UNIVERZITA PALACKÉHO V OLOMOUCI Přírodovědecká fakulta Katedra analytické chemie

Transkript

1 UNIVERZITA PALACKÉHO V OLOMOUCI Přírodovědecká fakulta Katedra analytické chemie Hmotnostní spektrometrie pro monitorování a studium chronické myeloidní leukémie HABILITAČNÍ PRÁCE Obor: analytická chemie Olomouc, 2016 RNDr. David Friedecký, Ph.D. Strana 1

2 Poděkování: Rád bych poděkoval Tomáši Adamovi za mnohaleté inspirativní diskuze, Edgaru Faberovi za zasvěcení do tajů léčby leukemických pacientů, kolegům Laboratoře dědičných metabolických poruch, OKB, FN Olomouc a postgraduálním studentům v Laboratoři metabolomiky, UMTM, LF UP Olomouc za výborný kolektiv, který je základem úspěšného tvůrčího procesu. Zvláštní dík patří mým rodičům, kteří mě s láskou vedli životní cestou. Prohlášení: Prohlašuji, že jsem tuto habilitační práci vypracoval samostatně s využitím citovaných literárních zdrojů. V Olomouci, dne 27. června Strana 2

3 Obsah Úvod Chronická myeloidní leukémie Hmotnostní spektrometrie z pohledu klinických aplikací Trojité kvadrupóly Hmotnostní spektrometrie s vysokým rozlišením Kapalinová chromatografie Dědičné metabolické poruchy Terapeutické monitorování léků Ostatní oblasti klinické diagnostiky založené na hmotnostní spektrometrii Terapeutické monitorování inhibitorů tyrosinové kinasy UHPLC pro stanovení inhibitorů tyrosinové kinasy Metoda isotopového zřeďování ve spojení s hmotnostní spektrometrií pro stanovení inhibitorů tyrosinové kinasy Online uspořádání extrakce na pevné fázi ve spojení s hmotnostní spektrometrií pro stanovení inhibitorů tyrosinové kinasy Klinický význam terapeutického monitorování hladin imatinibu Studium metabolizace imatinibu Metabolomické profilování pacientů s chronickou myeloidní leukémií Závěr Výhledy Seznam zkratek Seznam použité literatury Přílohy Strana 3

4 Úvod Hmotnostní spektrometrie je instrumentální analytická metoda, která má zásadní postavení v analýze širokého spektra látek v různých typech materiálů. Své uplatnění našla v mnoha průmyslových odvětvích. Díky rozvoji hmotnostní spektrometrie a separačních technik se v posledních letech stále více prosazuje i v medicíně, ať už při diagnostice či monitorování a léčbě onemocnění. Otevírají se nové možnosti v oblastech jak rutinních laboratorních metod pro rychlé, správné a přesné stanovení biomarkerů, tak multikomponentních metod pro hlubší pochopení patofyziologických či farmakokinetických procesů na úrovni metabolitů a proteinů. Jedním z příkladů je chronická myeloidní leukémie (CML), u níž je monitorování plasmatické hladiny léků nezbytné pro dosažení účinné terapie. Hladiny léků závisí na rychlosti střevní absorpce a metabolizace jaterními enzymy a na klinickém stavu pacienta. Dlouhodobě snížené hladiny léků mají zásadní vliv na možný regres onemocnění, zatímco vysoké hladiny často způsobují závažné nežádoucí účinky. Proto je terapie přísně individualizovaná. Léky pro CML mohou být v plasmě přítomny ve velmi nízkých, až nanomolárních, koncentracích. Pro stanovení jejich hladin v komplexní matrici lze použít metody založené na spojení kapalinové chromatografie s tandemovou hmotnostní spektrometrií. Nově lze aplikovat také metody bez použití konvenční chromatografie, založené na online extrakci na pevné fázi nebo izotopovém zřeďování. Léčba CML za pomocí inhibitorů tyrosinových kinas je vysoce účinná, avšak u některých pacientů dochází ke vzniku rezistence na léčbu anebo rozvoji nežádoucí účinků. Porozumění mechanismu vzniku rezistence je studováno na úrovni genů, proteinů a metabolitů. Metabolity ve srovnání s geny a proteiny odrážejí aktuální stav biologického systému a jsou přímým obrazem změn v metabolismu. Metabolity jsou přítomny v biologických vzorcích ve velkém počtu (tisíce metabolitů) v širokém spektru koncentrací Strana 4

5 a fyzikálně chemických vlastností, jejichž studiem se zabývá speciální obor - metabolomika. Metabolomická analýza zahrnuje celou řadu procesních kroků včetně samotné identifikace a kvantifikace za pomocí hmotnostní spektrometrie (případně nukleární magnetická reznoance) a vyžaduje úzkou multioborovou spolupráci analytické chemie, biochemie, statistiky a dalších. V případě metabolomiky u pacientů s CML jsou výsledky využity k detailnímu porozumění onemocnění na úrovni metabolických drah, mechanismu účinku léčiv anebo hledání nových prediktorů vývoje onemocnění. Imatinib je vysoce účinný lék pro léčbu CML ze skupiny specifických inhibitorů tyrosinových kinas. V současnosti se rutinně stanovuje pouze plasmatická hladina samotného léku. Avšak již dříve byla popsána metabolizace imatinibu na řadu metabolitů, které mohou mít význam pro léčebnou odpověď pacienta či rozvoj nežádoucích účinků. Pro identifikaci a konfirmaci nových metabolitů lze použít poslední generace citlivých vysoko rozlišujících hmotnostních spektrometrů. Tato práce shrnuje výsledky dosažené v posledních letech v oblasti využití hmotnostní spektrometrie pro monitorování inhibitorů tyrosinových kinas, metabolizaci imatinibu a metabolomickou analýzu u pacientů s chronickou myeloidní leukémií. Strana 5

6 1 Chronická myeloidní leukémie Leukémie jsou zhoubná nádorová onemocnění krevních buněk. Typický je vznik a nekontrolovaná proliferace klonu abnormálních nezralých bílých krvinek, které ztratí v organizmu své standardní funkce. Jejich dalším významným rysem je porucha apoptosy, programované buněčné smrti. Díky ní dochází k hromadění buněk leukemického klonu, infiltraci orgánů a redukci normální krvetvorby. Leukémie lze obecně rozdělit na základě typů postižených buněk na leukémie lymfoidní či myeloidní řady bílých krvinek a dále podle rychlosti průběhu na akutní a chronickou [1]. Chronická myeloidní leukémie (CML) je biologicky charakterizována neregulovaným dělením myeloidní buněčné řady v kostní dřeni. Z pohledu genetického je zásadní přítomnost tzv. chromosomu Philadephia obsahujícího BCR-ABL1 leukemický fúzní gen, který vzniká reciprokou translokací chromosomů 9 a 22 t(9;22)(q34;q11) (obrázek 1.1). Gen ABL1, jehož fyziologickou funkcí je stimulace proliferace buněk, se tak dostane do blízkosti velice silného promotoru genu BCR. Dojde k mnohonásobnému zvýšení transkripce. Vznikající bcr-abl protein je enzym s konstitutivní tyrosinkinasovou aktivitou, ovlivňující celou řadu signálních drah. Dojde k narušení základních buněčných procesů, zejména kontroly proliferace a diferenciace, adheze a apoptosy. Výsledkem je neregulované množení buněk myeloidní řady bílých krvinek myeloidní leukémie [2]. Diagnostika CML je založena na měření krevního obrazu a diferenciálního rozpočtu bílých krvinek. V krevním obraze se nachází zvýšené množství bílých krvinek (ve většině případů na úrovni kolem /l). Leukocytóza je způsobena masivním zmnožením buněk myeloidní řady, zejména neutrofilů, případně i bazofilů. Převládají středně zralé formy (metamyelocyty a myelocyty). U části pacientů může dojít k rozvoji anémie a trombocytemie, nicméně trombocytopenie diagnózu nevylučuje. Strana 6

7 Obrázek 1.1: Vznik chromosomu Philadelphia reciprokou translokací t(9;22)(q34;q11) [3]. K potvrzení diagnózy se obvykle provádí vyšetření kostní dřeně zahrnující mikroskopické a cytogenetické vyšetření. Aspirát bývá výrazně hypercelulární. Myelopoéza je výrazně zmnožena, zatímco erytropoéza je v typických případech reziduální. Diagnóza se potvrzuje cytogenetickou analýzou dokazující přítomnost chromosomu Philadelphia a následně molekulárně genetickými metodami přímo identifikujícími BCR-ABL1 fúzní gen či RNA transkript [4]. CML má tři fáze chronickou, která by v případě, že by pacient nebyl léčen, přešla během několika málo měsíců do tzv. akcelerované fáze a následně do blastického zvratu, který v podstatě odpovídá akutní leukémii a vede k úmrtí nemocného. Zpočátku probíhá chronická fáze asymptomaticky. U části pacientů vznikají nespecifické potíže (únava, ztráta hmotnosti, pocení, zvýšené teploty). Další potíže mohou vyplynout ze zvětšené sleziny (splenomegalie z důvodu hromadění bílých krvinek). V akcelerované fázi můžeme sledovat vystupňované projevy nemoci, které nedostatečně reaguje na léčbu [5]. Incidence CML je cca 1 nový případ v populaci jedinců za rok, s věkem vzrůstá. Pacienti jsou (asi v 95 % případů) zachyceni v chronické fázi onemocnění [6]. Strana 7

