MASARYKOVA UNIVERZITA PŘÍRODOVĚDECKÁ FAKULTA

Transkript

1 MASARYKOVA UNIVERZITA PŘÍRODOVĚDECKÁ FAKULTA STUDIUM ELEKTROCHEMICKÝCH VLASTNOSTÍ SYNTETICKÝCH OLIGONUKLEOTIDŮ A DNA MODIFIKOVANÝCH REDOX-AKTIVNÍMI SKUPINAMI Disertační práce Pavlína Vidláková Vedoucí práce: Doc. RNDr. Miroslav Fojta CSc. Brno 2015

2 Bibliografický záznam Autor: Mgr. Pavlína Vidláková Název práce: Studijní program: Studijní obor: Vedoucí práce: Studium elektrochemických vlastností syntetických oligonukleotidů a DNA modifikovaných redoxaktivními skupinami Fyzika Biofyzika Doc. RNDr. Miroslav Fojta CSc. Akademický rok: 2014/15 Počet stran: Klíčová slova: DNA, elektrochemie, elektrochemické značení, biosensor

3 Bibliographic Entry Author Mgr. Pavlína Vidláková Title of Thesis: Degree programme: Field of Study: Supervisor: Study of electrochemical properties of of synthetic oligonucleotides and DNA modified with redox-active moieties Physics Biophysics Doc. RNDr. Miroslav Fojta CSc. Academic Year: 2014/15 Number of Pages: Keywords: DNA, electrochemistry, electrochemical labeling, biosensor

4 Poděkování Na tomto místě bych chtěla poděkovat svému školiteli Doc. RNDr. Miroslavu Fojtovi CSc. a také Mgr. Luďkovi Havranovi Dr. za jejich odborné vedení a cenné rady a také za připomínky při zpracování této práce. Déle děkuji kolegům z Biofyzikálního ústavu za příjemné pracovní prostředí a veškerou pomoc, které se mi od nich dostalo. Prohlášení Prohlašuji, že jsem svoji rigorózní práci vypracovala samostatně s využitím informačních zdrojů, které jsou v práci citovány. Brno 6. března 2015 Pavlína Vidláková

5 Pavlína Vidláková, Masarykova Universita, 2015

6 Abstrakt V této disertační práci se věnujeme elektrochemické analýze nukleotidových sekvencí s využitím elektrochemických značek a vlastnostem těchto značek. Teoretická část práce je zaměřena na shrnutí poznatků týkajících se elektrochemického chování nukleových kyselin a oligonukleotidů s využitím různých typů elektrod a elektrochemických metod. Dále jsou zde popsány metody značení nukleových kyselin elektroaktivními značkami a také příprava a použití DNA-biosenzorů. Experimentální část je přiložena ve formě pěti publikací otištěných v impaktovaných časopisech, viz přílohy 1-5. V kapitole Výsledky a diskuze jsou shrnuty a stručně komentovány výsledky obsažené v těchto článcích. Tyto články jsou zaměřené především na přípravu nových elektrochemickým značek (antrachinonu, nitrofenylu, benzofurazanu a butylakrylátu) využitelných pro značení DNA a přípravu biosenzorů a detailní studium elektrochemického chování těchto látek a to jak samostatně, tak v různých kombinacích. Tyto značky byly pomocí metody prodlužování primeru inkorporovány do molekul oligonukleotidů a takto připravené oligonukleotidy byly opět elektrochemicky studovány. Poslední článek je zaměřen na elektrochemické studium DNA modifikované kancerostatikem cisplatinou. Cisplatina se kovalentně váže na DNA, nejčastějším vazebným místem jsou dinukleotidové motivy GG a AG. Při elektrochemické redukci komplexních sloučenin platiny na rtuťových elektrodách dochází ke katalytickému vylučování vodíku. Tento proces je možné využít pro citlivé stanovení modifikované DNA.

7 Abstract In this thesis we deal with electrochemical analysis of nucleotide sequences using electroactive labels and properties of these labels. The theoretical part is concentrated on summary of findings regarding of electrochemical behavior of nucleic acid and oligonucleotides using of various types of electrodes and electrochemical methods. Further are there methods of DNA labeling with using electroactive tags and methods of preparation of DNA-biosensors. Experimental part of the thesis encompasses five papers published in international peerreviewed journals (see appendices 1-5). The results included in these papers are summarized and briefly commented in the chapter Results and Discussion. These papers are concentrated on preparation of new electroactive labels for DNA and for preparation of DNA-biosensors, and on studying electrochemical behavior of these labels separately or in various combinations of several types of labels simultaneously. These tags were incorporated into oligonucleotides with using primer extension and these oligonucleotides were electrochemically studied. The last paper deals about electrochemical analysis of cisplatin modified DNA. Cisplatin binds covalently on DNA (especially on dinucleotide motifs GG and AG). Electrochemical reduction of cisplatin-dna adduct at mercury electrodes is accompanied by catalytic hydrogen evolution. This process can be used for sensitive analyses of modified DNA.

8 Obsah Seznam zkratek... 8 Úvod.. 10 Literární přehled Elektrochemické metody Pracovní elektrody Rtuťové pracovní elektrody Pevné pracovní elektrody Referentní a pomocné elektrody Elektroanalytické metody Rozpouštěcí a přenosové techniky Elektrochemické vlastnosti nukleových kyselin Elektrochemické chování DNA na rtuťových elektrodách Redoxní děje na rtuťových elektrodách Adsorpčně-desorpční děje na rtuťových elektrodách Elektrochemické chování DNA na uhlíkových elektrodách Elektrochemické značení nukleových kyselin Nekovalentě se vázající redoxní indikátory Kovalentně se vázající elektrochemické značky Enzymatická inkorporace elektrochemicky značených nukleotidů Magnetoseparační techniky Elektrochemické biosenzory Elektrochemické biosenzory pro detekci hybridizace DNA Imobilizace hybridizační sondy na povrchu elektrod Detekční principy využívané v elektrochemických senzorech pro hybridizaci DNA Elektrochemické senzory pro detekci mutací a polymorfismů..34 Cíle disertační práce..36 Seznam publikací 37 Výsledky a diskuse 38 Závěr.49 Seznam literatury..50 Přílohy

9 Seznam zkratek A, C, G, T adenin, cytosin, guanin, thymin ACV - voltametrie s vkládaným střídavým napětím AdSV adsorptivní rozpouštěcí voltametrie AdTSV adsorptivní přenosová rozpouštěcí voltametrie A ox, G ox oxidační píky adeninu a guaninu ASV anodická rozpouštěcí voltametrie CPSA - chronopotenciometrie s konstantním proudem CSV katodická rozpouštěcí voltametrie CV cyklická voltametrie DNA (ds, ss, sc) deoxyribonukleová kyselina (dvouřetězcová, jednořetězcová, superhelikální) dntp deoxyribonukleosid trifosfát DPP diferenční pulsní polarografie DPV diferenční pulsní voltametrie HMDE visící rtuťová kapková elektroda LSV - voltametrie s lineárně se měnícím potenciálem MeSAE pevná amalgámová elektroda (z amalgámu kovu Me) NK nukleová kyselina ON oligonukleotid Os,L komplexy oxidu osmičelého PEX prodlužování primeru (primer extension) 8

10 PGE elektroda z pyrolytického grafitu RNA ribonukleová kyselina SAM samoorganizovaná monovrstva (self-assambled monolayer) SWV - voltametrie se superponovaným pravoúhlým napětím TdT terminální deoxynuxleotidyl transferáza 9

11 Úvod Počátek elektrochemie nukleových kyselin spadá do druhé poloviny padesátých let dvacátého století. V roce 1958 uveřejnil E. Paleček práci, ve které pomocí oscilografické polarografie se střídavým proudem prokázal elektroaktivitu DNA (1). V roce 1961 byla publikována první práce, která se zabývala adsorpcí DNA na povrch rtuťové elektrody (2). Výsledky impedančního měření ukázaly, že je DNA povrchově aktivní látkou schopnou adsorpce na povrchu elektrody a při vkládání negativních potenciálů podléhá charakteristickým adsorpčně/desorpčním dějům. Tyto objevy vedly k dalšímu zkoumání elektrochemické a povrchové aktivity nukleových kyselin. Ukázalo se, že elektrochemické metody mohou přinášet informace jak o přítomnosti a koncentraci nukleových kyselin, tak i o jejich sekundární a terciální struktuře (3-7). Zpočátku byl vývoj v oblasti elektrochemie nukleových kyselin limitován jak dostupnou instrumentací, tak i omezenými možnostmi přípravy vhodného experimentálního materiálu. Tato situace se výrazně změnila až v posledním desetiletí 20. století, kdy došlo k velkému pokroku jak v biologických i medicínských vědách, tak i k rozvoji analytických zařízení i metod. V současné době se využívá široké spektrum elektrochemických metod, které umožňují stanovení stopových množství nukleových kyselin ve velmi malých objemech vzorků. Ke snížení spotřeby analyzovaného materiálu přispělo mimo jiné zavedení adsorptivních rozpouštěcích technik ve spojení se rtuťovými nebo uhlíkovými elektrodami. Tyto techniky spočívají v akumulaci vzorku na elektrodu před samotným měřením, čím je dosaženo větší citlivosti stanovení. Adsorpce nukleových kyselin na elektrodu je možné provést z velmi malého (jednotky mikrolitrů) množství vzorku, což snižuje spotřebu analytického materiálu (8). Přestože přirozená DNA je elektrochemicky aktivní, je pro některé analytické aplikace vhodné využít elektrochemického značení. To obvykle dovoluje citlivější detekci, než jaká by byla dosažena měřením vlastních signálů DNA, poskytuje signály v přístupnějších potenciálech mimo oblast vybíjení elektrolytu a elektrodové děje, jimž využívané značky podléhají, jsou často reversibilní. Je také možné detekovat značenou DNA i ve velkém nadbytku neznačené DNA. Při studiu struktury nukleových kyselin je možné využít specifických reakcí některých látek s určitou konformací DNA nebo jejich vazby na konkrétní báze (např. komplexy oxidu osmičelého) (9-11), nebo je možné využít inkorporaci nukleotidů 10

12 s kovalentně navázanými elektroaktivními skupinami s využitím metody prodlužování primeru (12-16). Při této metodě je pomocí různých DNA polymeráz prodlužován řetězec DNA od 5 konce ke 3 konci. Syntéza probíhá podle templátového řetězce na základě párování komplementárních bazí. Tato práce je zaměřena především na testování nových elektrochemických značek využitelných pro studium nukleových kyselin, na přípravu oligonukleotidů značených těmito značkami s využitím metody prodlužování primeru a obecně na studium elektrochemického chování chemicky modifikované DNA. 11

13 Literární přehled 1. Elektrochemické metody Základem zařízení pro elektroanalytická měření je pracovní elektroda zapojená do elektrického obvodu umožňujícího přesnou kontrolu vkládaného napětí a citlivé měření elektrického proudu, který obvodem prochází. Pracovní elektroda je obvykle ponořena do roztoku základního elektrolytu. Pokud je v tomto roztoku přítomna látka, která je za určitých podmínek schopná odevzdávat elektrony pracovní elektrodě, nebo je od ní přijímat, případně se na povrchu elektrody adsorbuje, lze v obvodu v závislosti na vloženém potenciálu naměřit proudové signály. Poloha těchto signálů poskytuje informaci o charakteru přítomné látky a jejich intenzita informace o jejím množství. Při elektrochemické analýze DNA se obvykle používá klasické tříelektrodové zapojení s pracovní, referentní a pomocnou elektrodou. 1.1 Pracovní elektrody Pracovní elektrody v elektrochemické analýze nukleových kyselin bývají rtuťové nebo z pevných materiálů (ušlechtilé kovy, amalgamy, uhlík). Na materiálu pracovní elektrody a použitém základním elektrolytu závisí rozsah potenciálů, které lze analyticky využít, tzv. potenciálové okno. Ve vodných roztocích je využitelný potenciálový rozsah zpravidla omezen elektrodovými reakcemi souvisejícími s elektrolýzou vody. Rozsah anodického potenciálu je omezen vylučováním kyslíku, katodický rozsah je omezen vylučováním vodíku. Oba tyto procesy jsou závislé na ph. V nevodných roztocích (resp. aprotických rozpouštědlech) je využitelné potenciálová okno zpravidla širší než v roztocích vodných Rtuťové pracovní elektrody Rtuť jako elektrodový materiál má oproti většině tuhých materiálů několik výhod. Jsou to zejména homogenní a snadno obnovitelný povrch a vysoká hodnota přepětí vodíku, která umožňuje měření i při velmi negativních potenciálech. Nevýhodou je naopak snadná oxidace rtuti při kladných potenciálech. Z tohoto důvodu jsou vhodné zejména pro stanovení látek jejich katodickou redukcí. Typy rtuťových elektrod: 12

14 - Kapající rtuťová elektroda DME elektrodovým povrchem je v čase rostoucí povrch odkapávající rtuťová kapky. - Statická rtuťová kapková elektroda SMDE u ústí kapiláry je reprodukovatelně vytvářena visící kapka, která je v pravidelných intervalech obnovována. Vzorek je tak na povrchu elektrody absorbován jen několik sekund, během kterých se vložený potenciál mění jen nepatrně, což omezuje např. změny ve struktuře DNA. Jak v případě DME, tak SMDE je nevýhodou je velká spotřeba analyzovaného materiálu, protože tento způsob měření (polarografie) vyžaduje relativně velké objemy vzorků o poměrně vysoké koncentraci (ve strovnání s technikami využívajícími akumulaci analytu na povrchu stacionární elektrody). - Visící rtuťová kapková elektroda HMDE v tomto případě je celá analýza prováděna na jedné kapce. Silné adsorpce DNA na elektrodě je možné využít při adsorpčních rozpouštěcích technikách včetně přenosových, které umožňují analyzovat i velmi malé množství zředěných vzorku. - Rtuťová filmová elektroda MFE připravuje se vyloučením malého množství rtuti na povrchu tuhé elektrody. - Amalgamové elektrody - pastové nebo pevné amalgámy, což jsou slitiny rtuti a dalšího kovu (Me). Pevné amalgamové elektrody (MeSAE) jsou obecně netoxické. Po potřeby analýzy DNA se nejčastěji používají stříbrné a měděné amalgámy, často pokryté rtuťovým filmem nebo meniskem. Mají velmi podobné elektrochemické vlastnosti jako elektrody rtuťové (zejména vodíkové přepětí), proto je řadíme do této části Pevné pracovní elektrody Pevné pracovní elektrody (kromě výše zmíněných MeSAE) bývají nejčastěji kovové nebo uhlíkové. Na rozdíl od rtuťových elektrod je povrch tuhých elektrod více či méně nehomogenní a je obtížněji obnovovatelný. Povrch je možné obnovovat mechanickým, chemických nebo elektrochemickým čištěním, případně kombinací těchto postupů. Před samotnou analýzou se často používá elektrochemická aktivace opakovanou cyklickou polarizací v určitém potenciálovém rozsahu. Výhodou pevných pracovních elektrod proti elektrodám rtuťovým je možnost použití při pozitivnějších potenciálech a také jejich použití v detektorech pro separační metody (chromatografie, elektroforéza) či pro měření v průtoku. 13

15 Lze je také použít ve formě mikroelektrod ke stanovování látek v biologických objektech. Uhlíkové elektrody se ve srovnání s kovovými elektrodami vyznačují nižším zbytkovým proudem, jsou méně náchylné k oxidaci povrchu a jejich povrch se obvykle snadněji obnovuje. Typy pevných elektrod: - Grafitová elektroda přírodní grafit je porézní materiál, do něhož může vzlínat roztok a geometrický povrch elektrody tak nelze přesně definovat. - Elektroda z pyrolytického grafitu (pyrolytic graphite electrode, PGE) připravuje se pyrolýzou uhlovodíků. Je méně pórovitá než běžný grafit a má vrstevnatou strukturu, což umožuje její použití ve dvou orientacích v orientaci základnové roviny (basal plane) a hranové roviny (edge plane), které mají odlišné vlastnosti. - Elektroda ze skelného uhlíku (glassy carbon) je prakticky nepórovitý a může být vyleštěn do zrcadlového lesku, čímž je jeho geometrický povrch poměrně dobře definovaný. - Uhlíkové pastové elektrody (carbon paste electrode) připravují se smísením uhlíkové pasty s vhodnou hydrofobní elektrochemicky inertní kapalinou. Jejich výhodou je přizpůsobení jejich složení stanovovanému analytu, včetně biologické či chemické modifikace a také snadné obnovení povrchu otřením. - Diamantové elektrody jde o film uhlíku se strukturou diamantu, který je pro zavedení elektrické vodivosti dopován atomy boru. Výhodou tohoto materiálu je mimořádně nízký šum a menší problémy s pasivací, než u jiných uhlíkových elektrod. - Zlaté a platinové elektrody zlato má menší elektrokatalytické účinky než platina a je tedy méně náchylné k otravě katalytickými jedy, proto bývá v elektroanalytické praxi upřednostňováno. Pro imobilizace DNA na povrchu zlaté elektrody se obvykle používají thiolované oligonukleotidy (17). 1.2 Referentní a pomocné elektrody Referentními elektrodami bývají elektrody II. druhu (jsou tvořeny kovem pokrytým vrstvou jeho málo rozpustné soli v roztoku obsahujícím anion této soli), jako jsou argentochloridová, merkurosulfátová či kalomelová elektroda. Pomocné elektrody bývají z inertního materiálu (Pt, C) a ve srovnání s pracovními elektrodami mívají výrazně větší povrch (drátek, plíšek atd.). 14

16 1.3 Elektroanalytické metody Pro analýzu DNA je možné využít celou řadu elektrochemických metod (např. metody potenciostatické, voltametrické). Nejčastěji používanou metodou je voltametrie, a to zejména voltametrie cyklická a voltametrie se superponovanými pravoúhlými napětovými pulsy (square-wave). Voltametrie (nebo polarografie, v případě, kdy pracovní elektrodou je kapající rtuťová kapka) je metoda, při níž se sleduje závislost proudu procházející pracovní elektrodou ponořenou v analyzovaném roztoku na potenciálu, který se na tuto elektrodu vkládá z vnějšího zdroje. Analytickým signálem je velikost proudu procházející obvodem v přítomnosti analytu při vhodném potenciálu. Závislost proudu na elektrodovém potenciálu se měří buď v ustáleném stavu, nebo za nestacionárních podmínek. Voltametrie s lineárně se měnícím potenciálem (LSV) Na pracovní elektrodu se vkládá potenciál, který se lineárně mění s časem. Měří se závislost proudu na vkládaném potenciálu - proudová odezva. Obr. 1: Potenciálový program při LSV Cyklická voltametrie (CV) Na pracovní elektrodu se vkládá potenciál trojúhelníkového průběhu (potenciál nejprve v čase lineárně roste do určité hodnoty potenciál bodu obratu (Esw) - a později opět lineárně klesá). Důležitým faktorem u LSV a CV je rychlost změny potenciálu. V důsledku toho, že difúze je pomalý proces, při dostatečné rychlosti polarizace nestačí produkty elektrodové reakce oddifundovat od elektrody a za vhodných podmínek je možné je při opačném směru potenciálové změny detekovat. Na základě měření při různých rychlostech polarizace lze usoudit na povahu příslušného elektrochemického děje a jeho reversibilitu. 15

17 Obr. 2: Potenciálový program při CV Voltametrie se superponovaným pravoúhlým napětím (square wave, SWV) Na elektrodu se vkládá potenciál lineárně se měnící s časem a ten se moduluje střídavým napětím pravoúhlého tvaru o malé amplitudě a vhodné frekvenci. Proud se měří pouze na konci každého (negativního a pozitivního) vloženého pulsu. Tímto způsobem naměřená hodnota proudu odpovídá prakticky faradaickým dějům na elektrodě, protože kapacitní proud je eliminován, což vede ke zvýšení citlivosti měření. Registruje se závislost rozdílu dvou po sobě změřených vzorcích proudu na potenciálu elektrody. Celé měření je tak sérií potenciálových mikrocyklů, proto je tato metoda vhodná zejména pro studium reverzibilních dějů. Obr. 3: Potenciálový program při SWV 16

18 Voltametrie s vkládaným střídavým napětím (ACV) Potenciál vkládaný na elektrodu, který se lineárně mění s časem, se moduluje střídavým napětím sinusového průběhu o malé amplitudě a nízké frekvenci (desítky až stovky Hz). Měří se závislost střídavého proudu procházejícího elektrodou na jejím potenciálu. Metoda je vhodná ke studiu adsorpčních dějů. Obr. 4: Potenciálový program při ACV Diferenční pulsní voltametrie (DPV) Lineárně se měnící potenciál vkládaný na elektrodu je modifikovaný pravidelně vkládanými pulsy s konstantní amplitudou. Stejně jako u SWV se proud měří pouze po určitou, přesně definovanou dobu před každým pulsem a na konci pulsu. Vynáší se rozdíl těchto proudů proti potenciálu. Zavedení pulsních metod vedlo ke snížení detekčních limitů (18, 19). Obr. 5: Potenciálový program při DPV 17

19 Rozpouštěcí chronopotenciometrie s konstantním prouden CPSA U CPSA se sleduje časový průběh změny potenciálu pracovní elektrody za vnuceného konstantního proudu. Výhodou této metody oproti voltametrickým metodám je možnost provádět měření v katodické oblasti i v elektrolytech obsahujících kyslík. CPSA se v poslední době osvědčila jako metoda vysoce citlivá k určitým katalytickým dějům, např. katalytickému vyvíjení vodíku v přítomnosti proteinů, kterého lze využít k citlivé analýze jejich struktury (20). 1.4 Rozpouštěcí a přenosové techniky Rozpouštěcí voltametrie využívá předběžnou akumulaci analytu z roztoku vzorku na povrchu pracovní elektrody. Tím se koncentrace analytu na povrchu elektrody oproti koncentraci analytu v roztoku o několik řádů zvýší, takže při následném rozpouštění z povrchu elektrody zpět do roztoku je naměřený signál (proud) též vyšší. Touto metodou lze dosáhnout mnohem lepšího limitu detekce, než při prostém měření analytu v roztoku bez akumulace. Akumulaci analytu na elektrodu lze provést buď potenciostatickou elektrolýzou nebo adsorpcí. Podle způsobu akumulace látky na elektrodě a jejího následného rozpouštění rozlišujeme následující metody: - Anodická rozpouštěcí voltametrie (ASV) analyt se nejprve katodicky vylučuje na elektrodě a následně se anodicky rozpouští zpět do roztoku. - Katodická rozpouštěcí voltametrie (CSV) analyt se nejprve anodicky vylučuje na elektrodě a následně se katodicky rozpouští zpět do roztoku. - Adsorpční rozpouštěcí voltametrie (AdSV) analyt se na povrchu elektrody akumuluje adsorpcí při určitém potenciálu nebo i při otevřeném obvodu. Pokud jsou adsorbované látky elektrochemicky aktivní, lze je stanovit pomocí jejich oxidačních/redukčních signálů. Pokud jsou elektrochemicky neaktivní, mohou se při dosažení určitého potenciálu desorbovat, což se projeví tzv. tensametrickým píkem, který lze rovněž analyticky využít. Tensametrický pík odpovídá kapacitnímu proudu procházejícímu elektrodou při změně kapacity elektrické dvojvrstvy při desorpci. 18

20 Protože se nukleové kyseliny velmi dobře adsorbují na povrch rtuťových i uhlíkových elektrod, je při jejich elektrochemické analýze AdSV hojně využívána. Zavedení této techniky v 70. letech 20. století vedlo ke značnému rozvoji elektrochemické analýzy DNA v důsledku zvýšení citlivosti stanovení a také zmenšením spotřeby analytického materiálu, který nebylo snadné připravit ve větších množstvích. K dalšímu zvýšení citlivosti a selektivity voltametrického stanovení přispívá oddělení akumulačního a detekčního kroku. Naadsorbování DNA na rtuťovou nebo uhlíkovou pracovní elektrodu je možné provést z malého objemu vzorku (obvykle několik l), elektroda s naadsorbovanou DNA je následně opláchnuta vodou, základním elektrolytem nebo vhodným činidlem schopným odstranit rušící látky a přenesena do základního elektrolytu, kde je provedeno elektrochemické stanovení (8). Tato metoda se označuje jako adsorptivní přenosová rozpouštěcí voltametrie (AdTSV). K výhodám AdTSV patří značné snížení spotřeby vzorku, možnost akumulace DNA z roztoků, které neumožňují elektrochemické stanovení, snadné odstranění řady rušících látek v promývacím kroku a v neposlední řadě i možnost využití elektrod s adsorbovanou vrstvou DNA jako jednoduchých elektrochemických biosenzorů (7). Obr. 6: Schéma AdTSV: 1 akumulace vzorku, 2 promytí, 3 měření 19

21 2 Elektrochemické vlastnosti nukleových kyselin Elektrochemická analýza je využívána ke studiu přirozených i modifikovaných molekul DNA i oligonukleotidů. Elektrochemická stanovení dosahují citlivosti přinejmenším srovnatelné s optickými metodami a často lepší selektivitu při nižších pořizovacích a provozních nákladech. Molekula DNA je elektroaktivní a je možné ji detekovat na rtuťových i uhlíkových elektrodách (21). Při detekci se využívá jak oxidačně-redukčních vlastností NK, tak i charakteristických adsorpčně-desorpčních dějů na povrchu elektrod. Pro detekci DNA je možné využít celé řady elektrochemických metod. Je možné využít jak klasická polarografická a voltametrická měření, LSV, CV, SWV (22, 23), CSV (24), pulsní techniky jako diferenční pulsní polarografie (25), tak i fázově citlivé techniky jako impedanční spektroskopie (26) a ACV (4). Z galvanostatických metod se osvědčila rozpouštěcí chronopotenciometrie s konstantním proudem (27). 2.1 Elektrochemické chování DNA na rtuťových elektrodách Při potenciálech větších než +0,1 V (proti Ag AgCl 3M KCl; všechny hodnoty potenciálů v této práci jsou vztaženy na argentchloridovou referentní elektrodu) dochází k elektrolytickému rozpouštění rtuti, proto jsou rtuťové elektrody preferovány pro sledování katodických dějů. Anodické jevy lze sledovat pouze v případě, že probíhají při potenciálech nižších než přibližně 0,0 V Redoxní děje na rtuťových elektrodách Z přirozených složek NK lze na povrchu rtuťových elektrod ve vodném prostředí redukovat cytosin, 5-methylcytosin (28), adenin a guanin. Cytosin, 5-methylcytosin a adenin v DNA se redukují při potenciálu okolo -1,5 V (v závislosti na ph elektrolytu) a poskytují katodický pík CA (7). Guanin se redukuje při potenciálech zápornějších, než -1,6 V. Redukční pík není na voltamogramech pozorovatelný, protože při takto záporných potenciálech dochází k vylučování vodíku na povrchu elektrody a proudové signály příslušející tomuto procesu jsou mnohem výraznější než redukce guaninu. Na voltamogramu můžeme pozorovat anodický pík G při potenciálu -0,25 V příslušející oxidaci 7,8-dihydrogenguaninu generovaného redukcí guaninu (21, 29, 30) (obr. 7). Redukce thyminu (nebo uracilu v RNA) na povrchu rtuti bylo pozorována pouze v nevodném prostředí (dimethylsulfoxid) při velmi negativních potenciálech (31). 20

22 Přístupnost zbytků bází je silně závislá na struktuře DNA. Zatímco v ssdna jsou báze volně přístupné, v dsdna jsou redukční místa bazí skryty uvnitř dvoušroubovice a nemohou volně komunikovat s prostředím ani s povrchem elektrody (Obr. 8). V důsledku toho se elektrochemické signály ssdna a dsdna na rtuťové elektrodě značně liší G -0.1 I / A CA E [V] Obr. 7: Cyklický voltamogram DNA z telecího brzlíku na HMDE Obr. 8: Primární redukční (modrý rámeček) a oxidační (červený kroužek) místa bází nukleových kyselin Adsorpčně-desorpční děje na rtuťových elektrodách Nukleové kyseliny jsou na povrchu rtuťových i amalgámových elektrod silně adsorbovány, čehož lze, kromě aplikace adsorptivních přenosových technik, využít i pro 21

23 přípravu elektrod modifikovaných nukleovými kyselinami. Adsorpčně-desorpční děje, jimž NK podléhají na rtuťových elektrodách při vkládání negativních potenciálů, vedou ke vzniku tensametrických signálů, které poskytují řadu informací o vlastnostech studovaných NK (především o jejich struktuře) (3, 4, 21). Při vkládání negativních potenciálů na povrch elektrody dochází k elektrostatickému odpuzování záporně nabité cukrfosfátové páteře molekul NK a za určitých podmínek dochází k desorpci těchto molekul nebo jejich částí z povrchu elektrody. Tím se mění diferenciální kapacita elektrodové dvojvrstvy a v důsledku toho se objevují zmiňované tensametrické signály. Charakter těchto signálů závisí na tom, která část molekuly se se adsorpčně-desorpčních dějů účastní, a to dále závisí na jejich struktuře (3). Vhodným nástrojem pro studium adsorpčně-desorpčních dějů a strukturních změn DNA na povrchu rtuťových kapkových elektrod nebo amalgámových pevných elektrod je AC voltametrie. V katodickém AC voltamogramu lze pozorovat sérii tenzametrických píků, které souvisí a adsorpcí/desorpcí molekul DNA na elektrodě. Při potenciálech okolo -1,2 V dochází k desorpci cukr-fosfátové páteře DNA, která se projevuje vznikem píku označovaného jako pík 1 (Obr. 9). Při potenciálu okolo -1,4 V dochází k desorpci molekul DNA adsorbovaných na povrchu elektrody prostřednictvím bází. Tento tensametrický pík je pozorován pouze tehdy, pokud je molekula DNA jednořetězcová nebo obsahuje jednořetězcové úseky (Obr. 9). V případě dsdna, která obsahuje volné konce, byl při potenciálu okolo -1,2 V (tzv. U- region) pozorován jev označovaný jako povrchová denaturace (32, 33). Jedná se o odvíjení molekuly DNA řízené potenciálem elektrody. Kromě píků 1 a 3 byl identifikován i pík 2 okolo -1,3 V (často se částečně překrývá s píkem 1), který lze pozorovat při konformačních změnách v dsdna (34). Jak již bylo řečeno, tensametrické signály na rtuťových elektrodách mohou být využity jako vysoce citlivý nástroj na sledování i velmi malých změn struktury DNA, jako jsou například odvinutí dvoušroubovice, tvorba jedno- i dvouřetězcových zlomů apod. Tyto změny struktury vedou ke zvýšení přístupnosti zbytků bází, která se projeví na jejich voltametrických signálech. (3, 4, 21, 34, 35). 22

24 scdna dsdna ssdna I/ A E/V Obr. 9: AdTS ACV superhelikální DNA (sc, černá), lineární dvouřetězcová DNA (ds, modrá) a jednořetězcové DNA (ss, červená). Pík 1 odpovídá desorpci cukr-fosfátové páteře, pík dva odpovídá desorpci bází 2.2 Elektrochemické chování DNA na uhlíkových elektrodách Uhlíkové elektrody na rozdíl od elektrod rtuťových umožňují sledovat i oxidační procesy probíhající při kladných potenciálech. Oxidace purinových bází na povrchu uhlíkové elektrody byla objevena v 70. letech 20. století (36-39). Oxidace guaninu probíhá při potenciálech (v závislosti na ph) okolo +1,0 V o poskytuje pík G ox, oxidace adeninu probíhá při potenciálech okolo +1,2 V o poskytuje pík A ox (Obr. 10). Oxidace pyrimidinových bází probíhá v závislosti na experimentálních podmínkách při ještě pozitivnějších potenciálech (okolo +1,3 V) (40, 41). Měření oxidačních píků pyrimidinových bází v polynukleotidovém řetězci je tak poměrně obtížné. Z tohoto důvodu jsou analyticky využívány obvykle pouze oxidační píky purinů. Ve srovnání s redukčními a tenzametrickými píky DNA na rtuťových a amalgamových elektrodách nejsou oxidační píky tolik citlivé na změnu sekundární struktury dsdna (41). Změny oxidačních píků purinů je možné využít při studiu interakcí DNA s různými činidly. Tvorba reakčního produktu mezi bází a interagující látkou obvykle vede k poklesu oxidačního píku této báze. Osvědčilo se zejména sledování píku G ox, protože 23

25 guanin je vůči většině činidel reaktivnější než ostatní báze. Příkladem těchto reakcí je například reakce s oxidačními činidly, která vede k oxidaci guaninu na 8-oxoguanin, který má nižší oxidační potenciál než guanin a při potenciálu píku G ox už žádný signál neposkytuje (40) I/ A 4 2 G ox A ox E/[V Obr. 10: AdTS SWV ssdna na elektrodě z pyrolytického grafitu (křivky po odečtení základní linie). 3 Elektrochemické značení nukleových kyselin Přestože nukleové kyseliny jsou elektrochemicky aktivní, a jejich oxidačně-redukční signály i tensametrické píky je možné použít pro celou řadu analytických aplikací, v jiných případech je často výhodné použít elektrochemické značení. Jako značky se využívají látky, které lze velmi dobře elektrochemicky detekovat, jako jsou například komplexy přechodných kovů (6, 42, 43), antrachinon (13), benzofurazan (12), nitro a aminosloučeniny (15) atd. Tyto látky podléhají redoxním reakcím a dávají takto modifikované DNA nové elektrochemické vlastnosti, které je možné využít pro studium struktury a interakcí nukleových kyselin. Díky těmto značkám lze snadno analyzovat přítomnost a množství modifikované DNA ve vzorku a to i v nadbytku neznačené DNA. Další nespornou výhodou použití značení DNA je možnost stanovení DNA i pomocí elektrod, na kterých přirozená DNA žádné analyticky využitelné redoxní signály neposkytuje (např. zlato) (44-46). Využití kombinace více druhů elektrochemických značek (s nepřekrývajícími se potenciály redoxních píků) umožuje specifické redoxní kódování nukleotidových sekvencí pro jejich paralelní stanovení (47), nebo dokonce kódování jednotlivých nukleobází (48-50). 24

26 Značená DNA se dá s výhodou použít pro přípravu hybridizačních sond, což jsou úseky DNA o specifické sekvenci, které mohou hybridizovat se sekvencí cílové DNA. Tímto způsoben může být detekována např. přítomnost mutací v různých klinických vzorcích (podrobněji v kapitole 4.1). 3.1 Nekovalentně se vázající redoxní indikátory Nekovalentně se vázající indikátory se používají především k rozlišení dsdna a ssdna imobilizované na povrchu elektrody. Indikátory se váží na DNA buď na základě elektrostatické interakce mezi indikátorem (který je obvykle kationtem) a polyanionickým řetězcem NK nebo se jedná o látky, které se interkalují do dvoušroubovice DNA. Mezi látky používané jako nekovalentně se vázající indikátory patří řada látek známých jako protinádorová léčiva (daunomycin (51), echinomycin (52)), organocyklických sloučenin (methylenová modř (53, 54), antrachinon (55, 56)) a kovových komplexů (57-60). Pro zvýšení citlivosti rozlišení mezi ssdna a dsdna bylo zavedeno používání threading (provlékacích) (61, 62) a bis-interkalátorů (63). Např. threading interkalátory mají jednu část, která se interkaluje a k této části jsou připojeny dvě objemné skupiny, které omezují vmezeření interkalující se skupiny do DNA. Jejich vazba na DNA je kineticky blokována, ale jakmile k ní dojde, je velmi stabilní. Příkladem takovéhoto interkalátoru je ferocenylnaftalendiimid, který byl použit např. jako indikátor mutací v genu pro p53 (64). 3.2 Kovalentně se vážící elektrochemické značky Další skupinou elektrochemických značek jsou látky, které se kovalentně vážou na DNA. Mezi tyto látky patří například ferocen, který se používá pro přípravu hybridizačních sond a k analýzám specifických bodových mutací (46, 65, 66), a také komplexy přechodných kovů, zejména ruthenia a osmia (67, 68). Mezi nejdéle používané elektrochemické značky pro DNA (už od 80. let minulého století) patří komplexy oxidu osmičelého s dusíkatými ligandy (Os,L, kde L je například 2,2 bipyridin nebo pyridin) (69, 70). Tyto komplexy se v DNA kovalentně vážou na pyrimidinové báze, přednostně na thymin (10, 11, 34, 71). Reakce Os,L s pyrimidinovými bázemi je konformačně specifická a v nativní dsdna ze sterických důvodů téměř neprobíhá. Proto je možné tyto látky použít jako citlivé sondy pro studium lokálních struktur, ve kterých 25

27 se vyskytují nespárované nukleotidy (10, 72, 73). Adukty Os,L s DNA lze detekovat na různých typech elektrod (69, 73-76). Na rtuťových a některých amalgámových elektrodách poskytuje DNA modifikovaná Os,bipy v neutrálním a kyselém ph trojici reversibilních signálů v rozmezí 0 až 1 V a signál katalytického vylučování vodíku při 1,3 V (obr. 11) (77). Na uhlíkových elektrodách rovněž podléhají jak volné Os,L, tak i adukty Os,L-DNA několika faradaickým procesům odpovídajícím postupné redukci/oxidací atomu osmia. Bylo ukázáno, že Os,bipy DNA adukt poskytuje specifický pík na PGE, který se potenciálové liší od píku volného komplexu (rozdíl 140 mv) (78). Tato skutečnost dovoluje stanovit DNA- Os,bipy i ve zbytkovém množství volného Os,bipy. Obr. 11: Schéma redoxních potenciálů přirozené DNA (CA C a A redukce, G guaninový signál na HMDE, G ox, A ox, C ox, T ox - oxidace nukleobazí), 7-deazapurinů (G *ox, A *ox ) a příkladů elektroaktivních značek. Převzato z (48). 26

28 3.3 Enzymatická inkorporace elektrochemicky značených nukleotidů Další možností elektrochemického značení DNA a oligonukleotidů je enzymatická inkorporace chemicky modifikovaných nukleotidů. První zprávu o inkorporaci značených dutp a rutp podal Langer už v roce 1981 (79). S využitím různých enzymů došlo k různě úspěšné inkorporaci v pozici 5 biotinem značených dutp a rutp. Nejúspěšnější byla inkorporace du bio TP pomocí E. Coli Pol1, nejméně pak byly úspěšné pokusy o zařazení ru bio TP pomocí RNA polymeráz. Nukleosidtrifosfáty modifikované na zbytku báze elektroaktivní skupinou je možné připravit např. Sonogashira (80-83) nebo Suzuki-Miyaura (84-86) cross-coupling reakcí s halogenovanými nukleosidtrifosfáty, případně nukleosidy, které jsou následně trifosforylovány (87-91). Příklad takovéto reakce je na Obr. 12. Pro značení DNA se používají nukleotidy modifikované elektroaktivními skupinami, které je možné elektrochemicky stanovit i ve velmi nízké koncentraci a které poskytují signály při potenciálech mimo oblast vybíjení elektrolytu a elektrodových dějů odpovídajícím redukci či oxidaci přirozených nukleobází. Pro řadu analytických aplikací je výhodou, pokud jsou redoxní změny elektroaktivní skupiny reverzibilní a/nebo pokud při jejich elektrochemické přeměně dochází k přenosu většího počtu elektronů, zajišťující vyšší citlivost stanovení. Z těchto hledisek se v naší laboratoři osvědčily např. antrachinon (13) ferocen (14) (oba vykazují reverzibilní elektrochemii), nitro skupina (15) (redukuje se ireverzibilně čtyřmi elektrony na hydroxylamin, který lze reverzibilně oxidovat na nitroso skupinu), nebo benzofurazan (12) (poskytuje ireverzibilní šestielektronovou redukci). 27

29 Obr. 12: Schéma přípravy dntp modifikovaných propargylkarbamoylantrachinonem. i) PAQ, [Pd(PPh3)2Cl2], CuI, (ipr)2etn, DMF, 1 h, 75 C. ii) PAQ, Pd(OAc)2, TPPTS, CuI, (ipr)2etn, CH3CN:H2O (2:1), 1 h, 75 C. Převzato z (13) Pro přípravu oligonukleotidů s inkorporovanými modifikovanými nukleotidy se používá metoda prodlužování primeru (PEX). Při této metodě je pomocí různých DNA polymeráz prodlužován řetězec DNA od 5 konce ke 3 konci. Syntéza probíhá sekvenčně specificky podle templátu (Obr. 13). DNA polymerázy dokáží inkorporovat jak přirozené, tak i vhodně chemicky modifikované nukleotidy (48). Kromě DNA polymeráz závislých na templátu je známá polymeráza schopná katalyzovat prodloužení řetězce DNA bez použití templátu, tzv. terminální deoxynukleotidyltransferáza (TdT). Pomocí tohoto enzymu je možné připravit DNA nebo oligonukleotidy značené na 3 konci modifikovanými nukleotidy, často v delších jednořetězcových přesazích (tail-labeling) (92). Bylo zjištěno, že účinnost zařazování nepřirozených dntp pomocí TdT nezávisí na jejich vodíkových vazbách nebo interakci mezi jejich π elektrony navzájem, ale hlavně na absolutní velikosti. Neschopnost zařazovat objemné nepřirozené dntp nejspíše vyplývá ze sterického bránění (93). 28

30 Obr. 13: Schéma přípravy jedno- nebo dvouřetězcových oligonukleotidů značených elektroaktivní skupinou (X), vázanou v tomto případě na A metodou prodlužování primeru 3.4 Magnetoseparační techniky Pro separaci a purifikaci produktů PEX nebo jiných metod značení DNA se často využívají magnetoseparační techniky. Tyto techniky využívají magnetický nosič (nejčastěji paramagnetické částice), na který je DNA po inkubaci s interagujícími činidly navázána. Částice s navázanou DNA jsou promyty vhodnými činidly a DNA je následně z nosiče uvolněna (např. zahřátím). Na magnetický nosič lze DNA ukotvit pomocí vhodného adaptoru. V praxi se uplatňují zejména systém streptavidin(avidin) biotin, kde se DNA s navázaným biotinem váže na magnetické částice nesoucí streptavidin, nebo hybridizace oligo(a) sekvence připojené ke studované DNA s oligo(t) sekvencí kovalentně vázanou na povrchu nosiče (94-96) (Obr. 14). Magnetoseparační techniky umožňují rychlou a účinnou separaci DNA z reakční směsi a ve spojení s AdTS voltametrií představují citlivou metodu pro stanovení velmi malého množství DNA i v nadbytku interferujících látek. 29

31 Obr. 14: Schéma separace DNA pomocí magnetických částic s navázaným streptavidinem (DBstr) 4 Elektrochemické biosenzory Senzor je zařízení, které snímá danou veličinu (většinou fyzikální nebo chemickou) a transformuje ji fyzikálním převodem na veličinu výstupní. V případě elektrochemických senzorů je senzor tvořen elektrodou, která je napojena na elektrický zdroj a vyhodnocovací zařízení. Pokud se jedná o biosenzory, je součástí elektrody biologický materiál (tzv. biorekogniční prvek), kterým může být např. DNA, enzym, protein a další (97). První biosenzor byl navržen už v šedesátých letech 20. století L. C. Clarkem. Jedná se o biosenzor na stanovení množství glukózy na základě její oxidace enzymem glukosaoxidázou (98). Tento senzor tvoří glokózooxidáza imobilizovaná na povrch kyslíkové elektrody pomocí dialyzační membrány. Enzym je schopný katalyzovat oxidaci glukózy, což je spojeno s úbytkem kyslíku. Ten byl měřen pomocí kyslíkové elektrody a změna jeho koncentrace odpovídala koncentraci glukózy ve vzorku. V případě elektrochemického senzoru pro hybridizaci NK je biorekogničním prvkem hybridizační sonda, analytem komplementární cílové vlákno a převodníkem signálu pracovní elektroda, na které je sonda imobilizována. 4.1 Elektrochemické biosenzory pro detekci hybridizace DNA Hybridizací NK se rozumí tvorba dvoušroubovice NK ze dvou komplementárních vláken. Techniky molekulární hybridizace využívají specifický úsek NK hybridizační sondu o známé sekvenci bází k detekci komplementárního vlákna NK. Za vhodných podmínek může 30

32 dojít k vytvoření dvoušroubovice mezi sondou a cílovým řetězcem NK přítomným v analyzovaném vzorku. Pro konstrukci hybridizačního biosenzoru jsou důležité výběr pracovní elektrody a detekční strategie a s nimi související způsob imobilizace sondy na povrch elektrody a blokování povrchu elektrody proti nespecifické adsorpci NK a dalších látek (3, ). Jako senzory se v oblasti detekce hybridizace NK používají pevné pracovní elektrody, zejména elektrody uhlíkové a zlaté Imobilizace hybridizační sondy na povrchu elektrod Hybridizační sondu lze na uhlíkových elektrodách zakotvit buď prostou fyzikální adsorpcí, nebo kovalentně. Fyzikální adsorpce (používaná zejména pro elektrody z pyrolytického grafitu a uhlíkové pastové elektrody) nezajišťuje specifickou orientaci zakotveného vlákna, ale vlákno na povrchu leží. Takto připravený senzor je poměrně nestabilní a může dojít k desorpci sondy z povrchu. I přes tyto potenciální nevýhody byly takto připravené senzory úspěšně využity a to zejména v experimentech využívajících krátké časy hybridizace za nízkých teplot a pro experimentální uspořádání, kdy je na povrch elektrody adsorbována přímo cílová DNA a ta je hybridizována se značenou sondou (68). Ke kovalentnímu zakotvení sondy na povrchu uhlíkových elektrod se využívá úprava povrchu elektrody nebo přímo elektrodového materiálu (např. modifikovaná uhlíková pasta) (102). Lze využít např. derivátů karbodiimidu, který zprostředkuje vazbu mezi aminoskupinami DNA a funkčními skupinami na povrchu elektrod (např. elektrochemicky generované karboxylové skupiny). Takto lze imobilizovat jak přirozené NK, tak NK koncově modifikované primární alifatickou aminoskupinou (tyto se na povrch elektrody vážou orientovaně a mohou se účinněji hybridizovat). Další možností imobilizace NK na povrch elektrody je imobilizace NK koncově značené vhodným adaptorem (např. biotinem) na elektrodu modifikovanou vhodným afinitním partnerem k danému adaptoru (např. streptavidinem). Pro zakotvení hybridizačních sond na povrchu zlatých elektrod se využívá zejména interakce thiolových skupin kovalentně navázaných na jednom konci syntetických oligonukleotidů s povrchem zlaté elektrody. Za vhodných experimentálních podmínek lze tímto způsobem připravit vysoce samoorganizovanou monovrstvu označovanou jako SAM 31

33 (self-assambled monolayer) ( ). Pro optimální citlivost detekce hybridizace je důležité optimální pokrytí povrchu elektrody sondou. Pro dosažení optimální hustoty pokrytí sondou a také pro zablokování volného povrhu elektrody se využívá derivátů thioalkanů (např. 6- mercapto-1-hexanol) Detekční principy využívané v elektrochemických senzorech pro hybridizaci DNA 1. Využití vlastní elektrochemické aktivity NK Vlastní elektrochemické aktivity bází NK lze využít v případě, kdy se obsah některé báze v sondě a cílové DNA výrazně liší. Nejčastěji se využívá oxidačního signálu guaninu, příp. adeninu (např. (106)). 2. Impedanční měření Elektroda s imobilizovanou ssdna vykazuje jinou diferenciální kapacitu než elektroda nesoucí dsdna, takže při vzniku duplexu dojde ke změně vlastností elektrické dvojvrstvy. Tuto změnu je možné detekovat. Pro sledování změn hustoty náboje na povrchu elektrody při tvorbě duplexu lze využít měření redoxních signálů anionických depolarizátorů (např. komplexy železa Fe II /Fe III ) (104). 3. Elektroaktivní indikátory Tato metoda využívá elektrochemicky aktivní látky, která se s vysokou preferencí váží na dsdna, zejména interkalátory a bis-interkalátory (viz kapitola 3.1). Vznik dsdna se projeví nárůstem signálu interkalátoru (52, 62). 4. Využití elektroaktivních značek Na cílovou DNA nebo na signální hybridizační sondu je kovalentně navázána vhodné elektrochemická značka (viz kapitola 3.2) (42, 47, 74). 5. Elektrochemický molekulární maják Na povrchu elektrody je za jeden konec zakotvena sonda, která zaujímá strukturu vlásenky (107). Na druhém konci je navázána elektrochemicky aktivní značka. Pokud je sonda v podobě vlásenky, značka se nachází v blízkosti povrchu elektrody a je elektrochemicky detekovatelná. Pokud dojde k hybridizaci, vznikne lineární duplex, čímž 32

