŽIVÁ PŘÍRODA Příroda na Zemi je tvořena dvěma základními složkami: a) přírodou živou b) přírodou neživou Příroda živá je závislá na přírodě neživé, bez neživé přírody by na Zemi nebyl život. Poskytuje


Biologie - Kvinta, 1. ročník

Biologie - Kvinta, 1. ročník - Kvinta, 1. ročník Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti Kompetence


Člověk a příroda přírodopis volitelný předmět

Člověk a příroda přírodopis volitelný předmět Vyučovací předmět : Období ročník : Učební texty : Člověk a příroda přírodopis volitelný předmět 3. období 9. ročník Jan Stoklasa a kol. : Organismy, prostředí, člověk /učebnice přírodopisu pro 9. roč.


Biologie nižší gymnázium

Biologie nižší gymnázium Biologie nižší gymnázium Obsahové vymezení Vyučovací předmět Biologie vychází ze vzdělávacího obsahu vzdělávací oblasti Člověk a příroda, vzdělávacího oboru Přírodopis. V rámci tohoto předmětu je realizována


Krev a míza. Napsal uživatel Zemanová Veronika Pondělí, 01 Březen 2010 12:07

Krev a míza. Napsal uživatel Zemanová Veronika Pondělí, 01 Březen 2010 12:07 Krev je součástí vnitřního prostředí organizmu, je hlavní mimobuněčnou tekutinou. Zajišťuje životní pochody v buňkách, účastní se pochodů, jež vytvářejí a udržují stálé vnitřní prostředí v organizmu, přímo


Učební osnovy předmětu Biologie

Učební osnovy předmětu Biologie (kvinta a sexta) Učební osnovy předmětu Biologie Charakteristika předmětu Vyučovací předmět vychází ze vzdělávací oblasti Člověk a příroda, vzdělávacích oborů Biologie a Geologie. Integruje část vzdělávacího


1. Virus je: a) buněčný organismus b) složený z nukleové kyseliny a kapsidu c) infekční bílkovina d) bakteriální organismus

1. Virus je: a) buněčný organismus b) složený z nukleové kyseliny a kapsidu c) infekční bílkovina d) bakteriální organismus 1. Virus je: a) buněčný organismus b) složený z nukleové kyseliny a kapsidu c) infekční bílkovina d) bakteriální organismus 2. Ukládání organických látek do buněčné stěny rostlinné buňky označujeme jako:


Vzdělávací obsah vyučovacího předmětu

Vzdělávací obsah vyučovacího předmětu Vzdělávací obsah vyučovacího předmětu Přírodopis 6. ročník Zpracovala: RNDr. Šárka Semorádová Obecná biologie rozliší základní projevy a podmínky života, orientuje se v daném přehledu vývoje organismů


BIOLOGIE-2015-03 Univerzita Hradec Králové Přírodovědecká fakulta katedra BIOLOGIE Ř E Š E N Í. Příjmení a jméno uchazeče:..

BIOLOGIE-2015-03 Univerzita Hradec Králové Přírodovědecká fakulta katedra BIOLOGIE Ř E Š E N Í. Příjmení a jméno uchazeče:.. Ř E Š E N Í Zadání písemné části přijímací zkoušky z BIOLOGIE Katedra BIOLOGIE Datum zkoušky:. Varianta: 03 Příjmení a jméno uchazeče:.. Datum narození: Číslo přihlášky: Předchozí studium:.. Bydliště:..