8 V léčbě CML v současné době hrají zásadní roli inhibitory tyrosinové kinasy (TKI). Jde o takzvanou cílenou léčbu, která významným způsobem změnila prognózu nemocných, takže v souvislosti s dlouhodobými výsledky podávání TKI se o CML mluví jako o chronickém a dobře zvládnutelném stavu. Medián přežití pacientů s optimální odpovědí na léčbu se odhaduje na 25 let. Účinek TKI je založen na kompetitivní inhibici bcr-abl proteinu v místě vazby pro adenosin trifosfát (obrázek 1.2). Díky tomu tyrosinová kinasa ztrácí svou aktivitu abnormálně stimulovaných signálních drah a leukemická buňka zaniká v důsledku apoptosy. TKI tak na rozdíl od historicky používaných léků (cytostatika jako hydroxyurea, busulfan a interferonu) dokáže u naprosté většiny léčených nemocných s CML navodit nejen cytogentickou (vymizení chromosomu Philadelphia), ale i hlubokou molekulární odpověď (významný pokles hladiny transkriptu Bcr-Abl měřený pomocí RT-PCR) [7]. Obrázek 1.2: Mechanismus účinku imatinibu ve vazebném místě proteinu [8]. V současné době se jako lék první volby používá imatinib (IMA). Pokud dojde k selhání léčby, obvykle z důvodu vzniku rezistence, tak se aplikuje preparát druhé generace dasatinib (DAS) či nilotinib (NIL) [9]. V posledních letech jsou k dispozici také bosutinib a ponatinib, ale v ČR jejich používání zatím není rozšířeno díky registraci, která proběhla teprve nedávno. Pro úspěšnost léčby je nezbytné dosažení dostatečné plasmatické hladiny TKI významně ovlivnitelné individuálním vstřebáváním léku u konkrétního pacienta, ale také jeho spoluprací na léčbě a lékovými interakcemi. Proto se u pacientů provádí terapeutické monitorování TKI. Naměřené koncentrace jsou rozhodující pro další postup Strana 8

9 léčby. V případě, že není dosaženo dostatečné hladiny TKI, se může dávka léku zvýšit. Naopak příliš vysoká hladina TKI může vést k prohloubení nežádoucích účinků. V případě vysoké variability mezi jednotlivými odběry u příslušného pacienta je třeba pomýšlet buď na klinické potíže způsobující tento trend (např. žaludeční nevolnost) anebo zejména na špatnou spolupráci pacienta s lékařem při léčbě. Strana 9

10 2 Hmotnostní spektrometrie z pohledu klinických aplikací Hmotnostní spektrometrie (MS) je analytická detekční technika nabitých molekul. Využívá se elektrického či magnetického pole za hlubokého vakua pro separaci iontů dle poměru hmotnosti iontu k jeho náboji (m/z). Hmotnostní spektrometry se skládají ze tří částí ionizace a případné převedení do plynného stavu v iontovém zdroji; separace či fragmentace v hmotnostním analyzátoru a detekce iontů detektorem částic. Ionizace se volí podle povahy vzorku vstupujícího do hmotnostního spektrometru. Nejčastěji se používají elektronová, chemická a elektrosprejová ionizace, matricí asistovaná laserová desorpce a další. Hmotnostních analyzátory jsou založeny na odlišných principech a umožňují tak provádět různé MS experimenty. V současnosti se nejčastěji setkáváme s průletovými či kvadrupólovými analyzátory, iontovými pastmi, orbitálními iontovými pastmi či cyklotronovou rezonancí. MS nachází v posledních deseti letech stále větší uplatnění v klinických laboratořích. Především díky jejímu technickému vývoji se tato technologie stala dostatečně robustní, rychlá a citlivá pro analýzy komplexních biologických materiálů. Naprosto převažující jsou trojité kvadrupóly pracující v režimu monitorování vybrané reakce (SRM, resp. MRM), které ve spojení s kapalinovou chromatografií (LC) umožňují cílenou multikomponentní analýzu širokého spektra látek v rychlém čase obvykle nepřesahujícím 5 minut na jeden vzorek. Další používanou technologií je spojení plynové chromatografie (GC) s jednoduchým kvadrupólem či iontovou pastí a to zejména pro analýzu těkavých látek (často po derivatizaci). Poměrně finančně náročná, vysoce rozlišující MS se používá pro necílený screening či pro identifikace. 2.1 Trojité kvadrupóly Kvadrupóly pracují na principu zajištění stabilní trajektorie iontů s definovanou m/z v elektrickém poli za pomocí vloženého střídavého a stejnosměrného napětí na čtyři tyče Strana 10

11 kvadrupólu. Pro spojení LC s MS se osvědčila kombinace tří kvadrupólů (obrázek 2.1), v nichž se obvykle pracuje v režimu SRM vybraný molekulární iont je 1. kvadrupólem odfiltrován od ostatních iontů s odlišnou m/z a poté fragmentován kolizním plynem v kolizní cele. Zvolený fragment je následně vyselektován 3. kvadrupólem a prochází až na detektor. V současnosti trojité kvadrupóly poskytují citlivost v závislosti na povaze biologického materiálu a samotného analytu jdoucí běžně k nanomolárním koncentračním hladinám. Současně se podařilo zkrátit dobu sběru dat SRM (tzv. dwell time ) až na jednu milisekundu, čímž není nereálné analyzovat stovky analytů v jedné analýze. Trochu překvapivě se limitujícím faktorem stává tzv. pause time, neboli čas potřebný pro vyčištění MS, který bývá běžně nastaven na 5 milisekund. Dalším zásadním parametrem při multikomponentní analýze je dynamický rozsah detektorů, které byly dříve schopny poskytnout linearitu v oblasti pěti řádů intenzit. V posledních dvou letech se však situace výrazně zlepšila a v současnosti MS poskytují lineární odezvu více než 7 řádů. Obrázek 2.1: Schéma trojitého kvadrupólu, API 4000, Applied Biosystems. Při výběru MS do klinické laboratoře je často opomíjeným parametrem robustnost přístroje, která se určuje velmi problematicky. Zjednodušeně lze popsat robustnost MS jako schopnost poskytovat stabilní citlivost MS. Záleží na povaze biologického materiálu, který vstupuje do MS a postupně dochází k zanášení (znečištění) jednotlivých částí MS iontové optiky, kvadrupólů a iontového zdroje. Při rutinní analýze je nezbytné dosáhnout stability MS bez potřeby čištění po dobu nejlépe několika měsíců. Zde je třeba zmínit, že zásadním způsobem může robustnost MS ovlivnit samotný analytický chemik, který by měl brát tuto Strana 11

12 vlastnost v potaz a v maximální míře přizpůsobit biologický materiál vhodnou přípravou vzorku či separací, aby nedocházelo k rychlému znečištění MS. 2.2 Hmotnostní spektrometrie s vysokým rozlišením Hmotnostní spektrometry s vysokým rozlišením, které umožňují měřit m/z s přesností lepší než 5 ppm, byly donedávna, z důvodu vysoké ceny a nedostatečné robustnosti, pro rutinní analýzy nedostupné. V poslední době se však situace výrazně zlepšila a i tyto přístroje postupně zaujímají své místo v diagnostických laboratořích. Jsou využívány především pro identifikace neznámých analytů na základě měření přesné m/z, ze které lze vypočítat pravděpodobný sumární vzorec. Pomocí této technologie lze provádět necílený screening analytů obsažených v biologickém vzorku. Limitací pak zůstává správná volba separačního systému, citlivost a užší rozsah lineární odezvy samotného MS. Na trhu dominují dva typy 1) průletové analyzátory pracující na principu měření doby letu akcelerovaných iontů, které dosahují hmotnostní rozlišení cca FWHM a 2) orbitální iontové pasti s rozlišením až FWHM zaznamenávající harmonické oscilace, které pomocí Fourierovy transformace převádějí signál na hodnotu m/z (obrázek 2.2). Obrázek 2.2: Schéma analyzátoru Orbitrap [10]. Strana 12

13 2.3 Kapalinová chromatografie Za posledních deset let došlo v oblasti LC k významnému pokroku ve kvalitě a výběru stacionárních fází na jedné straně a miniaturizaci na straně druhé. V současnosti je na výběr velké množství modifikovaných stacionárních fází s širokým spektrem selektivity pro analyty. Další inovací je hydrofilní interakční chromatografické (HILIC, Hydrophilic Interaction Liquid Chromatography) uspořádání, které umožňuje analýzu analytů s vysokou polaritou a také se úspěšně využívá tzv. vodná normální fáze (ANP, Aqeous Normal Phase), která dovoluje analýzu analytů s iontovým charakterem. Zmenšování rozměrů částic s navázanou stacionární fází z obvyklé velikosti 5 µm na méně než 2 µm vedlo k dramatickému zlepšení separační účinnosti až k hodnotám přesahujícím 100 tisíc teoretických pater na metr, čímž se účinnost úspěšně blíží kapilární elektroforéze. Tento systém se nazývá ultra vysokoúčinná kapalinová chromatografie (UHPLC). Avšak zmenšování částic mělo za následek zvýšení protitlaku chromatografických kolon, a tak byly na trh uvedeny chromatografické systémy umožňující generovat tlaky přes 1000 barů. Úspěšnou alternativou k UHPLC je tzv. core shell technologie částic s povrchově aktivní vrstvou o tloušťce několika desetin µm (obrázek 2.3), čímž kombinuje výhodu vysoké účinnosti srovnatelné s UHPLC při výrazně nižším protitlaku kolon. Toto uspořádání je dnes dostupné i ve velikosti 1,3 µm, čímž poskytuje nejlepší dostupnou separační účinnost LC. Obrázek 2.3: Schéma core-shell technologie [11]. Výše uvedené přístupy v současnosti umožňují zavést do praxe metody s časem analýzy méně než 2 minuty při životnosti kolon až 10 tisíc nástřiků reálných vzorků biologického Strana 13