34 dojde k oddálení značky od elektrody a elektrochemický signál značky poklesne, zmizí vypnutí signálu ( signal off ) v důsledku proběhnutí sledovaného děje. 6. Signální sondy značené enzymy Výhodou značení NK enzymy je amplifikace signálu, kdy jedna molekula enzymu může katalyzovat přeměnu velkého množství substrátu na elektrochemicky aktivní produkt, který je elektrochemicky stanovován. Enzymovou značku lze navázat na NK pomocí biotin-streptavidinové technologie (68, 108, 109). 7. Značení DNA pomocí nanočástic Jako nanočástice se obvykle označují částice o průměru od 1 do 100 nm. Tyto částice mají charakteristické fyzikální a chemické vlastnosti, které závisí na jejich materiálu, rozměru, tvaru a případně na použité stabilizující látce (110). Vhodná nanočástice (obvykle zlatá, stříbrná nebo např. ze sulfidů zinku nebo kadmia) se naváže na konec cílového vlákna NK ( ). Po hybridizaci a separaci mohou být nanočástice rozpuštěny a příslušný kov je elektrochemicky stanoven. Aplikace nanočástic zajišťuje vysokou citlivost detekce, protože cílová DNA nese větší počet elektrochemicky aktivních molekul nebo atomů tvořících příslušnou částici. 4.2 Elektrochemické senzory pro detekci mutací a polymorfismů Analýza odchylek v lidském genomu má význam z hlediska včasné diagnostiky určitých onemocnění a prevence jejich šíření. Elektrochemické metody mohou sloužit jako rychlý a levný nástroj k detekci mutací v molekule DNA. Tyto metody využívají hybridizaci studované DNA se sondou, proto jsou použitelné pouze v případech, kdy je dané onemocnění charakterizováno mutací ve známé sekvenci DNA. V tomto případě je analyzovaná sekvence DNA hybridizována se sondou navrženou speciálně pro odhalení testované mutace. Při hybridizaci může dojít ke dvěma situacím. Buď dvoušroubovici vytvoří dva plně komplementární řetězce a vzniká homoduplex, nebo navržená sonda není plně komplementární s cílovou DNA a vzniká heteroduplex. Heteroduplex je oproti homoduplexu méně stabilní a snáze se denaturuje. Čím je v duplexu více nekomplementárních míst, tím je duplex méně stabilní. Pokud se provede hybridizace za vysoce stringentních podmínek (vyšší 33

35 teplota, nižší iontová síla), je výtěžek příslušného heteroduplexu nižší, než výtěžek homoduplexu, což se projeví snížením měřeného signálu. V krajním případě heteroduplex vůbec nevznikne. V minulosti bylo zjištěno, že je DNA schopná přenášet elektrony prostřednictvím - elektronů aromatických zbytků bazí zapojených do systému stohových (stacking) interakcí uvnitř šroubovice ( ). Schopnost DNA přenášet náboj je výrazně eliminována až potlačena, jsou-li v duplexu DNA přítomny chybně spárované nebo nespárované báze. Tohoto jevu lze využít pro studium bodových mutací. Např. Kelley a spol. využívá systém, kdy je duplex DNA zakotvený jedním koncem na elektrodě a zprostředkovává přenos elektronů mezi elektrodou a redox aktivním interkalátorem vázaném na druhém konci duplexu (119). Pro detekci mutací je také možné využít protein MutS, který se váže na chybně spárované nebo nespárovaná baze v molekule DNA. MutS vázaný na heteroduplexy lze elektrochemicky stanovit (120, 121). Další strategií na detekci mutací v molekule DNA je minisekvenování, které využívá metodu prodlužování primeru (viz kapitola 3.3). K cílové sekvenci je připojen primer navržený tak, aby končil těsně před místem předpokládané mutace. K reakční směsi je přidán elektroaktivně značený nukleosid trifosfát komplementární k očekávané mutaci a vhodná DNA polymeráza. Pokud DNA obsahuje mutaci, dojde k zařazení značeného nukleotidu do DNA a ten je elektrochemicky detekován. V principu lze pracovat se čtyřmi různými značenými dntp a v jednom kroku tak zjistit všechny možné varianty změny v sekvenci (122). Tuto metodu je možné aplikovat přímo na povrchu elektrody (123) nebo ve spojení s dvoupovrchovými technikami založenými na magnetických mikročásticích (124). 34

36 Cíle dizertační práce 1. Prozkoumat elektrochemické vlastnosti nových potenciálních elektroaktivních značek pro DNA, zejména takových, které poskytují reverzibilní nebo multielektronové redoxní děje na rtuťových nebo uhlíkových elektrodách 2. Prozkoumat elektrochemické vlastnosti syntetických oligonukleotidů nebo DNA modifikovaných novými typy elektroaktivních značek 3. Nalézt podmínky umožňující současnou detekci dvou nebo více elektroaktivních modifikací DNA pro využití v analýze nukleotidových sekvencí 35

37 Seznam publikací (1) Vidlakova, P.; Pivonkova, H.; Fojta M.; Havran, L.: Electrochemical behavior of anthraquinone- and nitrophenyllabeled deoxynucleoside triphosphates: a contribution to development of multipotential redox labeling of DNA. Monatshefte fur Chemie 2015, 146, (2) Balintova, J.; Plucnara, M.; Vidlakova, P.; Pohl, R.; Havran, L.; Fojta, M.; Hocek, M.: Benzofurazane as a New Redox Label for Electrochemical Detection of DNA: Towards Multipotential Redox Coding of DNA Bases. Chemistry-a European Journal 2013, 19, (3) Balintova, J.; Pohl, R.; Horakova, P.; Vidlakova, P.; Havran, L.; Fojta, M.; Hocek, M.: Anthraquinone as a Redox Label for DNA: Synthesis, Enzymatic Incorporation, and Electrochemistry of Anthraquinone-Modified Nucleosides, Nucleotides, and DNA. Chemistry-a European Journal 2011, 17, (4) Dadova, J.; Vidlakova, P.; Pohl, R.; Havran, L.; Fojta, M.; Hocek, M.: Aqueous Heck Cross-Coupling Preparation of Acrylate-Modified Nucleotides and Nucleoside Triphosphates for Polymerase Synthesis of Acrylate-Labeled DNA. Journal of Organic Chemistry 2013, 78, (5) Horakova, P.; Tesnohlidkova, L.; Havran, L.; Vidlakova, P.; Pivonkova, H.; Fojta, M.: Determination of the Level of DNA Modification with Cisplatin by Catalytic Hydrogen Evolution at Mercury-Based Electrodes. Analytical Chemistry 2010, 82,

38 Výsledky a diskuse 1. Elektrochemické chování antrachinonen a nitrofenylskupinou značených nukleosid trifosfátů Vidlakova, P.; Pivonkova, H.; Fojta M.; Havran, L.: Electrochemical behavior of anthraquinone- and nitrophenyllabeled deoxynucleoside triphosphates: a contribution to development of multipotential redox labeling of DNA. Monatshefte fur Chemie 2015, 146, Přestože je přirozená DNA sama o sobě elektrochemicky aktivní a je možné ji stanovit na různých typech elektrod (21, 125), je pro řadu analytických aplikací praktické použít DNA značenou elektroaktivními molekulami. Tyto látky podléhají redoxním reakcím a dávají tak modifikované DNA nové elektrochemické vlastnosti. Takto značené molekuly mohou být využity v biologických, medicínských i nanotechnologických aplikacích. Při studiu struktury, poškození i interakcí DNA může být výhodné použít několik elektrochemických značek současně. V naší práci jsme studovali elektrochemické chování datp a dctp značených antrachinonem nebo nitrofenylskupinou za různých podmínek a také možnost stanovit je současně. Elektrochemické chování nukleosidtrifosfátů značených antrachinonem nebo nitroskupinou bylo studováno pomocí CV na HMDE. Pro elektrochemické chování antrachinonu je charakteristická dvouelektronová redoxní chinon/hydrochinon přeměna. V katodické větvi cyklického voltamogramu antrachinon poskytuje pík AQ red při potenciálu okolo -0,4 V, příslušející redukci antrachinonu na antrahydrochinon. V anodické větvi cyklického voltamogramu je patrný pík AQH2 ox příslušející zpětné oxidaci antrahydrochinonu (obr.15 A,B). Intenzita píku AQH2 ox závisí na potenciálu bodu obratu. Intenzita tohoto píku je největší při potenciálech bodu obratu -0,6 - -1,2 V, při potenciálech zápornějších než -1,4 V výška píku prudce klesá a při potenciálech zápornějších než -1,6 V pík AQH2 ox na voltamogramu nepozorujeme (Obr. 16). Nitroskupina během CV na HMDE poskytuje za daných podmínek při potenciálu okolo - 0,45 V katodický pík NO2 red, příslušející čtyřelektronové redukci nitroskupiny na hydroxylamin. Takto vzniklý hydroxylamin je při potenciálu kolem 0,0 V dvouelektronově 37

39 reverzibilně oxidován a poskytuje anodický pík NHOH ox (Obr. 15 C,D). Intenzita píku NHOH ox je také závislá na potenciálu bodu obratu, ale s posunem bodu obratu k negativnějším potenciálům klesá mnohem méně, než intenzita píku AQH2 ox (Obr. 16). Zkoumali jsme možnost současného stanovení antrachinonu a nitroskupiny. Vzhledem k blízkým hodnotám potenciálu redukce obou skupin jsou katodické píky antrachinonu a nitrofenylové skupiny často velmi obtížně rozlišitelné. Protože je však redukce nitroskupiny ireverzibilní a neposkytuje žádný oxidační signál v oblasti potenciálů, kde by interferoval s oxidací antrahydrochinonu. Produkt ireverzibilní redukce nitroskupiny navíc poskytuje oxidační signál NHOH ox, jehož potenciál se od potenciálu píku AQH2 ox liší o cca 400 mv a tudíž se oba signály neovlivňují. Obr. 15: CV dc PAQ TP (A), da PAQ TP (B), dnc NO 2 TP (C) a dnano 2 TP (D) na HMDE základní elektrolyt 0,3 M mravenčan amonný, 0,05 M fosforečnan sodný, ph 6,9, počáteční potenciál 0,05 V, potenciál obratu -1,85 V (přerušovaná čára), počáteční potenciál 0,05 V, potenciál bodu obratu -0,6 V (plná čára). 38

40 Ip/ A AQH ox 2 (dcpaq TP) NHOH ox (dc PhNO2 TP) Esw/V Obr 16: Závislost intenzity píku AQH2 ox (černá čára) a píku NHOH ox (červená čára) na potenciálu bodu obratu. 2. Benzofurazan jako redoxní značka pro analýzu DNA Balintova, J.; Plucnara, M.; Vidlakova, P.; Pohl, R.; Havran, L.; Fojta, M.; Hocek, M.: Benzofurazane as a New Redox Label for Electrochemical Detection of DNA: Towards Multipotential Redox Coding of DNA Bases. Chemistry-a European Journal 2013, 19, Tato práce se zabývá použitím benzofurazanu jako redoxní značky pro analýzu sekvence DNA. Benzofurazan je známý pro svoje fluorescenční vlastnosti ( ) a použití v organických elektronických materiálech (129), ale pro značení DNA zatím nebyl používán. S využitím cross-coupling reakcí byly připraveny datp a dctp s benzfurazanem vázaným buď přímo na bazi (Obr.17A), nebo přes acetylenový linker (Obr. 17B). Tyto dntp byly následně PEX reakcí s využítim KOD XL polymerázy inkorporovány do ON. Elektrochemické vlastnosti značených dntp a oligonukleotidů byly studovány pomocí cyklické a square wave voltametrie na HMDE a PGE. V případě CV na HMDE jsou v cyklickém voltamogramu neznačených ODN měřeném při počátečním potenciálu 0 V a potenciálu bodu obratu -1,85 V patrné dva signály příslušející elektrochemickým reakcím bází. Jedná se o katodický pík CA při potenciálu okolo -1,5 V příslušející ireverzibilní redukci cytosinu a adeninu a anodický pík G při potenciálu -0,25 V příslušející oxidaci 7,8- dihydrogenguaninu generovaného redukcí guaninu při potenciálech nižších než -1,6 V (21, 108). Ve voltamogramech značených oligonukleotidů je kromě píků příslušejících redoxním reakcím bazí i pík benzofurazanu (Obr. 18). Benzofurazan podléhá elektrochemické redukci a poskytuje intenzivní ireverzibilní katodický pík BF red v oblasti mezi -0,7 a -0,85 V (HMDE) nebo mezi -0,9 a -1,0 V (PGE). 39

41 Obr. 17: Schéma přípravy dntp modifikovaných benzfurazanem. A: i), iii) BF-B(OH)2 (1), Pd(OAc)2, 3,3,3 -phosphanetriyltris(benzenesulfonic acid) trisodium salt (TPPTS), Cs2CO3, CH3CN/H2O (1:2), 1 h, 75 C. ii) 1) PO(OMe)3, POCl3, 0 C; 2) (NHBu3)2H2P2O7, Bu3N, DMF, 0 C; 3) triethylammonium bicarbonate (TEAB). B: i) BF-C CH (2), [Pd(PPh3)2Cl2], (ipr)2etn, CuI, DMF, 1 h, 75 C; ii) 2, Pd(OAc)2, TPPTS, (ipr)2etn, CuI, CH3CN/H2O (1:2), 1 h, 75 C. Obr. 18: CV na HMDE oligonukleotidů značených benzfurazanem vázaným přímo na bázi (BF)nebo přes acetylenový linker (EBF) a kontroly, kdy do reakční směsi nebyla přidána polymeráza. Kromě PEX produktů značených pouze benzofurazanem byly připraveny i oligonukleotidy značené benzofurazanem (C BF ) a nitrofenyl skupinou (A NO2 ) současně. Tyto produkty byly opět analyzovány pomocí CV a SWV na HMDE a PGE. Nitroskupina podléhá redukci na hydroxylamin a poskytuje intenzivní pík NO2 red v oblasti okolo -0,45 V, což je o cca 300 mv pozitivnější, než redukce benzofurazanu (Obr. 19). Intenzita píků BF red a NO2 red 40

42 velmi dobře koresponduje s počtem značek v oligonukleotidu i s počtem elektronů účastnících se redukce (6 u BF a 4 u NO2) a může být použita pro sekvenční analýzu DNA, například při detekci mutací, založenou na stanovení poměru dvou značených nukleobazí. Obr. 19: CV na HMDE (A) a SWV na PGE (B) oligonukleotidů značených benzofurazanem a nitrofenyl skupinou. 3. Antrachinon jako redoxní značka pro analýzu DNA Balintova, J.; Pohl, R.; Horakova, P.; Vidlakova, P.; Havran, L.; Fojta, M.; Hocek, M.: Anthraquinone as a Redox Label for DNA: Synthesis, Enzymatic Incorporation, and Electrochemistry of Anthraquinone-Modified Nucleosides, Nucleotides, and DNA. Chemistrya European Journal 2011, 17, V této práci prezentujeme metodu značení DNA s využitím datp a dctp modifikovaných propargylkarbamoylantrachinonem (PAQ) a ethynylantrachinonem (EAQ). Modifikované nukleosidtrifosfáty byly připraveny Sonogashira cross-coupling reakcí 2- ethynylantrachinonu a N-(-2-propynyl)-antrachinoncarboamidu s halogenovanými nukleosidtrifosfáty. Modifikované dntp byly pomocí PEX metody s využitím KOD XL DNA polymerasy inkorporovány do oligonukleotidů. Takto připravené oligonukleotidy byly 41

43 přečištěny pomocí streptavidinových magnetických kuliček a následně elektrochemicky analyzovány. Elektrochemické chování PEX produktů značených antrachinonem bylo studováno pomocí cyklické voltametrie a square wave voltametrie na HMDE a PGE. V případě CV na HMDE jsou v cyklickém voltamogramu neznačených ODN měřeném při počátečním potenciálu 0 V a potenciálu bodu obratu -1,85 V patrné dva signály příslušející elektrochemickým reakcím bází. Jedná se o katodický pík CA při potenciálu okolo -1,5 V příslušející ireverzibilní redukci cytosinu a adeninu a anodický pík G při potenciálu -0,25 V příslušející oxidaci 7,8-dihydrogenguaninu generovaného redukcí guaninu při potenciálech nižších než -1,6 V (21, 108). Na cyklickém voltamogramu ODN značených antrachinonem je kromě píků CA a G v katodické větvi dobře vyvinutý pík v potenciálové oblasti okolo -0,4 V příslušející redukci antrachinonu (Obr. 20A ). V krátkém skenu CV (počáteční potenciál 0 V, potenciál bodu obratu -0,8 V, který není dostatečně negativní pro redukci guaninu) měřeném na HMDE nebo PGE neznačené ODN neposkytují žádný signál, zatímco ODN značené antrachinonem poskytují signály příslušející reverzibilní redukci antrachinonu (Obr.20B ). Obr. 20 : AdTS CV PEX produktů na HMDE - základní elektrolyt 0,3 M mravenčan amonný, 0,05 M fosforečnan sodný, ph 6,9, A - počáteční potenciál 0.0 V, potenciál obratu V, B - počáteční potenciál 0.0 V, potenciál bodu obratu -0,8 V. Na square wave voltamogramu nemodifikovaných ODN měřeném na PGE jsou patrné dva píky příslušející oxidacím bází guaninu G ox v oblasti okolo 1,2 V a adeninu A ox v oblasti okolo 1,4 V. V případě ODN značených antrachinonem je na voltamogramu kromě signálů příslušejících adeninu a guaninu v DNA patrný i pík antrachinonu při potenciálu okolo -0,4 V (Obr. 21). 42

44 neznačené s antrachinonem G ox A ox I/ A 6 AQ E [V] Obr. 21: AdTS SWV PEX produktů na PGE základní elektrolyt 0,2 M acetátový pufr, ph 5, počáteční potenciál -1 V, konečný potenciál 1,6 V. V této práci prezentujeme metodu značení DNA s využitím nukleosidtrifosfátů modifikovaných antrachinonem. Značenou DNA je možné velmi dobře elektrochemicky detekovat na různých typech elektrod. Výhodou antrachinonu jako elektrochemické značky je reverzibilita jeho redoxních změn. Tato vlastnost je výhodná zejména při konstrukci biosenzorů s DNA kovalentně vázanou na povrch pevných elektrod (např. zlatých), protože umožňuje provádět více elektrochemických měření s jednou navázanou DNA. 4. Příprava nukleosid trifosfátů modifikovaných butylakrylátem pro polymerázovou syntézu značené DNA Dadova, J.; Vidlakova, P.; Pohl, R.; Havran, L.; Fojta, M.; Hocek, M.: Aqueous Heck Cross- Coupling Preparation of Acrylate-Modified Nucleotides and Nucleoside Triphosphates for Polymerase Synthesis of Acrylate-Labeled DNA. Journal of Organic Chemistry 2013, 78, Tato práce se zabývá přípravou dntp modifikovaných butylakrylátem a využitím těchto dntp ke značení DNA inkorporací pomocí DNA polymeráz. Butylakrylátem modifikované nukleosidy, nukleosid monofosfáty a nukleosid trifosfáty byly připraveny cross-coupling reakcemi n-butylakrylátu s jodovanými nukleosidy a nukleosid trifosfáty (Obr. 22). Zatímco syntéza du BA, da BA a dg BA probíhala velmi dobře s vysokými výtěžky, dc I vykazoval mnohem nižší reaktivitu a výtěžek reakce byl nízký (okolo 14%). 43

45 Připravené dn BA TP byly použity pro syntézu značených oligonukleotidů metodou prodlužování primeru s využitím KOD XL, Vent(exo - ) a Pwo polymeráz. Zatímco da BA TP, dc BA TP, du BA TP byly všemi polymerázami bez komplikací začleňovány, dg BA TP polymerázovou reakci inhiboval a značený oligonukleotid nevznikal. Obr. 22: Schéma přípravy dntp modifikovaných butylakrylátem: (i) butyl acrylate, Pd(OAc)2, PPh3, Et3N, DMF; (ii) butyl acrylate, Pd(OAc)2, TPPTS, Et3N, CH3CN/H2O (1:1); (iii)po(ome)3, POCl3, 0 C; (iv) (1) PO(OMe)3, POCl3, 0 C, (2) NHBu3)2H2P2O7, Bu3N, DMF, 0 C, (3) 2 M TEAB; (v) butyl acrylate, Pd(OAc)2, TPPTS, Et3N, CH3CN/H2O (1:1). Jelikož dc BA TP bylo obtížné připravit a dg BA TP inhibovalo polymerázovou reakci, byly pro studium elektrochemického chování oligonukleotidů značených butylakrylátem připraveny PEX produkty s inkorporovanými A BA a U BA. Značené nukleosidy i oligonukleotidy byly studovány pomocí cyklické voltametrie na HMDE. Na Obr.23A,B jsou cyklické voltamogramy modifikovaných nukleosidů a nukleosid monofosfátů. da BA a da BA MP poskytují dva elektrochemické signály pík odpovídající redukci A okolo - 1,43 V a pík příslušející redukci butylakrylátu BA red okolo -1,3 V. V cyklickém voltamogramu du BA a du BA MP je pouze signál odpovídající redukci butylakrylátu, protože redukce uracilu není na HMDE detekovatelná. V souladu s předchozími studiemi redukce karbonylových sloučenin ( ) lze předpokládat, že primárním místem redukce butylakrylátu bude dvojná vazba C=C. 44

46 V cyklickém voltamogramu ODN (Obr. 23C) jsou patrné dva signály příslušející elektrochemickým reakcím bází. Jedná se o katodický pík CA při potenciálu okolo -1,5 V příslušející ireverzibilní redukci cytosinu a adeninu a anodický pík G při potenciálu - 0,25 V (21, 108). Ve voltamogramu oligonukleotidů s inkorporovaným A BA nebo U BA (4 BA v jednom ON) je navíc signál příslušející redukci butylakrylátu BA red při potenciálu - 1,4 V (stejný potenciál pro obě modifikované báze). Obr 23: Cyklické voltamogramy da BA, da BA MP (A), du BA, du BA MP (B) a značených i neznačených oligonukleotidů (C) Z výsledků naší studie vyplývá, že je možné připravit dntp modifikované butylakrylátem a s výjimkou dg BA TP je možné je inkorporovat do DNA a elektrochemicky detekovat. Butylakrylát lze pomocí voltametrie na HMDE velmi dobře detekovat díky vzniku redukčního signálu při potenciálu okolo -1,4 V, což je méně negativní potenciál než je redukce C a A. Zároveň je to výrazně negativnější potenciál, než u ostatních dosud navržených značek (12-15, 133), takže by bylo možné tuto značku použít i pro značení DNA více značkami současně. 45

47 5. Stanovení stupně modifikace DNA cisplatinou s využítím katalytického vylučování vodíku na rtuťových elektrodách Horakova, P.; Tesnohlidkova, L.; Havran, L.; Vidlakova, P.; Pivonkova, H.; Fojta, M.: Determination of the Level of DNA Modification with Cisplatin by Catalytic Hydrogen Evolution at Mercury-Based Electrodes. Analytical Chemistry 2010, 82, Cisplatina patří společně s dalšími komplexy platiny oxaliplatinou a carboplatinou mezi cytostatika používaná k léčbě různých druhů nádorů (134). Tyto látky se mohou kovalentně vázat na molekuly nukleových kyselin a vytvářet různé adukty (135). Nejčastějším vazebným místem platinových derivátů je guanin. V naší práci byla použita voltametrická analýza na rtuťových elektrodách pro studium DNA modifikované cisplatinou s využitím katalytického vylučování vodíku doprovázející redoxní jevy u těchto aduktů. Ke studiu modifikace DNA cisplatinou byla používána square wave voltametrie a cyklická voltametrie. V připadě CV byly měřeny voltamogramy nemodifikované a silně platinované DNA. V případě cyklického voltamogramu nemodifikované DNA byly naměřeny dva signály příslušející elektrochemickým reakcím bází DNA. Jedná se o katodický pík CA v oblasti -1,5 V příslušející ireverzibilní redukci cytosinu a adeninu a pík G příslušející oxidaci 7,8-dihydrogenguaninu generovaného redukcí guaninu při potenciálech menších než -1,6 V. V případě DNA modifikované cisplatinou dojde ve voltamogramu k viditelným změnám. V katodické části dochází k růstu proudu v oblasti kolem -1,2 V. Negativní proud dosahuje maxima v -1,75 V a tvoří široký pík. V anodické části voltamogramu jsou patrné tři vlny (okolo -1.75, a -1.3 V), v oblasti mezi -1,53 až -1,18 V má anodická část voltamogramu stejnou polaritu jako katodická část. Toto chování souvisí s katalytickým vyvíjením vodíku při s elektrochemických reakcích platinované složky DNA. Zároveň je ve voltamogramu s nárůstem stupně platinace patrné snižování intenzity píku G a jeho posun do negativnějších potenciálů. Pro podrobnější studii signálů příslušejících platinované DNA byla použita square wave voltametrie. Byly naměřeny voltamogramy nemodifikované DNA a DNA modifikované cisplatinou do různých rb (poměr cisplatina/nukleotid). Ve voltamogramu DNA modifikované cisplatinou jsou patrné dva signály, pík G v oblasti -0,26 V, který koresponduje se signálem ve voltamogramu nemodifikované DNA a pík P v oblasti -1,25 V, který je charakteristický 46

48 pro platinou modifikovanou DNA. Intenzita tohoto píku koresponduje se stupněm modifikace a roste lineárně přibližně do rb 0,12 (Obr 24). Obr. 24: (A) SWV nemodifikované DNA a DNA modifikované cisplatinou do různého rb, (B) závislost intenzity píku P na koncentraci cisplatiny V této práci byla prokázána možnost analytického využití katalytických proudů souvisejících s redoxními procesy platinované složky DNA v průběhu anodické polarizace následující po pre-redukci platinou modifikované DNA na HMDE. Z této studie vyplývá, že při modifikaci DNA cisplatinou je možné voltametricky stanovit i modifikace do nízkého stupně (rb 0,01). 47

49 Závěr Tato práce je zaměřena na chemickou modifikaci a značení oligonukleotidů a nukleových kyselin elektrochemicky aktivními molekulami a studium elektrochemického chování značených oligonukleotidů s využitím různých voltametrických metod a různých typů elektrod. Hlavní část práce je zaměřena na studium vlastností dntp s kovaletně vázanými elektroaktivními molekulami (antrachinon, nitrofenol, benzofurazan, butylakrylát). U těchto látek bylo pomocí cyklické a square wave voltametrie studováno elektrochemické chování za různých podmínek na rtuťových a uhlíkových elektrodách. Bylo zjištěno, že všechny tyto látky lze velmi dobře elektrochemicky detekovat a to jak samostatně, tak i více značek současně. Modifikované dntp byly pomocí polymerázových reakcí inkorporovány do oligonukleotidů a následně byly pomocí elektrochemických metod studovány jejich vlastnosti. DNA polymerázy jsou do oligonukleotidového řetězce schopné začlenit jak přirozené, tak i chemicky modifikované dntp, což umožňuje připravit oligonukleotid značený elektrochemickými (nebo třeba i fluorescenčními) značkami. Tento způsob elektrochemického značení lze využít při konstrukci různých biosenzorů pro detekci hybridizace, poškození i bodových mutací DNA. 48

50 Seznam literatury 1. Palecek E Naturwissenschaft 45: Miller IR J Mol Biol 3: Palecek E, Fojta M Bioelectronics: From Theory to Applications: Fojta M Collect Czech Chem Comm 69: Palecek E, Jelen F Crit Rev Anal Chem 32: Vacek J, Havran L, Fojta M Chemicke Listy 105: Palecek E, Bartosik M Chem Rev 112: Palecek E, Postbieglova I J Electroanal Chem 214: Palecek E Methods in Enzymology 212: Palecek E Method Enzymol 212: Jelen F, Karlovsky P, Makaturova E, Pecinka P, Palecek E Gen Physiol Biophys 10: Balintova J, Plucnara M, Vidlakova P, Pohl R, Havran L, et al Chem-Eur J 19: Balintova J, Pohl R, Horakova P, Vidlakova P, Havran L, et al Chem-Eur J 17: Brazdilova P, Vrabel M, Pohl R, Pivonkova H, Havran L, et al Chem-Eur J 13: Cahova H, Havran L, Brazdilova P, Pivonkova H, Pohl R, et al ANGEW CHEM INT EDIT 47: Hocek M, Fojta M Org Biomol Chem 6: Herne TM, Tarlov MJ J Am Chem Soc 119: Bond AM, Grabaric BS Anal Chem 51: Bond AM, Grabaric BS, Jones RD, Rumble NW J Electroanal Chem 100: Palecek E, Tkac J, Bartosik M, Bertok T, Ostatna V, Palecek J Chem Rev 115: Palecek E, Jelen F In Electrochemistry of Nucleic Acids and Proteins: Towards Electrochemical Sensors for Genomics and Proteomics, ed. E Palecek, F Scheller, J Wang, pp Jelen F, Tomschik M, Palecek E J Electroanal Chem 423: Bartosik M, Palecek E Electroanalysis 23: Palecek E Anal Biochem 108: Palecek E, Frary BD Arch Biochem Biophys 115: Strasak L, Dvorak J, Hason S, Vetterl V Bioelectrochemistry 56: Palecek E, Tomschik M, Stankova V, Havran L Electroanalysis 9: Bartosik M, Fojta M, Palecek E Electrochim Acta 78: Trnkova L, Studnickova M, Palecek E Bioelectrochemistry and Bioenergetics 7: Palecek E, Fojta M, Jelen F Bioelectrochemistry 56: Cummings TE, Elving PJ J Electroanal Chem 102: Fojta M, Bowater RP, Stankova V, Havran L, Lilley DMJ, Palecek E Biochemistry 37: Palecek E Bioelectrochemistry and Bioenergetics 28: Fojta M Electroanalysis 14: Palecek E Progress in nucleic acid research and molecular biology 18: Brabec V, Dryhurst G J Electroanal Chem 91: Brabec V, Dryhurst G J Electroanal Chem 89: Brabec V Bioelectrochemistry and Bioenergetics 8: Dryhurst G, Pace GF J Electrochem Soc 117: 1259-& 49

51 40. Oliveira-Brett AM, Piedade JAP, Silva LA, Diculescu VC Anal Biochem 332: Boussicault F, Robert M Chem Rev 108: Fojta M, Havran L, Kizek R, Billova S, Palecek E Biosens & Bioelectron 20: Vrabel M, Horakova P, Pivonkova H, Kalachova L, Cernocka H, et al Chemistry-a European Journal 15: Surkus A-E, Flechsig G-U Electroanalysis 21: Peter J, Reske T, Flechsig G-U Electroanalysis 19: Flechsig GU, Peter J, Hartwich G, Wang J, Grundler P Langmuir 21: Fojta M, Kostecka P, Trefulka MR, Havran L, Palecek E Anal Chem 79: Hocek M, Fojta M Chem Soc Rev 40: Simonova A, Balintova J, Pohl R, Havran L, Fojta M, Hocek M Chempluschem 79: Balintova J, Plucnara M, Vidlakova P, Pohl R, Havran L, et al Chemistry-a European Journal 19: Cheng GF, Zhao J, Tu YH, He PA, Fang YH Anal Chim Acta 533: Jelen F, Erdem A, Palecek E Bioelectrochemistry 55: Kerman K, Ozkan D, Kara P, Meric B, Gooding JJ, Ozsoz M Anal Chim Acta 462: Gu JY, Lu XJ, Ju HX Electroanalysis 14: Wong ELS, Gooding JJ Anal Chem 75: Yamana K, Kawakami N, Ohtsuka T, Sugie Y, Nakano H, Saito I Nuc ac res Millan KM, Saraullo A, Mikkelsen SR Anal Chem 66: Erdem A, Meric B, Kerman K, Dalbasti T, Ozsoz M Electroanalysis 11: Maruyama K, Mishima Y, Minagawa K, Motonaka J Anal Chem 74: Mugweru A, Wang BQ, Rusling J Anal Chem 76: Tansil NC, Xie H, Xie F, Gao ZQ Anal Chem 77: Takenaka S, Ohtuka K, Miyahara H, Nojima T, Takagi M Nuc ac res Xie H, Tansil NC, Gao ZQ Frontiers in Bioscience-Landmark 11: Miyahara H, Yamashita K, Kanai M, Uchida K, Takagi M, et al Talanta 56: Nakayama M, Ihara T, Nakano K, Maeda M Talanta 56: Umek RM, Lin SW, Vielmetter J, Terbrueggen RH, Irvine B, et al J Mol Diagnost 3: Vrabel M, Hocek M, Havran L, Fojta M, Votruba I, et al Eur J Inorg Chem: Fojta M, Brazdilova P, Cahova K, Pecinka P Electroanalysis 18: Palecek E, Hung MA Anal Biochem 132: Lukasova E, Jelen F, Palecek E Gen Physiol Biophys 1: Reske T, Surkus A-E, Duwensee H, Flechsig G-U Microchim Acta 166: Palecek E Crit Rev Biochem Mol 26: Jacobsen M, Flechsig G-U Electroanalysis 25: Fojta M, Havran L, Billova S, Kostecka P, Masarik M, Kizek R Electroanalysis 15: Kostecka P, Havran L, Pivonkova H, Fojta M Bioelectrochemistry 63: Trefulka M, Ferreyra N, Ostatna V, Fojta M, Rivas G, Palecek E Electroanalysis 19: Yosypchuk B, Heyrovsky M, Palecek E, Novotny L Electroanalysis 14: Fojta M, Havran L, Kizek R, Billova S Talanta 56: Langer PR, Waldrop AA, Ward DC Proc Natl Acad Sci USA 78: Capek P, Cahova H, Pohl R, Hocek M, Gloeckner C, Marx A Chem-Eur J 13: Capek P, Pohl R, Hocek M Organic & Biomolecular Chemistry 4: Cristalli G, Vittori S, Eleuteri A, Volpini R, Camaioni E, et al J Med Chem 38: Casalnuovo AL, Calabrese JC J Am Chem Soc 112: Capek P, Pohl R, Hocek M Org Biomol Chem 4: Western EC, Daft JR, Johnson EM, Gannett PM, Shaughnessy KH J Org Chem 68:

52 86. Western EC, Shaughnessy KH J Org Chem 70: Kuwahara M, Nagashima J-i, Hasegawa M, Tamura T, Kitagata R, et al Nuc Ac Res 34: Gramlich PME, Warncke S, Gierlich J, Carell T Angew Chem Int Ed 47: Nucleoside Triphosphates and their Analogs: Chemistry, Biotechnology, and Biological Applications 90. Hocek M, Fojta M Organic & Biomolecular Chemistry 6: Jager S, Rasched G, Kornreich-Leshem H, Engeser M, Thum O, Famulok M J Am Chem Soc 127: Horakova P, Macickova-Cahova H, Pivonkova H, Spacek J, Havran L, et al Org Biomol Chem 9: Berdis AJ, McCutcheon D Chembiochem 8: Wang J, Xu DK, Erdem A, Polsky R, Salazar MA Talanta 56: Palecek E, Fojta M Talanta 74: Palecek E, Kizek R, Havran L, Billova S, Fojta M Analytica Chimica Acta 469: Grieshaber D, MacKenzie R, Voeroes J, Reimhult E Sensors 8: Clark LC, Lyons C ANN NY ACAD SCI 102: 29-& 99. Labuda J, Oliveira Brett AM, Evtugyn G, Fojta M, Mascini M, et al Pure Appl Chem 82: Wang J Electrochemistry of Nucleic Acids and Proteins: Towards Electrochemical Sensors for Genomics and Proteomics 1: Tarlov MJ, Steel AB Biomolecular Films: Design, Function, and Applications 111: Drummond TG, Hill MG, Barton JK Nat Biotechnol 21: Zhao YD, Pang DW, Hu S, Wang ZL, Cheng JK, Dai HP Talanta 49: Keighley SD, Li P, Estrela P, Mighorato P Biosens Bioelectron 23: Levicky R, Herne TM, Tarlov MJ, Satija SK J Am Chem Soc 120: Hason S, Pivonkova H, Vetterl V, Fojta M Anal Chem 80: Palecek E Trends in Biotechnology 22: Fojta M, Havran L, Vojtiskova M, Palecek E J Am Chem Soc 126: Won BY, Lee DW, Shin SC, Cho D-Y, Lee SS, et al Biosensors & Bioelectronics 24: Niemeyer CM, Simon U Eur J Inorg Chem: Wang J Electrochemistry of Nucleic Acids and Proteins: Towards Electrochemical Sensors for Genomics and Proteomics 1: Wang J, Xu DK, Kawde AN, Polsky R Anal Chem 73: Authier L, Grossiord C, Brossier P, Limoges B Anal Chem 73: Wang J, Liu GD, Polsky R, Merkoci A Electrochem Commun 4: Bixon M, Jortner J Chem Phys 281: Delaney S, Barton JK J Org Chem 68: Treadway CR, Hill MG, Barton JK Chem Phys 281: Boon EM, Barton JK CURR OPIN STRUC BIOL 12: Kelley SO, Boon EM, Barton JK, Jackson NM, Hill MG Nucleid Acid Res 27: Palecek E, Masarik M, Kizek R, Kuhlmeier D, Hassmann J, Schulein J Anal Chem 76: Masarik M, Cahova K, Kizek R, Palecek E, Fojta M Anal Bioanal Chem 388: Di Giusto DA, Wlassoff WA, Giesebrecht S, Gooding JJ, King GC J Am Chem Soc 126: Patolsky F, Lichtenstein A, Willner I Nat Biotechnol 19: Patolsky F, Weizmann Y, Katz E, Willner I Angew Chem In Ed 42: Palecek E Talanta 56: Goncalves MST In Advanced Flourescence Reporters in Chemistry and Biology I: Fundamentals and Molecular Design, ed. AP Demchenko, pp

53 127. Uchiyama S, Santa T, Imai K Analyst 125: Rohacova J, Luisa Marin M, Martinez-Romero A, Diaz L, Enrique O'Connor J, et al Chemmedchem 4: Zhang B, Hu X, Wang M, Xiao H, Gong X, et al New J Chem 36: Zimmer JP, Richards JA, Turner JC, Evans DH Anal Chem 43: 1000-& 131. Klemm LH, Olson DR J Org Chem 44: Fahr T, Petr A, Dunsch L Ber Bunsenges Phys Chem 101: Vrabel M, Horakova P, Pivonkova H, Kalachova L, Cernocka H, et al Chem-Eur J 15: Hrubisko M Bratislavske lekarske listy 88: Kasparkova J, Vrana O, Farrell N, Brabec V J Inorg Biochem 98:

54 Monatsh Chem (2015) 146: DOI /s ORIGINAL PAPER Electrochemical behavior of anthraquinone- and nitrophenyllabeled deoxynucleoside triphosphates: a contribution to development of multipotential redox labeling of DNA Pavlína Vidláková Hana Pivoňková Miroslav Fojta Luděk Havran Received: 5 December 2014 / Accepted: 2 February 2015 / Published online: 25 February 2015 Ó Springer-Verlag Wien 2015 Abstract Electrochemical properties of base-modified cytosine or 7-deazaadenine nucleoside triphosphates (dntps) bearing electrochemically active anthraquinone or 3-nitrophenyl moieties were studied using cyclic voltammetry with the hanging mercury drop electrode. The anthraquinone moiety in the dntps gives well-pronounced reversible quinone/hydroquinone redox signals around V (against Ag AgCl 3M KCl reference electrode), while the nitro group in 3-nitrophenyl exhibits irreversible reduction to hydroxylamine around V that can be reversibly oxidized to corresponding nitroso compound close to 0.0 V. Both anthraquinone and hydroxylamine redox groups can be selectively switched off by further electrochemical transformation, depending on negative potential applied and composition of the background electrolyte. Results of this study suggest that both nucleobase and the conjugate label moiety influence remarkably the adsorbability and/or intermolecular interactions taking part at the electrode surface. The potential analytical utilization of these phenomena is discussed. P. Vidláková H. Pivoňková M. Fojta L. Havran (&) Institute of Biophysics, Academy of Sciences of the Czech Republic, v.v.i., Kralovopolska 135, Brno, Czech Republic raven@ibp.cz M. Fojta Central European Institute of Technology, Masaryk University, Kamenice 753/5, Brno, Czech Republic Graphical abstract Ip/μA AQH ox 2 (dcpaq TP) NHOH ox (dc PhNO 2 TP) Esw/V Keywords Nucleoside triphosphate DNA labeling DNA electrochemistry Anthraquinone Nitro compounds Cyclic voltammetry Introduction Labeling of nucleic acids (NA) by various electroactive tags is of broad interest to scientists in connection with the development of electrochemical methods and biosensors for NA analysis, such as analysis of nucleotide sequences or sensing of DNA damage (reviewed in [1 3]). Redox labels can be introduced into NA via chemical phosphoramidite-based synthesis of oligonucleotides, by chemical modification of natural NA components (such as thymine residues in DNA by osmium tetroxide reagents [4] or3 0 - terminal ribose in RNA by six-valent osmium complexes [5]), or enzymatically using polymerases and labeled (deoxy)nucleoside triphosphates [(d)ntps] as monomer substrates. The latter approach has proved especially efficient and versatile for the preparation of not only the redoxlabeled DNA, but also DNA bearing fluorophores [6, 7] or chemically reactive groups for further chemical transformations on DNA [8, 9] or for bioconjugation with proteins 123

55 840 P. Vidláková et al. [10]. A number of modified dntp bearing diverse electrochemically active moieties, such as ferrocene [11], organic nitrocompounds [12], [Ru/Os-(bpy) 3 ] complexes [13], anthraquinone [14], benzofurazane [15], methoxyphenol [16], phenylazide [8], and others (reviewed in [2, 17]), have been developed and applied. A combination of these labels (to encode different nucleotide sequences, or even each nucleobase with different tags being electrochemically reduced or oxidized at different potentials) allows parallel analysis of multiple nucleotide sequences [18], typing of sequence polymorphisms [12, 13], or a simple monitoring of the conversion of one redox tag to another, e.g., to probe interactions of the modified DNA with proteins [8]. Anthraquinone (AQ), as a moiety exhibiting well-pronounced reversible electrochemistry [19 21], has been utilized for redox labeling of biomolecules [22 24]. Derivatives of AQ linked via various tethers to nucleosides were used, for example, to study DNA-mediated charge transfer [25 27]. Base-modified cytosine and 7-deazaadenine dntps bearing the AQ labels have recently been developed and used for polymerase synthesis of AQmodified oligodeoxynucleotides, and utilization of the AQ tags for dual redox labeling of DNA in combination with earlier introduced nitrophenyl (PhNO 2 ) labels in simple model applications have been tested [14]. However, a more detailed study of electrochemical properties of oligodeoxyribonucleotides (ODNs) bearing AQ or PhNO 2 groups, or their combination, is to date missing. In this paper, we present a comparative study of base-modified AQ or PhNO 2 dntp conjugates using cyclic voltammetry with the hanging mercury drop electrode. Results and discussion In our previous study [14], anthraquinone-labeled dctp and 7-deaza-dATP were synthesized and used for DNA labeling via incorporation of corresponding nucleotides into ODNs by DNA polymerases (for general methodologies of this strategy of modified nucleic acids construction, see reviews [2, 17, 28]). Electrochemical measurements revealed the modified ODNs to give well-developed signals due to reversible redox electrochemistry of the AQ moiety. Experiments focused on simultaneous detection of the AQ tags with another type of organic electrochemically active moieties attached to nucleobases in modified ODNs, 3-nitrophenyl [12], indicated possibilities of using the two labels for convenient dual DNA labeling when optimum conditions for their distinction are applied. Namely, conversion of the PhNO 2 group into the corresponding hydroxylamine derivative (PhNHOH) via irreversible fourelectron reduction of the nitro group facilitated resolution of AQ and PhNO 2 signals when anodic responses were measured [14]. Cyclic voltammetry of AQ-dNTP conjugates Here, we studied in more detail the electrochemical behavior of AQ and PhNO 2 -labeled dntps, dc PAQ TP, da PAQ TP, dc PhNO 2 TP, and da PhNO 2 TP. Cyclic voltammograms (CVs) of these four compounds at concentrations of 40 lm, measured in 0.3 M ammonium formate, 0.05 M sodium phosphate, ph 6.9 (a medium optimized for electrochemical analysis of DNA at mercury electrodes, suitable for simultaneous detection of natural electroactive DNA components [1, 3]) without pre-accumulation of the analytes, are presented in Fig. 1. Red curves correspond to CVs measured with initial potential E i = 0.0 V and switching potential E sw =-0.85 V, while black dotted curves were obtained for E sw =-1.85 V. Both AQ-dNTP conjugates (Fig. 1a, b), when measured with E sw = V, gave a pair of peaks around -0.4 V corresponding to the reversible anthraquinone/anthrahydroquinone redox system: AQ + 2 e +2H þ $ AQH 2 ð1þ The behavior of dc PAQ TP (Fig. 1a) was nevertheless in some respects different from that of da PAQ TP (Fig. 1b). First, a considerable difference in the heights of cathodic peak AQ red and anodic peak AQH ox 2 (the latter being 3 times higher than the former for 40 lm dc PAQ TP; see concentration dependences for further discussion) was observed for dc PAQ TP, while for da PAQ TP the intensity of the cathodic peak AQ red was about 3.5-times higher compared to the analogous signal of dc PAQ TP, and the anodic peak AQH ox 2 of da PAQ TP was higher by only 33 % as compared to the peak AQ red of the same conjugate (Table 1; compare also solid curves in Fig. 2a, where details of the voltammograms are shown). Second, peak-topeak separation for the AQ/AQH 2 redox process was 19 mv in dc PAQ TP and 48 mv in da PAQ TP, suggesting more facile electron transfer in the first instance. Third, for da PAQ TP, clearly developed second pair of peaks at potentials more negative by 27 mv were observed. Differences in the relative intensities of the anodic and cathodic peaks of dc PAQ TP and da PAQ TP can be attributed to different adsorbabilities of the two conjugates, with the da PAQ TP adsorbing at the mercury surface more efficiently. The experiment, the results of which is shown in Fig. 2, supports such explanation: when dc PAQ TP was allowed to accumulate at the electrode surface with open current circuit for 60 s before the CVs were measured, the height of the peak AQ red increased by about three times. Peak AQH ox 2 became significantly higher after pre-accumulation and its height was practically the 123

56 Electrochemical behavior of dntps 841 Fig. 1 Cyclic voltammograms of dc PAQ TP (a), da PAQ TP (b), dc PhNO2 TP (c), and da PhNO2 TP (d). Cyclic voltammetry (CV) at HMDE: E i?0.0 V (a, b), or?0.1 (c, d), E sw or V, scan rate 1 V/s, background electrolyte: 0.3 M ammonium formate, 0.05 M sodium phosphate, ph 6.9, and concentration of all substances was 40 lm Table 1 Heights and potentials of peaks AQ red and AQH 2 ox obtained for da PAQ TP and dc PAQ TP and of peaks NO 2 red and NHOH ox for da PhNO2 TP and dc PhNO2 TP Peak AQ red ox AQH 2 Potential/V Height/lA Potential/V Height/lA da PAQ TP dc PAQ TP Peak NO 2 red NHOH ox Potential/V Height/lA Potential/V Height/lA da PhNO2 TP dc PhNO2 TP same as the height of the peak AQ red. The da PAQ TP exhibited similar effects upon the accumulation, giving wide cathodic and anodic peaks in which the two reversible pairs (distinguishable in CV measured without accumulation, Fig. 2) were clearly merged. When the CVs were measured with the E sw =-1.85 V (i.e., with a setup previously used in DNA analysis to reduce guanine residues and obtain an anodic peak G of guanine at the mercury electrode [1, 3, 14]), the anodic peak AQH 2 ox disappeared in both dc PAQ TP and da PAQ TP, suggesting a deeper reduction of the AQ moiety upon applying the highly negative potentials. Blocking of the electrode surface by the reduction products then probably prevents fresh dn PAQ TP from the bulk of solution to give peak AQH 2 ox in the anodic scan. The dc PAQ TP conjugate (Fig. 1a) exhibited rather complicated behavior in a potential region between -0.9 and -1.7 V, producing several, under the given conditions, irreversible peaks in 123