- pro biologickou funkci je rozhodující terciární (resp. kvartérní) struktura enzymu

- pro biologickou funkci je rozhodující terciární (resp. kvartérní) struktura enzymu Otázka: Enzymy, vitamíny, hormony Předmět: Chemie Přidal(a): VityVity Enzymy, vitamíny, hormony a jejich význam pro biologickou funkci živých organismů Enzymy - látka sloužící jako biokatalyzátory - historie:


ZELENÉ ŘASY rostliny bez stonku, listů a kořenu

ZELENÉ ŘASY rostliny bez stonku, listů a kořenu PŘEHLED ROSTLIN ZELENÉ ŘASY rostliny bez stonku, listů a kořenu Jednoduché tělo = stélka Skupiny spojených buněk kolonie Jednobuněční bičíkovci (pláštěnka) Řasy mnohobuněčné - řetězy buněk ROSTLINY NEJEN


10. oogeneze a spermiogeneze meióza, vznik spermií a vajíček ovulační a menstruační cyklus antikoncepční metody, oplození

10. oogeneze a spermiogeneze meióza, vznik spermií a vajíček ovulační a menstruační cyklus antikoncepční metody, oplození 10. oogeneze a spermiogeneze meióza, vznik spermií a vajíček ovulační a menstruační cyklus antikoncepční metody, oplození MEIÓZA meióza (redukční dělení/ meiotické dělení), je buněčné dělení, při kterém



KRYTOSEMENNÉ ROSTLINY KRYTOSEMENNÉ ROSTLINY JEDNODĚLOŽNÉ ROSTLINY VYBRANÉ ČELEDI obr. č. 1 znaky: rostlina ze semene klíčí 1 dělohou kořeny svazčité listy se souběžnou žilnatinou květ tříčetný, tříčetný ve 2 kruzích cévní svazky


věda zkoumající vzájemné vztahy mezi organismy a vztahy organismů k prostředí základní biologická disciplína využívá poznatků dalších věd - chemie, fyzika, geografie, sociologie rozdělení ekologie podle


Aplikovaná ekologie, Experimentální biologie, Systematická biologie a ekologie, Biologie - dvouoborová. bakalářské prezenční/kombinované studium

Aplikovaná ekologie, Experimentální biologie, Systematická biologie a ekologie, Biologie - dvouoborová. bakalářské prezenční/kombinované studium Aplikovaná ekologie, Experimentální biologie, Systematická biologie a ekologie, Biologie - dvouoborová Otázka 1 Genotyp je: a. typický gen b. podmíněn fenotypem bakalářské prezenční/kombinované studium


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Téma / kapitola Dělnická 6. 7. tř. ZŠ základní


Rostlinné orgány. Kořen (radix)

Rostlinné orgány. Kořen (radix) - jsou tvořeny soubory pletiv - vyznačují se určitou funkcí a stavbou Rostlinné orgány Rostlinné orgány vegetativní (vyživovací) kořen, stonek, list - funkce : zajištění výživy, růstu a výměny látek s


Ekologie živočichů, téma 10: Strategie pro přežití: vydržet nebo zmizet?

Ekologie živočichů, téma 10: Strategie pro přežití: vydržet nebo zmizet? Ekologie živočichů, téma 10: Strategie pro přežití: vydržet nebo zmizet? Strategie pro přežití: Konflikt mezi : - šíří ekologické valence daného druhu - a aktuálními vnějšími podmínkami Jak řešit? Změnou



STANDARDY PRO ZÁKLADNÍ VZDĚLÁVÁNÍ. Přírodopis STANDARDY PRO ZÁKLADNÍ VZDĚLÁVÁNÍ Přírodopis Zpracováno dle upraveného RVP ZV platného od 1. 9. 2013 Vypracovala skupina pro přípravu standardů vzdělávacího oboru Přírodopis ve složení: RNDr. Danuše Kvasničková,


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Semeno a plod krytosemenných

Semeno a plod krytosemenných Semeno a plod krytosemenných Vývoj a stavba semene Z oplozené vaječné buňky vzniká zygota, z které se vyvíjí embrio. Osemení může být různě zabarveno. Velikost semen je dána geneticky a je neměnná. S velikostí


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


II. Nástroje a metody, kterými ověřujeme plnění cílů

II. Nástroje a metody, kterými ověřujeme plnění cílů BIOLOGIE Gymnázium Nový PORG Biologii vyučujeme na gymnáziu Nový PORG jako samostatný předmět od primy do tercie a v kvintě a sextě. Biologii vyučujeme v češtině a rozvíjíme v ní a doplňujeme témata probíraná





Vzdělávací oblast: Člověk a příroda. Vyučovací předmět: Biologie. Třída: Sekunda. Očekávané výstupy. Poznámky. Přesahy. Průřezová témata.