14 Relativní intenzita kyselina citronová kyselina ethylmalonová IS - 4-fenylbutyrát materiálu (moč, krev atp.). Mezi další možnosti lze uvést micro-lc uspořádání či monolitické kolony, které se ale i přes své nesporné výhody zatím v rutinní analýze ve větší míře neprosadily. 2.4 Dědičné metabolické poruchy Pravděpodobně první klinickou aplikací MS vyvinutou před více než 40 lety byla analýza organických kyselin v moči pro diagnostiku pacientů s dědičnými metabolickými poruchami (DMP). Metoda je založena na separaci silylovaných metabolitů pomocí plynové chromatografie, které jsou fragmentovány elektronovou ionizací a fragmenty jsou následně detekovány jednoduchým kvadrupólem či iontovou pastí. Tento systém využívá k identifikaci bohaté databáze fragmentačních spekter organických kyselin. Metoda umožňuje komplexní analýzu až stovek organických kyselin a je jednou ze základních metod v diagnostice DMP (obrázek 2.4) [12]. Analýza velmi dlouhých mastných kyselin (C22 C26) pro diagnostiku skupiny peroxisomálních onemocnění je druhou již mnoho let rutinně využívanou DMP aplikací plynové chromatografie s hmotnostní spektrometrií (GC/MS), která opět využívá derivatizace silylací [13] Čas (min) Obrázek 2.4: Chromatografický záznam GC/MS analýzy organických kyselin (ethoximace a sylilace) u pacienta s deficitem acyl-coa-dehydrogenasy o krátké délce řetězce. Strana 14

15 Intenzita [ cps ] Intenzita [ cps ] Rozvoj trojitých kvadrupólů v posledních dvou dekádách umožnil zavést do rutinní praxe novorozenecký screening DMP založený na principu izotopové diluce bez separačního kroku. Analyzují se aminokyseliny a acylované karnitiny z extrahované krevní skvrny za pomocí přímého nástřiku vzorku do tandemového hmotnostního spektrometru. Pro správnou kvantifikaci se používají izotopově značené interní standardy. Vzhledem k velmi nízkým koncentracím některých acylovaných karnitinů se v dříve uvedené metodě využívala derivatizace těchto metabolitů na butylestery [14,15]. Alternativní novější a významně jednodušší metodou je přímá analýza extraktů krevních skvrn v SRM módu bez derivatizace [16,17]. Zde je však nezbytné použít novou generaci dostatečně citlivých trojitých kvadrupólů. Metoda umožňuje měřit více než 75 analytů a jejich interních standardů během 30 sekund a poskytuje účinný nástroj pro diagnostiku více než 50 onemocnění (obrázek 2.5). V ČR se v současné době provádí screening deseti DMP dvou aminoacidopatií, dvou organických acidurií a šesti onemocnění v metabolismu a transportu acylovaných karnitinů. 9.0e5 1.20e5 8.0e5 1.00e5 7.0e5 6.0e5 8.00e4 5.0e5 4.0e5 6.00e4 3.0e5 4.00e4 2.0e5 1.0e5 2.00e Čas [ min] Čas [ min] 0.5 Obrázek 2.5: Profil 31 aminokyselin (vlevo) a 46 acylovaných karnitinů (vpravo) v suché krevní skvrně metodou izotopového zřeďování MS. V návaznosti na novorozenecký screening byly vyvinuty tzv. second-tier neboli druhostupňové metody. Tyto na jedné straně potvrzují podezření daného onemocnění, ale na druhé straně eliminují falešně pozitivní výsledky z důvodu nízké specificity některých biomarkerů onemocnění. Metody využívají separačních přístupů pro separaci isobarických metabolitů v krevní skvrně např. leucinu, isoleucinu, alloisoleucinu, homocysteinu, kys. methylmalonové, methylcitrátu a dalších [18-20]. Strana 15

16 Intenzita [ cps ] Společně s analýzou organických kyselin v moči je pro diagnostiku DMP stanovení aminokyselin v séru či moči. Vzhledem k nezbytné separaci isobarických metabolitů bylo toto stanovení doménou rutinních analyzátorů aminokyselin pracujících na principu ionexové chromatografie s postkolonovou derivatizací. V posledních letech se však i v této oblasti uplatňují LC/MS metody, které výrazně zkracují dobu analýzy z typických 2-3 hodin na minut. Opět se zde setkáváme s variantami analýz derivatizovaných aminokyselin [21] anebo napřímo, bez derivatizace [22]. Další metody pro diagnostiku DMP využívající LC/MS zahrnují metabolismus kreatinu, purinů a pyrimidinů, acylglycinů, acylovaných karnitinů a daších [23-25]. Většina metod je založena na principu separace na reverzní fázi. V naší laboratoři byla vyvinuta metoda pro diagnostiku DMP na principu ANP LC/MS, což je modifikace cílené metabolomické metody [26]. Ve srovnání s dříve publikovanými metodami umožňuje stanovení i polárních metabolitů, které jsou obtížně analyzovatelné v systému reverzní fáze. Metoda umožňuje kvantifikaci a semikvantifikaci více než 40 metabolitů (puriny, pyrimidiny, acylglyciny, kreatin, kreatinin, guanidinoacetát, galaktitol, kys. sialová, sukcinylaceton, argininosucinát a další) během devítiminutové separace a diagnostiku téměř 30 onemocnění (obrázek 2.6). 3.2e5 2.8e5 2.4e5 2.0e5 1.6e5 1.2e5 8.0e4 4.0e Čas [ min] Obrázek 2.6: Analýza vybraných významných metabolitů pro diagnostiku DMP, systém ANP (20 mm NH4Ac, ph 9,7 / MeOH), kolona NH2 Luna 100x2 mm, 3 um (Phenomenex). Strana 16

17 Intenzita [ cps ] 2.5 Terapeutické monitorování léků Mezi nejvíce indikovaná vyšetření ve zdravotnictví patří terapeutické monitorování hladin (TDM) léků. V databázích vědeckých článků lze najít množství metod pro analýzy vybraných léků či jejich skupin. Obecně lze léky dělit do skupin podle účinku působení na imunosupresiva, antidepresiva, antipsychotika, antiarytmika, antiepileptika, antihypertenziva, antibiotika a mnohé další. Obvykle se pro analýzu léků využívá LC separace v systému reverzní fáze s gradientem mobilní fáze přecházející z vodné do organické fáze (methanol či acetonitril). Separační systém je v principu zapotřebí pro oddělení analytů od matrice (fosfolipidy, soli atd.), které způsobují iontovou supresi v elektrosprejovém iontovém zdroji. Iontová suprese je zásadní fenomén, který je zapotřebí eliminovat, protože jednak snižuje citlivost až o jeden řád, ale především výrazně zhoršuje validační parametry vyvíjených metod z důvodu matricových rozdílů mezi vzorky. Eliminace solí se děje za pomocí separace, kdy soli nejsou zadržovány v systému reverzní fáze (obrázek 2.7). Eliminace fosfolipidů v některých případech nelze docílit za pomocí nalezení optimálních separačních podmínek, lze však aplikovat korekci stabilně značenými isotopy stanovovaných látek [27]. x IMA Čas [ min] Obrázek 2.7: Postkolonová infuze standardu do LC/MS analýzy plasmy; oblast s vysokou iontovou supresí se vyskytuje v retenčním čase 0,3 min. Strana 17

18 Pro dosažení rychlých separací se s výhodou používají částice o velikostech pod 2 µm anebo alternativně core-shell technologie. V současné době se dostáváme do situace, kdy limitujícím faktorem rychlosti se stává příprava vzorků (obvykle deproteinace organických rozpouštědlem), která trvá 5-10x déle než samotná analýza. Avšak i v této oblasti dochází k automatizaci. Typickým příkladem je analýza imunosupresiv v plné krvi za pomocí LC/MS, která je rozšířená v mnoha laboratořích po celém světě. Analyty jsou měřeny v režimu SRM, amonné adukty se fragmentují v kolizní cele na molekulární ionty. Pro každý analyt se do vzorku přidává stabilně značený interní standard pro dosažení maximální kvality analytického systému. Měření v MS začíná z důvodu odklonění solí z matrice v čase 0,6 min (obrázek 2.8). 9.0e5 2.2e4 8.0e5 2.0e4 7.0e5 1.8e4 Intenzita [ cps ] 6.0e5 5.0e5 4.0e5 Intenzita [ cps ] 1.6e4 1.4e4 1.2e4 1.0e4 3.0e5 8.0e3 2.0e5 1.0e5 6.0e3 4.0e3 2.0e Čas [ min] Čas [ min] Obrázek 2.8: Analýza deseti antihypertentziv (vlevo) a čtyř imunosupresiv (vpravo) na koloně Acquity C18 BEH 1,7 µm, 50mmx2,1mm, mobilní fáze: mravenčan amonný ph 4,0 ve vodě / MeOH, detekce: SRM. Strana 18