57 842 P. Vidláková et al. I/µA I/µA a E/V b AQH ox 2 AQH ox AQ red AQ red 2 da PAQ TP t a = 0 s da PAQ TP t a = 60 s dc PA Q TP t a = 0 s dc PA Q TP t a = 60 s dc PAQ TP 1 st scan dc PAQ TP 2 nd scan dc PAQ TP 3 rd scan E/V Fig. 2 a Effects of adsorptive pre-accumulation (0 or 60 s at open current circuit) on CV responses of dc AQ TP and da PAQ TP. b Repeated CV scans of dc PAQ TP (without pre-accumulation, E i?0.1 V, E sw -0.6 V, scan rate 1 V/s, and other conditions as in Fig. 1) Ip/µA AQH ox 2 (dcpaq TP) NHOH ox (dc PhNO2 TP) E sw /V Fig. 3 Dependence of the intensity of peaks AQH 2 ox and NHOH ox on switching potential (dc PAQ TP and dc PhNO2 TP, CV at HMDE, other conditions as in Fig. 1) the cathodic scan that could be ascribed to reduction processes of ethynyl and carbamoyl groups in the linker, the above proposed reduction of the anthrahydroquinone (see the dependence of peak AQH 2 ox height on E sw in Fig. 3, showing a steep decrease of the peak current between -1.1 V and -1.6 V), reduction of cytosine as well as tensammetric processes of the negatively charged dntps on the negatively charged surface (note the sharp spike at V, Fig. 1a). On the contrary, da PAQ TP yielded only one well-developed cathodic peak under the same conditions (peak A red, Fig. 1b), which can be ascribed to reduction of the 7-deazaadenine nucleobase. Differences between the two dntps may be due to different adsorption modes (see above), influencing availability of different electroreducible groups for electronic communication with the electrode. Taken together, the shapes of CVs of individual PAQ conjugates, as well as differences observed between dc PAQ TP and da PAQ TP both in the region of the AQ reversible electrochemistry and in the more negative potential region, suggest rather complicated processes undergone by these complex compounds on the mercury electrode surface (see also discussion of concentration dependences below). Cyclic voltammetry of PhNO 2 -dntp conjugates Both nitrophenyl-labeled dntps, dc PhNO 2 TP (Fig. 1c) and da PhNO 2 TP (Fig. 1d), gave an irreversible cathodic signal, peak NO red 2, around V (Table 1). Nitro group is known to be electrochemically reduced at various types of electrodes [29, 30] to hydroxylamine: NO 2 +4e +4H þ -H 2 O! NH-OH ð2þ Due to the involvement of four electrons, the latter electrode reaction gives rise to a strong reduction signal allowing sensitive polarographic or voltammetric determination of various nitro compounds [31 39], including environmental pollutants [40 44]. In several proof-of-concept applications it has been utilized for convenient DNA labeling as well [8, 9, 12, 14]. The hydroxylamime moiety resulting from (2) is reversibly oxidizable by two electrons to the nitroso group [30]: NH-OH - 2 e - 2 H þ $ NO ð3þ Hydroxylamine reduction is reflected in anodic signals (peak NHOH ox ) yielded by both PhNO 2 dntp conjugates close to 0.0 V (Fig. 1c, d; Table 1). In contrast to the anodic peak AQH 2 ox, the peak NHOH ox was observed on the CVs even when the measurements were performed with E sw =-1.85 V, displaying only partial decrease of its intensity. Dependence of the peak NHOH ox height on E sw, measured for dc PhNO 2 TP (Fig. 3), shows the peak current to be practically unchanged between E sw =-0.6 V and -1.4, and to decrease gradually with E sw being shifted to more negative potentials; for E sw =-1.85 V the peak NHOH ox height corresponded to 55 % of value measured with E sw =-0.6 V. Such behavior suggests that either the corresponding redox moiety is not destroyed upon the electrode polarization to highly negative potentials, or the 123

58 Electrochemical behavior of dntps 843 electrode surface does not get fully blocked by reduction products and the anodic peak NHOH ox is produced by fresh analyte from the bulk of solution. Since the peak NHOH ox measured with PhNO 2 -labeled ODN using ex situ voltammetric procedure (i.e., with adsorbed layer onto the electrode and no analyte present in the bulk of background electrolyte) completely disappeared for E sw =-1.2 V (not shown preliminary data; a complex study with labeled ODNs will be published elsewhere), the explanation based on involvement of fresh dn PhNO 2 TP from solution appears to be more likely. Notably, significant decrease of the NHOH ox height in dc PhNO 2 TP was observed at E sw values coinciding with potential of reduction of the cytosine nucleobase (Fig. 1c), and partial electrode blocking with products of the latter reaction could cause the observed decrease of the peak NHOH ox intensity. Similarly as in the case of corresponding AQ conjugates (Fig. 1a, b), da PhNO 2 TP differed from dc PhNO 2 TP by absence of any distinct signals in the potential region between -0.6 and V (Fig. 1d). The da PhNO 2 TP did not yield even the signal of 7-deazaadenine reduction in the ammonium formate medium (it was nevertheless observed in Britton Robinson buffer at ph B 6, see below). On the other hand, the behavior of dc PhNO2 TP in the same potential region was similar to that of dc PAQ TP, suggesting the nucleobase to be a critical component of the dntp conjugate that dictates its behavior on the negatively charged mercury surface. Effects of dntp concentration, ph of background electrolyte, and scan rate Dependences of intensities of peaks AQ red /AQH 2 ox measured without pre-accumulation for dc PAQ TP and da PAQ TP, and of peaks NO 2 red and NHOH ox measured under the same conditions with da PhNO 2 TP, are shown in Fig. 4. The height of the cathodic peak AQ red of dc PAQ TP increased more or less linearly within the concentration region between 0 and 80 lm (Fig. 4a). A strikingly different concentration dependence was observed for the anodic peak AQH 2 ox of the same dntp conjugate. At low concentrations up to 25 lm dc PAQ TP, both peaks AQ red and AQH 2 ox followed an identical trend. However, between 25 and 40 lm dc PAQ TP, the height of peak AQH 2 ox increased steeply, reached its maximum at 50 lm dc PAQ TP and then gradually decreased. The sigmoidal shape of the concentration dependence suggests intermolecular interactions at the electrode surface: the steep increase of the signal around 30 lm dc PAQ TP can be explained by positive cooperative effects of the already adsorbed (and electrochemically reduced) molecules of lm dc PAQ TP on adsorption of more molecules from the solution taking place from a critical surface coverage (i.e., distances Ip/µA Ip/µA Ip/µA] c/ µm c/ µm a dc PAQ TP b AQ red AQH ox 2 da PAQ TP c da PhNO2 TP NO red 2 AQ red AQH ox 2 NHOH ox c/µm Ip/µA Fig. 4 Dependence of the intensity of peaks AQ red, AQH 2 ox,no 2 red, and NHOH ox on dntp concentration: adc PAQ TP, bda PAQ TP, and cda PhNO2 TP (E sw V and other conditions as in Fig. 1) between molecules at the surface), which under the given conditions is dictated by solution concentration of the dc PAQ TP. Alternatively, the reduction of dc PAQ TP may be accompanied by the formation of an ordered structure of the adsorbed layer and orientation of the AQH 2 in a way facilitating the oxidation process. Since the cooperative effect was reflected in peak AQH 2 ox, but not AQ red heights, the presumptive intermolecular interactions were specific, in the case of dc PAQ TP, for its reduced form. Moreover, differences in the peak AQ red and AQH 2 ox intensities measured for 40 lm dc PAQ TP were retained in repeated CV scans (Fig. 2b), suggesting the presumptive interaction to be reversibly on/off switchable via changing the AQ 123

59 844 P. Vidláková et al. Ip/µA da PAQ TP AQ red AQH ox 2 A red a Ep/V da PAQ TP AQ red AQH ox 2 A red b ph ph 1.2 c d Ip/µA da PhNO2 TP NO red 2 NHOH ox A red Ep/V da PhNO2 TP NO red 2 NHOH ox A red ph ph Fig. 5 Dependence of the intensity (a) and potential (b) of peaks AQ red, AQH 2 ox, and A red for da PAQ TP and intensity (c) and potential (d) of peaks NO 2 red, NHOH ox, and A red of da PhNO2 TP on ph of background electrolyte (E sw V, scan rate 1 V/s, background electrolyte: Britton Robinson buffers of the given ph and other conditions as in Fig. 1) redox state. In contrast to dc PAQ TP, for da PAQ TP the S-shaped dependences of signal intensity were obtained for both cathodic and anodic peaks, indicating that analogous intermolecular interactions may have occurred in both reduced and oxidized forms of the latter conjugate, facilitating accumulation of the oxidized form at the electrode surface (see above). Concentration dependence of the da PhNO2 TP peak NO 2 red (Fig. 4c) involved a linear region between 0 and 10 lm, followed by a less steeply increasing part at higher concentration. Dependence of the height of peak NHOH ox exhibited certain sign of transition around 20 lm; nevertheless, compared to signals of the AQ conjugates this effect was poorly pronounced. Dependences of heights and potentials of signals yielded by da PAQ TP and da PhNO2 TP on ph of the background electrolyte, measured in Britton Robinson buffer, are shown in Fig. 5. The heights of peaks AQ red and AQH 2 ox were almost ph-independent in a wide range between ph 3 and 9 (Fig. 5a), indicating that the availability of protons were not limiting for reaction (1) to take place under the given conditions. A similar behavior was observed for peak NO 2 red of da PhNO2 TP (Fig. 5c). By contrast, peak NHOH ox was detectable only in ph [ 5 (Fig. 5c), most probably due to reduction of the hydroxylamine to amine that took place in the acidic media (indeed, an additional ph-dependent cathodic peak was detected in ph B 5, but not in ph above 5; not shown). In both conjugates, peak A red due to reduction of the nucleobase was observed only in ph B 6, in agreement with earlier data showing that protonation was a prerequisite for the nucleobase reduction at the mercury electrode (reviewed in [3]). The potentials of all measured signals shifted to more negative potentials with increasing ph, exhibiting almost parallel trends (Fig. 5b, d). The effects of scan rate were studied in the ammonium formate medium and the results obtained for dc PAQ TP and dc PhNO2 TP are displayed in Fig. 6. As could be expected for rather complex molecules of the dntp conjugates, involving hydrophobic, hydrophilic, and/or negatively charged parts, dependences of the measured signals on scan rate mostly did not fit into simple models valid for electrode processes driven by either diffusion or adsorption. Peak NO 2 red of dc PhNO2 TP followed a slightly concave dependence on the scan rate (growing less steeply than a linear function, Fig. 6b); when the peak heights were 123

60 Electrochemical behavior of dntps 845 Ip/ µa Ip/ µa Ip/µA a dc PAQ TP AQ red AQH ox scan rate/v/s b dc PhNO2 TP NO red 2 NHOH ox scan rate /V/s 8 c dc PhNO 2 TP NO red (scan rate) 1/2 Fig. 6 Dependence of intensity of peaks AQ red, AQH ox 2 NO red 2, and NHOH ox on scan rate for dc PAQ TP (a) and dc PhNO2 TP (b); dependence of peak NO red 2 on square root of scan rate for dc PhNO2 TP (c) (E sw V, other conditions as in Fig. 1) I/µA I/µA I/µA dc PAQ TP:dC PhNO2 TP = 1:2 AQH ox 2 NO red 2 t a = 0 s t a = 60 s dc PAQ TP:dC PhNO2 TP = 1:1 2 AQ red E/V E/V dc PAQ TP:dC PhNO2 TP = 1:3 2 NO red 2 AQH ox 2 2 AQ red t a 0 s t a 60 s NHOH ox b NHOH ox E/V AQH ox AQ red t a = 0 s t a = 60 s a NHOH ox Fig. 7 Voltammetric responses of mixtures of dc PAQ TP and dc PhNO2 TP at various ratios: a dc PAQ TP:dC PhNO2 TP = 1:1, bdc PAQ TP:dC PhNO2 TP = 1:2, cdc PAQ TP:dC PhNO2 TP = 1:3, accumulation time 0 s (dashed) or 60 s (solid; E sw V, scan rate 1 V/s, and other conditions as in Fig. 1) 1 c plotted against square root of the scan rate (Fig. 6c), the resulting dependence was significantly convex (increasing more steeply than a line), together indicating the combined effects of diffusion and strong adsorption. The other peaks, AQ red ox and AQH 2 of dc PAQ TP and NHOH ox of dc PhNO2 TP, exhibited strongly supralinear dependences of their heights on scan rate, suggesting more complex process possibly involving time-dependent desorption/ reorientation of the dntp molecules at the negatively charged surface or the above discussed lateral interactions of the AQ conjugates at the electrode surface. Mixtures of AQ- and PhNO 2 -labeled dntps Finally, we have been interested in the possibility of simultaneous voltammetric detection of the AQ- and PhNO 2 - labeled dntps in mixtures (Fig. 7). For this purpose, dc PAQ TP and C PhNO2 TP were mixed at ratios 1:1, 1:2, 123

61 846 P. Vidláková et al. and 1:3 (keeping the dc PAQ TP concentration constant at 20 lm), and CVs were measured without pre-accumulation (dashed lines in Fig. 7) or after a 60-s pre-accumulation (solid lines). The results of these experiments demonstrated the above discussed preferential accumulation of the AQ conjugate at the electrode surface. When the CVs were measured without the pre-accumulation, peak NHOH ox was detectable at the dntps ratio 1:1, but not the peak NO 2, the potential of which (about V) was close to the potential of AQ reduction. Upon increasing the C PhNO2 TP/dC PAQ TP ratio to 2:1 and 3:1, the peak NO 2 was unmasked and peaks of the AQ red /AQH 2 ox depressed. However, after the pre-accumulation, both signals of C PhNO2 TP, peak NO 2 red, and peak NHOH ox, were strongly depressed even in threefold excess of the latter dntp, suggesting that the more strongly adsorbing dc PAQ TP displaced the C PhNO2 TP from the electrode surface. Interestingly, in the presence of both conjugates, a new cathodic peak appeared around V (well developed, at the C PhNO2 TP/dC PAQ TP ratio of 1:1 when the measurement was performed without pre-accumulation (Fig. 7a), and in measurements with pre-accumulation its intensity exhibited increasing trend with increasing concentration of C PhNO2 TP). This signal may indicate a chemical reaction between products or intermediate of electrochemical reduction of AQ and the nitro group at the electrode surface. Conclusions Cytosine or 7-deazaadenine dntps modified at the base residue with electrochemically active anthraquinone or 3-nitrophenyl moieties were studied using cyclic voltammetry with the hanging mercury drop electrode. AQ moiety in the dntp conjugates is shown to retain its well-pronounced reversible electrochemistry around V. The nitro group in PhNO 2 exhibits characteristic irreversible reduction around V. The product of this reduction, phenylhydroxylamine (NHOH), gives a well-developed signal close to 0.0 V due its reversible oxidation to the corresponding nitroso compound. Further electrochemical reduction of the AQH 2 and NHOH redox groups can be used for their selective switching off, depending on the potential applied and composition of the background electrolyte (namely, in acidic media the signal of NHOH oxidation disappeared, suggesting irreversible reduction of the hydroxylamine to amine). The modified dntps studied differed in their adsorbability at the mercury electrode surface. In general, the tendency to being accumulated at the electrode was higher in AQ-modified dntps than in the PhNO 2 derivatives, and among the former da AQ TP was more efficiently adsorbed in its oxidized (AQ) form than dc AQ TP. The shapes of concentration dependences indicate intermolecular interactions of the AQ conjugates at the electrode surface that appear to be redox sensitive (specific for the reduced AQH 2 form) in dc AQ TP. Inour follow-up study (research in progress), the electrochemical properties of oligonucleotides modified with AQ- and PhNO 2 conjugates are investigated and the possibilities of the analytical utilization of specific properties of the two types of DNA labels are tested (results will be published elsewhere). Experimental Synthesis of anthraquinone- and 3-nitrophenyl-labeled deoxynucleoside triphosphates Anthraquinone-modified nucleoside triphosphates (dntps) bearing anthraquinone attached through a propargylcarbamoyl linker at the 5-position of cytosine (dc PAQ TP) or at the 7-position of 7-deazaadenine (da PAQ TP) were prepared by Sonogashira cross-coupling of corresponding halogenated dntps with 2-(2-propynylcarbamoyl)anthraquinone according to [14]. Analogous 3-nitrophenylmodified dntps were prepared by the Suzuki Miyaura reaction of 7-iodo-7-deaza-2 0 -datp (to obtain da Ph- NO2 TP) or 5-iodo-2 0 -deoxycytidine 5 0 -dctp (to obtain dc PhNO2 TP) with 3-nitrophenylboronic acid according to [12]. Both modified dntps were kindly donated by Prof. Michal Hocek. Electrochemical analysis Nucleoside triphosphates were analyzed by conventional in situ CV with a hanging mercury drop electrode. CV settings: scan rate 1 V/s, initial potential 0.0 V or?0.1 V, switching potentials or V. Background electrolyte: 0.3 M ammonium formate, 0.05 mm sodium phosphate, ph 6.9, if not stated otherwise. All measurements were performed at room temperature by using an Autolab analyzer (Eco Chemie, The Netherlands) in connection with VA-stand 663 (Metrohm, Herisau, Switzerland). The three-electrode system was used with an Ag AgCl 3 M KCl electrode as a reference and platinum wire as an auxiliary electrode. Measurements were performed after deaeration of the solution by argon purging. Acknowledgments This work was supported by the Czech Science Foundation (grant P206/12/G151 to M.F. and 206/12/2378 to L.H.) and by the ASCR (RVO ). The authors thank Jana Balintová, Hana Macíčková-Cahová, and Michal Hocek (Institute of Organic Chemistry and Biochemistry, ASCR, Prague, Czech 123

62 Electrochemical behavior of dntps 847 Republic) for providing the modified nucleoside triphosphates used in this study. References 1. Fojta M, Jelen F, Havran L, Palecek E (2008) Curr Anal Chem 4: Hocek M, Fojta M (2011) Chem Soc Rev 40: Palecek E, Bartosik M (2012) Chem Rev 112: Fojta M, Kostecka P, Pivonkova H, Horakova P, Havran L (2011) Curr Anal Chem 7:35 5. Bartosik M, Trefulka M, Hrstka R, Vojtesek B, Palecek E (2013) Electrochem Commun 33:55 6. Dziuba D, Pohl R, Hocek M (2014) Bioconjugate Chem Riedl J, Pohl R, Ernsting NP, Orsag P, Fojta M, Hocek M (2012) Chem Sci 3: Balintova J, Spacek J, Pohl R, Brazdova M, Havran L, Fojta M, Hocek M (2014) Chem Sci 6: Raindlova V, Pohl R, Klepetarova B, Havran L, Simkova E, Horakova P, Pivonkova H, Fojta M, Hocek M (2012) Chem- PlusChem 77: Dadova J, Orsag P, Pohl R, Brazdova M, Fojta M, Hocek M (2013) Angew Chem Int Ed 52: Brazdilova P, Vrabel M, Pohl R, Pivonkova H, Havran L, Hocek M, Fojta M (2007) Chem Eur J 13: Cahova H, Havran L, Brazdilova P, Pivonkova H, Pohl R, Fojta M, Hocek M (2008) Angew Chem Int Ed 47: Vrabel M, Horakova P, Pivonkova H, Kalachova L, Cernocka H, Cahova H, Pohl R, Sebest P, Havran L, Hocek M, Fojta M (2009) Chem Eur J 15: Balintova J, Pohl R, Horakova P, Vidlakova P, Havran L, Fojta M, Hocek M (2011) Chem Eur J 17: Balintova J, Plucnara M, Vidlakova P, Pohl R, Havran L, Fojta M, Hocek M (2013) Chem Eur J 19: Simonova A, Balintova J, Pohl R, Havran L, Fojta M, Hocek M (2014) ChemPlusChem 79: Hocek M (2014) J Org Chem 79: Fojta M, Kostecka P, Trefulka MR, Havran L, Palecek E (2007) Anal Chem 79: Ajloo D, Yoonesi B, Soleymanpour A (2010) Int J Electrochem Sci 5: Batchelor-McAuley C, Li Q, Dapin SM, Compton RG (2010) J Phys Chem B 114: Quan M, Sanchez D, Wasylkiw MF, Smith DK (2007) J Am Chem Soc 129: Mahajan S, Richardson J, Ben Gaied N, Zhao Z, Brown T, Bartlett PN (2009) Electroanalysis 21: Wettig SD, Bare GA, Skinner RJS, Lee JS (2003) Nano Lett 3: Zhang Y-J, He X-P, Hu M, Li Z, Shi X-X, Chen G-R (2011) Dyes Pigm 88: Abou-Elkhair RAI, Dixon DW, Netzel TL (2009) J Org Chem 74: Gorodetsky AA, Barton JK (2007) J Am Chem Soc 129: Jacobsen MF, Ferapontova EE, Gothelf KV (2009) Org Biomol Chem 7: Hocek M, Fojta M (2008) Org Biomol Chem 6: Peckova K, Barek J, Navratil T, Yosypchuk B, Zima J (2009) Anal Lett 42: Zuman P (1993) Collect Czech Chem Commun 58: Beckett EL, Lawrence NS, Davis J, Compton RG (2002) Anal Lett 35: Boateng A, Brajter-Toth A (2012) Analyst 137: Cordero-Rando MD, Barea-Zamora M, Barbera-Salvador JM, Naranjo-Rodriguez I, Munoz-Leyva JA, de Cisneros J (1999) Mikrochim Acta 132:7 34. De Souza D, Mascaro LH, Fatibello-Filho O (2011) Int J Anal Chem 2011: Gupta S, Agarwal H, Gupta M, Verma PS (2010) J Indian Chem Soc 87: Gupta S, Gupta M, Verma PS (2009) Asian J Chem 21: Chu L, Han L, Zhang X (2011) J Appl Electrochem 41: Kawde A-N, Aziz MA (2014) Electroanalysis 26: Liu Z, Zhang H, Ma H, Hou S (2011) Electroanalysis 23: Danhel A, Peckova K, Cizek K, Barek J, Zima J, Yosypchuk B, Navratil T (2007) Chem List 101: Dejmkova H, Stoica A-I, Barek J, Zima J (2011) Talanta 85: Deylova D, Yosypchuk B, Vyskocil V, Barek J (2011) Electroanalysis 23: Fischer J, Vanourkova L, Danhel A, Vyskocil V, Cizek K, Barek J, Peckova K, Yosypchuk B, Navratil T (2007) Int J Electrochem Sci 2: Niaz A, Fischer J, Barek J, Yosypchuk B, Sirajuddin, Bhanger MI (2009) Electroanalysis 21:

63 DOI: /chem Benzofurazane as a New Redox Label for Electrochemical Detection of DNA: Towards Multipotential Redox Coding of DNA Bases Jana Balintovµ, [a] Medard Plucnara, [b] Pavlína Vidlµkovµ, [b] Radek Pohl, [a] Luděk Havran, [b] Miroslav Fojta,* [b, c] [a, d] and Michal Hocek* Abstract: Benzofurazane has been attached to nucleosides and dntps, either directly or through an acetylene linker, as a new redox label for electrochemical analysis of nucleotide sequences. Primer extension incorporation of the benzofurazane-modified dntps by polymerases has been developed for the construction of labeled oligonucleotide probes. In combination with nitrophenyl and aminophenyl labels, we have successfully developed a three-potential coding of DNA bases Keywords: DNA polymerase electrochemistry nucleoside triphosphates sequencing voltammetry and have explored the relevant electrochemical potentials. The combination of benzofurazane and nitrophenyl reducible labels has proved to be excellent for ratiometric analysis of nucleotide sequences and is suitable for bioanalytical applications. Introduction [a] J. Balintovµ, Dr. R. Pohl, Prof. Dr. M. Hocek Institute of Organic Chemistry and Biochemistry Academy of Sciences of the Czech Republic Gilead Sciences and IOCB Research Center Flemingovo nam. 2, Prague 6 (Czech Republic) Fax: (+ 420) hocek@uochb.cas.cz [b] M. Plucnara, P. Vidlµkovµ, Dr. L. Havran, Prof. Dr. M. Fojta Institute of Biophysics, v.v.i. Academy of Sciences of the Czech Republic Kralovopolska 135, Brno (Czech Republic) Fax: (+ 420) fojta@ibp.cz [c] Prof. Dr. M. Fojta Central European Institute of Technology Masaryk University Kamenice 753/ Brno (Czech Republic) [d] Prof. Dr. M. Hocek Department of Organic Chemistry, Faculty of Science Charles University in Prague, Hlavova Prague 2 (Czech Republic) Supporting information for this article is available on the WWW under DNA biosensors [1] are broadly applied in the life sciences and diagnostics. Electrochemical detection is a comparably sensitive, but less expensive alternative to current techniques of genomics that use optical detection [2] and, therefore, redox labeling can be a viable economical alternative to fluorescence and microarray techniques in sequencing. [3] Both the inherent electrochemistry of nucleic acids and the electrochemistry of additional DNA labels have been extensively used in diverse bioanalytical applications. [4] We have previously developed several new redox labels, including ferrocene, [5] aminophenyl and nitrophenyl, [6] [OsACHTUNGTRENUNG(bpy) 3 ] (bpy = 2,2 -bipyridyl), [7] tetrathiafulvalene, [8] anthraquinone, [9] alkylsulfanylphenyl, [10] hydrazones, [11] and so on, and by combining four different labels for the four nucleobases, established the first generation of multipotential redox coding [7] of DNA and applied it in minisequencing. However, in this first generation of redox labeling, only one or two labels (one reducible and one oxidizable) [6] were incorporated and detected in one DNA molecule. When trying to combine two different reducible labels (nitro and anthraquinone), [9] electrochemical analysis of the doubly-labeled DNA gave one broad signal without distinguishing the ratio of the two labels. Therefore, such first-generation labels were not practical and there is still a need to develop other redox labels in order to afford a set of four labels that can be readily incorporated into DNA by polymerase and subsequently be independently readable in the presence of all the other labels. Only such a fully orthogonal set of labels could be used for the simultaneous detection of multiple nucleobase mutations in short (2 6 nt) sequences in one primer extension (as opposed to current sequencing techniques, [3] which use a single label for each DNA molecule for identification of one nucleotide at a time) or for the determination of the nucleobase composition of longer sequences. We report herein the development of a new redox label, benzofurazane (BF), and its use in combination with nitrophenyl and aminophenyl groups in the first three-potential coding of three nucleobases. Since G is itself electrooxidizable, labeling of A, T, and C with external labels can be regarded as providing a complete set of redox labels for DNA coding. Oxadiazoles and benzofurazanes are an extensively studied class of compounds with a variety of applications. Oxadiazole derivatives are known antimicrobial agents. [12] Oxadiazole carboxamide deoxyribonucleoside analogues can effectively mimic natural nucleobases in DNA replication. [13] Benzofurazanes are known for their fluorescent properties [14] and are used in polymer solar cells [15] and organic Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Chem. Eur. J. 2013, 19,

64 FULL PAPER electronic materials. [16] No use of BFs in nucleic acid labeling had been reported until our recent study on hydrazone modification of DNA, [11,17] in which we first identified the promising electrochemical properties of this heterocyclic system. Therefore, we have focused on the synthesis of two types of BF derivative of nucleosides and dntps (connected either directly or through an acetylene linker at the 5-position of cytosine or at the 7-position of 7-deazaadenine) and their polymerase incorporation into DNA. [18] Results and Discussion Synthesis of BF-labeled nucleosides and dn XBF TPs: Directly linked BF derivatives of nucleosides dc BF and da BF were prepared in good yields of % in one step by Suzuki Miyaura cross-coupling [19] of unprotected halogenated nucleosides 5-iodocytidine (dc I ) and 7-deaza-7-iodoadenosine (da I ; Scheme 1) with benzo[c]achtungtrenung[1,2,5]oxadiazole-5-boronic acid (1) in the presence of PdACHTUNGTRENUNG(OAc) 2, TPPTS, and Cs 2 CO 3 in CH 3 CN/H 2 O (1:2) at 75 8C for 1 h (Table 1, entries 1 and 2). Suzuki Miyaura cross-coupling of halogenated dntps (dc I TP and da I TP) under the same aqueous conditions gave the desired BF-modified dntps (dc BF TP and da BF TP) in moderate yields (10 22 %, Table 1, entries 3 and 4). To prepare larger quantities of these dn BF TPs, we applied an alternative strategy of triphosphorylation [20] of the corresponding nucleosides (dn BF s; Scheme 1). Thus, treatment of dc BF and da BF with POCl 3 in POACHTUNGTRENUNG(OMe) 3 followed by addition of (NHBu 3 ) 2 H 2 P 2 O 7 and Bu 3 N and treatment with TEAB (Scheme 1) gave the desired dn BF TPs (Table 1, entries 5 and 6) in yields of 24 and 70 %, respectively, after isolation by RP HPLC. Sonogashira cross-coupling reactions [19a,21] of 5-ethynylbenzo[c]ACHTUNGTRENUNG[1,2,5]oxadiazole (2) [22] were used to attach the BF moiety through an acetylene tether. The reactions of 2 with 5-iodocytidine (dc I ) and 7-deaza-7-iodoadenosine (da I ) were performed by using [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ], (ipr) 2 EtN, and CuI in DMF at 75 8C for 1 h to give the desired nucleosides dc EBF and da EBF in good yields (60 70 %; Scheme 2, Table 1, entries 7 and 8). The same reactions under aqueous Scheme 1. Reagents and conditions: i), iii) BF-B(OH) 2 (1), PdACHTUNGTRENUNG(OAc) 2, 3,3,3 -phosphanetriyltris(benzenesulfonic acid) trisodium salt (TPPTS), Cs 2 CO 3, CH 3 CN/H 2 O (1:2), 1 h, 75 8C. ii) 1) POACHTUNGTRENUNG(OMe) 3, POCl 3, 08C; 2) (NHBu 3 ) 2 H 2 P 2 O 7,Bu 3 N, DMF, 0 8C; 3) triethylammonium bicarbonate (TEAB). conditions in the presence of PdACHTUNGTRENUNG(OAc) 2, TPPTS, CuI, and (ipr) 2 EtN in CH 3 CN/H 2 O (1:2) proceeded less efficiently to give dc EBF and da EBF in moderate yields (28 45 %; Table 1, entries 9 and 10). Analogous aqueous Sonogashira crosscoupling reactions were used to attach the EBF group to dntps. Thus, the reactions of dc I TP and da I TP with 2 (Scheme 2) in the presence of PdACHTUNGTRENUNG(OAc) 2, TPPTS, CuI, and (ipr) 2 EtN in CH 3 CN/H 2 O (1:2) gave the desired dc EBF TP and da EBF TP in relatively good yields of % (Table 1, entries 11 and 12). Table 1. Preparation of BF-modified nucleosides/nucleotides. Entry Starting compound Reagent Catalyst Additives Solvent Product Yield [%] [a] 1 da I 1 PdACHTUNGTRENUNG(OAc) 2, TPPTS Cs 2 CO 3 CH 3 CN/H 2 O (1:2) da BF 74 2 dc I 1 PdACHTUNGTRENUNG(OAc) 2, TPPTS Cs 2 CO 3 CH 3 CN/H 2 O (1:2) dc BF 69 3 da I TP 1 PdACHTUNGTRENUNG(OAc) 2, TPPTS Cs 2 CO 3 CH 3 CN/H 2 O (1:2) da BF TP 22 4 dc I TP 1 PdACHTUNGTRENUNG(OAc) 2, TPPTS Cs 2 CO 3 CH 3 CN/H 2 O (1:2) dc BF TP 10 5 da BF 1) POACHTUNGTRENUNG(OMe) 3, POCl 3,08C; 2) (NHBu 3 ) 2 H 2 P 2 O 7,Bu 3 N, DMF, 08C; 3) TEAB da BF TP 70 6 dc BF 1) POACHTUNGTRENUNG(OMe) 3, POCl 3,08C; 2) (NHBu 3 ) 2 H 2 P 2 O 7,Bu 3 N, DMF, 08C; 3) TEAB dc BF TP 24 7 da I 2 [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ] CuI, (ipr) 2 EtN DMF da EBF 70 8 dc I 2 [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ] CuI, (ipr) 2 EtN DMF dc EBF 60 9 da I 2 PdACHTUNGTRENUNG(OAc) 2, TPPTS CuI, (ipr) 2 EtN CH 3 CN/H 2 O (1:2) da EBF dc I 2 PdACHTUNGTRENUNG(OAc) 2, TPPTS CuI, (ipr) 2 EtN CH 3 CN/H 2 O (1:2) dc EBF da I TP 2 PdACHTUNGTRENUNG(OAc) 2, TPPTS CuI, (ipr) 2 EtN CH 3 CN/H 2 O (1:2) da EBF TP dc I TP 2 PdACHTUNGTRENUNG(OAc) 2, TPPTS CuI, (ipr) 2 EtN CH 3 CN/H 2 O (1:2) dc EBF TP 52 [a] Yields of the isolated products. Chem. Eur. J. 2013, 19, Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

65 M. Fojta, M. Hocek et al. Scheme 2. Reagents and conditions: i) BF-CCH (2), [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ], (ipr) 2 EtN, CuI, DMF, 1 h, 758C; ii) 2, PdACHTUNGTRENUNG(OAc) 2, TPPTS, (ipr) 2 EtN, CuI, CH 3 CN/H 2 O (1:2), 1 h, 758C. Polymerase incorporation of dn XBF TPs: In primer extension (PEX) experiments, DNA polymerase incorporates nucleotides (a natural dntp is replaced by a modified dn X TP) at the 3 -end of a primer in the presence of the complementary template. Each PEX experiment was analyzed by polyacrylamide gel electrophoresis (PAGE). In order to avoid any misincorporation, positive (all natural dntps) and negative (absence of one or more dntps) control experiments were performed and compared with the PEX experiments by using modified dn XBF TPs. The enzymatic incorporation of the BF-modified dn XBF TPs was studied by using a number of B-family thermostable DNA polymerases, namely KOD XL, Pwo, Vent (exo-), Deep Vent, and Deep Vent (exo-), which are known to have a high tolerance for modifications. [23] Incorporations of one dn XBF TP were tested (for sequences of templates and primer, see Table 2) by using 19-mer templates temp A and temp C in combination with KOD XL, Pwo, and Vent (exo-) DNA polymerases. All four dn XBF TPs (Figure 1, lanes 4, 5, 8, and 9) furnished the desired fully extended oligonucleotide (ON) in all cases (see Figures S1 and S2 in the Supporting Information). To explore the efficiency of the PEX experiment by using the dn XBF TPs, we also performed a simple kinetic analysis. The rates of the PEX experiments with natural dntps or Table 2. Primers and templates used for PEX experiments. [a] Sequences Prim rnd 5 -CATGGGCGGCATGGG-3 Temp rnd16 5 -CTAGCATGAGCTCAGTCCCATGCCGCCCATG-3 Temp A 5 -CCCTCCCATGCCGCCCATG-3 Temp Aterm 5 -TCCCATGCCGCCCATG-3 Temp C 5 -CCCGCCCATGCCGCCCATG-3 Temp 4mod 5 -GTAGCTCACGATCAGTCCCATGCCGCCCATG-3 Temp G 5 -GTAGCATCAGCTCAGTCCCATGCCGCCCATG-3 Temp 3A 5 -TCCTCCTCCCCCATGCCGCCCATG-3 Temp 3T 5 -CACCACACCCCCATGCCGCCCATG-3 Temp 3C 5 -CGCCGCGCCCCCATGCCGCCCATG-3 Temp 3T3C 5 -ACGACGACGCCCATGCCGCCCATG-3 Temp 1T3C 5 -CGCACGCGCCCCATGCCGCCCATG-3 Temp 3T1C 5 -CACACGCACCCCATGCCGCCCATG-3 Temp 3A3C 5 -TGCTGCTCGCCCATGCCGCCCATG-3 Temp 3A1C 5 -TCCTCGCTCCCCATGCCGCCCATG-3 Temp 2A1C 5 -CTCCGCCTCCCCATGCCGCCCATG-3 Temp 1A1C 5 -CCGCCCTCCCCCATGCCGCCCATG-3 Temp 1A2C 5 -CGCCTCCGCCCCATGCCGCCCATG-3 Temp 1A3C 5 -CGCTCGCGCCCCATGCCGCCCATG-3 Temp 3T3A 5 -TCATCATCACCCATGCCGCCCATG-3 Temp 3T1A 5 -CACTCACACCCCATGCCGCCCATG-3 Temp 1T3A 5 -TCTCACTCCCCCATGCCGCCCATG-3 Temp 3A2C1T 5 -CTCACGCTCGCTCCCCATGCCGCCCATG-3 Temp 3A1C3T 5 -GCTCACTCACTCACCCATGCCGCCCATG-3 Temp 1A3C2T 5 -GCTCGCCACGCCACCCATGCCGCCCATG-3 Temp 1A2C3T 5 -CTCAGCCACGCCACCCATGCCGCCCATG-3 Temp 2A1C3T 5 -CTCACGCACCTCACCCATGCCGCCCATG-3 Temp 2A3C1T 5 -GCTCGCCACGCTCCCCATGCCGCCCATG-3 Temp 3A3C3T 5 -GTCAGCTACGTCACCCATGCCGCCCATG-3 Temp 3A0C3T 5 -CTCACTCACCTCACCCATGCCGCCCATG-3 Temp 3A3C0T 5 -GCTCGCTCCGCTCCCCATGCCGCCCATG-3 Temp 0A3C3T 5 -GCCACGCACGCCACCCATGCCGCCCATG-3 [a] In the template (temp) ONs, segments that form a duplex with primer are printed in italics, and the replicated segments are printed in bold. For magnetic separation of the extended primer strands, the template 5 -end was biotinylated. Figure 1. PEX single incorporations of a dn XBF TP into 19-nt DNA by using temp C and temp A templates. P: primer; A+, C+ : natural dntps; A : dgtp; C : dgtp; A BF : da BF TP, dgtp; A EBF : da EBF TP, dgtp; C BF : dc BF TP, dgtp; C EBF : dc EBF TP, dgtp. modified dn XBF (dn EBF TP, dn BF TP) nucleotides using Pwo DNA polymerase with temp C (for C, without natural dgtp), temp Aterm (for A), and prim rnd were compared. The reaction mixtures were incubated for the time intervals indicated, and then the reactions were stopped by the addition of PAGE loading buffer and the mixtures were immediately heated. The incorporation of the natural dntps was com Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Chem. Eur. J. 2013, 19,

66 Redox Label for Electrochemical Detection of DNA plete within s, whereas the PEX experiments with dn XBF TPs took 1 2 min to reach completion (Figures 2 and 3). Figure 2. Kinetics of PEX by using da XBF TPs in comparison with natural datp (+). Time intervals are given in minutes. Figure 3. Kinetics of PEX by using dc XBF TPs in comparison with natural dctp (+). Time intervals are given in minutes. Multiple incorporations into random sequences were tested by using a temp rnd16 template in the presence of several DNA polymerases: KOD XL, Pwo, Vent (exo-), Deep Vent, and Deep Vent (exo-). Three of the modified dn XBF TPs (dc BF TP, dc EBF TP, da BF TP) were successfully incorporated into DNA providing full-length products in PAGE analysis (Figure 4, lanes 5, 7, and 8 and Figures S3 S7 in the Supporting Information), whereas da EBF TP gave an ON product that appeared shorter on PAGE (Figure 4, lane 6). However, MALDI analysis of this da EBF -containing FULL PAPER PEX product indicated the correct mass expected for the full-length product (Figure S36 in the Supporting Information). In almost all previous studies conducted in our own and other laboratories, [18a f] PEX incorporation of only one functionalized dn X TP (+ three unmodified dntps) into DNA has been performed. In principle, when using the natural four-letter genetic alphabet, it is possible to incorporate up to four different labels into one DNA molecule by PEX. Such four-label coding would be highly useful in bioanalytical applications. However, simultaneous PEX incorporation of several functionalized dn X TPs into DNA is much more challenging since the polymerase must recognize all of the dn X TPs as substrates and must also be able to extend the primer next to each modified nucleotide. To the best of our knowledge, only one example of the enzymatic synthesis of fully modified (at all four bases) DNA has hitherto been reported. [18a] In order to study multi-potential redox coding of DNA, we needed to develop the PEX incorporation of two or three different labels. We aimed to combine our novel BF labels with previously reported nitrophenyl and aminophenyl groups (Scheme 3). [6] First, we tested parallel incorporation of da NO 2TP and dc BF TP into DNA by using Pwo and KOD XL DNA polymerases and template temp rnd16 (Figure 5). In these experiments, it was necessary to perform more negative control Figure 4. PEX multiple incorporations of dn XBF TPs into 31-nt DNA by using temp rnd16 template and DNA polymerase: a) Pwo DNA polymerase; b) KOD XL DNA polymerase. P: primer; + : natural dntps; A : dctp, dgtp, dttp; C : datp, dgtp, dttp; A BF : da BF TP, dctp, dgtp, dttp; A EBF : da EBF TP, dctp, dgtp, dttp; C BF :datp,dc BF TP, dgtp, dttp; C EBF :datp,dc EBF TP, dgtp, dttp. Scheme 3. Structures of modified dntps (da NO 2 TP, dcbf TP, dt NH 2 TP) and PEX for multipotential coding of DNA. Chem. Eur. J. 2013, 19, Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

67 M. Fojta, M. Hocek et al. Figure 5. PEX incorporation of dc BF TP and da NO 2 TP into one ON by using temp rnd16 template to form 31-nt DNA products. P: primer; + : natural dntps; A : dctp, dgtp, dttp; C : datp, dgtp, dttp; A 1 : dc BF TP, dgtp, dttp; C 1 : da NO 2 TP, dgtp, dttp; A NO 2 : da NO 2 TP, dctp, dgtp, dttp; C BF : datp, dc BF TP, dgtp, dttp; A NO 2 + C BF : da NO 2 TP, dc BF TP, dgtp, dttp. tests (absence of each natural dntp in the presence and absence of the other modified dntps) in order to fully exclude any possible misincorporation case. Figure 5 shows that in both cases, the clean, fully extended, doubly-labeled ON products were obtained. After the successful incorporation of two redox labels, the PEX synthesis of ONs with three different redox labels, da NO 2 TP, dcbf TP, and dt NH 2TP, (Scheme 3) was tested by using the same template. This combination of labels was chosen because the oxidative aminophenyl and reductive nitrophenyl labels have previously been shown to be orthogonal. [6] To our delight, the results indicated that the combination of da NO 2 TP, dcbf TP, and dt NH 2TP also resulted in good incorporation of all modified ONs in the PEX experiments, and the desired full-length ONs were obtained (Figure 6). Therefore, ON probes containing different combinations of these two or three labels in different sequences were prepared by PEX experiments followed by magnetoseparation (25 examples, Table 2, Figures S8 S32, see the Supporting Information) and representative examples were characterized by MALDI (see the Supporting Information). In a few cases, PAGE analyses and MALDI showed the formation of ONs that were shorter by one nucleotide. Therefore, the templates of these sequences were extended by an additional C at the 5 -end, and this led to the PEX synthesis and isolation of the correct ON probes containing the desired number of different labels (see the Supporting Information). These labeled ON probes were then used for the electrochemical characterization (see below). Electrochemical analysis: The voltammetric properties of the BF-modified nucleosides and dntps were studied by using cyclic voltammetry (CV) at a hanging mercury drop electrode (HMDE) or a basal-plane pyrolytic graphite electrode (PGE). At the HMDE (Figure 7), the BF conjugates produced intense cathodic peaks (denoted BF red ) in the Figure 6. PEX incorporation of dc BF -, da NO 2 -, and dt NH 2 -labeled dntps by using temp rnd16 template to form 31-nt DNA products. P: primer; + : natural dntps; A : dctp, dgtp, dttp; C : datp, dgtp, dttp; T : datp, dctp, dgtp; A 1 : dc BF TP, dgtp, dttp; C 1 : datp, dgtp, dt NH 2 TP; T 1 : da NO 2 TP, dctp, dgtp; A 2 : dctp, dgtp, dt NH 2 TP; C 2 : da NO 2 TP, dgtp, dttp; T 2 :datp,dc BF TP, dgtp; A 3 : dc BF TP, dgtp, dt NH 2 TP; C 3 : da NO 2 TP, dgtp, dtnh 2 TP; T 3 : da NO 2 TP, dcbf TP, dgtp; A NO 2 : dano 2 TP, dctp, dgtp, dttp; CBF :datp,dc BF TP, dgtp, dttp; T NH 2 : datp, dctp, dgtp, dt NH 2 TP; A NO 2 + C BF + T NH 2 : da NO 2 TP, dc BF TP, dgtp, dt NH 2 TP. region between 0.70 and 0.85 V, in addition to signals known to correspond to reduction of cytosine (peak C red )or adenine (peak A red ) [2] at potentials more negative than 1.2 V. Peak BF red was also yielded by building blocks benzo[c]achtungtrenung[1,2,5]oxadiazole-5-boronic acid (1, BF BA ) and EBF not containing the nucleoside/nucleotide component (Figure S32 in the Supporting Information). Considering the absence of any anodic signal in the voltammograms, even Figure 7. CV responses of BF-labeled nucleosides (A) and dntps (B) at HMDE. Concentration of all substances 40 mm, initial potential 0 V, switching potential 1.6 V, end potential 0 V, scan rate 1 Vs 1, electrolyte: 0.2 m acetate buffer (ph 5.0), for other details, see the Experimental Section Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Chem. Eur. J. 2013, 19,

68 Redox Label for Electrochemical Detection of DNA FULL PAPER when the switching potential was set immediately after the cathodic peak BF red (not shown), we concluded that peak BF red corresponded to an irreversible reduction process of the BF moiety, presumably involving six electrons and six protons to reduce two C=N double bonds in the furazane ring and release of a water molecule, thus giving rise to a diaminobenzene derivative. At the PGE, analogous irreversible signals were observed at potentials between 0.9 and 1.0 V (Figure 8; the nucleobase reduction signals could not be observed at carbon Figure 9. AdTS CV responses at HMDE of PEX products synthesized with biotinylated Temp rnd16 template and dntp mixes containing one of the dn XBF TP conjugates (as specified in the legend) complemented with three respective unmodified dntps. Single-stranded PEX products were purified by using streptavidin-coated magnetic beads. Inset: Detail of the voltammograms showing the BF red and G peaks. Switching potential 1.85 V; for other details, see Figure 7 and the Experimental Section. Figure 8. CV responses of BF-labeled nucleosides (A) and dntps (B) at PGE. Switching potential 1.4 V; for other details, see Figure 7 and the Experimental Section. electrodes [2] ). The potentials of peak BF red depended to some extent on the type of nucleobase and on the presence or absence of the ethynyl linker. However, the shifts in the potentials did not exhibit any systematic (or summative) trend. For example, with nucleosides at the HMDE, the peak potentials followed the order da EBF >dc EBF > dc BF > da BF, which might indicate that electronic communication between the nucleobase and the BF moiety is less influenced by the ethynyl bridge in the case of C than in the case of A. Nonetheless, the trends observed with the modified dn XBF TPs and even with nucleosides dn XBF at the PGE were different to those observed at the HMDE. This suggests that the phenomena affecting the BF reduction potential are more complex, and are probably influenced by the presence (in dntps) or absence (in nucleosides) of the negatively charged triphosphate group and the mode of adsorption at the electrode surface. The same phenomena can be expected to influence the peak intensities, which were observed to vary among the individual substances studied (see Figures 7 and 8), including the BF BA and EBF building blocks (Figure S33 in the Supporting Information). In the next experiments, PEX products containing A XBF or C XBF were prepared and subjected to electrochemical analysis. Figure 9 shows cyclic voltammograms of PEX products synthesized on the temp rnd16 template, each containing four BF-modified nucleobases of one type in the extended stretch. All PEX products yielded a cathodic peak CA, corresponding to reduction of adenine and cytosine in DNA at around 1.4 V, and an anodic peak G at around 0.2 V, produced by a guanine reduction product generated in the DNA upon applying potentials more negative than 1.6 V. [2] In addition to these intrinsic DNA signals, the modified PEX products yielded well-developed, symmetrical, and irreversible cathodic peaks at around 0.8 V, which could be assigned to reduction of the BF moieties. Negative control experiments of PEX reactions (with no polymerase added to a mixture containing a dn XBF TP complemented with three unmodified ONs, as shown for dc BF TP in Figure 9) produced the specific signals of the nucleobases but no peak BF red, thus proving that peaks BF red detected for the positive PEX reactions were due to incorporated BF labels and not due to unremoved dn XBF TP. Since we did not observe any significant qualitative differences in electrochemical properties among the four BF labels (i.e., differences in peak potentials were too small to allow reliable discrimination between ONs labeled with A XBF or C XBF or even their independent detection in a mixture), we selected dc BF TP for ON labeling with BF and focused our attention on multi-potential DNA labeling by combining BF with other electroactive moieties. For these experiments, we chose a previously developed nitrophenyl (PhNO 2 ) tag as a second label that was irreversibly reducible with multiple electrons (four electrons under the conditions used in this work), and an irreversibly oxidizable aminophenyl (PhNH 2 ) label. [6] First, we were interested in ascertaining whether or not incorporation of two reducible tags into one PEX product would allow their independent detection without significant mutual interference. Figure 10 shows the voltammetric responses of PEX products obtained with the temp 3A3C3T template and dntp mixes containing either dc BF TP, da NO 2TP, or a combination of both simultaneously Chem. Eur. J. 2013, 19, Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