Vzdělávací oblast: Člověk a příroda. Vyučovací předmět: Biologie. Třída: Sekunda. Očekávané výstupy. Poznámky. Přesahy. Průřezová témata. Vzdělávací oblast: Člověk a příroda Vyučovací předmět: Biologie Třída: Sekunda Očekávané výstupy Žák: Vyjmenuje společné znaky strunatců Rozlišuje a porovnává základní vnější a vnitřní stavbu vybraných


Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského





36-47-M/01 Chovatelství

36-47-M/01 Chovatelství Střední škola technická, Most, příspěvková organizace Dělnická 21, 434 01 Most PROFILOVÁ ČÁST MATURITNÍ ZKOUŠKY V JARNÍM I PODZIMNÍM OBDOBÍ ŠKOLNÍ ROK 2014/2015 Obor vzdělání 36-47-M/01 Chovatelství ŠVP


Číslo materiálu: VY 32 INOVACE 22/12

Číslo materiálu: VY 32 INOVACE 22/12 Číslo materiálu: Název materiálu: ROSTLINNÉ ORGÁNY Písemná práce Číslo projektu: CZ.1.07/1.4.00/21.1486 Zpracovala: Marcela Kováříková JMÉNO: A 1. Jak se nazývá rostlinný orgán, který má rozmnožovací funkci


Otázky pro písemnou část přijímací zkoušky pro obor biologie a ekologie. Červen 2014

Otázky pro písemnou část přijímací zkoušky pro obor biologie a ekologie. Červen 2014 Otázky pro písemnou část přijímací zkoušky pro obor biologie a ekologie. Červen 2014 (zakroužkujte vždy jedinou správnou odpověď nebo čitelně větu většinou jednoslovně doplňte) Doba řešení: 90 minut. Správná


TEMATICKÝ PLÁN. září. říjen listopad prosinec

TEMATICKÝ PLÁN. září. říjen listopad prosinec Přírodopis 1- Černík a kol. Zoologie pracovní sešit - D. Králová Botanika pracovní sešit - D. Králová Přírodopis 6 pracovní sešit - Zapletal a kol.: 1. Země a život - vznik Země - slunce, atmosféra - fotosyntéza


Výukové environmentální programy s mezipředmětovými vazbami

Výukové environmentální programy s mezipředmětovými vazbami Výukové environmentální programy s mezipředmětovými vazbami Ekologie, krajina a životní prostředí, ochrana životního prostředí, geologie a pedologie, praxe (Ing. Lenka Zámečníková) I) pracovní listy, poznávačky,


obecné vlastnosti živých soustav soustav teorie evoluce Zeměpis, Dějepis 1. ročník prokaryotní a eukaryotní buňka buňka - stavba a funkce

obecné vlastnosti živých soustav soustav teorie evoluce Zeměpis, Dějepis 1. ročník prokaryotní a eukaryotní buňka buňka - stavba a funkce odliší živé soustavy od neživých na základě jejich charakteristických vlastností zkoumá formy, vlastnosti a vnitřní procesy živých soustav, jejich vzájemné a k neživému prostředí OBECNÁ BIOLOGIE vznik





Základní škola a mateřská škola, Ostrava-Hrabůvka, Mitušova 16, příspěvková organizace Školní vzdělávací program 2. stupeň, Člověk a příroda

Základní škola a mateřská škola, Ostrava-Hrabůvka, Mitušova 16, příspěvková organizace Školní vzdělávací program 2. stupeň, Člověk a příroda Základní škola a mateřská škola, Ostrava-Hrabůvka, Mitušova 16, příspěvková organizace Přírodopis 7. ročník Výstupy ŠVP Učivo Přesahy, metody a průřezová témata Žák 1. Zoologie chápe, proč obratlovce řadíme