19 V posledních letech byly na trh uvedeny komerční kity, které umožňují velmi rychlé analýzy vybraných skupin léků pro více než 100 analytů v rámci jedné metody [28]. Avšak ceny těchto vyšetření jsou pro zdravotnický systém ČR příliš vysoké, a proto se téměř výhradně setkáváme v laboratořích s home-made metodami, které jsou navíc vyvíjeny podle místních požadavků na vyšetření. Vzhledem k obsáhlé problematice stanovení léků v literatuře je v následující kapitole 3 uvedena rešerše na téma TDM inhibitorů tyrosinových kinas. 2.6 Ostatní oblasti klinické diagnostiky založené na hmotnostní spektrometrii Mimo TDM je MS široce používána pro stanovení hladiny vitaminu D a jeho metabolitu 25-hydroxyvitaminu D3 a D2. Toto vyšetření je jedno z nejvíce indikovaných laboratorních vyšetření. Dalšími diagnosticky významnými metabolity jsou 1,25-dihydroxyvitamina D3 a D2, které jsou v krvi přítomny ve velmi nízkých hladinách (10-12 g/l) a představují analytický problém, pro jehož překonání byla vyvinuta celá řada přístupů využívající prekoncentraci anebo derivatizaci [29]. Podobným problémem je analýza steroidních hormonů, které jsou v tělních tekutinách také přítomny ve velmi nízkých hladinách. Navíc se zde vyskytují isobary, které samotnou analýzu komplikují [30]. V této oblasti se rovněž angažují komerční společnosti (např. Recipe a Chromsystems v Evropě), které nabízejí celou řadu metod pro stanovení diagnosticky významných markerů. Z pohledu laboratoře zde opět narážíme na finanční náročnost, která je za současných podmínek financování zdravotní péče příliš vysoká. Analýza proteinů za pomocí MS je samostatnou vědeckou disciplínou, avšak klinické využití našly pouze vybrané oblasti. Pro rutinní diagnostiku se v současnosti rozšířila analýza specifických proteinů a proteinových profilů u inkubovaných bakterií a hub pomocí techniky MALDI-TOF. Vzorky lze analyzovat přímo nebo po kultivaci (dle citlivosti). Spektra se srovnávají s bohatými databázemi zahrnující tisíce spekter od stovek různých druhů bakterií. Umožňují tak jednoznačnou identifikaci patogenu. Tento přístup znamená zásadní pokrok v oblasti mikrobiologie. Navíc také významně zkracuje dobu potřebnou pro kultivaci a analýzu [31]. Strana 19

20 Pro metody soudního lékařství a toxikologie představuje technika hmotnostní spektrometrie hlavní volbu analýzy. GC/MS je v kombinaci s tenkovrstevnou chromatografií excelentní nástroj pro potvrzení identity zneužívaného léku či drogy, a to na základě shody fragmentačních spekter s databází spekter. V současné době se do toxikologických laboratoří rozšiřuje také LC/MS technika s detekcí na principu trojitého kvadrupólu či iontové pasti, která pokrývá větší rozsah mnoha skupin léků. Aplikuje se zde režim měření SRM či celého skenu m/z. a následného měření fragmentačních spekter iontů, které slouží pro potvrzení identity srovnáním s databází spekter. Také hmotnostní spektrometrie s vysokým rozlišením nachází své místo při necíleném screeningu a následné identifikaci neznámých látek, např. syntetických analog zneužívaných drog [32]. Význam a možnosti v klinické diagnostice nejlépe dokládá rozsah vyšetření jedné z největších laboratoří - Mayo Clinic (Rochester, Minnesota, USA, Počet testů založených na MS metodách čítá v on-line katalogu více než 500 a zahrnuje všechny výše uvedené oblasti vyšetřovacích metod. Strana 20

21 3 Terapeutické monitorování inhibitorů tyrosinové kinasy TKI jsou velmi účinné léky se specifickým účinkem na myeloidní řadu bílých krvinek s chromosomem Philadelphia. I přes vysokou účinnost je nezbytné monitorovat hladiny těchto léků v krvi, a to za účelem dosažení optimální terapie. Při vysokých hladinách se projevují nežádoucí klinické příznaky, naopak při nízkých hladinách může dojít k nedostatečné odpovědi na léčbu až k progresi onemocnění. Pro monitorování hladin se obvykle aplikuje technika LC/MS na principu trojitého kvadrupólu, která poskytuje nejlepší parametry pro rutinní analýzy komplexních biologických materiálů. 3.1 UHPLC pro stanovení inhibitorů tyrosinové kinasy Pro stanovení TKI byly vyvinuty instrumentálně nenáročné metody zahrnující kapilární elektroforézu [33,34] anebo kapalinovou chromatografii s UV detekcí [35-37]. Vzhledem k nízké specifitě UV detekce je zapotřebí aplikovat přečištění vzorku např. extrakcí na pevné fázi a separace musí být dostatečně účinná a selektivní pro oddělení TKI od interferujících složek. Byla publikována řada metod stanovení TKI na principu LC/MS [38-40]. Vzorky jsou obvykle připravovány jednoduchou precipitací proteinů organickými rozpouštědly. Separace je většinou dosažena v systému reverzní faze na kolonách o velikosti částic 5 um. Alternativně byl také použit separační princip HILIC [41] s délkou analýzy 2 minuty. V roce 2010 jsme vyvinuli a následně zavedli do rutinní praxe LC/MS metodu pro stanovení čtyř TKI v plasmatických vzorcích u pacientů s CML - IMA, DAS a NIL a karcinomem prsu - Lapatinib (LAP) (obrázek 3.1) [42]. TKI jsou separovány v systému reverzní fáze na 1,7 um C18 částicích, které poskytují vysokou separační účinnost a rychlý čas analýzy (2,2 min). Metoda vykazuje velmi vysokou robustnost při zachování analytických a validačních parametrů pro analýzy plasmatických vzorků s možností stanovení až vzorků na jedné koloně. Strana 21

22 Imatinib Dasatinib N H 3 C N N N H H O N N N CH 3 HO N N N H CH 3 N S N N H 3 C H N O Cl Nilotinib N CH 3 Lapatinib F H 3 C N O N O N N N H H N F F F CH 3 O S O HN O NH N N Cl Obrázek 3.1: Struktury TKI. Vzorky plasmy byly deproteinovány methanolem (1:10) s přídavkem interního standardu (IS) D8-IMA a centrifugovaný supernatant byl přímo analyzován (nástřik 2 µl). Pro porovnatelnost výsledků byly vzorky krve odebírány v rozmezí h po poslední dávce léku (poločas eliminace IMA = 18 h) a centrifugovaná plasma zamražena při -20 C. Analytická metoda byla založena na separaci léků od matrice na UHPLC koloně Acquity BEH C18 1,7 um (2,1 mm x 50 mm) od firmy Waters. Látky byly separovány v systému reverzní fáze s gradientovou elucí mobilní fáze o složení A) formiát amonný (4 mmol/l, ph 3,2) a B) acetonitrilu při průtoku 0,5 ml/min, při teplotě 40 C s celkovým časem analýzy 2,2 minuty (obrázek 3.2 a 3.3). Pro detekci byl použit MS API 4000 (trojitý kvadrupól) v režimu SRM. Dwell time byl nastaven na 50 ms (viz. tabulka 3.1). Všechny analyty byly kvantifikovány na deuterovaný interní standard D8-IMA. Strana 22

23 Tabulka 3.1: Parametry iontového zdroje a hmotnostního analyzátoru. Analyt MRM (m/z) čas měření (ms) deklasterační potenciál (V) kolizní energie (V) ostatní parametry IMA 494 => pomocné plyny GS1,GS2 50 psi D8IMA 502 => plyn v kolizní cele 6 psi desima 480 => napětí iontového zdroje 5500 V NIL 531 => teplota iontového zdroje 500 C LAP 582 => polarita ESI pozitiv DAS 489 => Obrázek 3.2: Analýza vzorků plasem tří pacientů léčených IMA s nedostatečnou (A, 60 ng/ml), odpovídající (B, 1150 ng/ml) a vysokou (C, 8450 ng/ml) hladinou léku. Obrázek 3.3: Analýza vzorků plasem tří pacientů léčených LAP. A) c = ng/ml (jaterní toxicita); B) c = ng/ml; C) c= 387 ng/ml (přerušení terapie při progresi). Strana 23

24 Metoda vykazuje dostatečnou citlivost pro stanovení všech léků. Byl dosažen limit kvantifikace 1,2, 6,4 a 13 ng/ml pro IMA, NIL a DAS. Byla potvrzena terapeutická mez pro IMA. Hladiny IMA by měly být pro dostatečnou účinnost terapie nad úrovní 1000 ng/ml. V případě DAS se metoda používá především pro kontrolu pacientů, zdali dodržují předepsanou terapii. Ve srovnání s ostatními TKI je stanovení DAS komplikováno jednak o jeden řád nižší citlivostí SRM pro tuto molekulu, rychlou farmakokinetikou (poločas eliminace 1,5-3 h) a nižšími dávkami léku (obvykle mg/den). V následujících letech byla metoda mírně modifikována a byly přidány deuterované IS pro všechny stanovované léky. 3.2 Metoda isotopového zřeďování ve spojení s hmotnostní spektrometrií pro stanovení inhibitorů tyrosinové kinasy Isotopové zřeďování s přímou injekcí do MS je jednou ze zásadních metod pro stanovení aminokyselin a acylovaných karnitinů v novorozeneckém screeningu [15-17]. Tímto přístupem jsou rutinně analyzovány velké série vzorků za účelem screenování vybraných DMP u novorozenců. Obdobně byla metoda aplikována na diagnostiku v močích dětí s podezřením na DMP [43,44]. Druhou oblastí využívající izotopového zřeďování je metabolomické profilování biologických vzorků [45-47], které je vysoko prostupnou alternativou k metodám založených na LC nebo GC separacích ve spojení s MS. Po zavedení LC/MS metody pro stanovení TKI jsme aplikovali přístup isotopového zřeďování na tuto skupinu léků v plasmatických vzorcích pacientů s CML. Jako první byla vyvinuta metoda pro stanovení IMA [48]. Příprava vzorků byla velmi jednoduchá a byla založena na precipitaci proteinů organických rozpouštědlem. Vzorky plasem pacientů na léčbě IMA byly deproteinovány methanolem obsahující D8-IMA vysokým poměrem - 1:10. I přesto toto opatření byla iontová suprese v rozmezí %. Supresní vlivy, které obecně významně zhoršují analytické parametry separačních metod, však byly eliminovány přídavkem deuterovaného IS. Díky desetinásobnému naředění vzorku a nízkému objemu dávkovaného vzorku (0,5 µl) jsme byli schopni změřit velké série (> 1000 vzorků) bez ztráty citlivosti MS a potřeby čištění iontového zdroje či vakuové části analyzátoru. Strana 24