69 M. Fojta, M. Hocek et al. da NO 2 TP, dcbf TP, dt NH 2TP, and unlabeled dgtp, where the number of individual labels incorporated per ON was dictated by the sequence of the given template (note that the same set of PEX products was analyzed for completeness and accuracy of synthesis by PAGE and MALDI-TOF MS; see above and the Supporting Information). Voltammetric responses of the PEX products were again measured at the HMDE (reductions) and the PGE (both reductions and oxidations). Results of the measurements at the HMDE are summarized in Figure 11 A, which shows the intensities of Figure 10. CV responses at HMDE (A) and SWV responses at PGE (B) obtained for PEX product synthesized with temp 3A3C3T template and combinations of BF and/or PheNO 2 dn X TP with unmodified dntps, as indicated by nucleobase symbols in the legend (valid for both panels). In (A), switching potential 1.3 V; for other details, see the Experimental Section. incorporated in one reaction. The resulting PEX products contained three BF and/or three PhNO 2 labels. Signals in voltammograms measured at the HMDE (Figure 10 A) reflected the composition of the PEX reaction mixture (i.e., peak BF red, peak NO red 2, or both peaks were detected when dc BF TP, da NO 2TP, or both conjugates were present, respectively). Notably, the relative intensities of the signals corresponded to the number of electrons expected to be involved in the given reduction process per label (6 for BF and 4 for PhNO 2 ), and no significant mutual interference was observed. When the PEX products were measured at the PGE, analogous results were obtained with the exception of the ratio of the intensities of peaks BF red and NO red 2. Both signals exhibited similar peak heights, suggesting an equal (rather than different) number of electrons being exchanged in the respective reduction processes. A detailed study of the electrode reaction mechanisms is beyond the scope of this report and will be published elsewhere. Combination of either of the reducible labels (or both) with the PhNH 2 label showed no effect of the PhNH 2 on the BF red red and NO 2 peaks (not shown). On the other hand, the signal of the one-electron primary oxidation of the amino group was rather poorly developed (compared to the reduction signals of BF and PhNO 2 ) and did not exhibit a good correlation between the number of PhNH 2 tags per ON and the signal intensity (see below). The next set of experiments was performed with PEX templates designed for incorporating the three labeled nucleotides in different quantities and ratios (Table 2). All PEX reactions were conducted with equimolar mixtures of Figure 11. A) Areas of AdTS CV peaks BF red and NO red 2 obtained at the HMDE for PEX products synthesized with temp xayczt templates (see Table 2; numbers of A, C, and T residues in the synthesized sequences are indicated in the graph) and da NO 2 TP + dc BF TP + dt NH 2 TP + dgtp mix. B) Ratios of areas of peaks BF red /NO red 2 obtained for the same PEX products. Numbers in blue indicate expected values calculated from the number of labels per ON and the number of electrons consumed per label. peak BF red and peak NO 2 red obtained for the individual PEX products. It is clear that the intensities of the reducible label signals varied consistently with the variation in the number of respective conjugates incorporated as dictated by the template nucleotide sequence. When a complementary base was missing from the template, a negligible signal corresponding to the given tag was observed (probably due to a small amount of misincorporation). Absolute signal intensities obtained for the PEX products containing identical numbers of a given labeled nucleotide (e.g., three C BF s) varied to a small extent within the groups of samples incorporating an identical number of the given Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Chem. Eur. J. 2013, 19,

70 Redox Label for Electrochemical Detection of DNA label, which can be explained in terms of natural variations in the yields of individual ONs after the isolation procedure. Such variations can, in principle, be eliminated by normalization of the signal for a unit amount of DNA, which can be accomplished, for example, by referring to a signal independent of the modification, such as peak G (provided that the guanine content does not vary significantly within a given set of samples). Another possible means of eliminating the effect of DNA concentration variations is calculation of the ratio between the intensities of signals yielded by two independently detectable labels. The latter approach was applied to generate Figure 11 B, in which ratios of peak areas BF red /NO red 2 are plotted. For measurements at the HMDE, we obtained a reasonable correlation between the ratios of peak areas (directly proportional to the number of electrons involved) and the ratios of labels incorporated, considering the number of electrons consumed per reduction of the given moiety (expected values are indicated by the numbers in blue for each sample in Figure 11 B). When the same measurements were performed with the PGE, similar results were obtained, but the peak area ratios BF red /NO red 2 were systematically lower (red columns in Figure 11 B) than those resulting from measurements at the HMDE, corresponding to approximately equal numbers of electrons being consumed for reduction of both the BF and PhNO 2 labels. Almost identical results were obtained when the PEX reactions were performed with the da NH 2 TP +dc BF TP + dt NO 2TP +unlabeled dgtp mixture (see Figure S34 in the Supporting Information). In contrast to the combination of two reducible labels, our attempts to use oxidizable PhNH 2 in combination with either BF or PhNO 2 tags in analogous measurements did not result in a good correlation between the relative number of tags incorporated into the DNA and the ratio of the respective signals (for an example, see Figure S35). Although the amino group can still be used as a qualitative marker for the presence of a PhNH 2 -encoded nucleobase in the synthesized ON stretch, its utilization as a ratiometric label was found to be limited. Above and beyond difficulties resulting from the relatively poorly developed signal of the amino group oxidation, another limitation may arise from the fact that amino derivatives are frequent products of the reduction of a variety of other organic nitrogenous compounds, and thus these moieties cannot be used as fully independent labels in combination with PhNH 2. Conclusion FULL PAPER We have proposed the use of benzofurazane as a novel reducible label for DNA. Adenine and cytosine dn XBF TP conjugates have been prepared and successfully tested as substrates for DNA polymerases, and have been reliably and precisely incorporated into different DNA sequences by primer extension. Multi-electron electrochemical reduction of the furazane ring gave rise to an intense cathodic signal that was easily measurable at both mercury and carbon electrodes, occurring at a potential not overlapping with the reduction potentials of natural nucleobases (in DNA, more negative by mv) or previously developed reducible labels PhNO [6] 2 or anthraquinone [9] (less negative by at least 300 mv). These features (at least in applications the principle of which has been proven herein) counterbalance an apparent drawback of BF as a label giving irreversible electrochemistry, that is, the impossibility of coupling it to an electrocatalytic system applicable in, for example, amperometric detectors. Nevertheless, in amperometric devices, it is in principle rather difficult to determine two or more redox species independently. On the other hand, simple voltammetric analysis of DNA labeled with combinations of BF, PhNO 2, and PhNH 2 as an oxidizable label revealed no significant interference between BF and PhNO 2 reductions and no effect of PhNH 2 on the signals of any of the reducible tags. The quantities of BF and PhNO 2 labels incorporated into a nucleotide sequence could be determined independently, and the relative intensities of their signals exhibited excellent correlation with the number of complementary bases in the template, making them applicable for ratiometric analysis of nucleotide sequences (such as electrochemical detection of mutations in a DNA stretch based on a change in the ratio of two nucleobases encoded by two different redox labels). On the other hand, PhNH 2 is suitable for qualitative but not (semi)quantitative ratiometric electrochemical probing of nucleotide sequences (at least when combined with BF and/or PhNO 2 ). Even though the currently available palette of redox labels is not ready for full DNA sequencing (i.e., reading of unknown nucleotide sequences), its applicability in single-nucleotide polymorphism (SNP) sensing has been demonstrated and extended here towards analysis of expected base variations in short DNA stretches of known sequence. Our ongoing research is focused on seeking further redox labels or their combinations to develop a generally applicable and orthogonal four-color coding scheme for electrochemical DNA labeling, which could be applied in the detection of multiple variants of mutations of certain important genes (e.g., the KRAS gene, in which several mutations in two consecutive codons are associated with colorectal cancer [24] ) in one simple experiment, thereby avoiding the expensive instrumentation and extensive computation needed for full sequencing. Other possible applications of orthogonal, independently detectable labels include one-step detection (and typing) of allele-specific mutants (discrimination between homozygous wild types, heterozygotes, and homozygous mutants), determination of the ratio between wild types and mutants in multicopy genes, and determination of the number of copies of a repetitive sequence per DNA fragment (e.g., in diagnostics of neurodegenerative disorders associated with triplet repeat expansions). [25] Chem. Eur. J. 2013, 19, Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

71 M. Fojta, M. Hocek et al. Experimental Section General: NMR spectra were measured at 500 MHz for 1 H and MHz for 13 C, or at 600 MHz for 1 H and MHz for 13 C, from solutions in D 2 O (referenced to dioxane as an internal standard, d H = 3.75 ppm, d C = 69.3 ppm) or in [D 6 ]DMSO (referenced to the residual solvent signal). Chemical shifts are given in ppm (d scale) and coupling constants (J) in Hz. Complete assignment of all NMR signals was achieved by using a combination of H,H-COSY, H,C-HSQC, and H,C-HMBC experiments. Mass spectra were measured on an LCQ Classic (Thermo-Finnigan) spectrometer using ESI or a Q-TOF Micro (Waters, ESI source, internal calibration with lockspray). Semi-preparative separation of nucleoside triphosphates was performed by HPLC on a column packed with reversed-phase 10 mm C18 (Phenomenex, Luna C18 (2)). IR spectra were measured by using the attenuated total reflectance (ATR) technique or by using KBr pellets. High-resolution mass spectra were measured under ESI conditions. Mass spectra of functionalized DNA were measured by MALDI-TOF spectrometry on a Reflex IV spectrometer (Bruker) with a nitrogen laser. Melting points were determined on a Kofler block. Known starting compounds were prepared according to literature procedures (EBF, [22] da NO 2 TP,[6] dt NH 2 TP[6] ). Synthesis of modified nucleosides: Suzuki Miyaura cross-coupling: Method A: (dc BF,dA BF ): A 2:1 mixture of H 2 O/CH 3 CN (2 ml) was added through a septum to an argon-purged flask containing halogenated nucleosides dn I (0.085 mmol, 1 equiv), boronic acid 1 (17 mg, 0.11 mmol, 1.2 equiv), and Cs 2 CO 3 (83 mg, 0.25 mmol, 3 equiv). In a separate flask, PdACHTUNGTRENUNG(OAc) 2 (1 mg, mmol, 5 mol %), and TPPTS (6 mg, mmol, 2.5 equiv with respect to Pd) were combined, the flask was evacuated and purged with argon, and then a 2:1 mixture of H 2 O/CH 3 CN (0.5 ml) was added. This catalyst solution was injected into the reaction mixture, which was then stirred at 75 8C for 1 2 h until complete consumption of the starting material and then concentrated in vacuo. The products were purified by column chromatography on silica gel eluting with chloroform/methanol (0 to 10%). Sonogashira cross-coupling: Method B: (dc EBF,dA EBF ): Dry DMF (3 ml) was added to an argon-purged flask containing 2 (15 mg, 0.10 mmol, 1.2 equiv), nucleoside analogue dn I (0.08 mmol, 1 equiv), CuI (2 mg, mmol, 10 mol %), and [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ] (3 mg, mmol, 5 mol %) followed by (ipr) 2 EtN (0.14 ml, 0.84 mmol, 10 equiv). The reaction mixture was stirred at 75 8C for 1 2 h until complete consumption of the starting material and then concentrated in vacuo. The products were purified by column chromatography on silica gel eluting with chloroform/ methanol (0 to 10%). Sonogashira cross-coupling: Method C: (dc EBF,dA EBF ): A 2:1 mixture of H 2 O/CH 3 CN (2 ml) was added through a septum to an argon-purged flask containing halogenated nucleosides dn I (0.056 mmol, 1 equiv), 2 (10 mg, mmol, 1.2 equiv), CuI (1 mg, mmol, 10 mol %), and (ipr) 2 EtN (0.1 ml, 0.56 mmol, 10 equiv). In a separate flask, PdACHTUNGTRENUNG(OAc) 2 (1 mg, mmol, 5 mol %) and TPPTS (4 mg, mmol, 2.5 equiv with respect to Pd) were combined, the flask was evacuated and purged with argon, and then a 2:1 mixture of H 2 O/CH 3 CN (0.5 ml) was added. This catalyst solution was injected into the reaction mixture, which was then stirred at 758C for 1 2 h until complete consumption of the starting material and then concentrated in vacuo. The products were purified by column chromatography on silica gel eluting with chloroform/methanol (0 to 10%). Synthesis of modified nucleoside triphosphates: Suzuki Miyaura cross-coupling: Method D: A 2:1 mixture of H 2 O/ CH 3 CN (2 ml) was added through a septum to an argon-purged flask containing halogenated nucleotides dn I TP (30 mg, 0.04 mmol, 1 equiv), boronic acid 1 (10 mg, 0.06 mmol, 1.5 equiv), and Cs 2 CO 3 (43 mg, 0.13 mmol, 3 equiv). In a separate flask, PdACHTUNGTRENUNG(OAc) 2 (0.5 mg, mmol, 5 mol %) and TPPTS (3 mg, mmol, 2.5 equiv with respect to Pd) were combined, the flask was evacuated and purged with argon, and then a 2:1 mixture of H 2 O/CH 3 CN (0.5 ml) was added. This catalyst solution was injected into the reaction mixture, which was then stirred at 758C for 45 min until complete consumption of the starting material. The product was isolated from the crude reaction mixture by HPLC on a C18 column, eluting with a linear gradient from 0.1m triethylammonium bicarbonate (TEAB) in H 2 O to 0.1 m TEAB in H 2 O/MeOH (1:1). Several co-distillations with water and conversion to the sodium salt form (Dowex 50WX8 in Na + cycle) followed by freeze-drying gave a solid product. Sonogashira cross-coupling: Method E: A 2:1 mixture of H 2 O/CH 3 CN (2 ml) was added through a septum to an argon-purged flask containing halogenated nucleotides dn I TP (0.085 mmol, 1 equiv), 2 (19 mg, 0.13 mmol, 1.5 equiv), CuI (2 mg, mmol, 10 mol %), and (ipr) 2 EtN (0.13 ml, 0.85 mmol, 10 equiv). In a separate flask, PdACHTUNGTRENUNG(OAc) 2 (1 mg, mmol, 5 mol %) and TPPTS (6 mg, 0.01 mmol, 2.5 equiv with respect to Pd) were combined, the flask was evacuated and purged with argon, and then a 2:1 mixture of H 2 O/CH 3 CN (0.5 ml) was added. This catalyst solution was injected into the reaction mixture, which was then stirred at 75 8C for 45 min until complete consumption of the starting material. The product was isolated from the crude reaction mixture by HPLC on a C18 column, eluting with a linear gradient from 0.1m TEAB in H 2 O to 0.1m TEAB in H 2 O/MeOH (1:1). Several co-distillations with water and conversion to the sodium salt form (Dowex 50WX8 in Na + cycle) followed by freeze-drying gave a solid product. Triphosphorylation: Method F: Dry trimethyl phosphate (0.32 ml) was added to an argon-purged flask containing a nucleoside analogue dn BF (0.17 mmol, 1 equiv) cooled to 08C on ice and then POCl 3 (20 ml, 0.2 mmol, 1.2 equiv) was added. After 1 3 h, a solution of (NHBu 3 ) 2 H 2 P 2 O 7 (480 mg, 0.9 mmol, 5 equiv) and Bu 3 N (0.17 ml, 0.7 mmol, 4.2 equiv) in dry DMF (1.3 ml) was added to the reaction mixture, which was then stirred for a further 1.5 h and quenched with 2 m TEAB buffer (1 ml). The product was isolated from the crude reaction mixture by HPLC on a C18 column, eluting with a linear gradient from 0.1m TEAB in H 2 O to 0.1m TEAB in H 2 O/MeOH (1:1). Several co-distillations with water and conversion to the sodium salt form (Dowex 50WX8 in Na + cycle) followed by freeze-drying gave a solid product. dc BF : Compound dc BF was prepared from dc I according to a general procedure (Method A). The product was isolated as a white solid (20 mg, 69%). M.p.>300 8C; 1 H NMR (600.1 MHz, [D 6 ]DMSO): d = 2.12 (ddd, 1H, J gem = 13.4, J 2 b,1 = 6.6, J 2 b,3 = 6.0 Hz; H-2 b), 2.18 (ddd, 1 H, J gem = 13.4, J 2 a,1 = 6.2, J 2 a,3 = 4.0 Hz; H-2 a), 3.52, 3.59 (2 ddd, 2 1H, J gem = 11.9, J 5,OH = 5.1, J 5,4 = 3.5 Hz; H-5 ), 3.78 (q, 1 H, J 4,3 = J 4,5 = 3.5 Hz; H- 4 ), 4.24 (m, 1H, J 3,2 = 6.0, 4.0, J 3,OH = 4.3, J 3,4 = 3.5 Hz; H-3 ), 4.98 (t, 1H, J OH,5 = 5.1 Hz; OH-5 ), 5.20 (d, 1 H, J OH,3 = 4.3 Hz; OH-3 ), 6.20 (dd, 1H, J 1,2 = 6.6, 6.2 Hz; H-1 ), 6.79, 7.49 (2 br s, 2 1H; NH 2 ), 7.53 (dd, 1H, J 6,7 = 9.3, J 6,4 = 1.4 Hz; H-6-benzooxadiazole), 7.97 (dd, 1H, J 4,6 = 1.4, J 4,7 = 1.1 Hz; H-4-benzooxadiazole), 8.07 (dd, 1H, J 7,6 = 9.3, J 7,4 = 1.1 Hz; H-7-benzooxadiazole), 8.11 ppm (s, 1 H; H-6); 13 C NMR (150.9 MHz, [D 6 ]DMSO): d=40.82 (CH 2-2 ), (CH 2-5 ), (CH-3 ), (CH-1 ), (CH-4 ), (C-5), (CH-4-benzooxadiazole), (CH-7-benzooxadiazole), (CH-6-benzooxadiazole), (C-5-benzooxadiazole), (CH-6), (C-7a-benzooxadiazole), (C-3a-benzooxadiazole), (C-2), ppm (C-4); IR (KBr): ñ=3466, 1634, 1603, 1539, 1365, 1265, 1094, 1067, 956, 1482, 1183, 782 cm 1 ; MS (ESI +): m/z (%): (100) [M + +Na]; HRMS (ESI): m/ z calcd for C 15 H 16 N 5 O 5 : ; found: da BF : Compound da BF was prepared from da I according to a general procedure (Method A). The product was isolated as a yellow solid (23 mg, 74%). M.p C; 1 H NMR (500.0 MHz, [D 6 ]DMSO): d = 2.24 (ddd, 1H, J gem = 13.1, J 2 b,1 = 6.0, J 2 b,3 = 2.8 Hz; H-2 b), 2.58 (ddd, 1H, J gem = 13.1, J 2 a,1 = 8.1, J 2 a,3 = 5.9 Hz; H-2 a), 3.53 (ddd, 1 H, J gem = 11.7, J 5 b,oh = 6.0, J 5 b,4 = 4.4 Hz; H-5 b), 3.60 (ddd, 1 H, J gem = 11.7, J 5 a,oh = 5.3, J 5 a,4 = 4.8 Hz; H-5 a), 3.85 (ddd, 1H, J 4,5 = 4.8, 4.4, J 4,3 = 2.6 Hz; H-4 ), 4.38 (m, 1H, J 3,2 = 5.9, 2.8, J 3,OH = 4.1, J 3,4 = 2.6 Hz; H-3 ), 5.04 (dd, 1H, J OH,5 = 6.0, 5.3 Hz; OH-5 ), 5.28 (d, 1H, J OH,3 = 4.1 Hz; OH-3 ), 6.57 (br s, 2H; NH 2 ), 6.61 (dd, 1 H, J 1,2 = 8.1, 6.0 Hz; H-1 ), 7.77 (dd, 1H, J 6,7 = 9.3, J 6,4 = 1.4 Hz; H-6-benzooxadiazole), 7.86 (dd, 1H, J 4,6 = 1.4, J 4,7 = 1.0 Hz; H-4-benzooxadiazole), 7.87 (s, 1H; H-6), 8.10 (dd, 1H, J 7,6 = 9.3, J 7,4 = 1.0 Hz; H-7-benzooxadiazole), 8.19 ppm (s, 1H; H-2); 13 C NMR (125.7 MHz, [D 6 ]DMSO): d=39.70 (CH 2-2 ), (CH 2-5 ), (CH- 3 ), (CH-1 ), (CH-4 ), (C-4a), (CH-4-benzooxadiazole), (C-5), (CH-7-benzooxadiazole), (CH-6), Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Chem. Eur. J. 2013, 19,

72 Redox Label for Electrochemical Detection of DNA FULL PAPER (CH-6-benzooxadiazole), (C-5-benzooxadiazole), (C-7a-benzooxadiazole), (C-3a-benzooxadiazole), (C-7a), (CH-2), ppm (C-4); IR (KBr): ñ=3328, 3218, 3187, 1629, 1585, 1543, 1469, 1449, 1206, 956, 795 cm 1 ; MS (ESI +): m/z (%): (10) [M + ], (100) [M + +Na]; HRMS (ESI): m/z calcd for C 17 H 16 N 6 NaO 4 : ; found: dc EBF : Compound dc EBF was prepared from dc I in 60% yield according to Method B and in 45% yield according to Method C. The product was isolated as a brown solid. M.p. > 300 8C; 1 H NMR (600.1 MHz, [D 6 ]DMSO): d=2.05 (ddd, 1H, J gem = 13.3, J 2 b,1 = 6.6, J 2 b,3 = 6.1 Hz; H- 2 b), 2.21 (ddd, 1H, J gem = 13.3, J 2 a,1 = 6.1, J 2 a,3 = 4.1 Hz; H-2 a), 3.61 (ddd, 1H, J gem = 11.8, J 5 b,oh = 4.7, J 5 b,4 = 3.5 Hz; H-5 b), 3.69 (ddd, 1 H, J gem = 11.8, J 5 a,oh = 5.0, J 5 a,4 = 3.5 Hz; H-5 a), 3.83 (q, 1 H, J 4,3 = J 4,5 = 3.5 Hz; H-4 ), 4.24 (m, 1 H, J 3,2 = 6.1, 4.1, J 3,OH = 4.3, J 3,4 = 3.5 Hz; H-3 ), 5.20 (dd, 1H, J OH,5 = 5.0, 4.7 Hz; OH-5 ), 5.26 (d, 1H, J OH,3 = 4.3 Hz; OH- 3 ), 6.11 (dd, 1H, J 1,2 = 6.6, 6.1 Hz; H-1 ), 7.27 (br s, 1 H; NH a H b ), 7.74 (dd, 1H, J 6,7 = 9.3, J 6,4 = 1.3 Hz; H-6-benzooxadiazole), 7.93 (br s, 1 H; NH a H b ), 8.11 (dd, 1H, J 7,6 = 9.3, J 7,4 = 1.1 Hz; H-7-benzooxadiazole), 8.32 (dd, 1 H, J 4,6 = 1.3, J 4,7 = 1.1 Hz; H-4-benzooxadiazole), 8.51 ppm (s, 1H; H-6); 13 C NMR (150.9 MHz, [D 6 ]DMSO): d=41.16 (CH 2-2 ), (CH 2-5 ), (CH-3 ), (CH-1 ), (pyrimidine-cc-benzoxadiazole), (CH-4 ), (C-5), (pyrimidine-cc-benzoxadiazole), (CH-7-benzooxadiazole), (CH-4-benzooxadiazole), (C-5-benzooxadiazole), (CH-6-benzooxadiazole), (CH-6), (C-7a-benzooxadiazole), (C-3a-benzooxadiazole), (C-2), ppm (C-4); IR (KBr): ñ = 3389, 2201, 1660, 1618, 1536, 1493, 1333, 1267, 1090, 1048, 780 cm 1 ; MS (ESI +): m/z (%): (100) [M+Na + ]; HRMS (ESI +): m/z calcd for C 17 H 16 N 5 O 5 : ; found: da EBF : Compound da EBF was prepared from da I in 70% yield according to Method B and in 28% yield according to Method C. The product was isolated as a yellow solid. M.p C; 1 H NMR (500.0 MHz, [D 6 ]DMSO): d=2.24 (ddd, 1H, J gem = 13.2, J 2 b,1 = 6.0, J 2 b,3 = 2.9 Hz; H- 2 b), 2.51 (ddd, 1H, J gem = 13.2, J 2 a,1 = 7.9, J 2 a,3 = 5.7 Hz; H-2 a), 3.55 (ddd, 1H, J gem = 11.8, J 5 b,oh = 5.9, J 5 b,4 = 4.3 Hz; H-5 b), 3.61 (ddd, 1 H, J gem = 11.8, J 5 a,oh = 5.3, J 5 a,4 = 4.5 Hz; H-5 a), 3.86 (ddd, 1 H, J 4,5 = 4.5, 4.3, J 4,3 = 2.6 Hz; H-4 ), 4.37 (m, 1 H, J 3,2 = 5.7, 2.9, J 3,OH = 4.1, J 3,4 = 2.6 Hz; H-3 ), 5.08 (dd, 1H, J OH,5 = 5.9, 5.3 Hz; OH-5 ), 5.29 (d, 1H, J OH,3 = 4.1 Hz; OH-3 ), 6.53 (dd, 1 H, J 1,2 = 7.9, 6.0 Hz; H-1 ), 6.85 (br s 2H; NH 2 ), 7.72 (dd, 1 H, J 6,7 = 9.3, J 6,4 = 1.3 Hz; H-6-benzooxadiazole), 8.02 (s, 1H; H-6), 8.11 (dd, 1H, J 7,6 = 9.3, J 7,4 = 1.1 Hz; H-7-benzooxadiazole), 8.17 (s, 1H; H-2), 8.38 ppm (dd, 1H, J 4,6 = 1.3, J 4,7 = 1.0 Hz; H-4-benzooxadiazole); 13 C NMR (125.7 MHz, [D 6 ]DMSO): d = (CH 2-2 ), (CH 2-5 ), (CH-3 ), (CH-1 ), (CH-4 ), (-CC-benzooxadiazole), (-CC-benzooxadiazole), (C-5), (C-4a), (CH-7-benzooxadiazole), (CH-4-benzooxadiazole), (C-5-benzooxadiazole), (CH-6), (CH-6-benzooxadiazole), (C-7a-benzooxadiazole), (C-3a-benzooxadiazole), (C-7a), (CH-2), (C-4); IR (KBr): ñ = 3458, 3419, 3345, 3304, 3112, 2197, 1650, 1623, 1591, 1527, 1467, 1083, 1054, 793, 634 cm 1 ; MS (ESI +): m/z (%): (20) [M + ], (100) [M+Na + ]; HRMS (ESI +): m/z calcd for C 19 H 17 N 6 O 4 : ; found: dc BF TP: Compound dc BF TP was prepared from dc I TP in 10% yield according to Method D or from dc BF in 24% yield according to Method F. 1 H NMR (499.8 MHz, D 2 O): d=2.39 (dt, 1 H, J gem = 14.1, J 2 b,1 = J 2 b,3 = 6.8 Hz; H-2 b), (ddd, 1 H, J gem = 14.1, J 2 a,1 = 6.4, J 2 a,3 = 3.8 Hz; H- 2 a), (m, 3 H; H-4,5 ), 4.65 (dt, 1 H, J 3,2 = 6.8, 3.8, J 3,4 = 3.8 Hz; H-3 ), 6.34 (dd, 1H, J 1,2 = 6.8, 6.4 Hz; H-1 ), 7.58 (dd, 1H, J 6,7 = 9.5, J 6,4 = 1.2 Hz; H-6-benzooxadiazole), ppm (m, 3 H; H-6, H-4,7-benzooxadiazole); 13 C NMR (125.7 MHz, D 2 O): d = (CH 2-2 ), (d, J C,P = 5.4 Hz; CH 2-5 ), (CH-3 ), (d, J C,P = 8.9 Hz; CH-4 ), (CH-1 ), (C-5), (CH-4-benzooxadiazole), (CH-7- benzooxadiazole), (CH-6-benzooxadiazole), (C-5-benzooxadiazole), (CH-6), (C-7a-benzooxadiazole), (C-3abenzooxadiazole), (C-2), ppm (C-4); 31 P{ 1 H} NMR (202.3 MHz, D 2 O): d= (t, J=20.0 Hz; P b ), (d, J = 20.0 Hz; P a ), 5.33 ppm (d, J=20.0 Hz; P g ); MS (ESI ): m/z (%): (95) [M H 2 PO 3 ], 606 (25) [M 2H+Na], (20) [M 3H+2Na] ; HRMS (ESI ): m/z calcd for C 15 H 15 N 5 Na 2 O 14 P 3 : ; found: da BF TP: Compound da BF TP was prepared from da I TP in 22% yield according to Method D or from da BF in 70 % yield according to Method F. 1 H NMR (499.8 MHz, D 2 O): d=2.52 (ddd, 1 H, J gem = 14.0, J 2 b,1 = 6.4, J 2 b,3 = 3.4 Hz; H-2 b), 2.78 (ddd, 1 H, J gem = 14.0, J 2 a,1 = 7.6, J 2 a,3 = 6.6 Hz; H-2 a), 4.13 (ddd, 1 H, J gem = 10.9, J H,P = 5.2, J 5 b,4 = 4.1 Hz; H-5 b), 4.22 (dt, 1H, J gem = 10.9, J H,P = J 5 a,4 = 5.0 Hz; H-5 a), 4.25 (m, 1H; H-4 ), 4.80 (overlapped with HDO; H-3 ), 6.72 (dd, 1 H, J 1,2 = 7.6, 6.4 Hz; H-1 ), 7.82 (dd, 1 H, J 6,7 = 9.3, J 6,4 = 1.2 Hz; H-6-benzooxadiazole), 7.83 (s, 1H; H-6), 7.91 (br s, 1 H; H-4-benzooxadiazole), 7.99 (d, 1 H, J 7,6 = 9.3 Hz; H-7-benzooxadiazole), 8.23 ppm (s, 1 H; H-2); 13 C NMR (125.7 MHz, D 2 O): d= (CH 2-2 ), (d, J C,P = 5.5 Hz; CH 2-5 ), (CH-3 ), (CH- 1 ), (d, J C,P = 8.9 Hz; CH-4 ), (C-4a), (CH-4-benzooxadiazole), (CH-7-benzooxadiazole), (C-5), (CH-6), (CH-6-benzooxadiazole), (C-5-benzooxadiazole), (C-7a-benzooxadiazole), (C-3a-benzooxadiazole), (C-7a), (CH-2), ppm (C-4); 31 P{ 1 H} NMR (202.3 MHz, D 2 O): d= (br t, J=20.0 Hz; P b ), (d, J=20.0 Hz; P a ), 6.19 ppm (br d, J=20.0 Hz; P g ); MS (ESI ): m/z (%): (100) [M H H 2 PO 3 +Na], (20) [M 2H+Na] ; HRMS (ESI ): m/z calcd for C 17 H 17 N 6 NaO 13 P 3 : ; found: dc EBF TP: Compound dc EBF TP was prepared from dc I TP in 52% yield according to Method E. 1 H NMR (600.1 MHz, D 2 O): d=2.35 (ddd, 1H, J gem = 14.2, J 2 b,1 = 6.7, J 2 b,3 = 6.4 Hz; H-2 b), 2.50 (ddd, 1H, J gem = 14.2, J 2 a,1 = 6.4, J 2 a,3 = 4.3 Hz; H-2 a), (m, 3H; H-4,5 ), 4.65 (dt, 1 H, J 3,2 = 6.4, 4.3, J 3,4 = 4.3 Hz; H-3 ), 6.25 (dd, 1H, J 1,2 = 6.7, 6.4 Hz; H-1 ), 7.68 (d, 1 H, J 6,7 = 9.3 Hz; H-6-benzooxadiazole), 7.90 (d, 1H, J 7,6 = 9.3 Hz; H-7-benzooxadiazole), 8.13 (s, 1H; H-4-benzooxadiazole), 8.30 ppm (s, 1 H; H-6); 13 C NMR (150.9 MHz, D 2 O): d=42.23 (CH 2-2 ), (d, J C,P = 5.5 Hz; CH 2-5 ), (CH-3 ), (pyrimidine-ccbenzooxadiazole), (d, J C,P = 9.0 Hz; CH-4 ), (CH-1 ), (C- 5), (pyrimidine-cc-benzooxadiazole), (CH-7-benzooxadiazole), (CH-4-benzooxadiazole), (C-5-benzooxadiazole), (CH-6-benzooxadiazole), (CH-6), (C-7a-benzooxadiazole), (C-3a-benzooxadiazole), (C-2), ppm (C-4); 31 P{ 1 H} NMR (202.3 MHz, D 2 O): d = (t, J = 20.0 Hz; P b ), (d, J = 20.0 Hz; P a ), 7.77 ppm (br d, J = 20.0 Hz; P g ); MS (ESI ): m/z (%): 448 (100) [M H 3 P 2 O 6 ], 528 (90) [M H 2 PO 3 ], (55) [M H H 2 PO 3 +Na], (10) [M H] ; HRMS (ESI ): m/z calcd for C 17 H 17 N 5 O 14 P 3 : ; found: da EBF TP: Compound da EBF TP was prepared from da I TP in 54% yield according to Method E. 1 H NMR (600.1 MHz, D 2 O): d=2.52 (ddd, 1H, J gem = 13.9, J 2 b,1 = 6.0, J 2 b,3 = 3.3 Hz; H-2 b), 2.65 (ddd, 1H, J gem = 13.9, J 2 a,1 = 8.0, J 2 a,3 = 6.0 Hz; H-2 a), 4.15 (dt, 1 H, J gem = 11.2, J H,P = J 5 b,4 = 4.4 Hz; H-5 b), 4.22 (dt, 1H, J gem = 11.2, J H,P = J 5 a,4 = 4.9 Hz; H-5 a), 4.24 (m, 1H; H-4 ), 4.78 (overlapped with HDO; H-3 ), 6.30 (dd, 1 H, J 1,2 = 8.0, 6.0 Hz; H-1 ), 7.36 (d, 1H, J 6,7 = 9.2 Hz; H-6-benzooxadiazole), 7.55 (d, 1 H, J 7,6 = 9.2 Hz; H-7-benzooxadiazole), 7.70 (s, 1H; H-4-benzooxadiazole), 7.75 (s, 1 H; H-6), 7.83 ppm (s, 1H; H-2); 13 C NMR (150.9 MHz, D 2 O): d=41.56 (CH 2-2 ), (d, J C,P = 5.9 Hz; CH 2-5 ), (CH-3 ), (CH-1 ), (d, J C,P = 8.9 Hz; CH-4 ), (-CC-benzooxadiazole), (-CC-benzooxadiazole), (C-5), (C-4a), (CH-7-benzooxadiazole), (CH-4-benzooxadiazole), (C-5- benzooxadiazole), (CH-6), (CH-6-benzooxadiazole), (C-7a-benzooxadiazole), (C-7a), (C-3a-benzooxadiazole), (CH-2), ppm (C-4); 31 P{ 1 H} NMR (202.3 MHz, D 2 O): d= (t, J=18.3 Hz; P b ), (d, J = 18.3 Hz; P a ), 8.10 ppm (d, J= 18.3 Hz; P g ); MS (ESI ): m/z (%): (95) [M H 2 PO 3 ], (100) [M H H 2 PO 3 +Na], (18) [M H], (30) [M 2H+Na], (28) [M 3H+2Na] ; HRMS (ESI ): m/z calcd for C 19 H 18 N 6 O 13 P 3 : ; found: Primer extension experiment: The reaction mixture (20 ml) contained DNA polymerase (KOD XL U, Pwo 0.5 U, Deep Vent 0.2 U, Deep Vent (exo-) 0.2 U, Vent (exo-) 0.1 U), primer (0.15 mm), template (0.23 mm), and both natural and modified dntps (0.2 mm) in reaction buffer. The primer was labeled with [g 32 P]ATP according to standard Chem. Eur. J. 2013, 19, Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

73 M. Fojta, M. Hocek et al. techniques. Reaction mixtures were incubated for min at 60 8C and then analyzed by PAGE electrophoresis. Kinetics of PEX: PEX reaction mixtures containing Pwo DNA polymerase were incubated for time intervals of min. The reactions were then stopped by the addition of PAGE loading buffer and the mixtures were immediately heated. Polyacrylamide gel electrophoresis: The PEX products were mixed with loading buffer (80 % formamide, 10 mm ethylenediaminetetraacetic acid (EDTA), 1 mg ml 1 xylene cyanol, 1 mg ml 1 bromophenol blue) and subjected to electrophoresis in 12% denaturing polyacrylamide gel containing 1 TBE [TRIS (2-amino-2-hydroxymethylpropane-1,3-diol)/ borate/edta] buffer (ph 8) and 7 m urea at 25 W for 50 min. Gels were dried, autoradiographed, and visualized by using a phosphorimager. Melting temperatures: The oligonucleotides for these measurements were prepared by PEX on a large scale by using Pwo as polymerase, template temp rnd16, and prim rnd as primer. For preparative purposes, a total volume of 500 ml PEX containing higher concentrations of primer (10 mm) and template (10 mm) was run and purification was carried out with a QIAquick Nucleotide Removal Kit (Qiagen). Samples were eluted with 100 ml H 2 O (ph 7.5) and then freeze-dried. DNA duplexes were first dissolved in 160 ml of phosphate buffer (50 mm, ph 6.7) and further diluted with the buffer to obtain an optimum concentration with aod 260 value between 0.08 and 0.1. Thermal denaturation studies were performed on a Cary 100 Bio UV/Vis spectrophotometer equipped with a temperature controller (Varian). Data were obtained from six individual cooling heating cycles. Melting temperatures (T m values in 8C) were obtained by plotting temperature versus absorbance and applying a sigmoidal curve fit. Isolation of single-strand oligonucleotides by magnetoseparation: The reaction mixture (100 ml) contained KOD XL DNA polymerase (2.5 UmL 1, 1 2 ml), 5 -biotinylated template (100 mm, 3 ml), primer (100 mm, 3mL), and both natural and modified dntps (4 mm, 7mL) in reaction buffer (40 ml) supplied by the manufacturer. The reaction mixture was incubated for 45 min at 608C in a thermal cycler. The reaction was then stopped by cooling on ice and the mixture was added to streptavidin magnetic particles [Roche; 30 ml of the stock solution was washed with three 200 ml portions of binding buffer TEN 100 (100 mm NaCl, 10mm TRIS, 1 mm EDTA, ph 7.5)]. The suspension was shaken at 15 8C for 15 min and 1200 rpm to allow the oligonucleotides to bind to the beads. After the incubation, the magnetic beads were collected on a magnet (Dynal, Invitrogen) and the solution was discarded. The beads were washed with three 200 ml portions of wash buffer TEN 1000 (1 m NaCl, 10 mm TRIS, 1 mm EDTA, ph 7.5) and then with three 200 ml portions of H 2 O. Water (200 ml) was then added and the sample was denatured for 2 min at 75 8C and 900 rpm. The beads were collected on a magnet and the solution was transferred to a clean vial. The product was analyzed by MALDI-TOF mass spectrometry. Electrochemical analysis: Nucleosides, dntps, and other building blocks were analyzed by conventional in situ cyclic voltammetry (CV). PEX products were analyzed by ex situ (adsorptive transfer stripping, AdTS) CV or square-wave voltammetry (SWV). The PEX products (purified in their single-stranded form by using streptavidin-coated magnetic beads or in their double-stranded forms by using a Qiagen Nucleotide Removal Kit) were accumulated at the surface of a working electrode (hanging mercury drop electrode, HMDE, or basal-plane pyrolytic graphite electrode, PGE) for 60 s from 5 ml aliquots containing 0.2m NaCl. The electrode was then rinsed with deionized water and placed in an electrochemical cell. CV settings: scan rate 1 V s 1, initial potential 0.0 V, for switching potentials, see figure legends. SWV settings: initial potential 0 V, for final potentials, see figure legends; frequency 200 Hz, amplitude 50 mv. Background electrolyte: 0.5m ammonium formate, 0.05m sodium phosphate, ph 6.9, or 0.2m sodium acetate, ph 5.0. All measurements were performed at room temperature by using an Autolab analyzer (Eco Chemie, The Netherlands) in connection with a VA-stand 663 (Metrohm, Herisau, Switzerland). A three-electrode system was used, with an Ag/ AgCl/3 m KCl electrode as a reference and a platinum wire as an auxiliary electrode. Reduction signals were measured after deaeration of the solution by argon purging. Acknowledgements This work was supported by the Academy of Sciences of the Czech Republic (RVO and institutional research plan AV0Z ), the Grant Agency of the Academy of Sciences of the Czech Republic (IAA ) to L.H. and M.F., and by the Czech Science Foundation (P206/12/G151) to J.B., M.P., M.H., and M.F. [1] a) M. J. Heller, Annu. Rev. Biomed. Eng. 2002, 4, ; b) A. Sassolas, B. D. Leca-Bouvier, L. J. Blum, Chem. Rev. 2008, 108, [2] a) E. Paleček, F. Jelen in Electrochemistry of Nucleic Acids and Proteins: Towards Electrochemical Sensors for Genomics and Proteomics (Eds.: E. Paleček, F. Scheller, J. Wang), Elsevier, Amsterdam, 2005, pp ; b) J. Wang in Electrochemistry of Nucleic Acids and Proteins: Towards Electrochemical Sensors for Genomics and Proteomics (Eds.: E. Paleček, F. Scheller, J. Wang), Elsevier, Amsterdam, 2005, pp [3] a) D. R. Bentley, S. Balasubramanian, H. P. Swerdlow, Nature 2008, 456, 53 59; b) D. A. Wheeler, M. Srinivasan, M. Egholm, Y. Shen, L. Chen, A. McGuire, W. He, Y.-J. Chen, V. Makhijani, G. T. Roth, X. Gomes, K. Tartaro, F. Niazi, C. L. Turcotte, G. P. Irzyk, J. R. Lupski, C. Chinault, X.-z. Song, Y. Liu, Y. Yuan, L. Nazareth, X. Qin, D. M. Muzny, M. Margulies, G. M. Weinstock, R. A. Gibbs, J. M. Rothberg, Nature 2008, 452, [4] a) M. Hocek, M. Fojta, Chem. Soc. Rev. 2011, 40, ; b) E. Paleček, M. Bartosik, Chem. Rev. 2012, 112, [5] a) P. Brµzdilovµ, M. Vrµbel, R. Pohl, H. Pivoňkovµ, L. Havran, M. Hocek, M. Fojta, Chem. Eur. J. 2007, 13, ; b) F. Patolsky, Y. Weizmann, I. Wilner, J. Am. Chem. Soc. 2002, 124, [6] H. Cahovµ, L. Havran, P. Brµzdilovµ, H. Pivoňkovµ, R. Pohl, M. Fojta, M. Hocek, Angew. Chem. 2008, 120, ; Angew. Chem. Int. Ed. 2008, 47, [7] M. Vrµbel, P. Horµkovµ, H. Pivoňkovµ, L. Kalachova, H. Černockµ, H. Cahovµ, R. Pohl, P. Šebest, L. Havran, M. Hocek, M. Fojta, Chem. Eur. J. 2009, 15, [8] J. Riedl, P. Horµkovµ, P. Šebest, R. Pohl, L. Havran, M. Fojta, M. Hocek, Eur. J. Org. Chem. 2009, [9] J. Balintovµ, R. Pohl, P. Horµkovµ, P. Vidlµkovµ, L. Havran, M. Fojta, M. Hocek, Chem. Eur. J. 2011, 17, [10] H. Macíčkovµ-Cahovµ, R. Pohl, P. Horµkovµ, L. Havran, J. Špaček, M. Fojta, M. Hocek, Chem. Eur. J. 2011, 17, [11] V. Raindlovµ, R. Pohl, B. Klepetµřovµ, L. Havran, E. Šimkovµ, P. Horµkovµ, H. Pivoňkovµ, M. Fojta, M. Hocek, ChemPlusChem 2012, 77, [12] M. A. Bakht, M. S. Yar, S. G. Abdel-Hamid, S. I. Al Qasoumi, A. Samad, Eur. J. Med. Chem. 2010, 45, [13] O. Adelfinskaya, W. Wu, V. J. Davisson, D. E. Bergstrom, Nucleosides, Nucleosides Nucleotides Nucleic Acids 2005, 24, [14] a) M. S. T. GonÅalves, Chem. Rev. 2009, 109, ; b) S. Uchiyama, T. Santa, K. Imai, Analyst 2000, 125, ; c) J. Rohacova, M. L. Marin, A. Martinez-Romero, L. Diaz, J. E. OConnor, M. J. Gomez-Lechon, M. T. Donato, J. V. Castell, M. A. Miranda, Chem- MedChem 2009, 4, ; d) C. Li, E. Henry, N. K. Mani, J. Tang, J.-C. Brochon, E. Deprez, J. Xie, Eur. J. Org. Chem. 2010, [15] B. Zhang, X. Hu, M. Wang, H. Xiao, X. Gong, W. Yang, Y. Cao, New J. Chem. 2012, 36, [16] P. B. Pati, S. Das, S. S. Zade, J. Polym. Sci. Part A 2012, 50, [17] V. Raindlovµ, R. Pohl, M. Šanda, M. Hocek, Angew. Chem. 2010, 122, ; Angew. Chem. Int. Ed. 2010, 49, [18] For polymerase incorporations of base-modified dntps, see refs. [5 11]. For other examples, see: a) S. Jäger, G. Rasched, H. Kornreich- Leshem, M. Engeser, O. Thum, M. Famulok, J. Am. Chem. Soc. 2005, 127, ; b) S. Obeid, M. Yulikow, G. Jeschke, A. Marx, Angew. Chem. 2008, 120, ; Angew. Chem. Int. Ed. 2008, 47, ; c) C. T. Wirges, J. Timper, M. Fischler, A. S Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Chem. Eur. J. 2013, 19,