Biologická olympiáda

Biologická olympiáda Česká zemědělská univerzita v Praze Ústřední komise Biologické olympiády Biologická olympiáda 50. ročník školní rok 2015 2016 Zadání školního kola kategorie D Praha 2015 Teoretická část test V otázkách



ŘÍŠE ROSTLINY (PLANTAE) Úvod do biologie rostlin Systém Slide 1 ŘÍŠE ROSTLINY (PLANTAE) podříše NIŽŠÍ ROSTLINY (Stélkaté Thallobionta) tělo = stélka (thallus) jednobuněčná vícebuněčná nerozlišená ve stonek, kořen, list, květ



EU PENÍZE ŠKOLÁM NÁZEV PROJEKTU : MÁME RÁDI TECHNIKU REGISTRAČNÍ ČÍSLO PROJEKTU :CZ.1.07/1.4.00/21.0663 EU PENÍZE ŠKOLÁM NÁZEV PROJEKTU : MÁME RÁDI TECHNIKU REGISTRAČNÍ ČÍSLO PROJEKTU :CZ.1.07/1.4.00/21.0663 Speciální základní škola a Praktická škola Trmice Fűgnerova 22 400 04 1 Identifikátor materiálu:


Gymnázium Aloise Jiráska, Litomyšl, T. G. Masaryka 590

Gymnázium Aloise Jiráska, Litomyšl, T. G. Masaryka 590 , T. G. Masaryka 590 Dodatek č. 1 ke Školnímu vzdělávacímu programu pro nižší stupeň gymnázia (zpracován podle RVP ZV) Tímto dodatkem se mění osnovy předmětu Biologie a geologie pro primu od školního roku


Biologická olympiáda

Biologická olympiáda Česká zemědělská univerzita v Praze Ústřední komise Biologické olympiády Biologická olympiáda 50. ročník školní rok 2015 2016 Zadání okresního kola kategorie C Praha 2016 Teoretická část test 1. Na obrázcích


Velká rodina života. mlha se zvedá

Velká rodina života. mlha se zvedá Úvod Jen málo národů a lidských pospolitostí na Zemi nemá svůj mýtus o stvoření. Američtí Irokézové věřili, že svět a všechno v něm stvořili nebeští lidé, podle starověkých Japonců byl svět výtvorem bohů,


KAPRAĎOROSTY. pracovní list

KAPRAĎOROSTY. pracovní list KAPRAĎOROSTY pracovní list Mezi kapraďorosty patří následující oddělení vyšších rostlin: plavuně, přesličky a kapradiny. Jsou to zelené výtrusné rostliny s dokonale vyvinutou nepohlavní generací (sporofytem)


Seminární práce Biologie Maturitní okruh č. 18 Mykologie

Seminární práce Biologie Maturitní okruh č. 18 Mykologie Seminární práce Biologie Maturitní okruh č. 18 Mykologie Hubert Šváb (3. ročník) Houby (Fungi) Mykologie: Věda zabývající se studiem hub (z řec. mýkés -houba) Nejstarší doklady o houbách pocházejí z prvohor,


Aplikovaná ekologie, Experimentální biologie, Systematická biologie a ekologie, Biologie - dvouoborová

Aplikovaná ekologie, Experimentální biologie, Systematická biologie a ekologie, Biologie - dvouoborová Aplikovaná ekologie, Experimentální biologie, Systematická biologie a ekologie, Biologie - dvouoborová bakalářské prezenční/kombinované studium Otázka 1 Samičí pohlaví je u ptáků určeno: a. AY gonozómy


Číslo projektu CZ.1.07/1.5.00/34.0743. Název školy. Moravské gymnázium Brno, s.r.o. Autor. Mgr. Martin Hnilo. Biologie 1 Nebuněční viry.