25 Vzorky byly dávkovány do průtoku methanolu s přídavkem 0,1% kyseliny mravenčí. Průtok 0,3 ml/min byl v momentě vstupu vzorku do iontového zdroje snížen na 0,03 ml/min, čímž se docílilo delšího časového okna pro měření samotného vzorku (cca 20 s) a také vyšší citlivosti z důvodu menší kompetice iontů o limitovaný náboj z elektrospreje. Další výhodou měření plasmatických vzorků je jejich matricová interindividuální podobnost, která je prezentována odchylkami v intenzitách IS menšími než 7 %. Celková doba analýzy včetně nástřiku byla 45 s ve srovnání s 2,5 min při LC/MS analýze. Pro vyloučení možné interference byly měřeny dva SRM a kalkulován jejich poměr s odchylkou méně než 15 %. Na obrázku 3.4 jsou srovnány analýzy přímým nástřikem a LC/MS. Díky iontové supresi je metoda 7,5x méně citlivá (LOQ 4 vs. 31 ng/ml). Avšak citlivost je naprosto dostačující pro účely terapeutického monitorování. Obvykle se hladiny pohybují v rozmezí ng/ml. Obrázek 3.4: Analýza plasmatického vzorku pacienta na IM metodou přímého nástřiku (A, 895 ng/ml) a LC/MS (B, 1153 ng/ml). Validační parametry lineární rozsah, nepřesnost v sérii a mezi dny, návratnost jsou srovnatelné mezi oběma metodami a poskytují shodné výsledky. Za tímto účelem bylo provedeno párové srovnání dat pomocí Bland-Altmanova grafu (obrázek 3.5), který Strana 25

26 zobrazuje závislost rozdílů mezi metodami na průměrné hodnotě pro každý změřený vzorek plasmy. Průměrná diference mezi metodami je -1,5 ng/ml. Rozdíl koncentrací (LC-MS/MS - FIA-MS/MS) SD mean - 2SD Průměrná koncentrace (ng/ml) Obrázek 3.5: Bland-Altmanův graf pro metodu izotopového zřeďování a LC/MS. Výše uvedená metoda byla optimalizována pro stanovení čtyř TKI na přístroji 5500 QTRAP (Sciex), což je trojitý kvadrupól kombinovaný s lineární iontovou pastí umožňující měřit v režimu MRM 3 (neboli provádět dvoustupňovou fragmentaci). Ve srovnání s dřívější generací MS (API 4000) instrumentace poskytla o téměř 1 řád lepší citlivost, což umožnilo stanovení i DAS s plasmatickými hladinami nižšími než 10 ng/ml [49]. MRM 3 režim byl úspěšně použit pro analýzu obtížně stanovitelných analytů v komplexních matricích [50,51]. Příprava vzorku před analýzou a podmínky LC byly identické s dříve publikovanou metodou [48]. Do metody byly vybrány čtyři TKI IMA, DAS, NIL a lapatinib (LAP), které se používají při léčbě CML a karcinomu prsu (LAP). Pro správnou kvantifikaci byla použita směs IS obsahující D8-IMA, D8-DAS, D6-NIL a D4-LAP. Pro eliminaci interferencí byly opět použity dva SRM a sledován jejich poměr. Na obrázku 3.6 jsou uvedeny záznamy jednotlivých TKI vzorku kontroly kvality (Chromsystems, DE). Je zde vidět významně horší odezva signálu u DAS. Strana 26

27 Obrázek 3.6: Analýza plasmatických vzorků metodou přímého nástřiku (IMA, c = 1911 ng/ml; NIL, c = 1184 ng/ml; DAS, c = 252 ng/ml, LAP, c = 2500 ng/ml). Mnohaleté monitorování DAS navíc ukazuje, že hladiny tohoto léku se pohybují v jednotkách či desítkách ng/ml z důvodu rychlé farmakokinetiky. Vyvinutá metoda poskytovala mez stanovitelnosti 45 ng/ml, což bylo nedostačující pro monitorování tohoto léku. Pro stanovení DAS byla využita vlastnost lineární iontové pasti a aplikovali přístup MRM 3. Princip spočívá ve výběru iontu na prvním kvadrupólu. Iont se fragmentuje v kolizní cele a vybraný fragment je izolován a akumulován ve třetím kvadrupólu. Fragment je následně znovu fragmentován na třetím kvadrupólu (obrázek 3.7). Vstup do detektoru Obrázek 3.7: Princip MRM 3 na trojitém kvadrupólu s lineární iontovou pastí. Strana 27

28 Pro DAS jsme zvolili nejvíce intenzivní SRM z molekulárního iontu m/z 488 na fragment m/z 401, který byl akumulován a následně fragmentován na iont m/z 232 (obrázek 3.8). Díky tomuto módu jsme získali o dva řády lepší citlivost pro DAS s LOQ 0,96 ng/ml. Nevýhodou tohoto přístupu je poměrně dlouhá doba plnění třetího kvadrupólu až 250 ms. Proto je třeba pro MRM 3 čas měření i více než 0,5 s (při součtu všech kroků fragmentací). Obrázek 3.8: Dvojitá fragmentace DAS (vlevo) a záznam přímého nástřiku vzorku DAS vnitřní kontroly kvality (c = 252 ng/ml). Celková doba analýzy obsahující SRM pro IMA, NIL a LAP a MRM 3 pro DAS zahrnující dostatečný počet měřených bodů a nástřik byla 55 s. V případě měření série jednoho léku byl aplikován nástřik všech vzorků během jedné analýzy do organického rozpouštědla - methanolu s 0,1% kyselinou mravenčí o průtoku 0,5 ml/min. V tomto případě byla analýza zrychlena na 19 s / vzorek, což bylo limitováno především rychlosti nástřiku autosampleru. Na obrázku 3.9 je záznam analýz kalibrátorů (Cal 0 Cal 3), vnitřních kontrol kvality (QC 1, QC 2) a plasem od pacientů na léčbě IMA. Strana 28

29 Rozdíl koncentrací [ LC-MS/MS - FIA-MS/MS ] Rozdíl koncentrací [ LC-MS/MS - FIA-MS/MS ] Obrázek 3.9: Záznam vícenásobného nástřiku vzorků plasem pacientů na léčbě IMA (modrá čára). Červená čára znázorňuje záznam intenzit deuterovaného IS D8-IMA. Vyvinutá metoda byla plně srovnatelná s LC/MS metodou. Správnost měření byla testována také na komerčních vzorcích interní kontroly kvality (bias < 3 %) a pro IMA na vzorcích externí kontroly kvality (bias < 7 %). Limity kvanitifikace pro IMA, NIL a LAP byly lepší než 6 ng/ml, což je naprosto dostačující pro terapeutické monitorování. Metoda byla srovnána s LC/MS za pomocí Bland-Altmanových grafů pro každý TKI (obrázek 3.10). 120 IMA Median: SD: NIL Median: 0.02 SD: DAS Median: SD: LAP Median: SD: Průměrná koncentrace [ ng/ml] Průměrná koncentrace [ ng/ml] Obrázek 3.10: Bland-Altmanovy grafy pro metodu přímého nástřiku a LC/MS. Strana 29

30 3.3 Online uspořádání extrakce na pevné fázi ve spojení s hmotnostní spektrometrií pro stanovení inhibitorů tyrosinové kinasy Online spojení extrakce na pevné fázi (SPE) s MS představuje slibnou alternativu ke konvenčním přístupům LC/MS [51]. Systém se skládá z autosampleru, SPE cartridge, přepínacích ventilů. SPE cartridge je opakovatelně použitelná až pro 2000 nástřiků. Díky plné automatizaci je možné dosáhnout velmi vysoké prostupnosti vzorků při délce analýzy 7 s/vzorek. Princip spočívá v odstranění solí a dalších suprimujících komponent biologické matrice (obrázek 3.11). Analyzovaný lék se na kolonce zadrží, zatímco ostatní složky jsou vymyty. Posléze se analyt eluuje do MS organickým rozpouštědlem. Během analýzy v MS se cartridge promývá a ekvilibruje pro extrakci dalšího vzorku. Díky velmi malým rozměrům SPE cartridge je celý proces velmi rychlý. Injekce vzorku Přenos vzorku na cartridge Odstranění interferujících látek promytím cartridge Eluce analytů zpětným průtokem mobilní fáze Transport eluentu do MS Obrázek 3.11: Schéma uspořádání online SPE/MS. Komerčně tento přístroj nabízí např. firma Agilent pod názvem RapidFire. Jako výhoda se uvádí nízká spotřeba organických rozpouštědel a kratší pracovní čas poměrně drahé MS instrumentace. Zásadním časově limitujícím faktorem celého přístupu, který však obvykle nebývá zmíněn, je deproteinace vzorku. Obvykle se provádí deproteinace organickým rozpouštědlem či silnou kyselinou a tento krok trvá 10 minut a více. Navíc je tato část ontížně automatizovatelná. I tak přístup online SPE/MS se jeví velmi perspektivní v analýze celé řady analytů zahrnující léky, diagnostické biomarkery a další. V posledních letech byly publikovány metody pro rychlé stanovení imunospuresiv v plné krvi [53] a busulfanu v plasmě [54]. Úspěšně byl tento systém aplikován pro stanovení heparan sulfátu v krevní skvrně pro diagnostiku mukopolysacharidos [55]. V naší studii byly pro vývoj metody využity zkušenosti s terapeutickým monitorováním TKI pomocí LC/MS a byly vybrány IMA, DAS, NIL a LAP [56]. Po prvních experimentech jsme z dalšího vývoje vyloučili DAS, který neposkytoval dostatečnou citlivost dokonce ani Strana 30