74 Redox Label for Electrochemical Detection of DNA FULL PAPER Sologubenko, J. Mayer, U. Simon, T. Carell, Angew. Chem. 2009, 121, ; Angew. Chem. Int. Ed. 2009, 48, ; d) N. Ramsay, A.-S. Jemth, A. Brown, N. Crampton, P. Dear, P. Holliger, J. Am. Chem. Soc. 2010, 132, ; e) K. Gutsmiedl, D. Fazio, T. Carell, Chem. Eur. J. 2010, 16, ; f) A. Baccaro, A. Marx, Chem. Eur. J. 2010, 16, ; g) H. Macíčkovµ-Cahovµ, R. Pohl, M. Hocek, ChemBioChem 2011, 12, ; h) P. Kielkowski, H. Macíčkovµ-Cahovµ, R. Pohl, M. Hocek, Angew. Chem. 2011, 123, ; Angew. Chem. Int. Ed. 2011, 50, ; i) P. MØnovµ, M. Hocek, Chem. Commun. 2012, 48, ; j) P. MØnovµ, H. Cahovµ, M. Plucnara, L. Havran, M. Fojta, M. Hocek, Chem. Commun. 2013, 49, [19] a) P. Čapek, R. Pohl, M. Hocek, Org. Biomol. Chem. 2006, 4, ; b) E. C. Western, J. R. Daft, E. M. Johnson, P. M. Gannett, K. H. Shaughnessy, J. Org. Chem. 2003, 68, ; c) E. C. Western, K. H. Shaughnessy, J. Org. Chem. 2005, 70, [20] T. Kovµcs, L. Ötvçs, Tetrahedron Lett. 1988, 29, [21] a) H. Kumamoto, H. Hayakawa, H. Tanaka, S. Shindoh, K. Kato, T. Miyasaka, K. Endo, H. Michida, A. Matsuda, Nucleosides Nucleotides 1998, 17, 15 27; b) G. Cristalli, E. Camaioni, S. Vittori, R. Volpini, P. A. Borea, A. Conti, S. Dionisotti, E. Ongini, A. Monopoli, J. Med. Chem. 1995, 38, ; c) C. Amatore, E. Blart, J. P. Genet, A. Jutand, S. Lemaire-Audoire, M. Savignac, J. Org. Chem. 1995, 60, [22] J. A. Key, Ch. W. Cairo, Dyes Pigm. 2011, 88, [23] a) N. Staiger, A. Marx, ChemBioChem 2010, 11, ; b) H. Sawai, J. Nagashima, M. Kuwahara, R. Kitagata, T. Tamura, I. Matsui, Chem. Biodiversity 2007, 4, ; c) H. Sawai, A. Ozaki-Nakamura, M. Mine, H. Ozaki, Bioconjugate Chem. 2002, 13, [24] X. Liu, M. Jakubowski, J. L. Hunt, Am. J. Clin. Pathol. 2011, 135, [25] M. Fojta, L. Havran, M. Vojtiskova, E. Paleček, J. Am. Chem. Soc. 2004, 126, Received: May 15, 2013 Revised: June 18, 2013 Published online: August 9, 2013 Chem. Eur. J. 2013, 19, Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

75 FULL PAPER DOI: /chem Anthraquinone as a Redox Label for DNA: Synthesis, Enzymatic Incorporation, and Electrochemistry of Anthraquinone-Modified Nucleosides, Nucleotides, and DNA Jana Balintovµ, [a] Radek Pohl, [a] Petra Horµkovµ, [b] Pavlína Vidlµkovµ, [b] Luděk Havran, [b] Miroslav Fojta,* [b] and Michal Hocek* [a] Abstract: Modified 2 -deoxynucleosides and deoxynucleoside triphosphates (dntps) bearing anthraquinone (AQ) attached through an acetylene or propargylcarbamoyl linker at the 5-position of pyrimidine (C) or at the 7-position of 7-deazaadenine were prepared by Sonogashira cross-coupling of halogenated dntps with 2-ethynylanthraquinone or 2-(2-propynylcarbamoyl)anthraquinone. Polymerase incorporations of the AQ-labeled dntps into DNA by primer extension with KOD Keywords: anthraquinone DNA electrochemistry nucleosides oligonucleotides XL polymerase have been successfully developed. The electrochemical properties of the AQ-labeled nucleosides, nucleotides, and DNA were studied by cyclic and square-wave voltammetry, which show a distinct reversible couple of peaks around 0.4 V that make the AQ a suitable redox label for DNA. Introduction DNA biosensors [1] are broadly applied in the life sciences. Electrochemical detection [2] is a less expensive alternative to common optical methods, so redox labeling of DNA by diverse electroactive tags is of increasing importance especially in sequence-specific electrochemical DNA sensing. [3] Our teams have recently jointly developed [4] redox labeling by polymerase incorporation of base-modified deoxynucleoside triphosphates (dntps) bearing a number of redox labels based on ferrocenes, [5] amino and nitrophenyl groups, [6] tetrathiafulvalene, [7] and [Ru/OsACHTUNGTRENUNG(bpy) 3 ] [8] complexes (bpy = 2,2 -bipyridine). Their combination (each nucleobase being labeled by a different marker of different redox potential) has been used [8] for the first generation of multicolor [a] J. Balintovµ, Dr. R. Pohl, Prof. Dr. M. Hocek Institute of Organic Chemistry and Biochemistry Academy of Sciences of the Czech Republic Gilead Sciences and IOCB Research Center Flemingovo nam. 2, Prague 6 (Czech Republic) Fax: (+ 420) hocek@uochb.cas.cz Homepage: [b] Dr. P. Horµkovµ, P. Vidlµkovµ, Dr. L. Havran, Prof. Dr. M. Fojta Institute of Biophsics v.v.i. Academy of Sciences of the Czech Republic Kralovopolska 135, Brno (Czech Republic) Fax: (+ 420) fojta@ibp.cz Homepage: Supporting information for this article is available on the WWW under redox labeling of DNA and for DNA minisequencing. Although the proof of concept for multicolor redox coding was successful, the above-mentioned labels are far from being perfect for real use in diagnostics. The ferrocenes are prone to oxidation by air, [5] the dntps bearing bulky inorganic [OsACHTUNGTRENUNG(bpy) 3 ] are rather poor substrates for DNA polymerases and cannot be incorporated into adjacent positions, [8] and the redox potential of Os 2 + is close to that of 7-deazaguanine base. [8] Therefore, the development of a second generation of redox labels is highly desirable. The labels should be air-stable and not too bulky to make the dntps good substrates for DNA polymerases. To increase sensitivity to DNA secondary structures (detection of single strands, mismatches or deletions), the redox label should preferably be tethered to the nucleobase by a conjugated linker (phenylene or acetylene spacer). Anthraquinone (AQ) is a redox-active [9] molecule frequently utilized for electrochemical labeling of biomolecules. [10] Diverse AQ derivatives linked either directly or through acetylene or longer flexible tethers were repeatedly used for labeling of purine [11,12] or pyrimidine [13,14] nucleosides and even chemically incorporated into DNA by phosphoramidite synthesis to study charge transport through DNA. [12 14] Oligonucleotides bearing an AQ moiety linked through a long flexible tether were observed to stabilize the triplexes. [15] On the other hand, AQ is a photo-oxidant [16] and some AQ derivatives are DNA intercalators, [16] protein photocleavers, [17] or inhibitors of enzymes. [18] To the best of our knowledge, no AQ-bearing dntps or polymerase synthesis of AQ-DNA have been reported. Therefore, herein we report the synthesis of AQ derivatives of nucleosides and dntps and their enzymatic incorporation and electrochemical properties. Chem. Eur. J. 2011, 17, Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim 14063

76 Results and Discussion Scheme 2. i) PAQ, [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ], CuI, (ipr) 2 EtN, DMF, 1 h, 758C. ii) PAQ, PdACHTUNGTRENUNG(OAc) 2, TPPTS, CuI, (ipr) 2 EtN, CH 3 CN/H 2 O (2:1), 1 h, 758C. Scheme 1. i) EAQ, [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ], CuI, (ipr) 2 EtN, DMF, 1 h, 75 8C. ii) 1. POACHTUNGTRENUNG(OMe) 3, POCl 3, 08C; 2. (NHBu 3 ) 2 H 2 P 2 O 7, Bu 3 N, DMF, 08C; 3. TEAB. iii) EAQ, [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ], CuI, (ipr) 2 EtN, DMF/H 2 O (4:1), 1 h, 758C. Base-modified dntps can be prepared either in the classical way by triphosphorylation [19] of modified nucleosides, or by our straightforward single-step aqueous cross-coupling reactions of halogenated dntps. 5-Substituted pyrimidine and 7- substituted 7-deazapurine dntps are usually good substrates [4,19,20] for DNA polymerases, whereas 8-substituted purine dntps are poor substrates. Also, it is known that an acetylene linker between a bulky aromatic substituent and the nucleobase makes the modified dntps better substrates. Therefore, we could not have used the previously reported modified purines [11,12] and directly linked AQ pyrimidines [13] and decided to introduce AQ through conjugated acetylene (analogous to the modification introduced by Barton et al. on deoxyuridine [14] ) as well as nonconjugated propargylcarbamoyl linker (analogous to the modification introduced by Grinstaff and Tierney on purine [12] ) to position 7 of 7-deazadATP (datp = deoxyadenosine triphosphate) and to position 5 of deoxycytidine triphosphate (dctp). To develop the Sonogashira cross-coupling reactions, we started with the modifications of halogenated nucleosides da I and dc I (Schemes 1 and 2, Table 1) with 2-ethynylanthraquinone (EAQ) [12] or 2-(2-propynylcarbamoyl)anthraquinone (PAQ). [11] The reactions of da I and dc I with EAQ in DMF in the presence of [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ], CuI, and (ipr) 2 EtN proceeded very smoothly (Scheme 1) to give the corresponding AQ nucleoside conjugates da EAQ and dc EAQ in good yields of 79 % (Table 1, entries 1, 2). On the other hand, under aqueous conditions (suitable for modification of dntps) in the presence of PdACHTUNGTRENUNG(OAc) 2, triphenylphosphane 3,3,3 -trisulfonate (TPPTS), CuI, and (ipr) 2 EtN in water/acetonitrile (2:1) at 75 8C for 1 h the reactions of these nucleosides with EAQ did not proceed (Table 1, entries 3, 4). Attempted cross-couplings of EAQ with halogenated dn I TPs (da I TP and dc I TP) under the same aqueous conditions with the same catalyst or with [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ] did not proceed either (Table 1, entries 5 7). As the reason could be the limited solubility of EAQ in water/acetonitrile, we also attempted the cross-coupling of da I TP and dc I TP with EAQ in DMF/ water (4:1) in the presence of [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ]. Under these conditions, the reaction proceeded to give the desired AQ dntps da EAQ TP and dc EAQ TP in moderate yields of about 30 % (Table 1, entries 8, 9). To prepare larger quantities of these dntps, we also applied an alternative strategy of triphosphorylation [21] of the corresponding nucleosides. Thus, the treatment of da EAQ and dc EAQ with POCl 3 in POACHTUNGTRENUNG(OMe) 3 followed by the addition of (NHBu 3 ) 2 H 2 P 2 O 7, Bu 3 N, and treatment with triethylammonium bicarbonate (TEAB; Scheme 1) gave the desired dn EAQ TPs in good yields (65 68 %) after isolation by reversed-phase HPLC. The reactions of halogenated nucleosides and dntps with PAQ were attempted under analogous conditions. Nucleosides da I and dc I readily reacted with PAQ in DMF in the presence of [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ], CuI, and (ipr) 2 EtN to give the Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Chem. Eur. J. 2011, 17,

77 Anthraquinone as a Redox Label for DNA FULL PAPER Table 1. Synthesis of AQ-modified nucleosides and nucleotides. Entry Starting compound Reagent Catalyst Additives Solvent Product Yield [%] 1 da I EAQ [PdACHTUNGTRENUNG(PPh 3 )Cl 2 ] CuI, (ipr) 2 NEt DMF da EAQ 79 2 dc I EAQ [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ] CuI, (ipr) 2 NEt DMF dc EAQ 79 3 da I EAQ PdACHTUNGTRENUNG(OAc) 2, TPPTS CuI, (ipr) 2 NEt CH 3 CN:H 2 O (1:2) da EAQ 4 dc I EAQ PdACHTUNGTRENUNG(OAc) 2, TPPTS CuI, (ipr) 2 NEt CH 3 CN:H 2 O (1:2) dc EAQ 5 da I TP EAQ PdACHTUNGTRENUNG(OAc) 2, TPPTS CuI, (ipr) 2 NEt CH 3 CN:H 2 O (1:2) da EAQ TP 6 dc I TP EAQ PdACHTUNGTRENUNG(OAc) 2, TPPTS CuI, (ipr) 2 NEt CH 3 CN:H 2 O (1:2) dc EAQ TP 7 da I TP EAQ [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ] CuI, (ipr) 2 NEt CH 3 CN:H 2 O (1:2) da EAQ TP 8 da I TP EAQ [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ] CuI, (ipr) 2 NEt DMF:H 2 O (4:1) da EAQ TP 30 (36) [a] 9 dc I TP EAQ [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ] CuI, (ipr) 2 NEt DMF:H 2 O (4:1) dc EAQ TP 31 (28) [a] 10 da EAQ 1) POACHTUNGTRENUNG(OMe) 3, POCl 3,08C; 2) (NHBu 3 ) 2 H 2 P 2 O 7,Bu 3 N, DMF, 0 8C; 3) TEAB da EAQ TP dc EAQ 1) POACHTUNGTRENUNG(OMe) 3, POCl 3,08C; 2) NHBu 3 ) 2 H 2 P 2 O 7,Bu 3 N, DMF, 08C; 3) TEAB dc EAQ TP da I PAQ [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ] CuI, (ipr) 2 NEt DMF da PAQ dc I PAQ [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ] CuI, (ipr) 2 NEt DMF dc PAQ da I PAQ PdACHTUNGTRENUNG(OAc) 2, TPPTS CuI, (ipr) 2 NEt CH 3 CN:H 2 O (1:2) da PAQ 15 dc I PAQ PdACHTUNGTRENUNG(OAc) 2, TPPTS CuI, (ipr) 2 NEt CH 3 CN:H 2 O (1:2) dc PAQ 16 da I TP PAQ PdACHTUNGTRENUNG(OAc) 2, TPPTS CuI, (ipr) 2 NEt CH 3 CN:H 2 O (1:2) da PAQ TP 80 (63) [a] 17 dc I TP PAQ PdACHTUNGTRENUNG(OAc) 2, TPPTS CuI, (ipr) 2 NEt CH 3 CN:H 2 O (1:2) dc PAQ TP 79 (74) [a] [a] In parentheses, the yields of dn X TPs were recalculated from UV spectra and the Lambert Beer equation. Table 2. Primers and templates used for PEX experiments. Sequences prim rnd 5 -CATGGGCGGCATGGG-3 prim rnda 5 -CATGGGCGGCATGGA-3 prim rndc 5 -CATGGGCGGCATGGC-3 prim rndt 5 -CATGGGCGGCATGGT-3 temp rnd16 5 -CTAGCATGAGCTCAGTCCCATGCCGCCCATG-3 temp A 5 -CCCTCCCATGCCGCCCATG-3 temp Aterm 5 -TCCCATGCCGCCCATG-3 temp C 5 -CCCGCCCATGCCGCCCATG-3 temp AA 5 -CCCTTCCATGCCGCCCATG-3 temp AC 5 -CCCGTCCATGCCGCCCATG-3 temp CA 5 -CCCTGCCATGCCGCCCATG-3 temp CC 5 -CCCGGCCATGCCGCCCATG-3 temp TA 5 -CCCTACCATGCCGCCCATG-3 temp TC 5 -CCCGACCATGCCGCCCATG-3 temp C4line 5 -TCATCATCATAGGGGCCCATGCCGCCCATG-3 5 -CAGCAGCAGCATTTTCCCATGCCGCCCATG-3 temp A4line desired da PAQ and dc PAQ in good yields of % (Table 1, entries 12, 13), whereas the same reactions under aqueous conditions did not proceed (Table 1, entries 14, 15). However, the aqueous Sonogashira reactions of da I TP and dc I TP with PAQ in the presence of TPPTS, CuI, and (ipr) 2 EtN in water/acetonitrile (2:1) proceeded very smoothly to give the desired nucleotides da EAQ TP and dc EAQ TP in excellent yields of approximately 80 % (Table 1, entries 16, 17). Because the dn XAQ TPs were isolated as salts with undefined molecular formula, the key yields were also recalculated from their absorbance in UV spectra and the Lambert Beer equation by using the extinction coefficients of the corresponding nucleosides to confirm similar values (Table 1, entries 8, 9, 16, 17 and the Supporting Information). The enzymatic incorporation of the AQ-modified dn AQ TPs in primer extension (PEX) experiments was studied by using KOD XL, Vent (exo-), Deep Vent (exo-), and Pwo polymerases, similarly to our previous works (for sequences of templates and primers, see Table 2). The templates and primers were chosen to compare the PEX incorporation of dn XAQ TPs into different sequences and both single modification and four modifications (either in separate positions or four in-line). Single nucleotide extension experiments were tested separately with each of the four dn XAQ TPs by using KOD XL polymerase. All four dn XAQ TPs (Figure 1, lanes 4, 5, 8, 9) were successfully incorporated into DNA. Figure 1. Denaturing polyacrylamide gel electrophoresis (PAGE) analysis of incorporations of dn XAQ TPs by using KOD XL polymerase, prim rnd, temp C, and temp A. Compositions of the dntp mixes and nucleotide labeling are as follows: + positive control (datp or dctp and deoxyguanosine triphosphate (dgtp)), negative control experiments N (absence of each natural dntp), N XAQ (dn XAQ TP + dgtp). To compare the efficiency in incorporation of the AQmodified dntps in comparison with the natural ones, we performed a simple kinetics study in single-nucleotide PEX reaction (Figure 2 and the Supporting Information). In all cases, the incorporation of the natural dntp was finished within s whereas the PEX with AQ-modified dntps took 2 5 min to complete. The dntps bearing the rigid EAQ label were incorporated more slowly than those bearing the PAQ group. Therefore, the reaction time for multiple incorporations must be prolonged to 30 min to ensure full-length product formation. Also, we tried the incorporation of a single modified dn XAQ TP followed by three natural dgtps in different sequence contexts (with primers having Chem. Eur. J. 2011, 17, Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

78 M. Hocek, M. Fojta et al. Figure 2. Comparison of the rate of the PEX with natural C + (dctp) or modified C PAQ (dc PAQ TP) nucleotides using KOD XL polymerase with temp C and prim rnd without natural dgtp. The reaction mixtures were incubated for the time intervals indicated, followed by stopping the reaction by addition of PAGE loading buffer and immediate heating. A, T, or C at the 3 -end) and in all cases the incorporation was successful but the efficiency was sequence dependent (see Figures S6 S8 in the Supporting Information). Multiple incorporations into a random sequence containing all four bases (temp rnd16 ) were also tested. The best results of incorporations were obtained using KOD XL polymerase (Figure 3), whereas other tested polymerases (Vent exo-, Pwo, Deep Vent exo-) gave worse results (see the Supporting Information). Both flexible propargylamide-linked dntps (da PAQ TP and dc PAQ TP; Figure 3, lanes 6, 8) gave the desired fully extended oligonucleotide (ON), whereas the rigid dn EAQ TPs gave either a shorter ON (da EAQ TP; Figure 3, lane 5) or full-length but slightly impure product (dc EAQ TP; Figure 3, lane 7). The PEX product containing C PAQ showed slightly higher mobility than the positive control and A PAQ product, thereby suggesting that the product might be shorter by one nucleotide. However, MALDI analysis of both PEX products gave correct masses of the expected full-length products (see the Supporting Information), clearly confirming full extension (the differences in PAGE mobilities might arise from formation of different secondary structures of the ONs containing several AQ moieties that could intercalate or stack with each other). To further increase the efficiency of the incorporation of the modified dn XAQ TPs by KOD polymerase, we tried to increase the concentration of the modified dn XAQ TPs to ten times that of the natural dntps (Figure 3, lanes 9 12). Surprisingly, inhibition of the PEX reaction by dn AQ TP resulted. This inhibition is interesting because it apparently does not proceed by termination of the primer by the modified nucleotide. This may indicate either binding of the modified dntps to the polymerase or damage of the enzyme by (photo)oxidation by AQ (analogously to refs. [16 18]). Finally, the KOD XL polymerase was challenged by incorporation of four AQ-containing dntps at adjacent positions followed by 11 unmodified nucleotides (Figure 4). Both Figure 4. Denaturing PAGE analysis of PEX experiments with KOD XL polymerase and the temp A4line, temp C4line templates and prim rnd. Compositions of the dntp mixes and nucleotide labeling are as follows: + positive control (datp, dctp, dttp, dgtp), negative control experiments N (absence of each natural dntp), N XAQ (dn XAQ TP + three other natural dntps). Figure 3. Denaturing PAGE analysis of PEX experiments with KOD XL polymerase, temp rnd16, and prim rnd. Compositions of the dntp mixes and nucleotide labeling are as follows: + positive control (datp, dctp, deoxythymidine triphosphate (dttp), dgtp), negative control experiments N (absence of each natural dntp), N XAQ (dn XAQ TP + three other natural dntps). PAQ-linked nucleotides (da PAQ TP and dc PAQ TP; Figure 4, lanes 5, 10) as well as da EAQ TP (Figure 4, lane 4) gave fulllength products, whereas the dc EAQ TP (Figure 4, lane 9) did not give full extension. Apparently, the more flexible dn PAQ TPs are better substrates for KOD polymerase than the rigid dn EAQ TPs and thus are more suitable as building blocks for redox labeling of DNA. Thermal denaturation temperatures of our modified double-stranded (ds) DNAs containing N EAQ or dn PAQ nucleotides were also studied. The melting temperatures of the natural and modified DNAs are summarized in Table 3 (for sequences see Table 4). The presence of rigid EAQ groups resulted in significant destabilization (DT m = 1.4 to 4 8C) of the duplex. On the other hand, the PAQ substituents Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Chem. Eur. J. 2011, 17,

79 Anthraquinone as a Redox Label for DNA FULL PAPER Table 3. Melting temperatures of DNA duplexes. DNA1 DNA2 [a] T m [8C] DT m T m [8C] DT m [a] A A EAQ A PAQ DNA3 DNA4 C C EAQ C PAQ [a] DT m = (T m mod T m + )/n mod. Table 4. Oligonucleotides used for measurements of T m. DNA1 5 -CCCTCCCATGCCGCCCATG-3 3 -GGGAGGGTACGGCGGGTAC-5 DNA2 5 -CTAGCATGAGCTCAGTCCCATGCCGCCCATG-3 3 -GATCGTACTCGAGTCAGGGTACGGCGGGTAC-5 DNA3 5 -CCCGCCCATGCCGCCCATG-3 3 -GGGCGGGTACGGCGGGTAC-5 DNA4 5 -CTAGCATGAGCTCAGTCCCATGCCGCCCATG-3 3 -GATCGTACTCGAGTCAGGGTACGGCGGGTAC-5 Figure 5. Voltammetric responses of AQ-labeled nucleosides and ONs (PEX products). a) CV at HMDE: free AQ (black); PAQ (red); dc PAQ (blue): concentration of all substances 40 mm, initial potential 0 V, switching potential 1.85 V; inset: switching potential 1.3 V. b) CV at HMDE: PEX product pex rnd16 ACHTUNGTRENUNG(C PAQ ) (black); the same but unmodified (red); negative PEX (no enzyme added: blue). Other conditions (including the inset) as in (a). c) SWV at PGE: PEX product pex rnd16 ACHTUNGTRENUNG(C PAQ ) (black); the same but unmodified (red). Inset: CV at PGE: samples as in (a). slightly stabilized the dsdna (DT m =0to+ 1). These results also support the conclusion that the PAQ substituents are more suitable as DNA labels. The electrochemical properties of the AQ-labeled nucleosides, dntps, and ONs were studied by cyclic voltammetry (CV) and/or square-wave voltammetry (SWV) at hanging mercury drop (HMDE) and pyrolytic graphite electrodes (PGE; Figure 5). Our attention has been oriented mainly towards the characteristic quinone/hydroquinone redox pair [22] close to 0.5 V, which gives rise to the peaks AQ red (cathodic, due to reduction of the AQ moiety) and AQH 2 ox (anodic, due to reoxidation of anthrahydroquinone (AQH 2 ), the product of the former electrode reaction). Nevertheless, we investigated the voltammetric responses of the title compounds in a wider potential range, particularly through regions where signals of natural nucleobases occur, [2] to assess the possibility of simultaneous monitoring of DNA modification and determination of the DNA amount through measuring its intrinsic responses (see below). Compared to free AQ, the redox potential of the AQ/ AQH 2 pair at the HMDE in EAQ and PAQ was shifted to less negative potentials by mv (Figure 5 a, Table 5), thus suggesting more facile reduction and more difficult oxidation in the presence of the substituents on the AQ aromatic system. These shifts could in principle be ascribed to electronic effects of unsaturated conjugate groups (ethynyl or carbonyl, respectively); on the other hand, measurements with the same compounds at the PGE revealed more complex phenomena, which resulted in negative potential shifts of the reduction peak and positive shift of the oxidation peak in EAQ (Table 5), whereas PAQ exhibited positive shifts of both signals. In general, the AQ/AQH 2 redox process at the PGE showed poorer reversibility (indicated by remarkable separation of the potentials of oxidation and reduction peaks), probably due to less facile electron transfer at the PGE compared to the HMDE. In EAQ nucleoside conjugates, further significant (more than 100 mv compared to EAQ) positive shift of the AQ/AQH 2 pair measured at the HMDE was observed, probably due to electron-with- Chem. Eur. J. 2011, 17, Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

80 M. Hocek, M. Fojta et al. Table 5. Redox potentials of AQ/anthrahydroquinone moiety in building blocks, nucleosides, dntps, and ONs. HMDE [a] PGE [b] AQ red AQH 2 ox AQ red AQH 2 ox AQ EAQ PAQ dc EAQ dc PAQ dc EAQ TP dc PAQ TP pex rnd16 ACHTUNGTRENUNG(C PAQ ) [c] da EAQ da PAQ da EAQ TP da PAQ TP pex rnd16 ACHTUNGTRENUNG(A PAQ ) [c] [a] CV measured at the HMDE in 0.3 m ammonium formate, 0.05 m sodium phosphate (ph 6.9) with initial potential 0.0 V and switching potential 1.3 V. [b] CV measured in sodium acetate (ph 5) with other conditions as above; for more details see the Experimental Section. [c] Product of PEX on temp rnd16, bearing four PAQ-labeled C or A residues. drawing effects of the nucleobase electronically coupled through the ethynyl linker. [5,23] In analogous PAQ nucleoside conjugates, the nucleobase effects were in minor agreement with the insulating effect of the propargyl bridge. No significant differences in peak potentials between the corresponding da X and dc X conjugates were observed. AQ-labeled dntps showed in general more negative potentials of the AQ/AQH 2 pair compared to the corresponding nucleosides (Table 5), probably due to charge effects of the phosphate groups affecting adsorption of the compounds at the electrode surfaces and consequently accessibility of the redox-active groups for the electrode reaction. [24] Figure 5 a shows that reversibility of the AQ/AQH 2 redox process is maintained in CV when the potential scan is switched from negative to positive at potentials V (inset in Figure 5 a). However, when highly negative potentials are applied (such as 1.85 V to reach G reduction in DNA, see below), no anodic AQH ox 2 is observed, which suggests deeper reduction of the AQ moiety resulting in its irreversible destruction. With nucleosides and nucleotides, reduction signals of the C or A moieties were observed at corresponding potentials (in Figure 5 a shown for dc PAQ, peak C red ). Depending on the conditions, some of the title compounds produced additional voltammetric signals (Figure 5 a), the detailed analysis of which is beyond the scope of this paper and will be presented elsewhere. By using the temp rnd16 template PEX products bearing four PAQ-labeled C or A residues were prepared and analyzed by CV at the HMDE (Figure 5 b) or PGE (Figure 5 c). CV results of the pex rnd16 ACHTUNGTRENUNG(C PAQ ) measured at the HMDE for switching potential 1.85 V revealed peak AQ red at 0.41 V in addition to peak CA close to 1.5 V (due to irreversible reduction of unmodified C and A in the ON) and peak G (due to reoxidation of 7,8-dihydroguanine to which G is converted at potentials close to the switching potential of 1.85 V). [2] The latter signals unlike the AQ red peak were produced by unmodified ONs as well. In agreement with observations made with the nucleosides and dntps, no anodic peak AQH ox 2 was detected under these conditions. When, however, the direction of potential scan was switched at 1.3 V, the AQ/AQH 2 redox pair exhibited excellent reversibility but no peak G was observed (because in this case potentials applied at the electrode were not sufficiently negative for G reduction; see inset in Figure 5 b). In general it is useful to measure simultaneously the voltammetric signals specific for a label introduced and intrinsic DNA responses (for example, for normalization of the label signal on the total DNA amount). [5 8] Here it is apparently impossible to measure the DNA peaks CA and G in one CV scan without loss of the AQ/AQH 2 reversibility. Nevertheless, all of the above signals can easily be obtained in two successive scans by using the less negative switching potential for the first and the more negative for the second (see the Supporting Information for more details). At the PGE, the AQ-specific peak was obtained in one scan together with purine oxidation peaks G ox and A ox when initial potentials more negative than the potential of the AQ/AQH 2 redox pair and positive scan direction were applied (Figure 5 c). Furthermore, we tested the possibility of simultaneous detection of AQ labels and another electrochemically reducible tag attached to nucleobases, 2-nitrophenyl (PhNO 2 ). [6] Previously, for the purposes of multicolor DNA coding, we proposed combinations of various enzymatically introduced electroactive tags differing in their redox potentials and/or character of the electrochemical process they undergo (reversible redox, irreversible oxidation or reduction). [6,8] Redox potentials of most of the (reversibly or irreversibly) oxidizable tags occur between about and +1.1 V and voltammetric signals of some of them partially interfere with those due to oxidation of natural purines or their 7- deaza analogues. On the other hand, reduction of the nucleobases occurs at potentials around 1.5 V (C, A) or more negative (G), and thus there is no interference between signals resulting from nucleobase reduction and those due to the external reducible tags such as nitrophenyl and AQ, and the only problem is differentiation between these tags. For this purpose we prepared pex rnd16 (C X ) and pex rnd16 (A X ) products in which PhNO 2 and PAQ were combined at various ratios (in Figure 6 a shown for A X ). Reduction peaks of both labels (AQ red around 0.41 and NO red 2 around 0.49 V) could easily be distinguished when PAQ alone or PhNO 2 alone was introduced. However, when both labels were present in the same ON chain, their reduction signals overlapped due to the relatively small difference in their peak potentials ACHTUNGTRENUNG(80 mv) and it was rather difficult to detect peak AQ red if one PAQ per three PhNO 2 was incorporated or vice versa. Nevertheless, since the reduction of AQ is reversible and that of the nitro group irreversible, only peak AQH ox 2 was detected in CV on the anodic branch (Figure 6 a), thus unmasking the minority PAQ label. Moreover, the PhNO 2 labels could be detected indirectly during the anodic voltage scan by using a signal corresponding to reversible oxidation of hydroxylamine (the product of four-elec Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Chem. Eur. J. 2011, 17,

81 Anthraquinone as a Redox Label for DNA FULL PAPER Scheme 3. Structures of NO 2 -modified dntps [6] used in this study. proved in principle applicable in single nucleotide polymorphism probing and useful to complement the palette of previously introduced multicolor DNA labels. Figure 6. a) CV responses of pex rnd16 (A X ) products with incorporated A PAQ and A PhNO2 conjugates at different ratios (given in the panel). b) CV responses obtained for sequence-specific incorporation of a single A X bearing either PAQ or PhNO 2 label. PEX reactions were performed with temp A template and dn (X) TP mixes given in the panel. CVs were measured with initial potential 0.0 V, switching potential 0.7 V, and final potential V; other conditions as in Figure 5. tron reduction of the nitro group) to the nitroso group (see the Supporting Information for more details). Because the corresponding peak NHOH ox occurs around 0.01 V (Figure 6), the almost 400 mv peak potential separation between peaks AQH ox 2 and NHOH ox allows perfect resolution and independent detection of both labels (Scheme 3). Finally, we tested the possibility of electrochemical monitoring of the sequence-specific incorporation of a single nucleotide labeled with either PAQ or PhNO 2 tag (Figure 6 b). The PEX reaction was carried out with the temp A template and mixtures containing either da PAQ TP +dc PhNO2 TP + dgtp, or da PhNO2 TP + dc PAQ TP +dgtp. It is evident from Figure 6 b that CV responses resulting from these experiments revealed perfectly specific incorporation of labeled A X against thymine residue in the template strand: when the reaction mixture contained da PAQ TP, peaks AQ red and AQH ox 2 were detected, whereas the absence of NO red 2 and NHOH ox peaks indicated no significant misincorporation of the labeled cytosine. For reaction mixtures containing da PhNO2 TP the opposite was true. Hence, PAQ labels Conclusion Novel AQ-modified dntps linked through conjugate acetylene or nonconjugate propargylcarbamoyl linker have been prepared and tested as substrates for DNA polymerases. The Sonogashira cross-couplings of halogenated nucleosides and dntps with EAQ proceeded only in DMF and therefore the corresponding dntps were prepared by triphosphorylation of nucleosides. On the other hand, the more polar PAQ was sufficiently reactive in aqueous cross-couplings with halogenated dntps. All four AQ-linked dn XAQ TPs (da EAQ TP, dc EAQ TP, da PAQ TP, and dc PAQ TP) were tested as substrates of DNA polymerases. KOD XL polymerase was identified as the most suitable enzyme for their incorporation. In single incorporation experiments, all four dn XAQ TPs worked well, whereas for multiple incorporations, the more flexible dn PAQ TPs were better substrates than the rigid dn EAQ TPs. Under tenfold higher concentration of dn XAQ TPs, inhibition of the polymerase was observed. Electrochemical studies of the AQ-modified nucleotides and DNA (PEX products) by voltammetry revealed well-developed peaks of reversible reduction of the AQ moiety around 0.4 V. Combination of the AQ modification with previously reported nitrophenyl labeling gave one unresolved broad reduction peak. However, CV can easily distinguish between these two labels since the reduction of NO 2 (unlike AQ) is irreversible, and produces no oxidation signal interfering with that of AQH 2 oxidation. Independent detection of the PhNO 2 in the presence of AQ is possible Chem. Eur. J. 2011, 17, Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

82 M. Hocek, M. Fojta et al. through oxidation of hydroxylamine, product of the NO 2 reduction. Therefore, the PhNO 2 and PAQ labels have a good potential for base-specific multiple labeling and selective detection of one in the presence of the other. The dc PAQ TP and da PAQ TP linked through the propargylcarbamoyl group are good substrates for polymerase incorporation, so the AQ can be used to complete the palette of redox labels for multicolor DNA coding in combination with some of the previously reported or future novel redox labels. Studies towards practical applications in diagnostics are under way. Experimental Section General chemistry: All cross-coupling reactions were performed under an argon atmosphere. Compounds 7-I-7-deaza-dATP, [6] 5-I-dCTP, [20] 2-(2- propynylcarbamoyl)anthraquinone, [11] and 2-ethynylanthraquinone [12] were prepared according to the literature procedures. Other chemicals were purchased from commercial suppliers and were used as received. NMR spectra were measured on Bruker Avance 500 (500 MHz for 1H, MHz for 13C, and MHz for 31P) or Bruker 600 (600 MHz for 1H, MHz for 13C) instruments in D 2 O (referenced to dioxane as internal standard, d( 1 H) = 3.75 ppm, dachtungtrenung( 13 C) = ppm, standard for 31P NMR was external H 3 PO 4 ). Chemical shifts are given in ppm (d scale), coupling constants (J) in Hz. Complete assignment of all NMR signals was achieved by use of a combination of H,H-COSY, H,C-HSQC, and H,C-HMBC experiments. NMR spectra of dntps were measured in phosphate buffer at ph 7.1. Mass spectra were measured on an LCQ classic (Thermo-Finnigan) spectrometer by using ESI or Q-Tof Micro (Waters, ESI source, internal calibration with lock spray). Preparative HPLC separations were performed on a column packed with 10 mm C18 reversed-phase material (Phenomenex, Luna C18(2)). IR spectra were measured either on a Bruker Alpha FTIR spectrometer with the ATR technique or by using KBr tablets. High-resolution mass spectra were measured on an LTQ Orbitrap XL (Hermo Fischer Scientific) spectrometer by using the ESI technique. Mass spectra of functionalized DNA were measured by MALDI-TOF, Reflex IV (Bruker) with nitrogen laser. UV/ Vis spectra were measured on a Varian CARY 100 Bio spectrophotometer at room temperature. Melting points were determined on a Kofler block. General procedure for the Sonogashira cross-coupling reaction of 2-ethynylanthraquinone and 2-(2-propynylcarbamoyl)anthraquinone with halogenated nucleosides: Method A: da EAQ, dc EAQ : Dry DMF (3 ml) was added to an argon-purged flask containing 2-ethynylanthraquinone (47 mg, 0.20 mmol, 1.2 equiv), nucleoside analogue dn I (0.16 mmol, 1 equiv), CuI (4 mg, 0.02 mmol, 10 mol %), and [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ] (6 mg, mmol, 5 mol %) followed by (ipr) 2 EtN (0.3 ml, 1.7 mmol, 10 equiv). The reaction mixture was stirred at 758C for 1 h until complete consumption of the starting material and then evaporated in vacuo. The products were purified by silica gel column chromatography with chloroform/methanol (0 to 10 %) as eluent. da PAQ, dc PAQ : Dry DMF (3 ml) was added to an argon-purged flask containing 2-(2-propynylcarbamoyl)anthraquinone (45 mg, 0.15 mmol, 1.2 equiv), nucleoside analogue dn I (0.13 mmol, 1 equiv), CuI (3 mg, mmol, 10 mol %), and [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ] (5 mg, mmol, 5 mol %) followed by (ipr) 2 EtN (0.23 ml, 1.3 mmol, 10 equiv). The reaction mixture was stirred at 75 8C for 1 h until complete consumption of the starting material and then evaporated in vacuo. The products were purified by silica gel column chromatography with chloroform/methanol (0 to 10%) as eluent. General procedure for the Sonogashira cross-coupling reaction of 2-ethynylanthraquinone with halogenated nucleoside triphosphates: Method B: da EAQ TP, dc EAQ TP: A DMF/H 2 O mixture (4:1, 2.5 ml) was added through a septum to an argon-purged vial containing da I TP sodium salt or dc I TP sodium salt (0.04 mmol), 2-ethynylanthraquinone (12 mg, 0.05 mmol, 1.2 equiv), [PdACHTUNGTRENUNG(PPh 3 ) 2 Cl 2 ] (2 mg, mmol, 5 mol %), CuI (1 mg, mmol), and (ipr) 2 EtN (0.74 ml, 0.42 mmol, 10 equiv). The mixture was stirred and heated to 758C for 1 h. The product was isolated from the crude reaction mixture by HPLC on a C18 column with the use of a linear gradient of 0.1m TEAB in H 2 O to 0.1 m TEAB in H 2 O/MeOH (1:1) as eluent. Several co-distillations with water and conversion to sodium salt form (Dowex 50WX8 in Na + cycle) followed by freezedrying from water gave a solid product. Triphosphosphorylation of the dn EAQ : Method C: da EAQ TP, dc EAQ TP: Dry trimethyl phosphate (0.16 ml) was added to an argon-purged flask containing nucleoside analogue dn EAQ (0.06 mmol, 1 equiv) cooled to 08C on ice followed by the addition of POCl 3 (7 ml, 0.07 mmol, 1.2 equiv). After 1.5 h, a solution of (NHBu 3 ) 2 H 2 P 2 O 7 (181 mg, 0.3 mmol, 5 equiv) and Bu 3 N (0.04 ml, 0.3 mmol, 4.2 equiv) in dry DMF (1 ml) was added to the reaction mixture which was stirred for another 1 h and quenched by 2 m TEAB buffer (1 ml). The product was isolated from the crude reaction mixture by HPLC on a C18 column with the use of a linear gradient of 0.1 m TEAB in H 2 O to 0.1 m TEAB in H 2 O/MeOH (1:1) as eluent. Several co-distillations with water and conversion to sodium salt form (Dowex 50WX8 in Na + cycle) followed by freezedrying from water gave a solid product. General procedure for the Sonogashira cross-coupling reaction of 2-(2- propynylcarbamoyl)anthraquinone with halogenated nucleoside triphosphates: Method D: da PAQ TP, dc PAQ TP: A 2:1 mixture of H 2 O/CH 3 CN (2 ml) followed by (ipr) 2 EtN (0.75 ml, 10 equiv) was added to an argonpurged flask containing halogenated nucleoside triphosphate da I TP or dc I TP (0.04 mmol), 2-(2-propynylcarbamoyl)anthraquinone (19 mg, 0,06 mmol, 1.2 equiv), and CuI (1 mg, 10 mol %). In a separate flask, Pd- ACHTUNGTRENUNG(OAc) 2 (1 mg, mmol, 5 mol %) and TPPTS (3 mg, mmol, 2.5 equiv with respect to Pd) were combined, the flask was evacuated and purged with argon, and then a 2:1 mixture of H 2 O/CH 3 CN (0.5 ml) was added. This catalyst solution was injected into the reaction mixture, which was then stirred at 75 8C for 1 h. The product was isolated from the crude reaction mixture by HPLC on a C18 column with the use of a linear gradient of 0.1 m TEAB in H 2 O to 0.1 m TEAB in H 2 O/MeOH (1:1) as eluent. Several co-distillations with water and conversion to sodium salt form (Dowex 50WX8 in Na + cycle) followed by freezedrying from water gave a solid product. da EAQ : Compound da EAQ was prepared from da I according to the general procedure (Method A). The product was isolated as a dark red solid (63.5 mg, 79%). M.p C; 1 H NMR (499.8 MHz, [D 6 ]DMSO): 2.24 (ddd, J gem = 13.3, J 2 b,1 6.0, J 2 b,3 = 2.9 Hz, 1 H; H-2 b), 2.52 (ddd, J gem = 13.3, J 2 a,1 = 7.9, J 2 a,3 = 5.9 Hz, 1H; H-2 a), 3.55 (ddd, J gem = 11.8, J 5 b,oh = 5.8, J 5 b,4 = 4.4 Hz, 1H; H-5 b), 3.61 (ddd, J gem = 11.8, J 5 a,oh = 5.4, J 5 a,4 = 4.4 Hz, 1H; H-5 a), 3.86 (td, J 4,5 = 4.4, J 4,3 = 2.6 Hz, 1 H; H-4 ), 4.38 (m, 1H; H-3 ), 5.09 (dd, J OH,5 = 5.8, 5.4 Hz, 1 H; OH-5 ), 5.31 (d, J OH,3 = 4.1 Hz, 1 H; OH-3 ), 6.53 (dd, J 1,2 = 7.9, 6.0 Hz, 1H; H-1 ), 6.90 (bs, 2H; NH 2 ), 7.95 (m, 2 H; H-6,7-anthr), 8.04 (s, 1 H; H-6), 8.10 (dd, J 3,4 = 8.0, J 3,1 = 1.7 Hz, 1H; H-3-anthr), 8.17 (s, 1H; H-2), 8.23 (m, 3H; H-4,5,8- anthr), 8.35 ppm (dd, J 1,3 = 1.7, J 1,4 = 0.6 Hz, 1H; H-1-anthr); 13 C NMR (125.7 MHz, [D 6 ]DMSO): (CH 2-2 ), (CH 2-5 ), (CH-3 ), (CH-1 ), (CH-4 ), (C5-CC-anthr), (C5-CCanthr), (C-5), (C-4a), , , (CH-4,5,8- anthr), (CH-6), (C-2-anthr), (CH-1-anthr), (C-4a-anthr), , , (C-8a,9a,10a-anthr), , (CH-6,7-anthr), (CH-3-anthr), (C-7a), (CH-2), (C-4), (C-10-anthr), ppm (C-9-anthr); IR (KBr): ñ= 3461, 3450, 3290, 2200, 1668, 1628, 1591, 1576, 1568, 1558, 1530, 1479, 1450, 1329, 1302, 1285, 1263, 1180, 1149, 1055 cm 1 ; MS (ESI +): m/z (%): (100) [M + 2H+Na]; HRMS (ESI +): calcd for C 27 H 20 N 4 Na O 5 : ; found dc EAQ : Compound dc EAQ was prepared from dc I according to the general procedure (Method A). The product was isolated as a yellow-orange solid (61 mg, 79%). M.p. > 300 8C; 1 H NMR (500.0 MHz, [D 6 ]DMSO): 2.07 (dt, J gem = 13.4, J 2 b,1 = J 2 b,3 = 6.1 Hz, 1H; H-2 b), 2.21 (ddd, J gem = 13.4, J 2 a,1 = 6.1, J 2 a,3 = 4.0 Hz, 1H; H-2 a), 3.61 and 3.69 (2 ddd, J gem = 12.0, J 5,OH = 5.1, J 5,4 = 3.6 Hz, 2 1H; H-5 ), 3.83 (q, J 4,5 = J 4,3 = 3.6 Hz, 1H; H-4 ), 4.25 (m, 1H; H-3 ), 5.19 (t, J OH,5 = 5.1 Hz, 1 H; OH-5 ), Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Chem. Eur. J. 2011, 17,