Číslo projektu CZ.1.07/1.5.00/34.0743. Název školy. Moravské gymnázium Brno, s.r.o. Autor. Mgr. Martin Hnilo. Biologie 1 Nebuněční viry. Číslo projektu CZ.1.07/1.5.00/34.0743 Název školy Moravské gymnázium Brno, s.r.o. Autor Mgr. Martin Hnilo Tematická oblast Biologie 1 Nebuněční viry. Ročník 1. Datum tvorby 10.10.2012 Anotace Pracovní


Je-li rostlinné společenstvo tvořeno pouze jedinci jedné populace, mluvíme o monocenóze nebo také o čistém prostoru.

Je-li rostlinné společenstvo tvořeno pouze jedinci jedné populace, mluvíme o monocenóze nebo také o čistém prostoru. EKOLOGIE SPOLEČENSTVA (SYNEKOLOGIE) Rostlinné společenstvo (fytocenózu) můžeme definovat jako soubor jedinců a populací rostlin rostoucích společně na určitém stanovišti, které jsou ovlivňovány svým prostředím,





ŠVP ZŠ Luštěnice, okres Mladá Boleslav verze 2012/2013

ŠVP ZŠ Luštěnice, okres Mladá Boleslav verze 2012/2013 5.6.3 Přírodopis Charakteristika vyučovacího předmětu PŘÍRODOPIS I. Obsahové vymezení Vyučovací předmět Přírodopis vychází z obsahu vzdělávacího oboru Člověk a příroda a je v některých ročnících částečně


Biokatalyzátory Ch_017_Chemické reakce_biokatalyzátory Autor: Ing. Mariana Mrázková

Biokatalyzátory Ch_017_Chemické reakce_biokatalyzátory Autor: Ing. Mariana Mrázková Registrační číslo projektu: CZ.1.07/1.1.38/02.0025 Název projektu: Modernizace výuky na ZŠ Slušovice, Fryšták, Kašava a Velehrad Tento projekt je spolufinancován z Evropského sociálního fondu a státního


A B C D E F 1 Vzdělávací oblast: Člověk a příroda 2 Vzdělávací obor: Přírodopis 3 Ročník: 7. 4 Klíčové kompetence (Dílčí kompetence) Zoologie

A B C D E F 1 Vzdělávací oblast: Člověk a příroda 2 Vzdělávací obor: Přírodopis 3 Ročník: 7. 4 Klíčové kompetence (Dílčí kompetence) Zoologie A B C D E F 1 Vzdělávací oblast: Člověk a příroda 2 Vzdělávací obor: Přírodopis 3 Ročník: 7. 4 Klíčové kompetence (Dílčí kompetence) 5 Kompetence občanské respektuje přesvědčení druhých je si vědom svých


,,Škola nás baví CZ. 1.07/1.4.00/21.1342

,,Škola nás baví CZ. 1.07/1.4.00/21.1342 ,,Škola nás baví CZ. 1.07/1.4.00/21.1342 VY_52_INOVACE_Př.Ma.15 AutoSave 1 Základní škola a Mateřská škola Dolní Hbity, okres Příbram PŘÍRODOPIS 7. ročník KVĚT A KVĚTENSTVÍ Vypracovala: Ing. Miroslava


Hmyz s proměnou nedokonalou. Vážky (řád) Rovnokřídlí (řád) - skákací končetiny - 2 páry křídel a, tuhý b, blanitý - samec cvrká

Hmyz s proměnou nedokonalou. Vážky (řád) Rovnokřídlí (řád) - skákací končetiny - 2 páry křídel a, tuhý b, blanitý - samec cvrká Hmyz s proměnou nedokonalou - nymfa = larvální stádium Vážky (řád) - rychlý let - stát nehybně ve vzduchu - blanitá křídla - velké oči - larvy = najády Z: 1. vážka ploská 2. šídlo červené 3. motýlice lesklá