31 v MRM 3 módu. I při vývoji metody pro IMA, NIL a LAP jsme se setkali s celou řadou problémů, které nejsou typické pro LC/MS přístup. Jako první byl výběr správné stacionární fáze pro SPE. Typicky se nabízí použít C18, která však vykazovala velmi silnou retenci pro TKI. Pro SPE byla zvolena C4 stacionární fáze, která vykázala stabilitu pro více než 3000 nástřiků. Dalším aspektem, který je třeba brát v potaz, je složení vzorku dávkovaného na SPE. Obvykle se plasmatické vzorky deproteinují methanolem či acetonitrilem. Avšak pro následnou SPE bylo zapotřebí vzorek naředit 10x 50% MeOH/H2O, čímž bylo dosaženo optimální retence analytů na C4 cartridge. Pro eluci TKI poskytoval nejlepší citlivost a nejnižší carry-over acetonitril s přídavkem 5% 5 mm mravenčanu amonného. I přes optimalizace podmínek SPE IMA vykazoval silnou tendenci ke carry-over. Proto byla prodloužena eluce vzorku z cartridge na 15 s a navíc byl zařazen mezi vzorky vždy jeden blank vzorek nastavený na 8s cyklus. V tomto uspořádání byl carry-over eliminován a doba analýzy se prodloužila na 29 s (obrázek 3.12). Obrázek 3.12: Analýza TKI pomocí online SPE/MS A) IMA, B) NIL, C) LAP. Plná čára záznam TKI, čárkovaná čára záznam IS. Strana 31

32 Odpověď (Ax/Ais) Vzhledem k ředění plasmatického vzorku 4x methanolem a následně 10x směsí methanol/voda (1:1) byla citlivost vyvinuté metody o jeden řád horší ve srovnání s LC/MS metodou. I přesto byla metoda lineární v rozsahu tří koncentračních řádů (obrázek 3.13). Ostatní validační parametry byly na úrovni požadované pro terapeutické monitorování. Poněkud překvapivě iontová suprese u vzorků plasem byla v rozmezí %, což ukazuje pravděpodobně na přítomnost lipidů, které je velmi obtížné separovat od analytů. Na druhé straně vliv samotných solí se zdá být ne až tak dramatický, protože i po jejich odstranění byla iontová suprese velmi intenzivní. Metoda byla testována na 180 vzorcích pacientů na léčbě TKI a poskytovala srovnatelné výsledky s LC/MS. y = x R² = Koncentrace (Cx/Cis) Obrázek 3.13: Kalibrační závislost IMA v rozsahu tří řádů: 10 ng/ml 10 ug/ml. 3.4 Klinický význam terapeutického monitorování hladin imatinibu V posledních letech bylo publikováno několik článků prezentujících statisticky vyšší hladiny IMA u pacientů, kteří dobře odpovídají na léčbu ve srovnání s pacienty se suboptimální odpovědí či pacienty, u kterých selhala léčba [57-59]. Zde je však třeba zmínit, že rozdíly mezi těmito skupinami byly vyhodnoceny pouze jako statisticky významné. Navíc byly zjištěny pouze v rámci klinické studie, nikoli v běžné klinické praxi. Avšak z pohledu reálné praxe je přenos těchto závěrů klinické studie diskutabilní a doposud nebyl inkorporován do žádných doporučení pro léčbu CML. V naši studii [60] jsme srovnali hladiny od 38 pacientů s optimální odpovědí, 22 pacientů se suboptimální odpovědí a 24 pacientů, u nichž selhala Strana 32

33 léčba. Výsledky ukázaly statisticky nevýznamné rozdíly mezi těmito třemi skupinami (obrázek 3.14; p(a/b)= 0.990; p(a/c)=0,949). Obrázek 3.14: Srovnání plasmatické hladiny IMA u pacientů s optimální (A; ±651.4, n=38, suboptimální léčebnou odpovědí (B; ±404.6, n=22) a pacientů se selháním léčby (C; ±479.2, n=24). Monitorování hladin TKI má však význam i pro běžnou klinickou praxi z několika důvodů. Můžeme sledovat, jakým způsobem pacienti akceptují léčbu, či zda správně spolupracují s lékařem při terapii. Obrázek 3.15 prezentuje skupinu pacientů (vlevo), kteří mají obtíže s terapií (nežádoucí účinky či neberou léky dle předpisu). V této skupině je intraindividuální variabilita mezi jednotlivými odběry v rozmezí %. Na druhé straně obrázek vpravo prezentuje skupinu pacientů, u nichž je léčba dlouhodobě bezproblémová. Zde je intraindividuální variabilita v rozmezí %. Strana 33

34 koncentrace (ng/ml) koncentrace (ng/ml) počet odběrů počet odběrů Obrázek 3.15: Intraindividuální variabilita u pacientů s optimální spoluprací (vpravo) a pacientů s nežádoucími účinky, či špatnou spoluprací s lékařem při terapii (vlevo). Odběry jsou v tříměsíčních intervalech. Každá linie odpovídá jednomu pacientovi. Odběry byly prováděny h po poslední dávce 400 mg/den. Zásadní význam má terapeutické monitorování IMA při dlouhodobém sledování molekulární/cytogenetické odpovědi na léčbu [61]. Standardní doporučená denní dávka IMA je 400 mg/den, avšak celá řada pacientů tuto dávku netoleruje a je třeba upravovat terapeutický režim směrem k nižším dávkám či menší četnosti. Na dvou pacientech jsme prezentovali pozitivní vliv zvýšení dávky IMA na léčebnou odpověď. V obou případech byly hladiny u pacientů nižší než doporučených 1000 ng/ml a po zvýšení dávky došlo k adekvátnímu nárůstu hladin a současně snížení přítomnosti onkogenního proteinu v krvi pod 0,1 % (obrázek 3.16). Strana 34

35 Pacient č. 1 Pacient č. 2 Dávka IMA měsíce měsíce Obrázek 3.16: Vliv změny dávky IMA na snížení molekulární odpověď (A) a zvýšení hladiny IMA (B) u dvou pacientů, kteří při standardní dávce nedosáhli kompletní molekulární odpověď. Ve FN Olomouc je v současné době léčeno 200 pacientů s CML za pomocí TKI (IM, DAS, NIL). Mnozí pacienti mají problém s tolerancí IMA při standardní dávce a je u nich terapie přizpůsobena. U těchto pacientů jsou hladiny IMA výrazně pod doporučenou hranicí (1000 ng/ml) a i přesto velmi dobře odpovídají na léčbu a dlouhodobě mají intraindividuální variabilitu pod 10%. Tento léčebný postup není ve světě zcela obvyklý. Pečlivé nastavení tolerovatelné léčby znamená pro pacienty velký benefit, za což patří dík lékařům Hematoonkologické kliniky. Strana 35

36 4 Studium metabolizace imatinibu Monitorování léků v současnosti patří mezi základní biochemická vyšetření a je využíváno pro individualizaci léčby za účelem dosažení optimální klinické odpovědi na léčbu a minimalizace nežádoucích reakcí často z důvodu příliš vysokých plasmatických hladin. V případě IMA je monitorována plasmatická hladina samotného léku. In-vivo jsou však léky transformovány na metabolity, které jsou obvykle méně toxické pro organismus. Biotransformace se obecně dělí na 1. fázi, která zahrnuje např. hydroxylaci, oxidaci, alkylaci, dealkylaci, redukci a na 2. fázi zahrnující kunjugaci s glukuronidy, aminokyselinami atd. Většina reakcí 1. fáze je katalyzována jednotlivými isoformami cytochromu P450 a 2. fáze glukuronyltransferasou a dalšími. Díky těmto reakcím můžou vznikat metabolity, které mohou vykazovat vysokou biologickou aktivitu či toxicitu. Proto je důležité stanovení nejen samotného léku, ale také jeho metabolitů, které mohou zásadně ovlivňovat terapii. Vývoj hmotnostní spektrometrie v posledních dvou dekádách umožnil detailní studium metabolizace léků. Pro tuto oblast jsou užitečné jak trojité kvadrupóly, které umožňují hledání známých metabolitů za pomocí predikovatelných SRM, tak vysoce rozlišující MS se schopností identifikace na základě přesné m/z. Pro potvrzení identity a určení struktury metabolitů se obvykle aplikují fragmentační experimenty na úrovni MS 2 MS 4. V tomto ohledu má výhodu orbitální iontová past, která je schopna měřit fragmenty s přesnou m/z během vícenásobných fragmentačních experimentů. Metabolizace IMA byla studována metodami RP-LC/MS s jednotkovým i vysokým rozlišením. V plasmě pacientů bylo nalezeno 14 metabolitů (oxidace, demethylace, ztráta piperazinového kruhu a jejich gukuronidy) za pomocí separace v systému reverzní fáze a detekce Q-TOF [62]. V mikrozomech inkubovaných s IMA bylo identifikováno a MSn fragmentacemi potvrzeno celkem 7 metabolitů (demethylace, N-oxidace a hydroxylace) na HILIC separaci ve spojení s trojitým kvadrupólem s lineární iontovou pastí [63]. Strana 36