83 Anthraquinone as a Redox Label for DNA FULL PAPER (d, J OH,3 = 4.3 Hz, 1H; OH-3 ), 6.13 (t, J 1,2 = 6.1 Hz, 1H; H-1 ), 7.39 and 7.87 (2 bs, 2 1H; NH 2 ), 7.95 (m, 2H; H-6,7-anthr), 8.08 (dd, J 3,4 = 8.1, J 3,1 = 1.7 Hz, 1 H; H-3-anthr), 8.22 (m, 3H; H-4,5,8-anthr), 8.44 (d, J 1,3 = 1.7 Hz, 1H; H-1-anthr), 8.48 ppm (s, 1 H; H-6); 13 C NMR (125.7 MHz, [D 6 ]DMSO): (CH 2-2 ), (CH 2-5 ), (CH-3 ), (CH-1 ), (C5-CC-anthr), (CH-4 ), (C-5), (C5-CC-anthr), , , (CH-4,5,8-anthr), (C-2-anthr), (CH- 1-anthr), (C-4a-anthr), (C-9a-anthr), , (C- 8a,10a-anthr), , (CH-6,7-anthr), (CH-3-anthr), (CH-6), (C-2), (C-4), (C-10-anthr), ppm (C-9- anthr); IR (KBr): ñ = 3417, 2202, 1675, 1659, 1643, 1590, 1558, 1503, 1360, 1328, 1290, 1278, 1259, 1203, 1177, 1093, 1053 cm 1 ; MS (ESI ): m/z (%): 456 (15) [M + H], 479 (38) [M + H+Na]; HRMS (ESI ): calcd for C 25 H 18 N 3 O 6 : ; found da PAQ : Compound da PAQ was prepared from da I according to the general procedure (Method A). The product was isolated as an orange solid (58 mg, 80%). M.p C; 1 H NMR (499.8 MHz, [D 6 ]DMSO): 2.17 (ddd, J gem = 13.1, J 2 b,1 6.0, J 2 b,3 = 2.9 Hz, 1H; H-2 b), 2.46 (ddd, J gem = 13.1, J 2 a,1 = 8.0, J 2 a,3 = 5.8 Hz, 1H; H-2 a), 3.50 (ddd, J gem = 11.8, J 5 b,oh = 6.0, J 5 b,4 = 4.3 Hz, 1H; H-5 b), 3.56 (ddd, J gem = 11.8, J 5 a,oh = 5.1, J 5 a,4 = 4.3 Hz, 1H; H-5 a), 3.81 (td, J 4,5 = 4.3, J 4,3 = 2.5 Hz, 1 H; H-4 ), 4.33 (m, 1H; H-3 ), 4.39 (d, J = 5.2 Hz, 2 H; CH 2 N), 5.08 (dd, J OH,5 = 6.0, 5.1 Hz, 1H; OH-5 ), 5.27 (d, J OH,3 = 4.1 Hz, 1 H; OH-3 ), 6.47 (dd, J 1,2 = 8.0, 6.0 Hz, 1H; H-1 ), 7.73 (s, 1 H; H-6), 7.96 (m, 2 H; H-6,7-anthr), 8.10 (s, 1H; H-2), 8.24, 8.26 (2 ddd, J = 5.7, 3.4, 0.6 Hz, 2 1 H; H-5,8-anthr), 8.31 (dd, J 4,3 = 8.1, J 4,1 = 0.6 Hz, 1 H; H-4-anthr), 8.39 (dd, J 3,4 = 8.1, J 3,1 = 1.9 Hz, 1 H; H-3-anthr), 8.69 (dd, J 1,3 = 1.9, J 1,4 = 0.6 Hz, 1H; H-1-anthr), 9.61 ppm (t, J = 5.2 Hz, 1H; NH); 13 C NMR (125.7 MHz, [D 6 ]DMSO): (CH 2 N), (CH 2-2 ), (CH 2-5 ), (CH-3 ), (C5- CC-anthr), (CH-1 ), (CH-4 ), (C5-CC-anthr), (C-5), (C-4a), (CH-1-anthr), (CH-6), , (CH-5,8-anthr), (CH-4-anthr), (CH-3-anthr), , , (C-2,8a,10a-anthr), (CH-6,7-anthr), (C-4aanthr), (C-9a), (C-7a), (CH-2), (C-4), (CONH), , ppm (C-9,10-anthr); IR (KBr): ñ=3432, 3398, 3285, 2231, 1676, 1655, 1626, 1591, 1570, 1533, 1473, 1457, 1325, 1298, 1283, 1255, 1173, 1093, 1058 cm 1 ; MS (ESI+): m/z (%): 538 (25) [M + +H], (100) [M + +H+Na]; HRMS (ESI +): calcd for C 29 H 24 N 5 O 6 : ; found dc PAQ : Compound dc PAQ was prepared from dc I according to the general procedure (Method A). The product was isolated as a yellow-orange solid (56 mg, 83%). M.p C; 1 H NMR (499.8 MHz, [D 6 ]DMSO): 1.97 (ddd, J gem = 13.2, J 2 b,1 = 7.2, J 2 b,3 = 6.0 Hz, 1H; H-2 b), 2.14 (ddd, J gem = 13.2, J 2 a,1 = 6.0, J 2 a,3 = 3.5 Hz, 1 H; H-2 a), 3.54, 3.62 (2 ddd, J gem = 12.1, J 5,OH = 4.8, J 5,4 = 3.6 Hz, 2 1H; H-5 ), 3.79 (q, J 4,3 = J 4,5 = 3.6 Hz, 1H; H-4 ), 4.20 (m, 1H; H-3 ), 4.39 (d, J = 5.1 Hz, 2 H; CH 2 N), 5.06 (bt, J OH,5 = 4.8 Hz, 1 H; OH-5 ), 5.21 (bd, J OH,3 = 3.8 Hz, 1 H; OH-3 ), 6.11 (dd, J 1,2 = 7.2, 6.0 Hz, 1H; H-1 ), 6.90, 7.84 (2 bs, 2 1H; NH 2 ), 7.97 (m, 2H; H-6,7-anthr), 8.16 (s, 1H; H-6), 8.24, 8.26 (2 ddd, J=5.7, 3.4, 0.6 Hz, 2 1H; H-5,8-anthr), 8.31 (dd, J 4,3 = 8.1, J 4,1 = 0.6 Hz, 1H; H-4- anthr), 8.36 (dd, J 3,4 = 8.1, J 3,1 = 1.8 Hz, 1H; H-3-anthr), 8.67 (dd, J 1,3 = 1.8, J 1,4 = 0.6 Hz, 1H; H-1-anthr), 9.44 ppm (t, J=5.2 Hz, 1H; NH); 13 C NMR (125.7 MHz, [D 6 ]DMSO): (CH 2 N), (CH 2-2 ), (CH 2-5 ), (CH-3 ), (C5-CC-anthr), (CH-1 ), (CH-4 ), (C-5), (C5-CC-anthr), (CH-1-anthr), , (CH- 5,8-anthr), (CH-4-anthr), (CH-3-anthr), , , (C-2,8a,10a-anthr), (CH-6,7-anthr), (C-4a-anthr), (C-9a), (CH-6), (C-2), (C-4), (CONH), ppm (C-9,10-anthr); IR (KBr): ñ=3410, 2927, 2231, 1676, 1646, 1593, 1533, 1505, 1481, 1416, 1360, 1327, 1283, 1250, 1177, 1093, 1053 cm 1 ; MS (ESI ): m/z (%): 513 (100) [M + H]; HRMS (ESI ): calcd for C 27 H 21 N 4 O 7 : ; found da EAQ TP: Compound da EAQ TP was prepared from da I TP according to the general procedure (Method B) in 30% yield or from da EAQ according to the general procedure (Method C) in 65% yield. The product was isolated as a dark brown solid. 1 H NMR (499.8 MHz, CD 3 OD + D 2 O): 1.29 (t, J vic = 7.2 Hz, 18H; CH 3 CH 2 N), 2.45 (ddd, J gem = 13.8, J 2 b,1 = 5.9, J 2 b,3 = 3.1 Hz, 1H; H-2 b), 2.60 (ddd, J gem = 13.8, J 2 a,1 = 8.0, J 2 a,3 = 5.6 Hz, 1H; H-2 a), 3.18 (t, J vic = 7.2 Hz, 12H; CH 3 CH 2 N), (m, 3H; H- 4,5 ), 4.76 (m, 1H; H-3 ), 6.39 (dd, J 1,2 = 8.0, 5.9 Hz, 1H; H-1 ), (m, 3H; H-6, H-6,7-anthr), 7.82 (d, J 3,4 = 7.9 Hz, 1H; H-3-anthr), 7.92 (d, J 8,7 = 7.3 Hz, 1H; H-8-anthr), 7.96 (s, 2 H; H-2, H-1-anthr), 8.04 (d, J 5,6 = 7.2 Hz, 1H; H-5-anthr), 8.10 ppm (d, J 4,3 = 7.9 Hz, 1 H; H-4-anthr); 13 C NMR (125.7 MHz, CD 3 OD + D 2 O): 9.20 (CH 3 CH 2 N), (CH 2-2 ), (CH 3 CH 2 N), (d, J C,P = 5.8 Hz; CH 2-5 ), (CH-3 ), (CH-1 ), (d, J C,P = 9.1 Hz; CH-4 ), (C5-CC-anthr), (C5- CC-anthr), (C-5), (C-4a), (CH-8-anthr), (CH- 5-anthr), (CH-4-anthr), (CH-6), (CH-1-anthr), (C-2-anthr), (C-4a-anthr), , , (C- 8a,9a,10a-anthr), , (CH-6,7-anthr), (CH-3-anthr), (C-7a), (CH-2), (C-4), , ppm (C-9,10- anthr); 31 P{ 1 H} NMR (202.3 MHz, CD 3 OD + D 2 O): (bdd, J = 20.2, 17.4 Hz; P b ), (d, J = 2.02 Hz; P a ), 9.54 ppm (bd, J = 17.4 Hz; P g ); MS (ESI ): m/z (%): 719 (12) [M + H], 741 (45) [M + 2H+Na]; HRMS (ESI ): calcd for C 27 H 22 N 4 O 14 P 3 : ; found dc EAQ TP: Compound dc EAQ TP was prepared from dc I TP according to the general procedure (Method B) in 31% yield or from dc EAQ according to the general procedure (Method C) in 68% yield. The product was isolated as a yellow solid. 1 H NMR (600.1 MHz, CD 3 OD + D 2 O): 2.29 (ddd, J gem = 14.0, J 2 b,1 = 7.2, J 2 b,3 = 6.2 Hz, 1 H; H-2 b), 2.45 (ddd, J gem = 14.0, J 2 a,1 = 6.0, J 2 a,3 = 3.8 Hz, 1H; H-2 a), 4.20 (q, J 4,3 = J 4,5 = 3.8 Hz, 1 H; H- 4 ), 4.23 (ddd, J gem = 11.1, J H,P = 4.9, J 5 b,4 = 3.8 Hz, 1H; H-5 b), 4.30 (ddd, J gem = 11.1, J H,P = 6.5, J 5 a,4 = 3.8 Hz, 1 H; H-5 a), 4.65 (dt, J 3,2 = 6.2, 3.8, J 3,4 = 3.8 Hz, 1H; H-3 ), 6.24 (dd, J 1,2 = 7.2, 6.0 Hz, 1 H; H-1 ), 7.91 (m, 2H; H-6,7-anthr), 8.10 (d, J 3,4 = 8.1 Hz, 1H; H-3-anthr), (m, 3H; H-4,5,8-anthr), 8.31 (s, 1 H; H-6), 8.38 ppm (s, 1H; H-1-anthr); 13 C NMR (150.9 MHz, CD 3 OD + D 2 O): (CH 2-2 ), (d, J C,P = 4.9 Hz; CH 2-5 ), (CH-3 ), (C5-CC-anthr), (d, J C,P = 8.7 Hz; CH-4 ), (CH-1 ), (C-5), (C5-CC-anthr), , , (CH-4,5,8-anthr), (C-2-anthr), (CH-1-anthr), (C-4a-anthr), , , (C-8a,9a,10a-anthr), , (CH-6,7-anthr), (CH-3-anthr), (CH-6), (C-2), (C-4), , ppm (C-9,10-anthr); 31 P{ 1 H} NMR (202.3 MHz, CD 3 OD + D 2 O): (t, J=19.3 Hz; P b ), 9.94 (d, J= 19.3 Hz; P a ), 7.67 ppm (bd, J = 19.3 Hz; P g ); MS (ESI ): m/z (%): 696 (23) [M + H], 718 (55) [M + 2H+Na]; HRMS (ESI ): calcd for C 25 H 21 N 3 O 15 P 3 : ; found da PAQ TP: Compound da PAQ TP was prepared from dc I TP according to the general procedure (Method D). The product was isolated as a white solid (30 mg, 80 %). 1 H NMR (499.8 MHz, CD 3 OD + D 2 O): 2.38 (ddd, J gem = 13.7, J 2 b,1 = 6.0, J 2 b,3 = 2.8 Hz, 1 H; H-2 b), 2.58 (ddd, J gem = 13.7, J 2 a,1 = 7.9, J 2 a,3 = 6.1 Hz, 1 H; H-2 a), 4.11 (bm, 1H; H-5 b), (bm, 2H; H-4,5 a), 4.44 (bs, 2 H; CH 2 N), 4.97 (bm, 1 H; H-3 ), 6.54 (dd, J 1,2 = 7.9, 6.0 Hz, 1H; H-1 ), 7.71 (s, 1 H; H-6), 7.90 (m, 2H; H-6,7-anthr), 8.05 (s, 1 H; H-2), (m, 3 H; H-3,5,8-anthr), 8.32 (d, J 4,3 = 8.0 Hz, 1H; H-4-anthr), 8.62 ppm (bs, 1 H; H-1-anthr); 13 C NMR (125.7 MHz, CD 3 OD + D 2 O): (CH 2 N), (CH 2-2 ), (b, CH 2-5 ), (CH-3 ), (C5-CC-anthr), (CH-1 ), (d, J C,P = 8.0 Hz; CH-4 ), (C5-CC-anthr), (C-5), (C-4a), (CH-1- anthr), (CH-6), , (CH-5,8-anthr), (CH-4- anthr), (CH-3-anthr), , , (C-2,8a,10a-anthr), , (CH-6,7-anthr), (C-4a-anthr), (C-9a-anthr), (C-7a), (CH-2), (C-4), (CONH), , ppm (C-9,10-anthr); 31 P{ 1 H} NMR (202.3 MHz, CD 3 OD + D 2 O): (bdd, J=18.9, 16.5 Hz; P b ), (d, J=18.9 Hz; P a ), 8.73 ppm (bd, J = 16.5 Hz; P g ); MS (ESI ): m/z (%): 776 (14) [M + H], 798 (12) [M + 2H+Na]; HRMS (ESI ): calcd for C 29 H 25 N 5 O 15 P 3 : ; found dc PAQ TP: Compound dc PAQ TP was prepared from dc I TP according to the general procedure (Method D). The product was isolated as a white solid (27 mg, 79 %). 1 H NMR (499.8 MHz, CD 3 OD + D 2 O): 2.24, 2.40 (2 bm, 2 1H; H-2 ), 4.15 (bm, 1H; H-4 ), 4.22 (bm, 2H; H-5 ), 4.45 (bs, 2H; CH 2 N), 4.60 (bm, 1 H; H-3 ), 6.21 (bt, J 1,2 = 6.0 Hz, 1H; H-1 ), 7.85 (bm, 2H; H-6,7-anthr), (bm, 2H; H-5,8-anthr), (bm, 3H; H-6, H-3,4-anthr), 8.49 ppm (bs, 1 H; H-1-anthr); 13 C NMR (125.7 MHz, CD 3 OD + D 2 O): (CH 2 N), (CH 2-2 ), (b, Chem. Eur. J. 2011, 17, Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

84 M. Hocek, M. Fojta et al. CH 2-5 ), (CH-3 ), (C5-CC-anthr), (b, CH-4 ), (CH-1 ), (C-5, C5-CC-anthr), (CH-1-anthr), , (CH-5,8-anthr), (CH-4-anthr), (CH-3-anthr), , , (C-2,8a,10a-anthr), , (CH-6,7-anthr), (C-4a-anthr), (C-9a-anthr), (CH-6), (C-2), (C-4), (CONH), , ppm (C-9,10-anthr); 31 P{ 1 H} NMR (202.3 MHz, CD 3 OD + D 2 O): (b, P b ), (b, P a ), 8.24 ppm (b, P g ); MS (ESI ): m/z (%): 753 (5) [M + ], 775 (22) [M + H+Na]; HRMS (ESI ): calcd for C 27 H 24 N 4 O 16 P 3 : ; found Materials for biochemistry: Synthetic oligonucleotides were purchased from VBC Genomics (Austria). Dynabeads M-270 Streptavidin (DBStv) were obtained from Dynal A.S. (Norway), Vent (exo-), Pwo, polymerases, and T4 polynucleotide kinase were from New England Biolabs (Great Britain), KOD XL DNA from Novagen, unmodified nucleoside triphosphates (datp, dttp, dctp, and dgtp) from Sigma, and g- 32 P-ATP from MP Empowered Discovery (USA). Other chemicals were of analytical grade. Primer extension experiment single incorporation (Figure 1): The reaction mixture (20 ml) contained KOD XL DNA polymerase (2.5 U ml 1, 0.02 ml), dgtp (natural, 4 mm, 0.05 ml), dn XAQ TP, datp (dctp) (4 mm, 1mL), primer (3 mm, 1mL, prim rnd :3 -GGGTACGGCGGGTAC-5 ), and 19-mer template (3 mm, 1.5 ml, temp A : 5 -CCCTCCCATGCCGCC- CATG-3 or temp C : 5 -CCCGCCCATGCCGCCCATG-3 ) in KOD XL reaction buffer (1 ml) supplied by the manufacturer. Prim rnd was labeled by use of [g 32 P]-ATP according to standard techniques. Reaction mixtures were incubated for 15 min at 60 8C in a thermal cycler and were stopped by addition of stop solution (40 ml, 80% [v/v] formamide, 10 mm ethylenediaminetetraacetic acid (EDTA), % [w/v] bromophenol blue, % [w/v] xylene cyanol) and heated for 5 min at 958C. Reaction mixtures were separated by use of a 12.5 % denaturing PAGE. Visualization was performed by phosphoimaging. Kinetics of PEX: The PEX reaction mixtures using KOD XL DNA polymerase were incubated for time intervals ( min), followed by stopping the reaction by addition of PAGE loading buffer and immediate heating. Primer extension experiment multiple incorporation (Figure 3): The reaction mixture (20 ml) contained KOD XL DNA polymerase (2.5 UmL 1, 0.3 ml), dntps [in samples 2 8: (4 mm, 1mL); in samples 9 12: dntps (4 mm, 1mL), dn XAQ TPs (40 mm, 1mL)], primer (3 mm, 1mL, prim rnd : 3 -GGGTACGGCGGGTAC-5 ), and 31-mer template (3 mm, 1.5 ml, temp rnd16 :5 -CTAGCATGAGCTCAGTCCCATGCCGCCCATG- 3 ) in KOD XL reaction buffer (1 ml) supplied by the manufacturer. Prim rnd was labeled by use of [g 32 P]-ATP according to standard techniques. Reaction mixtures were incubated for 30 min at 60 8C in a thermal cycler and were stopped by addition of stop solution (40 ml, 80% [v/ v] formamide, 10 mm EDTA, % [w/v] bromophenol blue, % [w/v] xylene cyanol) and heated for 5 min at 958C. Reaction mixtures were separated by use of a 12.5 % denaturing PAGE. Visualization was performed by phosphoimaging. Primer extension experiment multiple incorporation (Figure 4): The reaction mixture (20 ml) contained KOD XL DNA polymerase (2.5 UmL 1, 0.3 ml), dntps (4 mm, 1mL), primer (3 mm, 1mL, prim rnd :3 - GGGTACGGCGGGTAC-5 ), and 30-mer template (3 mm, 1.5 ml, temp A4line : 5 -CAGCAGCAGCATTTTCCCATGCCGCCCATG-3 or temp C4line : 5 -TCATCATCATAGGGGCCCATGCCGCCCATG-3 ) in KOD XL buffer (1 ml) supplied by the manufacturer. Prim rnd was labeled by use of [g 32 P]-ATP according to standard techniques. Reaction mixtures were incubated for 30 min at 60 8C in a thermal cycler and were stopped by addition of stop solution (40 ml, 80% [v/v] formamide, 10 mm EDTA, % [w/v] bromophenol blue, % [w/v] xylene cyanol) and heated for 5 min at 958C. Reaction mixtures were separated by use of a 12.5 % denaturing PAGE. Visualization was performed by phosphoimaging. PAGE: The PEX products were mixed with loading buffer (80 % formamide, 10 mm EDTA, 1 mg ml 1 xylene cyanol, 1 mg ml 1 bromophenol blue) and subjected to electrophoresis in 12.5 % denaturing polyacrylamide gel containing 1 Tris/borate/EDTA (TBE) buffer (ph 8) and 7 m urea at 25 W for 50 min. Gels were dried, autoradiographed, and visualized using a phosphorimager. Melting temperatures: The oligonucleotides for these measurements were prepared by PEX on a large scale with KOD XL DNA as polymerase, templates temp A, temp C, and temp rnd16, and prim rnd as primer. For preparative purposes, a total volume of 500 ml PEX with higher concentrations of primer (10 mm) and template (10 mm) was run and purification was carried out with QIAquick Nucleotide Removal Kit (Qiagen). Samples were eluted with H 2 O (100 ml, ph 7.5) and then freeze-dried. DNA duplexes were first dissolved in phosphate buffer (160 ml, 50 mm, ph 6.7) and further diluted with the buffer to optimum concentration OD 260 between 0.08 and 0.1. Thermal denaturation studies were performed on a Cary 100 Bio (UV visible spectrometer with temperature controller, Varian). Data were obtained from six individual cooling heating cycles. Melting temperatures (T m values in 8C) were obtained by plotting temperature versus absorbance and by applying a sigmoidal curve fit. Isolation of single-strand oligonucleotides by the DBStv magnetoseparation procedure: Reaction mixture (50 ml) containing 0.3 m NaCl was added to DBStv [25 ml of stock solution washed three times by 150 ml of buffer (0.3 m NaCl, 10 mm Tris, ph 7.4)]. The suspension was shaken at room temperature to allow the oligonucleotides to bind to the DBStv beads. The DBStv beads were washed three times with phosphate-buffered saline (PBS) solution (200 ml, 0.14 m NaCl, 3 mm KCl, 4 mm sodium phosphate, ph 7.4) with 0.01 % Tween 20 and then three times by buffer (200 ml, 0.3m NaCl, 10 mm Tris, ph 7.4) and finally by doubly distilled H 2 O (200 ml). Single-strand oligonucleotides were released by shaking and heating the sample at 758C for 2 min. Each medium exchange was performed by using a magnetoseparator (Dynal, Norway). Electrochemical analysis: Nucleosides, deoxynucleoside monophosphates (dnmps), and other building blocks were analyzed by conventional in situ CV. PEX products were analyzed by ex situ (adsorptive transfer stripping) CV or SWV. The PEX products were accumulated for 60 s from aliquots (5 ml) containing 0.2 m NaCl at the surface of the working electrode (HMDE or basal-plane PGE). The electrode was then rinsed with deionized water and placed in the electrochemical cell. CV settings: scan rate 0.5 V s 1, initial potential 0.0 V, for switching and final potentials see figure legends. SWV settings: initial potential 0.6 V, final potential 1.6 V, frequency 200 Hz, amplitude 25 mv. Background electrolyte: 0.3 m ammonium formate, 0.05 m sodium phosphate, ph 6.6 (for measurements at HMDE) or 0.2 m sodium acetate ph 5.0 (for measurements at PGE). All measurements were performed at room temperature by using an Autolab analyzer (Eco Chemie, The Netherlands) in connection with VA-stand 663 (Metrohm, Herisau, Switzerland). The three-electrode system was used with an Ag/AgCl/3m KCl electrode as a reference and platinum wire as an auxiliary electrode. Measurements at the HMDE were performed after deaeration of the solution by argon purging. Acknowledgements This work was supported by the Academy of Sciences of the Czech Republic (Z , Z , and Z ), the Ministry of Education (LC06035, LC512), Grant Agency of the Academy of Sciences of the Czech Republic (IAA ), and by Gilead Sciences, Inc. (Foster City, CA, USA.). [1] a) M. J. Heller, Annu. Rev. Biomed. Eng. 2002, 4, ; b) A. Sassolas, B. D. Leca-Bouvier, L. J. Blum, Chem. Rev. 2008, 108, [2] a) E. Paleček, F. Jelen in Electrochemistry of Nucleic Acids and Proteins: Towards Electrochemical Sensors for Genomics and Proteomics (Eds.: E. Paleček, F. Scheller, J. Wang), Elsevier, Amsterdam, 2005, pp ; b) J. Wang in Electrochemistry of Nucleic Acids and Proteins: Towards Electrochemical Sensors for Genomics and Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Chem. Eur. J. 2011, 17,

85 Anthraquinone as a Redox Label for DNA FULL PAPER Proteomics (Eds.: E. Paleček, F. Scheller, J. Wang), Elsevier, Amsterdam, 2005, pp [3] T. G. Drummond, M. G. Hill, J. K. Barton, Nat. Biotechnol. 2003, 21, [4] Review: M. Hocek, M. Fojta, Org. Biomol. Chem. 2008, 6, [5] P. Brµzdilovµ, M. Vrµbel, R. Pohl, H. Pivoňkovµ, L. Havran, M. Hocek, M. Fojta, Chem. Eur. J. 2007, 13, [6] H. Cahovµ, L. Havran, P. Brµzdilovµ, H. Pivoňkovµ, R. Pohl, M. Fojta, M. Hocek, Angew. Chem. 2008, 120, ; Angew. Chem. Int. Ed. 2008, 47, [7] J. Riedl, P. Horµkovµ, P. Šebest, R. Pohl, L. Havran, M. Fojta, M. Hocek, Eur. J. Org. Chem. 2009, [8] M. Vrµbel, P. Horµkovµ, H. Pivoňkovµ, L. Kalachova, H. Černockµ, H. Cahovµ, R. Pohl, P. Šebest, L. Havran, M. Hocek, M. Fojta, Chem. Eur. J. 2009, 15, [9] a) D. Ajloo, B. Yoonesi, A. Soleymanpour, Int. J. Electrochem. Sci. 2010, 5, ; b) M. Quan, D. Sanchez, M. F. Wasylkiv, D. K. Smith, J. Am. Chem. Soc. 2007, 129, ; c) C. Batchelor- McAuley, Q. Li, S. M. Dapin, R. G. Compton, J. Phys. Chem. B 2010, 114, ; d) C. Batchelor-McAuley, B. R. Kozub, D. Menshykau, R. G. Compton, J. Phys. Chem. C 2011, 115, [10] a) S. D. Wettig, G. A. Bare, R. J. S. Skinner, J. S. Lee, Nano Lett. 2003, 3, ; b) S. Mahajan, J. Richardson, N. Ben Gaied, Z. Zhao, T. Brown, P. N. Barlett, Electroanalysis 2009, 21, ; c) Y. J. Zhang, X. P. He, M. Hu, Z. Li, X. X. Shi, G. R. Chen, Dyes Pigments 2011, 88, [11] a) R. Abou-Elkhair, T. Netzel, Nucleosides Nucleotides Nucleic Acids 2005, 24, ; b) R. A. I. Abou-Elkhair, D. W. Dixon, T. L. Netzel, J. Org. Chem. 2009, 74, [12] M. Tierney, M. Grinstaff, Org. Lett. 2000, 2, [13] M. F. Jacobsen, E. E. Ferapontova, K. V. Gothelf, Org. Biomol. Chem. 2009, 7, [14] A. A. Gorodetsky, O. Green, E. Yavin, J. K. Barton, Bioconjugate Chem. 2007, 18, [15] Z. Zhao, G. Peng, J. Michels, K. R. Fox, T. Brown, Nucleosides, Nucleotides Nucleic Acids 2007, 26, [16] a) C. C. Bjorklund, W. B. Davis, Biochemistry 2007, 46, ; b) K. E. Augustyn, E. J. Merino, J. K. Barton, Proc. Natl. Acad. Sci. USA 2007, 104, ; c) T. T. Williams, C. Dohno, E. D. A. Stamp, J. K. Barton, J. Am. Chem. Soc. 2004, 126, [17] A. Suzuki, M. Hasegawa, M. Ishii, S. Matsumura, K. Toshima, Bioorg. Med. Chem. Lett. 2005, 15, [18] a) G. I. Giles, R. P. Sharma, J. Pept. Sci. 2005, 11, ; b) E. De Moliner, S. Moro, S. Sarno, G. Zagotto, G. Zanotti, L. A. Pinna, R. Battistutta, J. Biol. Chem. 2003, 278, [19] a) T. Gourlain, A. Sidorov, N. Mignet, S. J. Thorpe, S. E. Lee, J. A. Grasby, D. M. Williams, Nucleic Acids Res. 2001, 29, ; b) H. A. Held, S. A. Benner, Nucleic Acids Res. 2002, 30, ; c) S. Jäger, G. Rasched, H. Kornreich-Leshem, M. Engeser, O. Thum, M. Famulok, J. Am. Chem. Soc. 2005, 127, ; d) M. Kuwahara, J. Nagashima, M. Hasegawa, T. Tamura, R. Kitagata, K. Hanawa, S. Hososhima, T. Kasamatsu, H. Ozaki, H. Sawai, Nucleic Acids Res. 2006, 34, ; e) P. M. E. Gramlich, S. Warncke, J. Gierlich, T. Carell, Angew. Chem. 2008, 120, ; Angew. Chem. Int. Ed. 2008, 47, ; f) V. Borsenberger, M. Kukwikila, S. Howorka, Org. Biomol. Chem. 2009, 7, ; g) S. Obeid, M. Yulikow, G. Jeschke, A. Marx, Angew. Chem. 2008, 120, ; Angew. Chem. Int. Ed. 2008, 47, [20] P. Čapek, H. Cahovµ, R. Pohl, M. Hocek, C. Gloeckner, A. Marx, Chem. Eur. J. 2007, 13, [21] T. Kovacs, L. Ötvçs, Tetrahedron Lett. 1988, 29, [22] a) P. Manisankar, A. Gomathi, D. Velayutham, J. Solid State Electrochem. 2005, 9, ; b) J. Vacek, L. Havran, M. Fojta, Electroanalysis 2009, 21, ; c) D. A. Di Giusto, W. A. Wlassoff, S. Giesebrecht, J. J. Gooding, G. C. King, J. Am. Chem. Soc. 2004, 126, [23] M. Hocek, P. Stepnicka, J. Ludvik, I. Cisarova, I. Votruba, D. Reha, P. Hobza, Chem. Eur. J. 2004, 10, [24] a) P. Zuman, Collect. Czech. Chem. Commun. 1993, 58, 41 46; b) K. Peckovµ, J. Barek, T. Navratil, B. Yosypchuk, J. Zima, Anal. Lett. 2009, 42, Received: March 28, 2011 Published online: November 17, 2011 Chem. Eur. J. 2011, 17, Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

86 Article pubs.acs.org/joc Aqueous Heck Cross-Coupling Preparation of Acrylate-Modified Nucleotides and Nucleoside Triphosphates for Polymerase Synthesis of Acrylate-Labeled DNA Jitka Dadova, Pavlína Vidlaḱova, Radek Pohl, Ludeǩ Havran, Miroslav Fojta,, and Michal Hocek*,, Institute of Organic Chemistry and Biochemistry, Academy of Sciences of the Czech Republic, Gilead Sciences & IOCB Research Center, Flemingovo naḿ. 2, CZ Prague 6, Czech Republic Institute of Biophysics, v.v.i., Academy of Sciences of the Czech Republic, Kralovopolska 135, CZ Brno, Czech Republic Central European Institute of Technology, Masaryk University, Kamenice 753/5, CZ Brno, Czech Republic Department of Organic Chemistry, Faculty of Science, Charles University in Prague, Hlavova 8, CZ Prague 2, Czech Republic *S Supporting Information ABSTRACT: Aqueous-phase Heck coupling methodology was developed for direct attachment of butyl acrylate to 5-iodoracil, 5- iodocytosine, 7-iodo-7-deazaadenine, and 7-iodo-7-deazaguanine 2 - deoxyribonucleoside 5 -O-monophosphates (dnmps) and 5 -Otriphosphates (dntps) and compared with the classical approach of phosphorylation of the corresponding modified nucleosides. The 7- substituted 7-deazapurine nucleotides (da BA MP, da BA TP, dg BA MP, and dg BA TP) were prepared by the direct Heck coupling of nucleotides in good yields (35 55%), whereas the pyrimidine nucleotides reacted poorly and the corresponding BA-modified dntps were prepared by triphosphorylation of the modified nucleosides. The acrylate-modified dn BA TPs (N = A, C, and U) were good substrates for DNA polymerases and were used for enzymatic synthesis of acrylate-modified DNA by primer extension, whereas dg BA TP was an inhibitor of polymerases. The butyl acrylate group was found to be a useful redox label giving a strong reduction peak at 1.3 to 1.4 V in cyclic voltammetry. INTRODUCTION Base-modified 2 -deoxyribonucleoside triphosphates (dntps) bearing chemical modifications at position 5 of pyrimidines or at position 7 of 7-deazapurines are generally good substrates for DNA polymerases. Diverse protocols for enzymatic synthesis of base-modified DNA have been developed and have been extensively used in the past decade. 1 The methods include primer extension (PEX) or PCR, 2 site-specific single-nucleotide incorporation, 3 or nicking-enzyme amplification reaction (NEAR). 4 The applications cover fluorescent, 5,6 redox, 7 spin, 8 barcode, 9 and reactive 10 labeling, protection, 11 and incorporation of protein-like groups for catalysis. 12 The modified dntps are usually synthesized by triphosphorylation of modified nucleosides which is laborious and sometimes incompatible with the introduced functionality. Aqueous-phase cross-coupling reactions are an increasingly popular and useful tool in modifications of polar molecules 13 and are of particular importance for biomolecules. The very first report was on the Sonogashira coupling of 5-iodo-2 - deoxyuridine and dump with propargylamine by Casalnuovo. 14 Later on, the Shaughnessy group has developed the first aqueous Suzuki Miyaura coupling of unprotected halogenated purine nucleosides, 15 whereas the Burgess group reported the first direct Sonogashira coupling of 5-iodoracil dntp. 5 In our laboratory, the aqueous Suzuki coupling of halogenated nucleotides and dntps with diverse boronic acids was developed. 16 More recently, the Suzuki reactions of oligonucleotides have also been reported. 17 We extensively use both Suzuki and Sonogashira couplings for modification of pyrimidine and 7-deazapurine dntps linked through aryl groups (by the Suzuki coupling) or through the alkynyl moiety (by the Sonogashira coupling). 6,7,10,11 Both these reactions are performed in water/acetonitrile mixtures using triphenylphosphine-3,3,3 -trisulfonate (TPPTS) as water-soluble ligand for palladium catalyst. Both these reactions are very tolerant to the presence of large variety of functional groups and allow a singlestep preparation of modified dntps without the need of protection group manipulation. Development of other aqueous coupling reactions applicable for other types of carbon substituents is still highly desirable to extend the portfolio of bioorthogonal modifications of nucleic acids. The Heck reaction is another very useful type of crosscoupling extensively applied in attachment of alkenyl groups. 18 Received: May 28, 2013 Published: August 30, American Chemical Society 9627 dx.doi.org/ /jo J. Org. Chem. 2013, 78,

87 The Journal of Organic Chemistry Article Scheme 1. Synthesis of Butyl Acrylate Modified Nucleosides (dn BA s), Nucleoside Mono- (dn BA MPs), and Triphosphates (dn BA TPs) a a Reagents and conditions: (i) butyl acrylate, Pd(OAc) 2, PPh 3,Et 3 N, DMF; (ii) butyl acrylate, Pd(OAc) 2, TPPTS, Et 3 N, CH 3 CN/H 2 O (1:1); (iii) PO(OMe) 3, POCl 3,0 C; (iv) (1) PO(OMe) 3, POCl 3,0 C, (2) (NHBu 3 ) 2 H 2 P 2 O 7,Bu 3 N, DMF, 0 C, (3) 2 M TEAB; (v) butyl acrylate, Pd(OAc) 2, TPPTS, Et 3 N, CH 3 CN/H 2 O (1:1). Table 1. Synthesis of Butyl Acrylate Modified Nucleosides and Nucleotides entry starting compd product catalyst additives solvent yield (%) 1 dc I dc BA Pd(OAc) 2, PPh 3 Et 3 N DMF 14 2 du I du BA Pd(OAc) 2, PPh 3 Et 3 N DMF 93 3 da I da BA Pd(OAc) 2, PPh 3 Et 3 N DMF 97 4 dg I dg BA Pd(OAc) 2, PPh 3 Et 3 N DMF 83 5 dc I dc BA Pd(OAc) 2, TPPTS Et 3 N CH 3 CN/H 2 O (1:1) 16 6 du I du BA Pd(OAc) 2, TPPTS Et 3 N CH 3 CN/H 2 O (1:1) 98 7 da I da BA Pd(OAc) 2, TPPTS Et 3 N CH 3 CN/H 2 O (1:1) 81 8 dg I dg BA Pd(OAc) 2, TPPTS Et 3 N CH 3 CN/H 2 O (1:1) 84 9 dc I MP dc BA MP Pd(OAc) 2, TPPTS Et 3 N CH 3 CN/H 2 O (1:1) - 10 du I MP du BA MP Pd(OAc) 2, TPPTS Et 3 N CH 3 CN/H 2 O (1:1) da I MP da BA MP Pd(OAc) 2, TPPTS Et 3 N CH 3 CN/H 2 O (1:1) dg I MP dg BA MP Pd(OAc) 2, TPPTS Et 3 N CH 3 CN/H 2 O (1:1) dc I TP dc BA TP Pd(OAc) 2, TPPTS Et 3 N CH 3 CN/H 2 O (1:1) - 14 du I TP du BA TP Pd(OAc) 2, TPPTS Et 3 N CH 3 CN/H 2 O (1:1) 4 15 du I TP du BA TP Pd(OAc) 2, PPh 3 Et 3 N DMF da I TP da BA TP Pd(OAc) 2, TPPTS Et 3 N CH 3 CN/H 2 O (1:1) dg I TP dg BA TP Pd(OAc) 2, TPPTS Et 3 N CH 3 CN/H 2 O (1:1) du BA du BA MP PO(OMe) 3, POCl 3,0 C da BA da BA MP PO(OMe) 3, POCl 3,0 C dc BA dc BA TP (1) PO(OMe) 3, POCl 3,0 C; (2) (NHBu 3 ) 2 H 2 P 2 O 7,Bu 3 N, DMF, 0 C; (3) 19 2 M TEAB 21 du BA du BA TP (1) PO(OMe) 3, POCl 3,0 C; (2) (NHBu 3 ) 2 H 2 P 2 O 7,Bu 3 N, DMF, 0 C; (3) 40 2 M TEAB 22 da BA da BA TP (1) PO(OMe) 3, POCl 3,0 C; (2) (NHBu 3 ) 2 H 2 P 2 O 7,Bu 3 N, DMF, 0 C; (3) 28 2 M TEAB 23 dg BA dg BA TP (1) PO(OMe) 3, POCl 3,0 C; (2) (NHBu 3 ) 2 H 2 P 2 O 7,Bu 3 N, DMF, 0 C; (3) 2 M TEAB 25 In nucleoside chemistry it has been often used for modifications of pyrimidines 19 but is difficult for modifications of purines. 20 Only very recently, Shaughnessy reported 21 the first aqueousphase Heck reactions for modification of 5-iodo-2 -deoxyuridine. Here we report on the development of the aqueus Heck coupling for modifications of pyridimine and 7-deazapurine nucleoside mono- and triphosphates and the use of acrylate- dntps for enzymatic synthesis of modified DNA. modified RESULTS AND DISCUSSION Synthesis of Acrylate-Modified Nucleosides and Nucleotides by Aqueous Heck Coupling. The acrylate 9628 dx.doi.org/ /jo J. Org. Chem. 2013, 78,

88 The Journal of Organic Chemistry Article Table 2. List of Oligodeoxyribonucleotides Used or Synthesized a oligonucleotide sequence prim 5 -CATGGGCGGCATGGG-3 temp 1C 5 -CCCGCCCATGCCGCCCATG-3 temp 1T 5 -CCCACCCATGCCGCCCATG-3 temp 1A 5 -CCCTCCCATGCCGCCCATG-3 temp 1G 5 -AAACCCCATGCCGCCCATG-3 temp 4 5 -CTAGCATGAGCTCAGTCCCATGCCGCCCATG-3 ON 1C 5 -CATGGGCGGCATGGGC BA GGG-3 ON 1T 5 -CATGGGCGGCATGGGU BA GGG-3 ON 1A 5 -CATGGGCGGCATGGGA BA GGG-3 ON 1G 5 -CATGGGCGGCATGGGG BA TTT-3 ON 4C 5 -CATGGGCGGCATGGGAC BA TGAGC BA TC BA ATGC BA TAG-3 ON 4T 5 -CATGGGCGGCATGGGACU BA GAGCU BA CAU BA GCU BA AG-3 ON 4A 5 -CATGGGCGGCATGGGA BA CTGA BA GCTCA BA TGCTA BA G-3 ON 4G 5 -CATGGGCGGCATGGGACUG BA AG BA CUCAUG BA CUAG BA -3 a In the template (temp) ONs the segment-forming duplex with the primer are underlined and the replicated segments are in bold. For magnetic separation of the extended primer strands, the templates were 5 -end biotinylated. Acronyms used in the text for primer extension products are analogous to those introduced for the templates (e.g., ssdna PEX product ON 1A was synthesized on temp 1A etc.). ester moiety is an attractive label for DNA since it can be in principle further derivatized by amide formation, conjugate additions, reductions, etc. and also could be reduced on electrode to serve as redox label for electrochemistry. Ja ger et al. 2 prepared methyl acrylate-modified dutp by triphosphorylation of nucleoside and showed its successful incorporation by Vent(exo-) polymerase but never reported any further use. We wanted to study the aqueous Heck reaction of iodinated pyrimidine and deazapurine nucleotides and dntps. However, at first we tested the Heck reactions of 2 -deoxy-5-iodocytidine (dc I ), 2 -deoxy-5-iodoridine (du I ), 2 -deoxy-7-iodo-7-deazaadenosine (da I ) and 2 -deoxy-7-iodo-7-deazaguanosine (dg I ) nucleosides with n-butyl acrylate (6 equiv) in the presence of Pd(OAc) 2 (10 mol %), triphenylphosphine, and triethylamine in DMF (Scheme 1). While the reactions with du I, da I, and dg I proceeded almost quantitatively to give the desired acrylate-modified nucleosides in excellent yields (93% du BA, 97% da BA, and 83% dg BA ; Table 1, entries 2 4), dc I showed much lower reactivity and the desired dc BA was isolated in poor yield (14%; Table 1, entry 1). Then, for comparison, aqueous Heck reactions of iodinated nucleosides with n-butyl acrylate were carried out in the mixture water/acetonitrile (1:1) in the presence of water-soluble phosphine ligand tris(3- sulfonatophenyl)phosphine (TPPTS, Scheme 1). The results were comparable to the DMF protocol in all cases. The couplings on du I, da I,and dg I proceeded smoothly with good isolated yields of modified nucleosides (98% du BA, 81% da BA, and 84% dg BA ; Table 1, entries 6 8), whereas dc I gave dc BA in an isolated yield of 16% (Table 1, entry 5). Then the aqueous conditions were tested with halogenated nucleoside monophosphates (dnmps) which are relatively stable and water-soluble compounds suitable as models for nucleic acids (Scheme 1). Thus, the aqueous Heck coupling of dc I MP, du I MP, da I MP, and dg I MP with n-butyl acrylate (the excess was increased to 10 equiv) were performed in the presence of Pd(OAc) 2 (10 mol % were necessary) and TPPTS (25 mol %). The reactions proceeded less efficiently (compared to nucleosides) with ca % conversion to give modified nucleotides du BA MP, da BA MP, and dg BA MP in isolated yields of 35%, 55%, and 38%, respectively (Table 1, entries 10 12). The formation of dc BA MP was not observed (Table 1, entry 9). Finally, the aqueous phase Heck coupling was performed on nucleoside triphosphates (dc I TP, du I TP, da I TP, and dg I TP, Scheme 1). To minimize hydrolysis of triphosphate group, the reaction time was shortened to 1 h under the same conditions as above to reach ca. 50% conversion. The deazapurine dntps reacted well to obtain da BA TP and dg BA TP in acceptable yields of 43% and 44%, respectively (Table 1, entries 16 and 17). On the other hand, pyrimidine dntps reacted poorly. dc BA TP was not detected in the reaction mixture, whereas du BA TP was isolated in 4% yield only due to substantial hydrolysis of both starting du I TP and the product (Table 1, entries 13 and 14). To prevent the hydrolysis, the Heck coupling of du I TP was also performed in DMF under the conditions described above for the synthesis of modified nucleosides. The conversion increased to ca. 80%, but the isolated yield of du BA TP was 14% (Table 1, entry 15) and substantive amounts of the corresponding mono- and diphosphate were observed. It indicates that du BA TP was largely hydrolyzed during the isolation and purification process. For comparison of the efficiency of the aqueous-phase direct modification of nucleotides with the classical approach, the acrylate modified nucleosides (dc BA, du BA, da BA, and dg BA ) were phosphorylated to obtain dn BA MPs and dn BA TPs (Scheme 1, Table 1). The treatment of du BA or da BA with POCl 3 in PO(OMe) 3 at 0 C followed by quenching the reaction with triethylammonium bicarbonate (TEAB, 2M) gave the desired modified dn BA MPs in acceptable isolated yields (42% for du BA MP and 54% for da BA MP). Triphosphorylation of nucleosides dc BA, du BA, da BA, and dg BA was performed under standard conditions 22 by treatment with POCl 3 in PO(OMe) 3 at 0 C followed by addition of (NHBu 3 ) 2 H 2 P 2 O 7 in DMF in the presence of tributylamine. The reaction was quenched with TEAB and after purification, dn BA TPs were obtained in acceptable yields (19% for dc BA TP, 40% for du BA TP, 28% for da BA TP, and 25% for dg BA TP). The yields of both approaches were then compared. The efficiency of direct aqueous Heck reaction of halogenated nucleotides was comparable with phosphorylation in the case of both tested monophosphates (du BA MP and da BA MP) giving yields of 35 55%. It was even more efficient for the synthesis of deazapurine dntps: da BA TP (43% compared to 28% yield of triphosphorylation) and dg BA TP (44% compared to 25% yield of triphosphorylation). However, in the preparation of 9629 dx.doi.org/ /jo J. Org. Chem. 2013, 78,

89 The Journal of Organic Chemistry Article Figure 1. Primer extension with (a) temp1c; (b) temp1t; (c) temp1a; (d) temp1g. Key: P, primer; C+, dctp, dgtp; C, dgtp; CBA, dcbatp, dgtp; T+, dttp, dgtp; T, dgtp; UBA, dubatp, dgtp; A+, datp, dgtp; A, dgtp; ABA, dabatp, dgtp; G+, dgtp, dttp; G, dttp; GBA, dgbatp, dttp. Figure 2. Primer extension with temp4 using (a) KOD XL; (b) Vent(exo-); (c) Pwo DNA polymerase; (d) inhibition of KOD XL DNA polymerase by dgbatp. Key: P, primer; +, all natural dntps; C, datp, dttp, dgtp; CBA, dcbatp, datp, dttp, dgtp; T, datp, dctp, dgtp; UBA, dubatp, datp, dctp, dgtp; A,dTTP, dctp, dgtp; ABA, dabatp, dttp, dctp, dgtp; G, dttp, dctp, datp; GBA, dgbatp, dttp, dctp, datp. In (d): lane 4, 140 μm; lane 5, 260 μm; lane 6, 600 μm dgbatp. dubatp and dcbatp, the Heck reaction of duitp proceeded only in low yield accompanied by large hydrolysis and the reaction of dcitp did not occur at all. Significantly higher yields were observed by triphosphorylation of duba (40%) or dcba (19%). Incorporation of dnbatps into DNA by PEX. The enzymatic synthesis of n-butyl acrylate modified oligonucleotides (ONBAs) was studied by primer extension experiment (PEX) using KOD XL, Vent(exo-), or Pwo polymerases. The templates and primer (for sequences see Table 2) were chosen in order to introduce one (ON1X) or four modifications (ON4X) to the extended primer strand. dcbatp, dubatp, and dabatp were found to be good substrates for all of the tested enzymes and were successfully incorporated into DNA bearing one modification (ON1X). Figure 1 shows the denaturing PAGE where only full length products were observed in all cases (except of weak additional bands of n 1 products with Pwo polymerase). dgbatp was not incorporated into DNA (ON1G, Figure 1d) by the tested enzymes under the same conditions dx.doi.org/ /jo J. Org. Chem. 2013, 78,

90 The Journal of Organic Chemistry Article All dn BA TPs were also tested for multiple incorporations into DNA of a mixed sequence bearing four modifications (Figure 2). All tested DNA polymerases gave full length products with dc BA TP and da BA TP. KOD XL and Vent(exo-) (but not Pwo) were shown to be suitable enzymes for multiple incorporation of du BA TP (Figure 2a,b; lane 6). On the other hand, dg BA TP was not only a poor substrate for these polymerases but also apparently inhibited the enzymatic synthesis of DNA by KOD XL and Vent(exo-) (Figure 2a,b; lane 10) where only unextended primers were detected. Therefore, the PEX using KOD XL was performed with decreasing concentrations of dg BA TP. Figure 2d clearly confirms that higher concentrations of dg BA TP inhibited polymerase activity, whereas at lower concentration of dg BA TP, the desired full-length PEX product has been obtained. All ON BA s prepared by PEX with biotinylated template using KOD XL DNA polymerase were isolated by magnetoseparation 7 and analyzed by MALDI (data are summarized in Table 3; for copies of spectra see Figures S1 S8 in the Supporting Information). KOD XL DNA polymerase was then also used for preparation of ON BA s for the electrochemical studies. Table 3. MALDI Data of ONs Bearing Butyl Acrylate oligonucleotide M (calcd) (Da) M (found) [M + H] + (Da) ON 1C ON 1T ON 1A ON 1G ON 4C ON 4T ON 4A ON 4G Electrochemical Study. Electrochemistry has proved to be potent, widely applicable tool for analysis of nucleic acids modified with diverse oxidizable or reducible extrinsic moieties. 7 In our previous work, we demonstrated that such species can be applied for redox coding of nucleotide sequences and/or individual nucleobases with potential applications in DNA diagnostics. To complete the palette of redox tags for independent coding of all four nucleobases, new potential labels are sought among all newly synthesized dntp conjugates. Moreover, not only species applied purposely as redox DNA labels but also functional groups serving for further derivatization (DNA postsynthetic modification) introduced into DNA can be determined and their chemical conversion monitored by means of simple voltammetric techniques. 23 Thus, we were interested in electrochemical properties of the BA nucleos(t)ide conjugates. Since the dc BA nucleotides were difficult to synthesize (due to low reactivity) and dg BA TP was an inhibitor of DNA polymerases, we have chosen du BA - and da BA -modified ONs for the electrochemical studies. As evident from cyclic voltammograms (CVs) measured on a hanging mercury electrode (HMDE) shown in Figure 3A, da BA as well da BA MP produced two separated irreversible cathodic peaks which can be assigned to electrochemical reduction of adenine (peak A red at V) and of the BA moiety at a less negative potential (peak BA red at V; compare with the behavior of modified DNA, vide infra). For du BA and du BA MP only one irreversible signal was observed in agreement with the fact that Figure 3. (A, B) Cyclic voltammograms of da BA, da BA MP (A), du BA and du BA MP (B). Concentrations of all substances 40 μm, background electrolyte sodium acetate buffer ph 5.0. (C) Ex situ CVs of unmodified ON and ON 4BA s with A BA or U BA incorporated; measured in ammonium formate/sodium phosphate background electrolyte. See the Experimental Section for details. reduction of uracil cannot be measured at mercury electrodes in aqueous media. In analogy with previously studied α,βunsaturated carbonyl compounds, 24 including ketones, 24a esters, amides, 24b and acrylate anion, 24c the primary electroreduction of BA moiety can be expected at the α,β C C double bond probably via two successive one-electron steps, in aqueous medium resulting in the double bond hydrogenation. Different shapes and potential shifts of the BA red peak among the BA-modified nucleos(t)ides can be ascribed to different adsorbability of these species, effect of negative charge of the phosphate group and influence of these phenomena on the reduction mechanism of the given compound. Figure 3C shows ex situ CVs obtained for unmodified ON (product of PEX with all four unmodified dntps on temp 4 template) and ON 4BA s with incorporated either A BA or U BA conjugates. All ONs yielded a cathodic peak CA at V due to irreversible reduction of adenines and cytosines and an anodic peak G at V due to reoxidation of guanine reduction product generated at potentials more negative than 1.6 V. 25 Both ON 4BA s produced and additional reduction signal, peak BA red,at V, i.e., at a potential less negative 9631 dx.doi.org/ /jo J. Org. Chem. 2013, 78,

91 The Journal of Organic Chemistry than potential of peak CA (compare behavior of da BA (MP) above). In contrast to nucleo(s)tides, the modified ON produce practically identical shape of the voltammograms regardless of which modified nucleotide was incorporated. Such behavior could be expected considering the major contribution of the polyanionic ON molecule containing excess of unmodified nucleotides, dictating the overall interaction of the ON with the negatively charged electrode surface. Some differences were observed in the anodic branch of CVs where broad peaks appeared with the modified ONs in the region between and V and intensities and potential of peak G were also influenced by the modifications (Figure 3C) which may be ascribed to effects of the BA reduction products on electrode processes at negatively charged HMDE surface. Explanation of these phenomena will require more detailed study which is beyond the scope of this report. Nevertheless, data presented here demonstrate applicability of the BA electrochemical reduction for monitoring of DNA modification with this functional group. CONCLUSIONS The first aqueous Heck cross-coupling of halogenated nucleotides and dntps has been developed and tested on the synthesis of acrylate-modified dn BA MPs and dn BA TPs. For modification of 7-deazapurine nucleotides (synthesis of da BA MP, da BA TP, dg BA MP, and dg BA TP), the direct aqueous coupling procedure is comparable or more efficient than phosphorylation of modified nucleosides. However, the Heck coupling of pyrimidine dntps gave only traces of du BA TP or no reaction at all (for dc I MP and dc I TP), and therefore, the phosphorylation approach is necessary for the synthesis of these compounds. It can be concluded that the aqueous Heck cross-coupling is a possible reaction for modification of deazapurine dntps; however, apparently it is far less general and efficient than the Suzuki and Sonogashira reactions developed previously. 5 7,10,11 dc BA TP, du BA TP, and da BA TP were found to be good substrates for DNA polymerases and were efficiently incorporated to ssons and dsdnas by PEX, whereas dg BA TP was found to be inhibitor at higher concentrations. Electrochemical properties of the butyl acrylate group were also studied on du BA - and da BA -modified ONs to show that it gives an analytically useful signal of reduction at 1.4 V in cyclic voltammetry suitable for monitoring DNA modification with BA. Considering the position of the BA reduction signal at a potential less negative than potential of nucleobase reduction but more negative than potential of reduction of previously introduced redox tags, 7 it is promising also for possible redox coding of nucleobases in combination with other redox labels 7 as an extension of the available palette of reducible tags toward more negative potential region. Another field of potential applications are further postsynthetic chemical transformations of the butyl acrylate group in DNA. Further studies along these lines are under way. EXPERIMENTAL SECTION NMR spectra were recorded on a 600 MHz (600.1 MHz for 1 H, MHz for 13 C) or a 500 MHz (499.8 or MHz for 1 H, or MHz for 31 P, MHz for 13 C) spectrometer from sample solutions in D 2 OorCD 3 OD. Chemical shifts (in ppm, δ scale) were referenced as follows: D 2 O (referenced to dioxane as internal standard: 3.75 ppm for 1 H NMR and ppm 13 C NMR); CD 3 OD (referenced to solvent signal: 3.31 ppm for 1 H NMR and ppm 9632 Article for 13 C NMR). 31 P chemical shifts were referenced to H 3 PO 4 as external reference or to phosphate buffer signal 2.35 ppm in the case of measurement in phosphate buffer. Coupling constants (J) are given in hertz. NMR spectra of dntps were measured in phosphate buffer at ph 7.1. Complete assignment of all NMR signals was achieved by using a combination of H,H-COSY, H,C-HSQC, and H,C-HMBC experiments. Mass spectra and high-resolution mass spectra were measured using ESI ionization technique. Mass spectra of functionalized ONs were measured by MALDI-TOF with 1 khz smartbeam II laser. Water used in synthetic part was of HPLC quality. Ultrapure water (18 MΩ.cm) was used for all biochemical experiments. All chemicals, oligonucleotides, enzymes, streptavidine magnetic particles, and isolation kits were purchased from commercial suppliers. Synthesis and characterization data for 2 -deoxy-5-iodocytidine 5 -O-triphosphate, 7b 2 -deoxy-5-iodouridine 5 -O-triphosphate, 26a 2 -deoxy-7-iodo-7- deazaadenosine 5 -O-triphosphate, 16b 2 -deoxy-7-iodo-7-deazaguanosine 5 -O-triphosphate 26b were reported previously. General Procedure I: Preparation of Butylacrylate-Modified Nucleosides (dn BA s). Method Ia. Nucleoside (dn I ), butyl acrylate, Pd(OAc) 2, and TPPTS were dissolved in a mixture of water/ acetonitrile (1:1, 3 ml) under argon atmosphere followed by addition of trielthylamine. The reaction mixture was stirred at 80 C for 1.5 h and then evaporated in vacuo. The products were purified by column chromatography. Method Ib. Nucleoside (dn I ), butyl acrylate (6 equiv), Pd(OAc) 2 (10 mol %), and PPh 3 (20 mol %) were dissolved in DMF (3 ml) under argon atmosphere followed by addition of trielthylamine (2 equiv). The reaction mixture was stirred at 100 C and then evaporated in vacuo. The products were purified by column chromatography. (E)-5-[2-(n-Butyloxycarbonyl)vinyl]-2 -deoxyuridine (du BA ). According to general method Ia, 2 -deoxy-5-iodouridine (71 mg, mmol), butyl acrylate (172 μl, mmol), Pd(OAc) 2 (3.4 mg, mmol), TPPTS (17.1 mg, mmol), and Et 3 N (172 μl, mmol) were heated. The crude product was purified by column chromatography using chloroform/methanol (10:1) as a mobile phase. du BA was isolated as white powder (70 mg, 98%). According to general method Ib, 2 -deoxy-5-iodouridine (100 mg, mmol), butyl acrylate (243 μl, mmol), Pd(OAc) 2 (6.3 mg, mmol), PPh 3 (15.0 mg, mmol), and Et 3 N (79 μl, mmol) were heated for 45 min. The crude product was purified by column chromatography using chloroform/methanol (7:1) as a mobile phase. du BA was isolated as white powder (93 mg, 93%). 1 H NMR (600.1 MHz, CD 3 OD): 0.97 (t, 3H, J 4,3 = 7.4, H-4 ); 1.43 (m, 2H, H-3 ); 1.66 (m, 2H, H-2 ); 2.27 (dt, 1H, J gem = 13.6, J 2 b,1 = J 2 b,3 = 6.5, H-2 b); 2.34 (ddd, 1H, J gem = 13.6, J 2 a,1 = 6.2, J 2 a,3 = 4.1, H-2 a); 3.76 (dd, 1H, J gem = 12.1, J 5 b,4 = 3.4, H-5 b); 3.86 (dd, 1H, J gem = 12.1, J 5 a,4 = 3.0, H-5 a); 3.95 (ddd, 1H, J 4,3 = 3.6, J 4,5 = 3.4, 3.0, H-4 ); 4.16 (t, 2H, J 1,2 = 6.7, H-1 ); 4.42 (dddd, 1H, J 3,2 = 6.5, 4.1, J 3,4 = 3.6, J 3,1 = 0.5, H-3 ); 6.26 (ddd, 1H, J 1,2 = 6.5, 6.2, J 1,3 = 0.5, H-1 ); 6.89 (dd, 1H, J 2,3 = 15.8, J 2,6 = 0.3, H-2 ); 7.39 (dd, 1H, J 3,2 = 15.8, J 3,6 = 0.6, H-3 ); 8.49 (dd, 1H, J 6,3 = 0.6, J 6,2 = 0.3, H-6). 13 C NMR (150.9 MHz, CD 3 OD): 14.1 (CH 3-4 ); 20.2 (CH 2-3 ); 31.9 (CH 2-2 ); 41.9 (CH 2-2 ); 62.4 (CH 2-5 ); 65.3 (CH 2-1 ); 71.7 (CH-3 ); 87.1 (CH-1 ); 89.2 (CH-4 ); (C-5); (CH-2 ); (CH-3 ); (CH-6); (C-2); (C-4); (C- 1 ). MS (ESI + ): m/z (100) [M + Na] + ; (50) [2M + Na] +. HR/MS (ESI + ) for C 16 H 22 O 7 N 2 Na: [M + Na] + calcd , found dx.doi.org/ /jo J. Org. Chem. 2013, 78,

92 The Journal of Organic Chemistry (E)-7-[2-(n-Butyloxycarbonyl)vinyl]-2 -deoxy-7-deazaadenosine (da BA ). According to general method Ia, 2 -deoxy-7-iodo-7-deazaadenosine (100 mg, mmol), butyl acrylate (381 μl, mmol), Pd(OAc) 2 (6.1 mg, mmol), TPPTS (37.8 mg, mmol), and Et 3 N (111 μl, mmol) were reacted. The crude product was purified by column chromatography using chloroform/methanol (10:1). da BA was isolated as white powder (81 mg, 81%). According to general method Ib, 2 -deoxy-7-iodo-7-deazaadenosine (100 mg, mmol), butyl acrylate (229 μl, mmol), Pd(OAc) 2 (6.1 mg, mmol), PPh 3 (13.9 mg, mmol), and Et 3 N (74 μl, mmol) were heated for 1.5 h. The crude product was purified by column chromatography using chloroform/methanol (10:1) as a mobile phase. da BA was isolated as white powder (97 mg, 97%). 1 H NMR (600.1 MHz, CD 3 OD): 0.98 (t, 3H, J 4,3 = 7.4, H- 4 ); 1.46 (m, 2H, H-3 ); 1.70 (m, 2H, H-2 ); 2.35 (ddd, 1H, J gem = 13.4, J 2 b,1 = 6.0, J 2 b,3 = 2.8, H-2 b); 2.64 (ddd, 1H, J gem = 13.4, J 2 a,1 = 8.0, J 2 a,3 = 6.0, H-2 a); 3.75 (dd, 1H, J gem = 12.2, J 5 b,4 = 3.6, H-5 b); 3.82 (dd, 1H, J gem = 12.2, J 5 a,4 = 3.2, H-5 a); 4.02 (ddd, 1H, J 4,5 = 3.6, 3.2, J 4,3 = 2.8, H-4 ); 4.21 (t, 2H, J 1,2 = 6.6, H-1 ); 4.53 (dtd, 1H, J 3,2 = 6.0, 2.8, J 3,4 = 2.8, J 3,1 = 0.6, H-3 ); 6.41 (d, 1H, J 2,3 = 15.8, H-2 ); 6.54 (dd, 1H, J 1,2 = 8.0, 6.0, H-1 ); 7.95 (dd, 1H, J 3,2 = 15.8, J 3,6 = 0.8, H-3 ); 7.98 (bd, 1H, J 6,3 = 0.8, H-6); 8.12 (s, 1H, H-2). 13 C NMR (150.9 MHz, CD 3 OD): 14.1 (CH 3-4 ); 20.2 (CH 2-3 ); 32.0 (CH 2-2 ); 41.7 (CH 2-2 ); 63.5 (CH 2-5 ); 65.5 (CH 2-1 ); 72.9 (CH- 3 ); 86.6 (CH-1 ); 89.2 (CH-4 ); (C-4a); (C-5); (CH-2 ); (CH-6); (CH-3 ); (C-7a); (CH- 2); (C-4); (C-1 ). MS (ESI + ): m/z (100) [M + H] + ; (20) [M + Na] +. HR/MS (ESI + ) for C 18 H 25 O 5 N 4 :[M+ H] + calcd , found (E)-5-[2-(n-Butyloxycarbonyl)vinyl]-2 -deoxycytidine (dc BA ). 2 -Deoxy-5-iodocytidine (100 mg, mmol), butyl acrylate (404 μl, mmol), Pd(OAc) 2 (6.4 mg, mmol), and TPPTS (32.0 mg, mmol) were dissolved in mixture water/acetonitrile (1:1, 6 ml) under argon atmosphere followed by addition of triethylamine (80 μl, mmol). The reaction mixture was stirred at 80 C for 2 h and then evaporated in vacuo. The product was purified by column chromatography using chloroform/methanol (7:1) as a mobile phase. dc BA was isolated as pale yellow powder (16 mg, 16%) after final purification using reversed-phase HPLC (water/methanol, 5 100%). According to general method Ib, 2 -deoxy-5-iodocytidine (100 mg, mmol), butyl acrylate (243 μl, mmol), Pd(OAc) 2 (6.4 mg, mmol), PPh 3 (14.7 mg, mmol), and Et 3 N (79 μl, mmol) were heated for 2 h. The crude product was purified by column chromatography using chloroform/methanol (7:1) as a mobile phase. dc BA was isolated as pale yellow powder (14 mg, 14%). 1 H NMR (499.8 MHz, CD 3 OD): 0.97 (t, 3H, J 4,3 = 7.4, H-4 ); 1.44 (m, 2H, H-3 ); 1.68 (m, 2H, H-2 ); 2.22 (ddd, 1H, J gem = 13.6, J 2 b,3 = 6.3, J 2 b,1 = 5.8, H-2 b); 2.42 (ddd, 1H, J gem = 13.6, J 2 a,1 = 6.4, J 2 a,3 = 4.9, H-2 a); 3.77 (dd, 1H, J gem = 12.1, J 5 b,4 = 3.2, H-5 b); 3.89 (dd, 1H, J gem = 12.1, J 5 a,4 = 2.9, H-5 a); 3.96 (ddd, 1H, J 4,3 = 4.3, J 4,5 = 3.2, 2.9, H-4 ); 4.18 (t, 2H, J 1,2 = 6.7, H-1 ); 4.40 (ddd, 1H, J 3,2 = 6.53, 4.9, J 3,4 = 4.3, H-3 ); 6.21 (dd, 1H, J 1,2 = 6.4, 5.8, H-1 ); 6.33 Article (d, 1H, J 2,3 = 15.7, H-2 ); 7.59 (dd, 1H, J 3,2 = 15.7, J 3,6 = 0.7, H- 3 ); 8.72 (d, 1H, J 6,3 = 0.6, H-6). 13 C NMR (125.7 MHz, CD 3 OD): (CH 3-4 ); (CH 2-3 ); (CH 2-2 ); (CH 2-2 ); (CH 2-5 ); (CH 2-1 ); (CH-3 ); (CH-1 ); (CH-4 ); (C-5); (CH-2 ); (CH-3 ); (CH-6); (C-2); (C-4); (C-1 ). MS (ESI + ): m/z (50) [M + H] + ; (100) [M + Na] +. HR/MS (ESI + ) for C 16 H 24 O 6 N 3 :[M+H] + calcd , found (E)-7-[2-(n-Butyloxycarbonyl)vinyl]-2 -deoxy-7-deazaguanosine (dg BA ). According to general method Ia, 2 -deoxy-7-iodo-7-deazaguanosine (50 mg, mmol), butyl acrylate (182 μl, 1.28 mmol), Pd(OAc) 2 (2.9 mg, mmol), TPPTS (18.2 mg, mmol), and Et 3 N (54 μl, mmol) were heated. The crude product was purified by column chromatography using chloroform/methanol (10:1) as a mobile phase. dg BA was isolated as white powder (42 mg, 84%) after final purification using reversed-phase HPLC (water/methanol, 5 100%). According to general method Ib, 2 -deoxy-7-iodo-7-deazaguanosine (100 mg, mmol), butyl acrylate (366 μl, mmol), Pd(OAc) 2 (5.7 mg, mmol), PPh 3 (13.4 mg, mmol), and Et 3 N (72 μl, mmol) were heated for 1 h. The crude product was purified by column chromatography using chloroform/methanol (7:1) as a mobile phase. dg BA was isolated as white powder (83 mg, 83%). 1 H NMR (500.0 MHz, CD 3 OD): 0.97 (t, 3H, J 4,3 = 7.4, H- 4 ); 1.44 (m, 2H, H-3 ); 1.67 (m, 2H, H-2 ); 2.28 (ddd, 1H, J gem = 13.4, J 2 b,1 = 6.0, J 2 b,3 = 3.0, H-2 b); 2.50 (ddd, 1H, J gem = 13.4, J 2 a,1 = 7.9, J 2 a,3 = 6.1, H-2 a); 3.71 (dd, 1H, J gem = 12.0, J 5 b,4 = 4.2, H-5 b); 3.77 (dd, 1H, J gem = 12.0, J 5 a,4 = 3.8, H-5 a); 3.94 (td, 1H, J 4,5 a = J 4,5 b = 4.0, J 4,3 = 2.9, H-4 ); 4.15 (t, 2H, J 1,2 = 6.6, H-1 ); 4.47 (dtd, 1H, J 3,2 a = 6.0, J 3,2 b = J 3,4 = 3.0, J 3,1 = 0.6, H-3 ); 6.40 (bdd, 1H, J 1,2 a = 7.9, J 1,2 b = 6.0, H-1 ); 7.19 (dd, 1H, J 2,3 = 15.7, J 2,6 = 0.6, H-2 ); 7.43 (q, 1H, J 6,2 = J 6,3 = J 6,1 = 0.5, H-6); 7.66 (dd, 1H, J 3,2 = 15.7, J 3,6 = 0.6, H-3 ). 13 C NMR (125.7 MHz, CD 3 OD): (CH 3-4 ); (CH 2-3 ); (CH 2-2 ); (CH 2-2 ); (CH 2-5 ); (CH 2-1 ); (CH-3 ); (CH-1 ); (CH-4 ); (C-4a); (C-5); (CH-2 ); (CH-6); (CH-3 ); (C-7a); (C-2); (C-4); (C-1 ). MS (ESI + ): m/z (100) [M + H] + ; (35) [M + Na] + ; (42) [2M + H] + ; (26) [2M + Na] +. HR/MS (ESI + ) for C 18 H 25 O 6 N 4 :[M+H] + calcd , found General Procedure II: Preparation of Butyl Acrylate Modified Nucleoside Monophosphates (dn BA MPs). Method IIa: Heck Coupling of Butyl Acrylate to dn I MPs. Nucleoside monophosphate (dn I MP), butyl acrylate (10 equiv), Pd(OAc) 2 (10 mol %), and TPPTS (25 mol %) were dissolved in a mixture water/ acetonitrile (1:1, 2 ml) under argon atmosphere followed by addition of triethylamine (3 equiv). The reaction mixture was stirred at 80 C for 2 h and then evaporated in vacuo. The products were purified by C18 reversed-phase HPLC using water/methanol (5 to 100%) containing 0.1 M TEAB buffer as eluent. Several codistillations with water and conversion to sodium salt (Dowex 50WX8 in Na + cycle) followed by freeze-drying from water gave the desired dn BA MPs as white solids. Method IIb: Phosphorylation of dn BA s. Acrylate-modified nucleoside (dn BA ) was dried at 80 C for 2 h in vacuo. After cooling, PO(OMe) 3 and POCl 3 were added on ice under argon atmosphere. The resulting mixture was stirred at 0 C. The phosphorylation was stopped by addition of TEAB (2 M, 2 ml) and water (2 ml). The products were purified by C18 reversed-phase HPLC using water/ methanol (5 to 100%) containing 0.1 M TEAB buffer as eluent dx.doi.org/ /jo J. Org. Chem. 2013, 78,

93 The Journal of Organic Chemistry Several codistillations with water and conversion to sodium salt (Dowex 50WX8 in Na + cycle) followed by freeze-drying from water gave the desired dn BA MPs as white solids. (E)-5-[2-(n-Butyloxycarbonyl)vinyl]-2 -deoxyuridine 5 -O- Phosphate (du BA MP). Article (E)-7-[2-(n-Butyloxycarbonyl)vinyl]-2 -deoxy-7-deazaguanosine 5 -O-Phosphate (dg BA MP). According to general method IIa, du I MP (50.0 mg, mmol), butyl acrylate (150 μl, mmol), Pd(OAc) 2 (2.3 mg, 11 μmol), TPPTS (14.9 mg, 27 μmol), and Et 3 N (44 μl, mmol) were reacted to yield du BA MP (17.5 mg, 35%). According to general method IIb, du BA (60 mg, mmol), PO(OMe) 3 (0.6 ml), and POCl 3 (60 μl) were stirred at 0 C for 4 h and then kept in the refrigerator overnight. du BA MP was isolated as a white powder (25 mg, 42%). 1 H NMR (600.1 MHz, D 2 O): 0.92 (t, 3H, J 4,3 = 7.4, H-4 ); 1.39 (m, 2H, H-3 ); 1.68 (m, 2H, H-2 ); 2.42 (m, 2H, H-2 ); 4.03 (m, 2H, H-5 ); 4.20 (m, 1H, H-4 ); 4.21 (t, 2H, J 1,2 = 6.7, H-1 ); 4.57 (dt, 1H, J 3,2 = 5.6, 3.7, J 3,4 = 3.7, H-3 ); 6.30 (t, 1H, J 1,2 = 6.9, H-1 ); 6.90 (d, 1H, J 2,3 = 15.9, H-2 ); 7.46 (d, 1H, J 3,2 = 15.9, H-3 ); 8.19 (s, 1H, H-6). 13 C NMR (150.9 MHz, D 2 O): 15.7 (CH 3-4 ); 21.3 (CH 2-3 ); 32.7 (CH 2-2 ); 41.8 (CH 2-2 ); 67.0 (d, J C,P = 4.7, CH 2-5 ); 68.2 (CH 2-1 ); 73.9 (CH-3 ); 88.8 (CH-1 ); 88.9 (d, J C,P = 8.4, CH-4 ); (C-5); (CH-2 ); (CH-3 ); (CH-6); (C-2); (C-4); (C- 1 ). 31 P{ 1 H} NMR (202.4 MHz, D 2 O): MS (ESI ): m/z (100) [M + H]. HR/MS (ESI ) for C 16 H 22 O 10 N 2 P: [M + H] calcd , found (E)-7-[2-(n-Butyloxycarbonyl)vinyl]-2 -deoxy-7-deazaadenosine 5 -O-Phosphate (da BA MP). According to general method IIa, da I MP (20.0 mg, 41.9 μmol), butyl acrylate (57 μl, mmol), Pd(OAc) 2 (0.9 mg, 4.2 μmol), TPPTS (5.7 mg, 10.5 μmol), and Et 3 N (17 μl, mmol) were heated to yield da BA MP (10.5 mg, 55%). According to general method IIb, da BA (50.0 mg, mmol), PO(OMe) 3 (0.5 ml), and POCl 3 (25 μl) were stirred at 0 C for 45 min. da BA MP was isolated as white powder (27.1 mg, 54%). 1 H NMR (600.1 MHz, D 2 O): 0.95 (t, 3H, J 4,3 = 7.4, H-4 ); 1.42 (m, 2H, H- 3 ); 1.71 (m, 2H, H-2 ); 2.49 (ddd, 1H, J gem = 14.0, J 2 b,1 = 6.2, J 2 b,3 = 3.1, H-2 b); 2.73 (ddd, 1H, J gem = 14.0, J 2 a,1 = 8.0, J 2 a,3 = 6.2, H- 2 a); 3.85 (dt, 1H, J gem = 11.1, J H,P = J 5 b,4 = 5.0, H-5 b); 3.89 (ddd, 1H, J gem = 11.1, J H,P = 5.4, J 5 a,4 = 5.0, H-5 a); 4.18 (td, 1H, J 4,5 = 5.0, J 4,3 = 3.1, H-4 ); 4.23 (t, 2H, J 1,2 = 6.8, H-1 ); 4.68 (dt, 1H, J 3,2 = 6.2, 3.1, J 3,4 = 3.1, H-3 ); 6.33 (d, 1H, J 2,3 = 15.8, H-2 ); 6.56 (dd, 1H, J 1,2 = 8.0, 6.2, H-1 ); 7.75 (dd, 1H, J 3,2 = 15.8, J 3,6 = 0.6, H-3 ); 7.91 (s, 1H, H-6); 8.10 (s, 1H, H-2). 13 C NMR (150.9 MHz, D 2 O): 15.8 (CH 3-4 ); 21.3 (CH 2-3 ); 32.8 (CH 2-2 ); 40.9 (CH 2-2 ); 66.6 (d, J C,P = 4.5, CH 2-5 ); 68.2 (CH 2-1 ); 74.4 (CH-3 ); 85.6 (CH-1 ); 88.6 (d, J C,P = 8.4, CH-4 ); (C-4a); (C-5); (CH-2 ); (CH-6); (CH-3 ); (C-7a); (CH-2); (C-4); (C-1 ). 31 P{ 1 H} NMR (202.4 MHz, D 2 O): MS (ESI ): m/z (100) [M + H]. HR/MS (ESI ) for C 18 H 24 O 8 N 4 P: [M + H] calcd , found According to general method IIa, dg I MP (30.0 mg, 63.8 μmol), butyl acrylate (91 μl, mmol), Pd(OAc) 2 (1.4 mg, 6.4 μmol), TPPTS (9.1 mg, 16.0 μmol), and Et 3 N (27 μl, mmol) were heated to yield dg BA MP (11.5 mg, 38%). 1 H NMR (500.0 MHz, D 2 O, ref(dioxane) = 3.75 ppm): 0.94 (t, 3H, J 4,3 = 7.4, H-4 ); 1.42 (m, 2H, H-3 ); 1.69 (m, 2H, H-2 ); 2.41 (ddd, 1H, J gem = 13.9, J 2 b,1 = 6.3, J 2 b,3 = 3.3, H-2 b); 2.65 (ddd, 1H, J gem = 13.9, J 2 a,1 = 7.9, J 2 a,3 = 6.3, H-2 a); 3.87 (t, 2H, J H,P = J 5,4 = 5.3, H-5 ); 4.14 (td, 1H, J 4,5 = 5.3, J 4,3 = 3.3, H-4 ); 4.20 (t, 2H, J 1,2 = 6.7, H-1 ); 4.64 (dt, 1H, J 3,2 = 6.3, 3.3, J 3,4 = 3.3, H-3 ); 6.34 (dd, 1H, J 1,2 = 7.9, 6.3, H-1 ); 6.90 (d, 1H, J 2,3 = 15.7, H-2 ); 7.47 (s, 1H, H-6); 7.63 (d, 1H, J 3,2 = 15.7 H-3 ). 13 C NMR (125.7 MHz, D 2 O, ref(dioxane) = 69.3 ppm): (CH 3-4 ); (CH 2-3 ); (CH 2-2 ); (CH 2-2 ); (d, J C,P = 4.5, CH 2-5 ); (CH 2-1 ); (CH-3 ); (CH-1 ); (d, J C,P = 8.3, CH-4 ); (C-4a); (C-5); (CH-2 ); (CH-6); (CH-3 ); (C-7a); (C-2); (C-4); (C-1 ). 31 P{ 1 H} NMR (202.4 MHz, D 2 O): MS (ESI ): m/z (100) [M + H]. HR/MS (ESI ) for C 18 H 24 O 9 N 4 P: [M + H] calcd , found General Procedure III: Preparation of Butyl Acrylate Modified Nucleoside Triphosphates (dn BA TPs). Method IIIa: Heck Coupling of Butyl Acrylate to dn I TPs. Nucleoside monophosphate (dn I TP), butyl acrylate (10 equiv), Pd(OAc) 2 (10 mol %), and TPPTS (25 mol %) were dissolved in a mixture water/acetonitrile (1:1, 2 ml) under argon atmosphere followed by addition of triethylamine (3 equiv). The reaction mixture was stirred at 80 C for 1 h and then evaporated in vacuo. The products were purified by C18 reversed-phase HPLC using water/methanol (5 to 100%) containing 0.1 M TEAB buffer as eluent. Several codistillations with water and conversion to sodium salt (Dowex 50WX8 in Na + cycle) followed by freeze-drying from water gave the desired dn BA TPs as white solids. Method IIIb: Triphosphorylation of dn BA s. Acrylate-modified nucleoside (dn BA ) was dried at 80 C for 2 h in vacuo. After cooling, PO(OMe) 3 and POCl 3 were added on ice under argon atmosphere. The resulting mixture was stirred at 0 C. In a separate flask, the mixture of (NHBu 3 ) 2 H 2 P 2 O 7 and tributylamine in dry DMF was prepared under argon atmosphere, cooled to 0 C, and then added by syringe to the reaction mixture. The mixture was stirred at 0 C. The phosphorylation was stopped by addition of TEAB (2 M, 2 ml) and water (2 ml). The products were purified by C18 reversed-phase HPLC using water/methanol (5 to 100%) containing 0.1 M TEAB buffer as eluent. Several codistillations with water and conversion to sodium salt (Dowex 50WX8 in Na + cycle) followed by freeze-drying from water gave the desired dn BA TPs as white solids. (E)-5-[2-(n-Butyloxycarbonyl)vinyl]-2 -deoxyuridine 5 -O- Triphosphate (du BA TP). According to general method IIIa, du I TP (40 mg, 58.7 μmol), butyl acrylate (84 μl, mmol), Pd(OAc) 2 (1.3 mg, 5.9 μmol), TPPTS (8.3 mg, 14.7 μmol), and Et 3 N (25 μl, mmol) were reacted to yield du BA TP (1.5 mg, 4%) dx.doi.org/ /jo J. Org. Chem. 2013, 78,

94 The Journal of Organic Chemistry According to general method IIIb, du BA (30.0 mg, 84.7 μmol), PO(OMe) 3 (0.3 ml), and POCl 3 (30 μl) were stirred at 0 C for 4 h and then kept in the refrigerator overnight. A cool solution of (NHBu 3 ) 2 H 2 P 2 O 7 (0.3 g) and tributylamine (120 μl) in dry DMF (1.2 ml) was added, and the resulting mixture was stirred at 0 C for 2 h. du BA TP was isolated as a white powder (22.0 mg, 40%). Method IIIc. Triethylammonium salt of du I TP (50 mg, 55.8 μmol), butyl acrylate (48 μl, mmol), Pd(OAc) 2 (1.3 mg, 5.6 μmol), and PPh 3 (2.9 mg, 11.2 μmol) were dissolved in DMF (3 ml) under argon atmosphere followed by addition of trielthylamine (16 μl, mmol). The reaction mixture was stirred at 100 C for 1 h and then evaporated in vacuo. The product was purified by C18 reversed-phase HPLC using water/methanol (5 to 100%) containing 0.1 M TEAB buffer as eluent. Several codistillations with water and conversion to sodium salt (Dowex 50WX8 in Na + cycle) followed by freeze-drying from water gave du BA TP (5.0 mg, 14%). 1 H NMR (600.1 MHz, D 2 O, pd = 7.1, phosphate buffer): 0.92 (t, 3H, J 4,3 = 7.4, H-4 ); 1.39 (m, 2H, H-3 ); 1.68 (m, 2H, H-2 ); 2.43 (m, 2H, H-2 ); (m, 5H, H-1,4,5 ); 4.67 (m, 1H, H-3 ); 6.29 (t, 1H, J 1,2 = 6.6, H-1 ); 6.91 (d, 1H, J 2,3 = 15.9, H-2 ); 7.48 (d, 1H, J 3,2 = 15.9, H-3 ); 8.17 (s, 1H, H-6). 13 C NMR (150.9 MHz, D 2 O, pd = 7.1, phosphate buffer): 15.7 (CH 3-4 ); 21.3 (CH 2-3 ); 32.7 (CH 2-2 ); 41.5 (CH 2-2 ); 67.9 (d, J C,P = 5.7, CH 2-5 ); 68.2 (CH 2-1 ); 73.1 (CH-3 ); 88.5 (d, J C,P = 8.8, CH-4 ); 88.7 (CH-1 ); (C-5); (CH-2 ); (CH-3 ); (CH-6); (C-2); (C-4); (C- 1 ). 31 P{ 1 H} NMR (202.3 MHz, D 2 O, pd = 7.1, phosphate buffer): (t, J = 19.8, P β ); (d, J = 19.8, P α ); 6.77 (bd, J = 19.8, P γ ). MS (ESI ): m/z (60) [M 3PO 3 C 4 H 9 ] ; (50) [M 2PO 3 +H] ; (100) [M + H PO 3 ] ; (90) [M + Na PO 3 ] ; (10) [M + 3H] ; (30) [M + 2H + Na] ; (20) [M + H + 2Na]. HR/MS (ESI ) for C 16 H 24 O 16 N 2 P 3 :[M + 3H] calcd , found (E)-7-[2-(n-Butyloxycarbonyl)vinyl]-2 -deoxy-7-deazaadenosine 5 -O-Triphosphate (da BA TP). Article (ESI ) for C 17 H 20 O 13 N 5 P 3 Na: [M + 2H + Na] calcd , found (E)-5-[2-(n-Butyloxycarbonyl)vinyl]-2 -deoxycytidine 5 -O- Triphosphate (dc BA TP). According to general method IIIb, dc BA (30.0 mg, 84.9 μmol), PO(OMe) 3 (0.3 ml), and POCl 3 (16 μl) were stirred at 0 C for 1 h. Cool solution of (NHBu 3 ) 2 H 2 P 2 O 7 (0.3 g) and tributylamine (120 μl) in dry DMF (1.3 ml) was added and the resulting mixture was stirred at 0 C for 1.5 h. dc BA TP was isolated as a white powder (9.2 mg, 19%). 1 H NMR (600.1 MHz, D 2 O, ref(dioxane) = 3.75 ppm, pd = 7.1, phosphate buffer): 0.92 (t, 3H, J 4,3 = 7.4, H-4 ); 1.40 (m, 2H, H-3 ); 1.69 (m, 2H, H-2 ); 2.37 (ddd, 1H, J gem = 14.2, J 2 b,1 = 7.1, J 2 b,3 = 6.4, H-2 b); 2.46 (ddd, 1H, J gem = 14.2, J 2 a,1 = 6.2, J 2 a,3 = 3.7, H-2 a); (m, 5H, H-1,4,5 ); 4.63 (dt, 1H, J 3,2 = 6.2, 3.7, J 3,4 = 3.7, H-3 ); 6.25 (dd, 1H, J 1,2 = 7.1, 6.2, H-1 ); 6.39 (d, 1H, J 2,3 = 15.9, H-2 ); 7.55 (d, 1H, J 3,2 = 15.9, H-3 ); 8.17 (s, 1H, H-6). 13 C NMR (150.9 MHz, D 2 O, ref(dioxane) = 69.3 ppm, pd = 7.1, phosphate buffer): (CH 3-4 ); (CH 2-3 ); (CH 2-2 ); (CH 2-2 ); (d, J C,P = 5.7, CH 2-5 ); (CH 2-1 ); (CH-3 ); (d, J C,P = 8.6, CH-4 ); (CH-1 ); (C-5); (CH-2 ); (CH-3 ); (CH-6); (C- 2); (C-4); (C-1 ). 31 P{ 1 H} NMR (202.4 MHz, D 2 O, ref(phosphate buffer) = 2.35 ppm, pd = 7.1, phosphate buffer): (t, J = 19.8, P β ); (d, J = 19.8, P α ); 6.84 (bd, J = 19.8, P γ ). MS (ESI ): m/z (100) [M + 3H PO 3 H] ; (98) [M +2H+Na PO 3 H] ; (45) [M + H 2PO 3 H] ; (30) [M + 2H + Na] ; (26) [M + H + 2Na]. HR/MS (ESI ) for C 16 H 24 O 15 N 3 P 3 Na: [M + 2H + Na] calcd , found (E)-7-[2-(n-Butyloxycarbonyl)vinyl]-2 -deoxy-7-deazaguanosine 5 -O-Triphosphate (dg BA TP). According to general method IIIa, da I TP (40 mg, 56.8 μmol), butyl acrylate (81 μl, mmol), Pd(OAc) 2 (1.3 mg, 5.7 μmol), TPPTS (8.1 mg, 14.2 μmol), and Et 3 N (24 μl, mmol) were reacted to yield da BA TP (15.5 mg, 43%). According to general method IIIb, da BA (30 mg, 79.7 μmol), PO(OMe) 3 (0.3 ml), and POCl 3 (15 μl) were stirred at 0 C for 45 min. A cool solution of (NHBu 3 ) 2 H 2 P 2 O 7 (0.3 g) and tributylamine (120 μl) in dry DMF (1.2 ml) was added, and the resulting mixture was stirred at 0 C for 2 h. da BA TP was isolated as a white powder (15.2 mg, 28%). 1 H NMR (600.1 MHz, D 2 O, pd = 7.1, phosphate buffer): 0.95 (t, 3H, J 4,3 = 7.4, H-4 ); 1.42 (m, 2H, H-3 ); 1.71 (m, 2H, H-2 ); 2.51 (ddd, 1H, J gem = 13.8, J 2 b,1 = 6.2, J 2 b,3 = 3.2, H-2 b); 2.71 (ddd, 1H, J gem = 13.8, J 2 a,1 = 8.0, J 2 a,3 = 6.6, H-2 a); 4.12 (dt, 1H, J gem = 11.2, J H,P = J 5 b,4 = 5.3, H-5 b); 4.18 (ddd, 1H, J gem = 11.2, J H,P = 6.2, J 5 a,4 = 4.4, H-5 a); 4.23 (t, 2H, J 1,2 = 6.7, H-1 ); 4.24 (m, 1H, H-4 ); 4.76 (m, 1H, H-3 overlapped with HDO signal); 6.31 (d, 1H, J 2,3 = 15.7, H-2 ); 6.55 (dd, 1H, J 1,2 = 8.0, 6.2, H-1 ); 7.70 (d, 1H, J 3,2 = 15.7, H-3 ); 7.87 (s, 1H, H-6); 8.08 (s, 1H, H-2). 13 C NMR (150.9 MHz, D 2 O, pd = 7.1, phosphate buffer): 15.8 (CH 3-4 ); 21.3 (CH 2-3 ); 32.8 (CH 2-2 ); 41.1 (CH 2-2 ); 68.2 (d, J C,P = 5.7, CH 2-5 ); 68.2 (CH 2-1 ); 73.8 (CH-3 ); 85.7 (CH-1 ); 88.0 (d, J C,P = 8.8, CH-4 ); (C-4a); (C-5); (CH-2 ); (CH-6); (CH-3 ); (C-7a); (CH-2); (C-4); (C-1 ). 31 P{ 1 H} NMR (202.3 MHz, D 2 O, pd = 7.1, phosphate buffer): (t, J = 19.4, P β ); (d, J = 19.4, P α ); 6.53 (bd, J = 19.4, P γ ). MS (ESI ): m/z (100) [M + 3H PO 3 H] ; (90) [M + 2H + Na PO 3 H] ; (15) [M + 2H + Na]. HR/MS According to general method IIIa, dg I TP (30 mg, 47.8 μmol), butyl acrylate (68 μl, mmol), Pd(OAc) 2 (1.1 mg, 4.8 μmol), TPPTS (6.8 mg, 12.0 μmol), and Et 3 N (20 μl, mmol) were reacted to yield dg BA TP (13.0 mg, 44%). According to general Method IIIb, dg BA (38.0 mg, 96.9 μmol), PO(OMe) 3 (0.3 ml), and POCl 3 (18 μl) were stirred at 0 C for 1 h. A cool solution of (NHBu 3 ) 2 H 2 P 2 O 7 (360 mg) and tributylamine (146 μl) in dry DMF (1.5 ml) was added, and the resulting mixture was stirred at 0 C for 1.5 h. dg BA TP was isolated as a white powder (15.4 mg, 25%). 1 H NMR (500.0 MHz, D 2 O, ref(dioxane) = 3.75 ppm): 0.94 (t, 3H, J 4,3 = 7.4, H-4 ); 1.42 (m, 2H, H-3 ); 1.69 (m, 2H, H- 2 ); 2.42 (ddd, 1H, J gem = 14.0, J 2 b,1 = 6.2, J 2 b,3 = 3.3, H-2 b); 2.65 (ddd, 1H, J gem = 14.0, J 2 a,1 = 7.9, J 2 a,3 = 6.3, H-2 a); (m, 3H, H-4,5 ); 4.20 (t, 2H, J 1,2 = 6.7, H-1 ); 4.72 (bdt, 1H, J 3,2 a = 6.2, J 3,2 b = J 3,4 = 3.2, H-3 ); 6.35 (dd, 1H, J 1,2 a = 7.9, J 1,2 b = 6.2, H- 1 ); 7.91 (d, 1H, J 2,3 = 15.8, H-2 ); 7.46 (s, 1H, H-6); 7.63 (d, 1H, J 3,2 = 15.8, H-3 ). 13 C NMR (125.7 MHz, D 2 O, ref(dioxane) = 69.3 ppm): (CH 3-4 ); (CH 2-3 ); (CH 2-2 ); (CH 2-2 ); (CH 2-1 ); (d, J C,P = 5.9, CH 2-5 ); (CH- 3 ); (CH-1 ); (d, J C,P = 8.8, CH-4 ); (C-4a); (C-5); (CH-2 ); (CH-6); (CH-3 ); (C-7a); (C-2); (C-4); (C-1 ). 31 P{ 1 H} NMR (202.4 MHz, D 2 O): (t, J = 19.7, P β ); (d, J = 9635 dx.doi.org/ /jo J. Org. Chem. 2013, 78,

95 The Journal of Organic Chemistry 19.7, P α ); 7.95 (bd, J = 19.6, P γ ). MS (ESI ): m/z (100) [M + 3H-PO 3 H] ; (90) [M + 2H + Na PO 3 H] ; (43) [M + 3H + 2PO 3 H] ; (30) [M + 2H + Na] ; (15) [M + 3H]. HR/MS (ESI ) for C 18 H 26 O 15 N 4 P 3 : [M + 3H] calcd , found Incorporation of Butyl Acrylate Modified Triphosphates into DNA by PEX. The reaction mixture (20 μl) contained primer (4 μm), template (4 μm), DNA polymerase (0.075 U KOD XL, 0.1 U Vent(exo-) or 0.5 U Pwo), and dntps (either all natural or 3 natural and 1 modified, 260 μm; for the inhibition studies shown in Figure 2d, 140; 260 and 600 μm dg BA TP was used) in enzyme reaction buffer supplied by the manufacturer. Primer was labeled on its 5 -end by use of [γ 32 P]-ATP according to standard techniques. The reaction mixture was incubated for 40 min at 60 C in a thermal cycler. Primer extension was stopped by addition of stop solution (40 μl, 80% (v/v) formamide, 20 mm EDTA, 0.025% (w/v) bromophenol blue, 0.025% (w/v) xylene cyanol) and heated for 5 min at 95 C. Samples were separated by 12.5% PAGE under denaturing conditions (42 ma, 1 h). Visualization was performed by phosphoimaging (Figures 1 and 2). MALDI-TOF Experiments. The MALDI-TOF spectra were measured on a MALDI-TOF/TOF mass spectrometer with 1 khz smartbeam II laser. The measurements were done in reflectron mode by droplet technique, with the mass range up to 30 kda. The matrix consisted of 3-hydroxypicolinic acid (HPA)/picolinic acid (PA)/ ammonium tartrate in ratio 9/1/1. The matrix (1 μl) was applied on the target (ground steel) and dried down at room temperature. The sample (1 μl) and matrix (1 μl) were mixed and added on the top of the dried matrix preparation spot and dried at room temperature. Preparation of ON BA s for MALDI-TOF Analysis. Streptavidin magnetic particles stock solution (Roche, 50 μl) was washed with binding buffer (3 200 μl, 10 mm Tris, 1 mm EDTA, 100 mm NaCl, ph 7.5). The PEX solution (prepared as described above) and binding buffer (50 μl) were added. Suspension was shaken (1200 rpm) for 30 min at 15 C. The magnetic beads were collected on a magnet (DynaMag-2, Invitrogen) and washed with wash buffer (3 200 μl, 10 mm Tris, 1 mm EDTA, 500 mm NaCl, ph 7.5) and water (4 200 μl). Then water (50 μl) was added and the sample was denatured for 2 min at 55 C and 900 rpm. The beads were collected on a magnet and the solution was transferred into a clean vial. The product was analyzed by MALDI-TOF mass spectrometry (the results are summarized in Table 3, for copies of mass spectra, see Figures S1 S8, Supporting Information). Electrochemistry. Nucleosides and dnmps were analyzed by conventional in situ cyclic voltammetry (CV) while ONs (PEX products) by ex situ (adsorptive transfer stripping, AdTS) CV. The PEX products (purified in their single-stranded form using streptavidin-coated magnetic beads as above) were accumulated at the surface of a hanging mercury drop electrode (HMDE) for 60 s from 5-μL aliquots containing 0.2 M NaCl. The electrode was then rinsed with deionized water and placed into an electrochemical cell. CV settings: scan rate 1 V s 1, initial potential 0.0 V, switching potential 1.85 V. Background electrolyte: 0.3 M ammonium formate, 0.05 M sodium phosphate, ph 6.9 (for ON measurements) or 0.2 M sodium acetate ph 5.0 (for measurements of nucleos(t)ides). All measurements were performed at room temperature using an Autolab analyzer (Eco Chemie, The Netherlands) in connection with VA-stand 663 (Metrohm, Herisau, Switzerland) using a three-electrode system with a Ag/AgCl/3 M KCl electrode as a reference and platinum wire as an auxiliary electrode in solution deareated by argon purging. ASSOCIATED CONTENT *S Supporting Information Copies of NMR and MALDI spectra. This material is available free of charge via the Internet at AUTHOR INFORMATION Corresponding Author * hocek@uochb.cas.cz Article Notes The authors declare no competing financial interest. ACKNOWLEDGMENTS This work was supported by the Academy of Sciences of the Czech Republic (RVO and institutional research plan AV0Z ) and the Grant Agency of the Academy of Sciences of the Czech Republic (IAA ). REFERENCES (1) Reviews: (a) Kuwahara, M.; Sugimoto, N. Molecules 2010, 15, (b) Hollenstein, M. Molecules 2012, 17, (2) Ja ger, S.; Rasched, G.; Kornreich-Leshem, H.; Engeser, M.; Thum, O.; Famulok, M. J. Am. Chem. Soc. 2005, 127, (3) Meńova, P.; Cahova, H.; Plucnara, M.; Havran, L.; Fojta, M.; Hocek, M. Chem. Commun. 2013, 49, (4) Meńova, P.; Raindlova, V.; Hocek, M. Bioconjugate Chem. 2013, 24, (5) Thoresen, L. H.; Jiao, G.-S.; Haaland, W. C.; Metzker, M. L.; Burgess, K. Chem. Eur. J. 2003, 9, (6) (a) Riedl, J.; Pohl, R.; Ernsting, N. P.; Orsag, P.; Fojta, M.; Hocek, M. Chem. Sci. 2012, 3, (b) Riedl, J.; Meńova, P.; Pohl, R.; Orsaǵ, P.; Fojta, M.; Hocek, M. J. Org. Chem. 2012, 77, (7) (a) Braźdilova, P.; Vra bel, M.; Pohl, R.; Pivonǩova, H.; Havran, L.; Hocek, M.; Fojta, M. Chem. Eur. J. 2007, 13, (b) Cahova, H.; Havran, L.; Braźdilova, P.; Pivonǩova, H.; Pohl, R.; Fojta, M.; Hocek, M. Angew. Chem., Int. Ed. 2008, 47, (c) Vra bel, M.; Horaḱova, P.; Pivonǩova, H.; Kalachova, L.; Cěrnocka, H.; Cahova, H.; Pohl, R.; Sěbest, P.; Havran, L.; Hocek, M.; Fojta, M. Chem. Eur. J. 2009, 15, (d) Balintova, J.; Pohl, R.; Horaḱova, P.; Vidlaḱova, P.; Havran, L.; Fojta, M.; Hocek, M. Chem. Eur. J. 2011, 17, (8) Obeid, S.; Yulikow, M.; Jeschke, G.; Marx, A. Angew. Chem., Int. Ed. 2008, 47, (9) Baccaro, A.; Steck, A.-L.; Marx, A. Angew. Chem., Int. Ed. 2012, 51, (10) (a) Borsenberger, V.; Kukwikila, M.; Howorka, S. Org. Biomol. Chem. 2009, 7, (b) Wirges, C. T.; Timper, J.; Fischler, M.; Sologubenko, A. S.; Mayer, J.; Simon, U.; Carell, T. Angew. Chem., Int. Ed. 2009, 48, (c) Borsenberger, V.; Howorka, S. Nucleic Acids Res. 2009, 37, (d) Gutschmiedl, K.; Fazio, D.; Carell, T. Chem. Eur. J. 2010, 16, (e) Raindlova, V.; Pohl, R.; Sǎnda, M.; Hocek, M. Angew. Chem., Int. Ed. 2010, 49, (f) Raindlova, V.; Pohl, R.; Hocek, M. Chem. Eur. J. 2012, 18, (11) (a) Kielkowski, P.; Macícǩova -Cahova, H.; Pohl, R.; Hocek, M. Angew. Chem., Int. Ed. 2011, 50, (b) Kielkowski, P.; Brock, N. L.; Dickschat, J. S.; Hocek, M. ChemBioChem 2013, 14, (12) (a) Sidorov, A. V.; Grasby, J. A.; Williams, D. M. Nucleic Acids Res. 2004, 32, (b) Kuwahara, M.; Nagashima, J.; Hasegawa, M.; Tamura, T.; Kitagata, R.; Hanawa, K.; Hososhima, S.; Katsmatsu, T.; Ozaki, H.; Sawai, H. Nucleic Acids Res. 2006, 34, (c) Hollenstein, M.; Hipolito, C. J.; Lam, C. H.; Perrin, D. M. Nucleic Acids Res. 2009, 37, (d) Hollenstein, M. Chem. Eur. J. 2012, 18, (13) (a) Shaughnessy, K. H. Eur. J. Org. Chem. 2006, (b) Shaughnessy, K. H. Chem. Rev. 2009, 109, (14) Casalnuovo, A. L.; Calabrese, J. C. J. Am. Chem. Soc. 1990, 112, (15) Western, E. C.; Daft, J. R.; Johnson, E. M., II; Gannett, P. M.; Shaughnessy, K. H. J. Org. Chem. 2003, 68, (16) (a) Cǎpek, P.; Pohl, R.; Hocek, M. Org. Biomol. Chem. 2006, 4, (b) Cǎpek, P.; Cahova, H.; Pohl, R.; Hocek, M.; Gloeckner, Ch.; Marx, A. Chem. Eur. J. 2007, 13, dx.doi.org/ /jo J. Org. Chem. 2013, 78,