37 V další studii byly srovnány metabolity mikrozomální inkubace s IMA s plasmatickými vzorky od pacientů léčených IMA. Bylo identifikováno 30 metabolitů v mikrozomech a 14 metabolitů v plasmě [64]. V naší studii jsme se zaměřili na hledání metabolitů IMA v plasmatických vzorcích pacientů s CML [65]. Pro separaci byl zvolen systém reverzní fáze na core-shell koloně Phenomenex Kinetex C18 s velikostí částic 1,7 µm (10 cm x 2,1 mm). Metabolity byly detekovány MS s vysokým rozlišením Orbitrap Elite v pozitivním módu při rozlišení FWHM ve full scan módu a FWHM pro MS 2 (metabolity 1. fáze) a MS 3 (metabolity 2. fáze) fragmentační experimenty. Byly změřeny vzorky osmi pacientů ve full scan módu v rozsahu m/z a data byla procesována software Metworks 1.3 (Thermo Fisher Scientific, USA). Byly nalezeny potenciální metabolity na základě listu predikovaných metabolizací a z něj vypočtených přesných m/z. Celkem bylo nalezeno více než 180 chromatografických píků odpovídajících metabolitům IMA 1. a 2. fáze biotransformace. Následně byly vybrány píky přítomné minimálně ve čtyřech vzorcích plasem a tyto byly podrobeny fragmentačním experimentům za účelem potvrzení navržené identity. Pro predikci fragmentace metabolitů byl použit software Mass Frontier 7.0 (HighChem, SK). Ve vzorcích plasem bylo nalezeno 90 metabolitů, z nichž 74 bylo charakterizováno MS 2 /MS 3 fragmentačními spektry měřené s vysokým rozlišením. 16 metabolitů bylo identifikováno pouze na základě přesné m/z a nebylo potvrzeno z důvodu nízké intenzity chromatografických píků a nepřítomnosti fragmentačních spekter. Bylo nalezeno celkem 23 modifikací IMA, přičemž nejvíce zastoupené byly oxidace - 11 metabolitů, oxidace s demethylací - 12 metabolitů a dioxidace - 13 metabolitů (tabulka 4.1). Strana 37

38 Tabulka 4.1: Metabolity IMA nalezené v plasmatických vzorcích pacientů s CML. Modifikace Modifikace m/z m/z posun Metabolit Imatinib Imatinib + glukuronidace +C6H8O Demethylace -CH Demethylace + glukuronidace -CH2+C6H8O Oxidace +O Oxidace + glukuronidace +O+C6H8O Demethylace + oxidace -CH2+O Demethylace + oxidace + glukuronidace -CH2+O+C6H8O Dioxidace +O Dioxidace + glukuronidace +O2+C6H8O Desaturace -H Demethylace + desaturace -CH2-H Desaturace + oxidace +O-H Desaturace + oxidace + glukuronidace +O-H2+C6H8O Dioxidace + desaturace +O2-H Dioxidace + desaturace + glukuronidace +O2-H2+C6H8O Oxidace + hydrolýza +H2O Oxidace + hydrolýza + glukuronidace +H2O2+C6H8O Methylace +CH Oxidace + methylace +CH2O Demethylace + desaturace + oxidace +O-CH2-H Demethylace + desaturace + oxidace + +O-CH2- glukuronidace H2+C6H8O Glycinová konjugace -OH+C2H4NO Glukuronidace + dekarboxylace +C5H8O Separace na sub-2um koloně poskytovala velmi vysokou separační účinnost, díky čemuž jsme získali chromatografickou separaci množství metabolitů. Tento separační systém v kombinaci s MS detekcí dosáhl citlivost až 0.1 nmol/l, což je z části dáno také vhodnou strukturou IMA. Typická separace metabolitů v separačním okně 7-14 min je zobrazena na obrázku 4.1. Metabolity byly změřeny v rozmezí čtyř řádů (2x10e 2 1.5x10 6 ). V některých případech nedošlo k dokonalé chromatografické separaci metabolitů, ale díky rozdílům v Strana 38

39 MS 2 fragmentačních spektrech byly od sebe odlišeny. Dalšími faktory komplikující identifikace metabolitů byly fragmentace metabolitů v iontovém zdroji (např. přítomnost píků odpovídající glukuronidovaným metabolitům č v extrahovaném chromatogramu oxidovaného metabolitu (f)) anebo elektrochemické děje v iontovém zdroji, které jsou sice obvykle přítomny v méně než 0,1 % původního analytu, avšak při vysoké citlivosti Orbitrapu byly tyto pozorovány a eliminovány z potenciálních metabolizací Relativní intenzita [ % ] e) f) Čas (min) 6.83E E5 Relativní intenzita [ % ] i) j) Čas (min) 2.31E4 3.58E4 Obrázek 4.1: Extrahované iontové chromatogramy vybraných m/z odpovídající metabolizacím: oxidace (f, m/z = 510,2612), oxidace+glukuronidace (e, m/z = 686,2933), dioxidace (j, m/z = 526,2561) a dioxidace+glukuronidace (i, m/z = 702, 2882). Identity byly potvrzeny u metabolitů 1. fáze CID MS 2 fragmentačním spektrem (obrázek 4.2) a u glukuronidů (metabolity 2. fáze) byla provedena CID MS 3 fragmentace. Metabolit nejprve MS 2 fragmentací ztrácí glukuronid a pak následuje MS 3 fragmentace modifikované části samotného metabolitu. Při hledání struktury jednotlivých fragmentů měřených s vysokým rozlišením jsme s výhodou využili software Mass Frontier 7.0, který je schopen Strana 39

40 generovat struktury fragmentů jednak na základě obecných fragmentačních pravidel, ale také na základě rozsáhlé databáze reálně naměřených fragmentací publikovaných ve vědeckých pracích. V případě přítomnosti neznámých fragmentů jsme velké množství z nich identifikovali na základě posunů m/z v závislosti na příslušné metabolizaci. Relativní intenzita [ % ] N H 3 C N N ppm N H ppm N O H + F : F : F+O : N N CH ppm ppm m/z + F-H O : Relativní intenzita [ % ] N H 3 C N N N H F +O + : N O H + F : F : F-2H : ; F : ; F + : F : F+O : ppm ppm ppm ppm ppm ppm ppm 1.1 ppm 1.3 ppm ppm 2.3 ppm 1.3e3 3.0e N + F : m/z + F : N CH3 + F+O-H O : Obrázek 4.2: Ukázka MS 2 fragmentačního spektra dvou na různých místech oxidovaných metabolitů přítomných v retenčních časech 10,12 min (vlevo) a 12,31 min (vpravo). Na základě výše uvedených experimentů jsme sestrojili schéma metabolizací IMA a relativní zastoupení jednotlivých druhů metabolizací 1. a 2. fáze (Obrázek 4.3). Kalkulace je limitována faktem, že vychází z měření detailních metabolických charakteristik osmi vzorků plasem pacientů s CML. Avšak dává představu, jaké jsou hlavní metabolizační dráhy. Dále je třeba uvést, že toto schéma platí pro steady state, čili pro vzorky odebrané v čase h po poslední dávce 400 mg/den. Je zde předpoklad různé rychlosti metabolizace IMA na různé metabolity a tedy relativní zastoupení jednotlivých metabolitů se bude velmi pravděpodobně lišit, pokud vzorky budou odebírány v jiných časových intervalech. Strana 40

41 Dioxidace + desaturace + glukuronidace (0.001 %) Demethylace + desaturace +oxidace + glukuronidace (0.069 %) -H 2 +O -CH 2 -H 2 Oxidace + hydrolýza + glukuronidace (0.002 %) Dioxidace + glukuronidace (0.056 %) Oxidace + desaturace + glukuronidace (0.202 %) Demethylace + oxidace + glukuronidace (0.058 %) +H 2 O +O -H 2 -Ch 2 +O + glukuronidace (1.161 %) Oxidace/hydroxylace + glukuronidace (1.015 %) Demethylace + glukuronidace (0.077 %) glukuronidace + dekarboxylace (0.019 %) + C6H8O 6 + O + C6H 8O6 - Ch 2 + C 6 H 8 O 6 + C5H8O5 IMATINIB + CH 2 + O - CH 2 - OH + C H NO Methylace (0.100 %) Oxidace/hydroxylace (3.686 %) Demethylace (5.939 %) Glycin konjugace (0.167 %) + O + CH 2 + H 2 O + O - H 2 -Ch 2 +O - H 2 Oxidace + methylace (0.004 %) Oxidace + hydrolýza ( %) Dioxidace (0.109 %) Oxidace + desaturace (2.297 %) Demethylace + oxidace (0.197 %) Demethylace + desaturace (0.003 %) - H 2 + O -CH 2 - H 2 +O Dioxidace + desaturace (0.094 %) Demethylace + desaturace +oxidace ( %) Obrázek 4.3: Schéma metabolizace IMA v plasmě pacientů s CML. Význam této studie spočívá v aplikaci výsledků pro následné projekty, které budou zahrnovat velké skupiny vzorků pacientů, a bude sledován vztah mezi plasmatickými hladinami metabolitů a účinkem léčby, nežádoucími účinky léků či selháním léčby. Již při analýze osmi vzorků plasem jsme našli výrazné rozdíly v hladinách metabolitů. Na obrázku 4.4 je srovnání vybraných metabolizací dvou pacientů. Jsou zde vidět významné rozdíly například v profilu dioxidovaných metabolitů (metabolit č. 48 a 49) či oxidovaném metabolitu č. 15 anebo v demethylovaném/oxidovaném metabolitu č. 22. Strana 41

42 IMA IMA a) 4.44E7 a) 1.40E7 4 4 Relativní intenzita [ % ] b) c) d) e) f) Čas (min) E6 6.11E E5 d) E e) E4 f) 0 Relativní intenzita [ % ] b) c) Čas (min) 5.64E5 1.28E5 1.82E5 5.46E3 1.52E3 Obrázek 4.4: Metabolické profily dvou různých pacientů na dávce IMA 400 mg/den (krev odebrána 24 h po dávce). Analýzy reprezentují extrahované iontové chromatogramy pro vybrané metabolizace: (a) IMA, m/z 494,2663, (b) demethylace, m/z 480,2506, (c) oxidace, m/z 510,2612, (d) desaturace+oxidace, m/z , (e) demethylace+oxidace, m/z 496,2455 a (f) dioxidace, m/z Strana 42