96 The Journal of Organic Chemistry Article (17) (a) Omumi, A.; Beach, D. G.; Baker, M.; Gabryelski, W.; Manderville, R. A. J. Am. Chem. Soc. 2010, 133, (b) Cahova, H.; Ja schke, A. Angew. Chem., Int. Ed. 2013, 52, (18) Reviews: (a) Heck, R. F. Acc. Chem. Res. 1979, 12, (b) Beletskaya, I. P.; Cheprakov, A. V. Chem. Rev. 2000, 100, (19) General review: (a) Agrofoglio, L. A.; Gillaizeau, I.; Saito, Y. Chem. Rev. 2003, 103, Recent examples: (b) Lee, S. E.; Sidorov, A.; Gourlain, T.; Mignet, N.; Thorpe, S. J.; Brazier, J. A.; Dickman, M. J.; Hornby, D. P.; Grasby, J. A.; Williams, D. M. Nucleic Acids Res. 2001, 29, (c) Garg, N. K.; Woodroofe, C. C.; Lacenere, C. J.; Quake, S. R.; Stoltz, B. M. Chem. Commun. 2005, (d) Ding, H.; Greenberg, M. M. J. Am. Chem. Soc. 2007, 129, (e) Ogino, M.; Taya, Y.; Fujimoto, K. Org. Biomol. Chem. 2009, 7, (20) Tobrman, T.; Dvorǎḱ, D. Eur. J. Org. Chem. 2008, (21) Cho, J. H.; Shaughnessy, K. H. Synlett 2011, (22) Ludwig, J. Acta Biochim. Biophys. Acad. Sci. Hung. 1981, 16, (23) Raindlova, V.; Pohl, R.; Klepetaŕǒva, B.; Havran, L.; Sǐmkova, E.; Horaḱova, P.; Pivonǩova, H.; Fojta, M.; Hocek, M. ChemPlusChem 2012, 77, (24) (a) Zimmer, J. P.; Richards, J. A.; Turner, J. C.; Evans, D. H. Anal. Chem. 1971, 43, (b) Klemm, L. H.; Olson, D. R. J. Org. Chem. 1979, 44, (c) Fahr, T.; Petr, A.; Dunsch, L. Ber. Bunsenges. Phys. Chem. 1997, 101, (25) Palecěk, E.; Bartos ík, M. Chem. Rev. 2012, 112, (26) (a) Kovacs, T.; Otvo s, L. Tetrahedron Lett. 1988, 29, (b) McDougall, M. G.; Hosta, L. P.; Kumar, S.; Fuller, C. W. Nucleosides Nucleotides 1999, 18, dx.doi.org/ /jo J. Org. Chem. 2013, 78,

97 Anal. Chem. 2010, 82, Determination of the Level of DNA Modification with Cisplatin by Catalytic Hydrogen Evolution at Mercury-Based Electrodes Petra Horáková,, Lucie Těsnohlídková, Luděk Havran, Pavlína Vidláková, Hana Pivoňková,*, and Miroslav Fojta Institute of Biophysics, Academy of Sciences of the Czech Republic, v.v.i., Královopolská 135, Brno, Czech Republic, and Department of Analytical Chemistry, Faculty of Chemical Technology, University of Pardubice, Studentská 573, Pardubice, Czech Republic Electrochemical methods proved useful as simple and inexpensive tools for the analysis of natural as well as chemically modified nucleic acids. In particular, covalently attached metal-containing groups usually render the DNA well-pronounced electrochemical activity related to redox processes of the metal moieties, which can in some cases be coupled to catalytic hydrogen evolution at mercury or some types of amalgam electrodes. In this paper we used voltammetry at the mercury-based electrodes for the monitoring of DNA modification with cisdiamminedichloroplatinum (cisplatin), a representative of metallodrugs used in the treatment of various types of cancer or being developed for such purpose. In cyclic voltammetry at the mercury electrode, the cisplatinmodified DNA yielded catalytic currents the intensity of which reflected DNA modification extent. In square-wave voltammetry, during anodic polarization after prereduction of the cisplatinated DNA, a well-developed, symmetrical signal (peak P) was obtained. Intensity of the peak P linearly responded to the extent of DNA modification at levels relevant for biochemical studies (rb ) , where rb is the number of platinum atoms bound per DNA nucleotide). We demonstrate a correlation between the peak P intensity and a loss of sequencespecific DNA binding by tumor suppressor protein p53, as well as blockage of DNA digestion by a restriction endonuclease Msp I (both caused by the DNA cisplatination). Application of the electrochemical technique in studies of DNA reactivity with various anticancer platinum compounds, as well as for an easy determination of the extent of DNA platination in studies of its biochemical effects, is discussed. Electrochemical methods proved useful as simple and inexpensive tools for the analysis of natural as well as chemically modified nucleic acids. 1-5 In particular, covalently attached metalcontaining groups usually render the DNA well-pronounced * To whom correspondence should be addressed. hapi@ibp.cz. Academy of Sciences of the Czech Republic. University of Pardubice. (1) Brabec, V.; Vetterl, V.; Vrana, O. In Experimental Techniques in Bioelectrochemistry; Brabec, V., Walz, D., Milazzo, G., Eds.; Birkhauser Verlag: Basel, Switzerland, 1996; Vol. 3, pp electrochemical activity related to redox processes of the metal moieties. Metal chelates and organometallics have been used for labeling of DNA in electrochemical DNA hybridization sensors and other techniques designed for the sequence-specific DNA sensing or detecting DNA damage Reversible redox responses of ferrocene derivatives, ruthenium, osmium, or other metal complexes attached to DNA via chemical oligonucleotide synthesis, 12 using modified nucleoside triphosphates and DNA polymerases, 11,13,17,18 or via chemical modification of natural DNAs or standard (unmodified) synthetic oligonucleotides, 7,14 16,19 have been measured at different working electrodes. (2) Fojta, M. Collect. Czech. Chem. Commun. 2004, 69, (3) Fojta, M. In Electrochemistry of Nucleic Acids and Proteins. Towards Electrochemical Sensors for Genomics and Proteomics; Palecek, E., Scheller, F., Wang, J., Eds.; Elsevier: Amsterdam, The Netherlands, 2005; pp (4) Fojta, M.; Jelen, F.; Havran, L.; Palecek, E. Curr. Anal. Chem. 2008, 4, (5) Palecek, E.; Jelen, F. In Electrochemistry of Nucleic Acids and Proteins. Towards Electrochemical Sensors for Genomics and Proteomics; Palecek, E., Scheller, F., Wang, J., Eds.; Elsevier: Amsterdam, The Netherlands, 2005; pp (6) Fojta, M.; Horakova, P.; Cahova, K.; Fojtova, M.; Hason, S.; Havran, L.; Kostecka, P.; Nemcova, K.; Pivonkova, H.; Brazdova, M. In Bioelectrochemistry Research Developments; Bernstein, E. M., Ed.; Nova Publishers: Hauppauge, NY, (7) Havran, L.; Vacek, J.; Cahova, K.; Fojta, M. Anal. Bioanal. Chem. 2008, 391, (8) Labuda, J.; Fojta, M.; Jelen, F.; Palecek, E. In Encyclopedia of Sensors; Grimes, C. A., Dickey, E. C., Pishko, M. V., Eds.; American Scientific Publishers: Stevenson Ranch, CA, 2006; Vol. 3E-F, pp (9) Palecek, E.; Fojta, M. In Bioelectronics; Wilner, I., Katz, E., Eds.; Wiley VCH: Weinheim, Germany, 2005; pp (10) Palecek, E.; Fojta, M. Talanta 2007, 74, (11) Brazdilova, P.; Vrabel, M.; Pohl, R.; Pivonkova, H.; Havran, L.; Hocek, M.; Fojta, M. Chem.sEur. J. 2007, 13, (12) Fan, C.; Plaxco, K. W.; Heeger, A. J. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, (13) Patolsky, F.; Weizmann, Y.; Willner, I. J. Am. Chem. Soc. 2002, 124, (14) Flechsig, G. U.; Reske, T. Anal. Chem. 2007, 79, (15) Fojta, M.; Havran, L.; Kizek, R.; Billova, S.; Palecek, E. Biosens. Bioelectron. 2004, 20, (16) Fojta, M.; Kostecka, P.; Trefulka, M.; Havran, L.; Palecek, E. Anal. Chem. 2007, 79, (17) Vrabel, M.; Horakova, P.; Pivonkova, H.; Kalachova, L.; Cernocka, H.; Cahova, H.; Pohl, R.; Sebest, P.; Havran, L.; Hocek, M.; Fojta, M. Chem.sEur. J. 2009, 15, (18) Hocek, M.; Fojta, M. Org. Biomol. Chem. 2008, 6, (19) Trefulka, M.; Ferreyra, N.; Ostatna, V.; Fojta, M.; Rivas, G.; Palecek, E. Electroanalysis 2007, 19, /ac902987x 2010 American Chemical Society Analytical Chemistry, Vol. 82, No. 7, April 1, Published on Web 02/26/2010

98 Electrochemical reduction of some of these species is coupled to catalytic hydrogen evolution at mercury or some types of amalgam electrodes, and the high electron-yield catalytic processes can be utilized to attain a high sensitivity of the determination of the modified DNA (in the sense of either detection of low amounts of the densely modified DNA or detection of low levels of DNA modification in the presence of a considerable excess of unmodified nucleotides). Typical examples of transition metal-based nucleic acid adducts yielding well-pronounced catalytic response at the mercury-based electrodes are the products of DNA 16,20-22 or PNA 23 modification with osmium tetroxide complexes 24,25 or adducts of ribonucleosides with analogous osmate complexes. 26 Cisplatin [cis-diamminedichloroplatinum(ii)] is a representative of cytotoxic and antineoplastic metallodrugs used for the treatment of various malignancies or being developed for such purpose The drug binds covalently to DNA, forming several kinds of adducts. In double-stranded chromosomal DNA, the most frequent of them are intrastrand cross-links (IAC) between neighboring purine residues: 65% of 1,2-GG IAC and 25% of 1,2-AG IAC. Another 6-10% belong to 1,3-GNG IAC and interstrand cross-links and 2-3% of various monofunctional adducts. Similar products are formed by clinically used cisplatin analogues carboplatin and oxaliplatin, whereas other types of platinum complexes may form other types of DNA adducts, depending on the mutual steric positioning of DNA and the given complex upon their physical interaction Besides utilization of other biochemical and physicochemical techniques, modification of DNA with cisplatin or its analogues has been studied by electrochemical methods. Guanine is the primary target for the platinum complexes, and chemical modification of this nucleobase often affects its electrochemical responses at both carbon- and mercury-based electrodes. 3,4,30 Several authors thus focused their attention to changes in the guanine (and/or adenine) oxidation response at various types of carbon electrodes to develop techniques suitable for monitoring DNA modification with the platinum complexes and/or biosensors for the platinum drugs using DNA as the recognition layer Similarly, changes in the guanine response at the mercury electrode have recently (20) Havran, L.; Fojta, M.; Palecek, E. Bioelectrochemistry 2004, 63, (21) Reske, T.; Surkus, A. E.; Duwensee, H.; Flechsig, G. U. Microchim. Acta 2009, 166, (22) Yosypchuk, B.; Fojta, M.; Havran, L.; Heyrovsky, M.; Palecek, E. Electroanalysis 2006, 18, (23) Palecek, E.; Trefulka, M.; Fojta, M. Electrochem. Commun. 2009, 11, (24) Jelen, F.; Karlovsky, P.; Pecinka, P.; Makaturova, E.; Palecek, E. Gen. Physiol. Biophys. 1991, 10, (25) Palecek, E. In Methods in Enzymology; Abelson, J. N., Simon, M. I., Eds.; Academic Press: New York, 1992; Vol. 212, pp (26) Trefulka, M.; Ostatna, V.; Havran, L.; Fojta, M.; Palecek, E. Electroanalysis 2007, 19, (27) Kasparkova, J.; Fojta, M.; Farrell, N.; Brabec, V. Nucleic Acids Res. 2004, 32, (28) Marini, V.; Kasparkova, J.; Novakova, O.; Scolaro, L. M.; Romeo, R.; Brabec, V. J. Biol. Inorg. Chem. 2002, 7, (29) Kloster, M.; Kostrhunova, H.; Zaludova, R.; Malina, J.; Kasparkova, J.; Brabec, V.; Farrell, N. Biochemistry 2004, 43, (30) Fojta, M. Electroanalysis 2002, 14, (31) Bagni, G.; Osella, D.; Sturchio, E.; Mascini, M. Anal. Chim. Acta 2005, , (32) Brabec, V. Electrochim. Acta 2000, 45, (33) Brett, A. M. O.; Serrano, S. H. P.; Macedo, T. A.; Raimundo, D.; Marques, M. H.; LaScalea, M. A. Electroanalysis 1996, 8, (34) Mascini, M.; Bagni, G.; Di Pietro, M. L.; Ravera, M.; Baracco, S.; Osella, D. Biometals 2006, 19, been utilized to monitor DNA cisplatination. 36 Other approaches to electrochemical analysis of DNA modified with platinum or other metal complexes rely in measurements of the changes of structure-selective DNA signals. Modification of DNA with the metallodrugs is connected with characteristic conformational changes in the DNA double helix, which may be denaturational (resulting in opening of base pairs) or nondenaturational (changes of DNA conformation without opening the base pairs). 28,37 These events can be monitored and distinguished by polarographic techniques, 1,2,5 which represent a potent tool for studies of specific DNA modifications. Moreover, bending of DNA due to cisplatination has recently been reported to hamper long-range electron transfer through DNA, which has been monitored electrochemically. 38 Differential pulse polarography has been used for indirect determination of the extent of global DNA platination via determination of the residual unbound platinum complex. 39 Surprisingly, reports on direct determination of DNA platination via measuring electrochemical responses related to electrochemical activity of the DNA-bound platinum moieties are missing in the literature (with an exception of stripping voltammetric technique proposed for the determination of DNA-bound platinum in mineralized samples from patients treated with oxaliplatin 40 ). In this paper we applied voltammetry at the mercury-based electrodes for the monitoring of DNA modification with cisplatin using catalytic hydrogen evolution that accompanies redox processes of the cisplatin-dna adducts. We demonstrate that intensities of the catalytic currents, measured by cyclic or squarewave voltammetry, linearly respond to the extent of DNA modification at levels relevant in the studies of biochemical effects of DNA cisplatination ( platinum atoms per nucleotide). A correlation between the intensity of the electrochemical response (providing information about the level of DNA cisplatination) and a loss of sequence-specific DNA binding by tumor suppressor protein p53, as well as blockage of DNA digestion by a restriction endonuclease Msp I due to DNA cisplatination, is demonstrated. MATERIALS AND METHODS Material and Reagents. Supercoiled (sc) pbsk (-) DNA was prepared as described, 41 synthetic oligonucleotides (ODNs; Table 1) were purchased from VBC Biotech, calf thymus DNA and cisplatin were from Sigma, restriction endonuclease Msp I and T4 polynucleotide kinase were from NEB, and γ- 32 P-ATP was from ICN. Other chemicals were of analytical grade. Dynabeads Oligo(dT) 25 (DBT) and magnetic concentrator were supplied by Invitrogen. DNA Modification with Cisplatin. DNA was incubated with cisplatin in 0.1 M NaClO 4 at 37 C overnight (usually single- (35) Ravera, M.; Bagni, G.; Mascini, M.; Dabrowiak, J. C.; Osella, D. J. Inorg. Biochem. 2007, 101, (36) Krizkova, S.; Adam, V.; Petrlova, J.; Zitka, O.; Stejskal, K.; Zehnalek, J.; Sures, B.; Trnkova, L.; Beklova, M.; Kizek, R. Electroanalysis 2006, 19, (37) Novakova, O.; Chen, H. M.; Vrana, O.; Rodger, A.; Sadler, P. J.; Brabec, V. Biochemistry 2003, 42, (38) Wong, E. L. S.; Gooding, J. J. J. Am. Chem. Soc. 2007, 129, (39) Kim, S. D.; Vrána, O.; Kleinwächter, V.; Niki, K.; Brabec, V. Anal. Lett. 1990, 23, (40) Weber, G.; Messerschmidt, J.; Pieck, A. C.; Junker, A. M.; Wehmeier, A.; Jaehde, U. Anal. Bioanal. Chem. 2004, 380, (41) Fojta, M.; Palecek, E. Anal. Chim. Acta 1997, 342, Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

99 Table 1. Nucleotide Sequences of Synthetic Oligonucleotides Used in This Work a acronym nog G25 GTT GGT ds50 nucleotide sequence CATCATCATCATCATCATCATAAAAAAAAAAAAA AAAAAAA GGGGGGGGGGGGGGGGGGGGGGGGGAAAAAAA AAAAAAAAAAAAAAAAAA GTTGTTGTTGTTGTTGTTGTTAAAAAAAAAAAAA AAAAAAA GGTGGTGGTGGTGGTGGTGGTAAAAAAAAAAAA AAAAAAAA GACGATATGCTAGAGGCATGTTTAAACATGTTT ACCGGTTGATATCGAA a The nog, G25, GTT and GGT ODNs were designed for the experiments involving magnetoseparation; they contain A n adaptors for capture at the DBT and the probe stretches differing in reactivity towards cisplatin. The ds50 ODN (shown top strand only, for the duplex see Figure 5 legend) involves a p53 target site (underlined) and a Msp I restriction site (bold italics) for testing biochemical effects of DNA cisplatination. stranded calf thymus DNA and the ODN probes) or for 48 h (double-stranded ODN) in the dark. DNA concentration in the reaction mixture was 20 µg ml -1 ; in the case of the modification of ODN probes in the presence of the competitor DNA, the reaction mixture contained 20 µg ml -1 of the probe and 20 µg ml -1 of the pbsk (-) plasmid. The plasmid DNA was chosen for this purpose because it is suitable for the parallel Msp I cleavage tests (see below and the Supporting Information), as it contains defined number of the restriction sites. Cisplatin concentrations and the corresponding rb values (number of cisplatin moieties per DNA nucleotide, always related to total DNA content in the sample) are given in the text and figure legends. Note: cisplatin is a genotoxic compound which has to be handled with care. Magnetoseparation Procedure. The purpose of the magnetic separation was to isolate the cisplatin-treated ODNs from the mixture with the competitor plasmid DNA, and thus to determine the portion of cisplatin bound the given ODN probe. Aliquots of 20 µl of the DBT were washed thrice in 50 µl of binding buffer (0.3 M NaCl + 10 mm Tris, ph 7.4), followed by incubation with 40 µl of the cisplatin-treated samples in the binding buffer on a shaker at 20 C for 30 min to allow binding of the ODN to the DBT via hybridization of the immobilized T 25 stretches with A n adaptors of the ODN. Then the beads were washed four times by 50 µl of the binding buffer (using repeated magnetoseparation and resuspending) and transferred into 10 µl of deionized water. ODNs were released from DBT by heating at 85 C for 2 min. After addition of NaCl to a concentration of 0.2 M, the recovered ODNs were analyzed electrochemically. Voltammetric Measurements. Voltammetric responses of the modified DNA or ODNs were measured using the adsorptive transfer stripping, AdTS, 2,5 procedure with DNA-modified electrodes. A hanging mercury drop electrode (HMDE) or mercury meniscus-modified silver solid amalgam electrode (m-agsae) was immersed in a 5 µl aliquot of the sample. After a 60 s accumulation at open current circuit, the electrode was subsequently washed by deionized water and by background electrolyte and placed in a voltammetric cell. All measurements were performed at room temperature with an Autolab analyzer (Eco Chemie, Utrecht, The Netherlands) connected to VA-Stand 663 (Metrohm, Herisau, Switzerland) in three-electrode setup (Ag/AgCl/3 M KCl electrode as a reference and platinum wire as an auxiliary electrode), under argon. Cyclic voltammetry (CV) at HMDE was performed as follows: background electrolyte, 0.3 M ammonium formate, 0.05 M sodium phosphate, ph 6.9 (AFP) or Britton-Robinson buffer of different phs; initial potential, 0.0 V; switching potential, V; scan rate, 1Vs -1 (if not stated otherwise). Square-wave voltammetry (SWV) at a HMDE was performed as follows: background electrolyte, AFP or Britton-Robinson buffer of different phs; initial potential, V; end potential, 0.0 V; quiescent time, 2 s; frequency, 200 Hz; amplitude, 50 mv; potential step, 5 mv, if not stated otherwise. SWV at a pyrolytic graphite electrode (PGE) was performed as follows: background electrolyte, 0.2 M sodium acetate, ph 5.0; initial potential, 0.0 V; end potential, +1.5 V; quiescent time, 2 s; frequency, 200 Hz; amplitude, 25 mv; potential step, 5 mv. Renewal of electrode surfaces: for m-agsae, after each measurement, the electrode was cleaned by applying of -2.0 V for 120 s in 0.2 M KCl; for PGE, the surface was renewed by peeling-off the graphite top layer using sticky tape after applying +1.7 V for 60 s in the background electrolyte. Restriction Cleavage and p53-dna Binding. Restriction cleavage of the pbsk (-) plasmid competitor DNA and of the ds50 ODN (radiolabeled with 32 P using γ- 32 P-ATP and T4 polynucleotide kinase) was conducted under standard conditions recommended by the enzyme supplier. Products of the enzymatic cleavage were analyzed using electrophoresis in 1% agarose gel stained with ethidium bromide (plasmid DNA) or in 15% polyacrylamide gel followed by autoradiography. Binding of the p53 protein to the ds50 ODN protein was tested in 2 mm DTT, 50 mm KCl, 5 mm Tris ph 7.6, 0.01% Triton-X 100 (total volume 20 µl), after 30 min of incubation on ice, using a protein/dna molar ratio of 5/1. The reaction mixture contained 50 ng of the 32 P-labeled ds50 ODN and 2 µg of nonspecific competitor calf thymus DNA. The protein-ds50 complexes were detected by electrophoretic mobility shift assay in 5% native polyacrylamide gel followed by autoradiography. Band intensities on the gels were quantified by ImageJ software. RESULTS AND DISCUSSION For the monitoring of DNA modification with platinum complexes, several authors used voltammetry at carbon electrodes to follow changes in the intensity of oxidation signal due to oxidation of purine residues, particularly the peak G ox due to guanine Such an approach is rational because N7 of guanine is the primary target of cisplatin and other platinum drugs, and chemical damage within the guanine imidazole ring results in diminution of the peak G ox. Prolonged exposure of DNA recognition layer immobilized on a carbon electrode to a solution containing a platinum complex forming covalent adducts with the DNA results in accumulation of damage to guanine residues with concomitant decrease of the peak G ox. On the other hand, such an approach is less well suited for the determination of low levels of DNA modification because of its signal off nature. DNA contains many guanine residues, and relative decrease of the peak G ox depends on the fraction of guanines modified. Reasonable levels of DNA platination Analytical Chemistry, Vol. 82, No. 7, April 1,

100 used in biochemical studies 27,28,37,42-44 are usually below 0.1 platinum atoms per nucleotide (further referred to as rb). Our experiments revealed rb ) 0.1 as the lowest degree of DNA modification reliably detectable via decrease of the peak G ox ; changes of the signal reached at lower platination levels did not exceed relative experimental error (see below). We therefore tested the possibility of determination of the DNA platination level using an electrochemical signal specific for the platinum adducts instead of following diminution of the response of the unmodified DNA. Cyclic Voltammetry. We first measured AdTS cyclic voltammograms of unmodified and strongly cisplatinated denatured calf thymus DNA in AFP at the HMDE (Figure 1A). The unmodified DNA yielded two signals due to electrode processes undergone by the DNA bases: a cathodic peak CA at V (corresponding to irreversible reduction of cytosine and adenine residues) and peak G (corresponding to chemically reversible oxidation of 7,8- dihydrogen guanine generated at the electrode upon guanine reduction at potentials <-1.6 V). 2,5,45 For the cisplatinated DNA, the shape of the voltammograms was changed significantly. In the cathodic part, the negative current started to increase sharply around -1.2 V, resulting in complete obscuring of the peak CA. The negative current reached its maximum at V, forming a wide peak. The anodic part of the CV displayed three waves (around -1.75, -1.45, and -1.3 V), and between and V it was going through higher negative current values than the cathodic part in the same region. Such behavior suggested a kinetic process coupled to reversible electron-transfer reactions, 46,47 most likely catalytic hydrogen evolution accompanying redox processes of the platinum moieties which has been observed earlier as a common feature of platinum group metals and their compounds. 48 The catalytic nature of the processes undergone by the cisplatin-modified DNA at the HMDE was further assessed in studies of the effects of parameters such as scan rate or ph, the results of which are shown and discussed briefly in the Supporting Information. As shown in Figure 1B, intensity of the catalytic currents responded to the degree of DNA modification. For rb ) 0.1, the cathodic waves on the anodic part of the CV were well-developed, but in contrast to rb ) 1.0, the broad peak on the cathodic part around V was not observed. A clear effect of DNA cisplatination was observable at rb as low as 0.01 (Figure 1B). Peak G produced by the cisplatinated DNA in the first cycle was by about 30% lower than the same signal produced by the unmodified DNA and was shifted by 30 mv to more negative potentials. Notably, in contrast to the peak G ox due to guanine electrooxidation at carbon electrodes (Figure S1 in the Supporting Information), which was strongly depressed at the same (42) Pivonkova, H.; Brazdova, M.; Kasparkova, J.; Brabec, V.; Fojta, M. Biochem. Biophys. Res. Commun. 2006, 339, (43) Brabec, V. In Progess in Nucleic Acid Research and Molecular Biology; Moldave, K., Ed.; Academic Press Inc.: San Diego, CA, 2002; pp (44) Kasparkova, J.; Pospisilova, S.; Brabec, V. J. Biol. Chem. 2001, 276, (45) Trnkova, L.; Studnickova, M.; Palecek, E. Bioelectrochem. Bioenerg. 1980, 7, (46) Bond, A. M. Modern Polarographic Methods in Analytical Chemistry; Marcel Dekker: New York, (47) Nicholson, R. S.; Shain, I. Anal. Chem. 1965, 36, (48) Heyrovsky, J.; Kuta, J. Principles of Polarogarphy; Czechoslovak Academy of Sciences: Prague, Czechoslovakia, Figure 1. (A) Adsorptive transfer stripping cyclic voltammograms at HMDE of unmodified denatured calf thymus DNA (blue) and the same DNA strongly modified with cisplatin (black): DNA concentration, 20 µg ml -1 ; cisplatin/nucleotide ratio, rb ) 1.0; accumulation time, 60 s; initial potential, 0.0 V; switching potential, V; scan rate, 1.0Vs -1 ; background electrolyte (dashed curve), 0.3 M ammonium formate, 50 mm sodium phosphate, ph 6.9. Inset: details of peak G for the same samples. (B) Sections of AdTS CVs obtained for unmodified or cisplatinated calf thymus DNA: unmodified (blue); rb ) 0.01 (green); rb ) 0.1 (red); rb ) 1.0 (black). Other conditions are as in panel A. (C) Effects of repeated potential cycling on the peak G intensity for unmodified (red) and strongly (rb ) 1) cisplatinated (black) DNA. Inset: details of peak G for unmodified DNA, first scan (blue), and cisplatinated DNA, first (black), third (green), and fifth (red) scan. Conditions as in panel A. degree of DNA cisplatination, the peak G at the HMDE was only partially decreased. Moreover, the intensity of peak G produced by the cisplatinated DNA at HMDE increased with the number of successive potential cycles between 0 and V, and starting from the third cycle it was even higher than observed for the same but unmodified DNA under the same conditions (Figure 1C). Such behavior suggests that during their electrochemical reduction, the 2972 Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

101 Figure 2. Monitoring of selective cisplatination of probe oligonucleotides in the presence of competitor plasmid DNA using magnetoseparation and AdTS CV. (A) Separation of the cisplatinated ODN probes using magnetic beads. A mixture of either nog or G25 ODN (20 µg ml -1 ), comprising a stretch tested for formation of the platinum adducts and an A 20 adaptor, with plasmid competitor DNA (20 µg ml -1 ), was treated with different concentrations of cisplatin in 40 µl of 0.1 M NaClO 4. After overnight incubation at 37 C in the dark, 20 µl aliquots of the reaction mixtures were withdrawn, mixed with the binding buffer to a total volume of 40 µl, and incubated with the DBT in a shaker at 20 C for 30 min. After binding, the beads were washed and transferred into 20 µl of deionized water. ODNs were released from the DBT by heating at 85 C for 2 min. The recovered ODNs were analyzed by AdTS CV. (B) Sections of AdTS CVs obtained for the ODNs nog (black) or G25 (red) treated with cisplatin (rb ) 0.1) in the mixture with plasmid DNA. Inset: sections of anodic parts of AdTS CVs obtained for G25 treated with various concentrations of cisplatin corresponding to rb values of 0, 0.01, 0.02, 0.04, 0.06, 0.08, and 0.1 (increasing rb is denoted by the arrow). (C) Dependence of the current value measured at the anodic part of the AdTS CV at -1.3 V (as indicated by dashed line in panel B, inset) on the concentration of cisplatin used for modification of the ODN probes in the presence of plasmid DNA: nog (black); G25 (red). Other conditions are as in Figure 1. cisplatin adducts were decomposed with concomitant regeneration of guanine residues in DNA adsorbed at the electrode (in contrast, during DNA oxidation at the PGE the adducts were not decomposed and the peak G ox intensity was close to zero for the same level of calf thymus DNA modification). Our preliminary results (not shown) further suggest that reduction of guanine at HMDE (to 7,8-dihydroguanine whose electrooxidation back to guanine is reflected in the peak G 2,5,45 ) is facilitated by the presence of products of cisplatin reduction at the HMDE, probably through a mechanism involving the catalytic hydrogen evolution (more details will be published elsewhere). The main goal of this work was to develop a simple electrochemical technique suitable for the determination of biochemically relevant levels of DNA modification with platinum complexes, useful also in studies of selective platination of various DNA substrates differing in the content of guanine and/or nucleotide sequence. We therefore compared CV responses of ODNs differing in the content and sequence context of guanine residues (see Table 1) modified with various concentrations of cisplatin. Each ODN possessed an A 20 stretch designed for the separation of the modified ODN probe from the reaction mixture using magnetic beads bearing T 25 capture probes (DBT). 6,10 However, after cisplatination of individual ODNs and magnetic separation, all ODNs showed considerable catalytic currents, including the nog ODN lacking any guanine residue (see Figure S3 in the Supporting Information). This observations suggests that the single-stranded ODNs were forming various types of platinum adducts regardless of the presence or absence of guaninecontaining sequence motifs, and that in the absence of guanine residues other nucleobases accommodated the platinum moieties. Therefore, we further performed modification of the ODNs in the presence of plasmid DNA serving as an indifferent competitor DNA (featured by pbsk (-) plasmid offering multiple guanine motifs for the formation of the stable bifunctional adducts). In such situation, distribution of the cisplatin adducts between the given probe ODN and the competitor plasmid DNA was expected to reflect occurrence of motifs forming preferentially stable cisplatin adducts. Mixtures of either nog or G25 ODN with the competitor plasmid DNA were treated with various concentrations of cisplatin, followed by separation of the ODN probes from mixtures with the modified plasmid DNA using DBT (Figure 2A) and AdTS CV measurements (Figure 2, parts B and C). In agreement with the above assumption, the nog ODN displayed no significant changes in its CV responses after treatment with 0-12 µm cisplatin (corresponding to rb values between 0 and 0.1, as related to total DNA in the mixture) (Figure Analytical Chemistry, Vol. 82, No. 7, April 1,

102 2, parts B and C). On the other hand, the G25 ODN, comprising numerous sites for formation of stable bifunctional cisplatin adducts, exhibited a clear dependence of the catalytic currents on the concentration of cisplatin used for the DNA modification. Negative current measured within the wave at -1.3 V on the anodic part of the CV (inset in Figure 2B) was increasing linearly with the DNA cisplatination level in the rb range between 0 and 0.1 (Figure 2, parts B and C). Modification of the competitor plasmid DNA was tested in parallel by cleavage with a restriction endonuclease Msp I specific for CCGG tetranucleotide. Preferential DNA cisplatination within the GG doublets resulted in inhibition of the DNA cleavage, which was monitored by agarose gel electrophoresis. These experiments confirmed modification of the indifferent competitor in the presence of any of the ODN probes. Moreover, the extent of restriction cleavage inhibition was reflecting inversely the distribution of cisplatin between the probe and competitor DNA in dependence on the probe reactivity, as assessed by the voltammetric measurements (Figure 2, parts B and C; results of the Msp I digestion experiments are shown in the Supporting Information, Figure S4). Square-Wave Voltammetry. The CV studies revealed catalytic currents at the HMDE during the anodic polarization to respond proportionally to the DNA cisplatination level. To obtain better developed signal specific for the DNA modification, we used anodic AdTS SWV instead of CV in the following experiments (Figure 3). Denatured calf thymus DNA modified with cisplatin to rb 0.01, 0.05, and 0.1 was prepared as above and measured by the AdTS SWV under conditions previously optimized 49 for the measurements of peak G. The latter signal, occurring at V, was the only peak observed on the voltammogram corresponding to the unmodified DNA (black curve in Figure 3A). DNA modified with cisplatin produced, in addition to peak G, another distinct signal at V (in Figure 3A denoted as peak P), the intensity of which was about proportional to the DNA modification level. Cisplatin alone, at the same concentration as was corresponding to rb ) 0.1 when used for DNA modification in this experiment, yielded only a faint signal at a potential close to that of peak P, suggesting a weak adsorption of the DNA-unbound platinum complex at the HMDE surface and its efficient removal and separation of the firmly adsorbed DNA 50 during the washing steps (even at a concentration an order of magnitude higher, the response of cisplatin alone was negligible, not shown). Similarly as observed in the CV measurements (Figure 1), the peak G tended to shift toward more negative potentials (Figure 3A). To optimize parameters for the SWV measurements, we followed SWV responses of the cisplatinated DNA as functions of pulse amplitude, frequency, and ph of background electrolyte. We selected an amplitude of 50 mv and a frequency of 200 Hz as values giving rise to the best developed, symmetrical, and from background separated peak P. Although the peak P intensity was increasing with ph shifting to acid values (in the Britton-Robinson buffer) in agreement with the involvement of catalytic hydrogen evolution in the electrode process, we have chosen AFP as a medium suitable for simultaneous measurements of both peak P and peak G (see below). Results of these experiments are shown in detail in the Supporting Information (Figure S5). (49) Jelen, F.; Tomschik, M.; Palecek, E. J. Electroanal. Chem. 1997, 423, (50) Palecek, E.; Postbieglova, I. J. Electroanal. Chem. 1986, 214, Figure 3. AdTS square-wave voltammetry of single-stranded calf thymus DNA (20 µg ml -1 ) treated with cisplatin. (A) AdTS SWV at HMDE: unmodified DNA (black); rb ) 0.01 (green); rb ) 0.05 (blue); rb ) 0.1 (red); 6 µm cisplatin in the absence of DNA (corresponding to rb ) 0.1 in samples with DNA). SWV: amplitude 50 mv, frequency 200 Hz, initial potential V, quiescent time 2 s, final potential 0.0 V; background electrolyte, AFP. Other conditions are as in Figure 1. Inset: AdTS SWV at m-agsae: unmodified DNA (black); rb ) 0.1 (red); parameters of the measurements were the same as used for HMDE. (B) Comparison of the effects of various degrees of cisplatination on AdTS peak G ox due to guanine oxidation measured at a pyrolytic graphite electrode (empty), peak G measured at HMDE (blue), and peak P due to platinum adducts measured at HMDE (red). We tested also the possibility of using a mercury meniscusmodified solid silver amalgam electrode instead of the HMDE in measurements of the cisplatin-modified DNA. The m-agsae proved a potent substitute for the HMDE in many analytical applications, including nucleic acids studies. 22,51,52 Besides sensitive determination of purine nucleobases 52 and label-free electrochemical analysis of natural DNAs, 51 it was successfully applied also for the measurements of catalytic response of DNA modified with an osmium tetroxide complex. 22 The inset in Figure 3A shows a well-developed peak P of the cisplatin-modified DNA (rb ) 0.1) when measured by AdTS SWV at the m-agsae, suggesting the latter to be applicable for this purpose as well. In Figure 3B we compare effects of DNA cisplatination at levels corresponding to rb e 0.1 on the peak G ox measured at a PGE, (51) Fadrna, R.; Yosypchuk, B.; Fojta, M.; Navrátil, T.; Novotny, L. Anal. Lett. 2004, 37, (52) Yosypchuk, B.; Heyrovsky, M.; Palecek, E.; Novotny, L. Electroanalysis 2002, 14, Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

103 Figure 4. Monitoring of selective cisplatination of probe ODNs in the presence of competitor plasmid DNA using magnetic separation and AdTS SWV. Dependences of the peak P on the rb obtained for nog (black), GTT (blue), and GGT (red). The ODNs were treated with cisplatin in the presence of plasmid competitor DNA and separated using DBT as in Figure 2. For other details see Figure 3A. peak G and peak P (both measured at the HMDE). Whereas peak G ox at PGE exhibited certain (albeit within the experimental error) decrease for rb ) 0.1, but no measurable changes for lower modification levels, peak G at the HMDE showed a small increase in its intensity (not exceeding 10% within the given rb range). On the contrary, the cisplatination-specific peak P, which was naturally absent on the voltammogram of unmodified DNA, clearly indicated DNA cisplatination and changes in its level within the given rb range. The peak P can thus be utilized for the determination of the extent of DNA modification at rb levels relevant for biochemical studies. Owing to its weak sensitivity to DNA cisplatination at rb e 0.1, the peak G (which is measured simultaneously with the peak P during a single voltammetric scan, see Figure 3A) can be employed as an independent signal for the determination of total DNA concentration and normalization of the platination-specific signal per unit of DNA (with the limitation given by the requirement for constant G content). Further, we used the AdTS SWV to monitor modification of the nog, GTT, and GGT ODN probes in the presence of the plasmid DNA competitor, separated after the cisplatin treatment using the DBT (as in Figure 2). For the nog ODN, only a small peak P was observed at rb ) 0.1, whereas practically zero signal was detected for lower cisplatination levels (Figure 4). GTT, although not containing optimum sequence motifs identified as major targets for cisplatin in double-stranded DNA, 43,53 exhibited almost linear increase of the peak P intensity with increasing concentration of cisplatin in the reaction mixture. The flexible single-stranded (GTT) 7 stretch was thus able to accommodate, in the presence of the plasmid DNA competitor, a remarkable number of platinum moieties yielding in SWV the peak P. The best target for cisplatination was the GGT ODN probe, as revealed by the most intense peak P obtained for any cisplatin (53) Jamieson, E. R.; Lippard, S. J. Chem. Rev. 1999, 99, concentration (Figure 4). This observation was in accord with our expectations since the latter ODN comprised adjacent guanine residues for formation of the 1,2-GG IAC featuring the most frequent of DNA modification with cisplatin. Finally, we designed a 50-mer double-stranded ODN ds50 (Table 1) comprising a target binding site for tumor suppressor protein p53 (p53con) and an Msp I restriction site (see scheme in Figure 5A). The sensitivity of Msp I cleavage within the CCGG site to DNA cisplatination has been mentioned above. The p53con involved a single GG doublet (Figure 5A). Previously it was shown that DNA cisplatination inhibits p53 binding to target p53cons containing cisplatin-reactive motifs. 27,44,54 Here we modified the ds50 ODN with various concentrations of cisplatin (corresponding to rb values 0.02, 0.04, and 0.08) and followed effects of this modification on the Msp I cleavage (Figure 5B), p53-dna binding (Figure 5C), and voltammetric response of the cisplatin adducts represented by the SWV peak P. Figure 5D shows relative correlation between these three features. Intensity of the peak P was increasing with the cisplatin concentration, albeit following a significantly sublinear trend (whereas the cisplatin concentration increased in the ratio 1:2:4, the peak P intensity was only in the ratio 1:1.7:2.2). This nonlinearity was nevertheless natural in this case considering the facts that the ds50 ODN was modified in the absence of any other DNA and that the rb was calculated relative to all nucleotides in the ds50 ODN, whereas only three preferentially modified guanine doublets were present in the ODN. Thus, three platinum moieties per ODN molecule were in principle sufficient to create the 1,2-GG IAC at all of these doublets, which formally corresponds to rb ) 0.03 (the 50-mer duplex contains 100 nucleotides). Further increasing the cisplatin concentration resulted in exceeding the equivalence point and in the observed sublinearity. Binding of the p53 protein to the ds50 50-mer, giving rise the band R due to the protein-dna complex in the electrophoretic mobility shift assay (Figure 5C), was gradually decreasing as the rb was increasing, inversely reflecting the trend exhibited by the peak P intensity. The Msp I cleavage, resulting in formation of the ds37 fragment (Figure 5A) and a corresponding band in polyacrylamide electrophoresis (Figure 5B), was strongly (practically by an order of magnitude) inhibited at rb as low as 0.02, and no cleavage product was detected at higher rb values. The stronger effect of DNA cisplatination on the restriction cleavage, compared to the p53-dna binding, accorded well with the presence of only one GG doublet in the p53con but two doublets in the Msp I site (one in the top and the other in the bottom strand, see Figure 5A). Probability of the formation of a 1,2-GG IAC within the Msp I site at lower cisplatin concentrations was thus 2-fold, compared to probability of modification of the GG doublet in the p53con; at the same time, cisplatination of only one doublet in the restriction site was sufficient for preventing the cleavage. When the trends in relative intensities of the peak P, the amount of ds50 ODN bound by p53 protein, and the amount of the Msp I cleavage product ds37 (Figure 5D) are compared, one can see that about 2-fold amount of cisplatin bound to the ODN substrate was required to cause the same relative effect on the p53-dna binding, compared to the restriction cleavage inhibition. Taken together, we demon- (54) Pivonkova, H.; Pecinka, P.; Ceskova, P.; Fojta, M. FEBS J. 2006, 273, Analytical Chemistry, Vol. 82, No. 7, April 1,

104 Figure 5. Correlation between biochemical effects of DNA cisplatination and the intensity of peak P due to the cisplatin adducts. (A) Scheme of a 50-mer ODN, bearing a target sequence of p53 protein (p53con) and an Msp I restriction site. The ODN was labeled with 32 P and modified to various levels (see panels B-D) with cisplatin. (B) Effect of cisplatination on the ODN cleavage with the Msp I enzyme. The ds50 band corresponds to full-length 50-mer, ds37 band to the cleaved ODN. (C) Effect of cisplatination on binding of the p53 protein to the 50-mer ODN (R band corresponds to the p53-dna complex). (D) Bar graph comparing the effect of the cisplatin/nucleotide ratio (rb) on the relative intensity of AdTS SWV peak P (gray; value obtained for rb ) 0.08 taken as 100%), cleavability of the Msp I site (blue; relative intensity of the ds37 band, taken as 100% for rb ) 0), and the p53-dna sequence-specific interaction (red; relative intensity of the R band, taken as 100% for rb ) 0). For AdTS SWV measurements, the 50-mer ODN was modified under the same conditions as used for the cleavage and binding experiments but was not radiolabeled. strate an excellent correlation between electrochemical response of the cisplatinated DNA and biochemical consequences of the DNA modification. CONCLUSIONS We propose an electrochemical technique suitable for the determination of DNA modification with cisplatin at levels relevant for studies of biochemical effects of the DNA platination. For the first time we demonstrate analytically useful catalytic current responses accompanying redox processes of the cisplatin moieties in DNA, without any sample pretreatment, during anodic polarization following prereduction of the cisplatinated DNA at HMDE or m-agsae. Using a competition approach, relying in cisplatin treatment of ODN probes in the presence of indifferent DNA and magnetic separation of the probes, followed by AdTS voltammetric measurements, selective modification of various sequence motifs can simply be monitored. Results of our preliminary experiments with cisplatin analogues carboplatin and oxaliplatin (H. Pivoňková, L. Těsnohlídková, and M. Fojta, unpublished) suggest that application of the technique is not restricted to cisplatin. Hence, the proposed approach can easily be adapted for different singleor double-stranded ODN probes designed to form adducts with various platinum complexes, as well as for testing reactivity of various platinum complexes toward different DNA sequence motifs. Variations in the intensity of the SWV peak P, providing information about changes in the extent of the modification of double-stranded DNA substrate, correlated well with effects of the DNA cisplatination on the binding of the p53 as well as on the susceptibility of the DNA to cleavage with a restrictase Msp I. Since the intensity of an intrinsic DNA signal, peak G due to guanine measured by SWV, is not significantly affected by reasonable levels of DNA cisplatination (such as rb e 0.1), the latter signal can be utilized as an internal control for the determination of DNA concentration and normalization of the number of cisplatin adducts per DNA unit. The proposed approaches can find application in studies of DNA modification with platinum complexes and development of novel metallodrugs as a simple and inexpensive alternative to other methods of determination of transition metals such as AAS or ICPMS. ACKNOWLEDGMENT This work was supported by the Czech Science Foundation (Grant 204/07/P476 to H.P.) and partially by the Grant Agency of the ASCR (Grant IAA to M.F. and IAA to L.H.), by the ASCR (Grant 1QS , institutional research plans AV0Z and AV0Z ), and by the MEYS CR (LC06035). SUPPORTING INFORMATION AVAILABLE Results of experiments focused on the effect of parameters such as scan rate (in CV), pulse amplitude, frequency (in SWV), and ph of background electrolyte on the cisplatinated DNA voltammetric responses, as well as results of cisplatin treatment of ODN probes in the absence of competitor DNA and of independent enzymatic probing of the extent of competitor plasmid DNA platination. This material is available free of charge via the Internet at Received for review December 31, Accepted February 12, AC902987X 2976 Analytical Chemistry, Vol. 82, No. 7, April 1, 2010