43 5 Metabolomické profilování pacientů s chronickou myeloidní leukémií Metabolomika hraje v posledních dekádě významnou roli v klinickém výzkumu a přispívá na jedné straně k hledání nových biomarkerů a na druhé straně k pochopení patobiochemických procesů v biologických systémech (např. buňkách, krvi). Metabolomický přístup zahrnuje celou řadu kroků a vyžaduje interdisciplinární spolupráci lékařů, biochemiků, analytických chemiků a statistiků. V posledních letech byla publikována řada prací zaměřená na studium metabolomických profilů u akutních forem leukémie. U pacientů s akutní myeloidní leukemií byly v séru identifikovány diskriminující metabolity v metabolismu glukosy (např. citrát, laktát, glycerol-3-fosfát) cílenou metabolomickou metodou na GC/TOF [66]. Jiná studie pacientů s akutní myeloidní leukemií prezentovala stejně jako výše uvedená studie změny v glykolýze, citrátovém cyklu a navíc v biosyntéze proteinů, metabolismu mastných kyselin a komponent buněčných membrán [67]. U dětí s akutní lymfoblastickou leukémií byly v séru nalezeny nejvíce diskriminující fosfolipidy necílenou RP-LC/TOF metodou [68]. Druhá studie na akutní lymfoblastickou leukémii ukázala odlišné metabolické změny v acylovaných karnitinech a mastných kyselinách i přesto, že byla použita velmi obdobná necílená metabolomická metoda analýzy založená na systému RP-LC/TOF [69]. Ve spolupráci s Hematoonkologickou klinikou, FN Olomouc byla cílená metabolomika založená na metodě LC/MS aplikována na soubor pacientů s CML [70]. Během tří let byly sbírány plasmy a leukocyty od nově diagnostikovaných pacientů (ND), pacientů na léčbě hydroxyureou (HU), IMA, DAS, NIL a zdravých kontrol (CON). Tyto skupiny vzorků byly analyzovány metodou, která zahrnuje více než 350 metabolitů běžně přítomných v biologických tekutinách či buněčných extraktech (modifikace metody dle [26]). Pro separaci se využívá vodná normální fáze na koloně s aminopropylovými skupinami, které poskytují v alkalickém prostředí interakce s negativními funkčními skupinami analytů. Strana 43

44 Tento přístup umožňuje v jedné analýze separovat a široké spektrum metabolitů organické kyseliny, aminokyseliny, purinové a pyrimidinové báze, ribosidy a nukleotidy, acylované karnitiny, mastné kyseliny a další (obrázek 5.1). Ve spojení s posledními generacemi trojitých kvadrupólů je možno za pomocí krátkých času měření (méně než 5 ms), vybraných časových oken (scheduled MRM) a rychlého přepínání polarity v jedné analýze separovat stovky metabolitů. Negativní stránkou tohoto přístupu je významně nižší citlivost z důvodu obrácení gradientu mobilní fáze (z acetonitrilu do vodného pufru) ve srovnání s reverzní fází. Také vysoké alkalické ph (9,75) má negativní vliv na citlivost. Tyto efekty jsou nicméně kompenzovány výrazným nárůstem citlivosti trojitých kvadrupólů. báze a ribosidy nukleotid mono, di a trifosfáty aminokyseliny acylkarnitiny ESI-, int: 2.9e5 ESI+, int: 4.2e Čas [min] ESI+, int: 2.6e Čas [min] ESI+, int: 8.5e Čas [min] Obrázek 5.1: Cílená metabolomická analýza extraktu leukocytů nově diagnostikovaného pacienta; ukázky separace skupin metabolitů v jedné analýze. LC/MS cílenou metabolomickou metodou bylo změřeno více než 300 analýz zahrnující vzorky plasem a leukocytů studovaných skupin, vzorky vnitřní kontroly kvality a blanky. V leukocytech bylo nalezeno 149 metabolitů a v plasmě 124 metabolitů, které byly podrobeny následnému zpracování dat a statistickému vyhodnocení. V tabulce 5.1 jsou uvedeny počty vzorků použitých pro vyhodnocení. Strana 44

45 Tabulka 5.1: Počty vzorků pacientů a kontrol zahrnutých do vyhodnocení. Skupiny CON ND IMA NIL DAS HU Celkem Plasma (*6) Leukocyty (*6) * skupina pacientů se selháním léčby nebo suboptimální odpovědí Chromatografické píky odpovídající příslušným metabolitům byly integrovány (MultiQuant 3.0, AB Sciex) a jejich plochy byly použity pro následné statistické zpracování dat. Dle definovaného pořadí vzorků v sérii byla aplikována korekce dat na vzorky kontroly kvality metodou LOESS (LOcally WEighted Scatter-plot Smoother) pro odstranění vlivu systematických změn v intenzitách metabolitů v průběhu analýz. Příčiny jsou obvykle ve změnách chromatografického chování a především v postupné ztrátě citlivosti hmotnostního spektrometru z důvodu přítomných solí, proteinů a lipidů. Z dalšího procesování byly vyloučeny metabolity, které i po LOESS korekci vykazovaly vysokou variabilitu v vzorcích kontroly kvality (CV > 30%). Následně byla data zpracována jako kompoziční - byla použita Clr transformace (centered logratio) a centrování. Pro jednorozměrnou statistickou analýzu byl zvolen t-test s Bonferroniho korekcí. Vzhledem k povaze dat byly aplikovány mnohorozměrné statistické metody - nesupervizovaná analýza hlavních komponent (PCA) a supervizovaná ortogonální diskriminační analýza nejmenších čtverců (OPLS-DA). PCA obecně poskytuje informaci o struktuře dat, rozdíly a podobnosti mezi vzorky bez znalosti příslušnosti k jednotlivým skupinám. Nalezení shlukujících se skupin a následně diferencujících metabolitů v PCA má zásadní význam, protože to ukazuje na významné rozdíly mezi vzorky/skupinami. PCA aplikovaná na vzorky CML studie ukazuje významné rozdíly mezi skupinami ND + HU a CON + IMA + NIL + DAS. Příčina shody metabolického profilu mezi ND a HU je v cytostatickém účinku hydroxyurey, která především snižuje počty leukemických buněk na principu suprese DNA syntézy. Rozdělení skupin v PCA je významnější u leukocytů ve srovnání s plasmou, což je podpořeno procentuálním vysvětlením modelů (52 % vs. 34 %). Můžeme tedy očekávat větší ovlivnění Strana 45

46 PC2 14.5% PC % metabolomu leukocytů (obrázek 5.2). Samotnou skupinu tvoří v PCA leukocytů skupina DAS, která je v oblasti mezi skupinami ND+HU a ostatními. Toto může ukazovat na širší mechanismus účinku léčby DAS ve srovnání s IMA a NIL. A B PC %; Kumulativně = 51.82% Pc %; Kumulativně = 33.94% Obrázek 5.2: PCA leukocytů (A) a plasmy (B); CON - ; ND - ; IMA - ; DAS -, NIL - ; HU -. Elipsy reprezentují oblast III. kvartilu. Diskriminační analýza založená na OPLS-DA dokáže najít diferencující metabolity charakteristické pro příslušnou skupinu. Její relativní nevýhoda spočívá v omezení srovnání pouze dvou skupin. Pro vyhodnocení se používají S-ploty, které vycházejí z kovariance (x-osa) a korelace (y-osa). Metabolity s nejvyššími absolutními hodnotami na ose x a y jsou nejvíce diferencující. Na obrázku 5.3 jsou vyobrazeny S-ploty srovnání skupin ND a CON v leukocytech a plasmě. Strana 46

47 A CAIr ccmp ornithine isoleucine_alloile propionylglycine glycine myoinositol homocysteine 0.6 S-adenosylmethionine tyrosine pcorr aspartate ADP cytidine glycerate-3-phosphate nicotinamide mononucleotide guanosine adenylylsulfate IMP C14:2OH IDP p1 B xanthine orotic acid CAIr aminoisobutyrate C5DC_C6OH pseudouridine C3DC_C4OH NN-dimethylarginine gluconate methylguanine pcorr tryptophan methionine homoarginine histidine tyrosine homocysteine valine phenylserine arginine guanidinoacetate -1.0 Obrázek 5.3. S-ploty vzorků leukocytů (A) a plasem (B) srovnávající skupiny ND a CON. Přiblížení oblastí v boxech zobrazuje nejvíce diskriminující metabolity. Jednorozměrné statistické metody jsou graficky nejlépe prezentovány krabicovými grafy, které detailně zobrazují distribuci dat jednotlivých skupin a jejich rozdíly Na obrázku 5.4 jsou zobrazeny krabicové grafy vybraných metabolitů a jejich propojení s metabolickými drahami. Strana 47

48 Glycine Glucose6phosphate_fructose6phosphate glucose1phosphate_galactose1phosphate 2-Oxoglutarate Isocitrate Succinyl-CoA Aconitate Succinate_methylmalonate Con Nd Nil Das Ima Hu Serine Con Nd Nil Das Ima Hu Con Nd Nil Das Ima Hu Fructose-1,6-bisphosphate Glyceraldehyde-3-phosphate 1,3-Bisphosphoglycerate Glycerate-3-phosphate G L Y K O L Ý Z A Con Nd Nil Das Ima Hu Citrate_isocitrate CITRÁTOVÝ CYKLUS Con Nd Nil Das Ima Hu Fumarate_capr oic acid_ 3-meth yl-2-oxobutanoate Con Nd Nil Das Ima Hu Con Nd Nil Das Ima Hu BIOSYNTÉZA GLYCINU/SERINU Con Nd Nil Das Ima Hu Glycerate-2-phosphate AcetylCoA Oxaloacetate_glutarate_eth ylmalonate Malate Phosphoenolpyruvate Con Nd Nil Das Ima Hu Con Nd Nil Das Ima Hu Pyruvate Con Nd Nil Das Ima Hu Aspartate CAIr PURINOVÁ BIOSYNTÉZA Con Nd Nil Das Ima Hu Con Nd Nil Das Ima Hu Obrázek 5.4: Krabicové grafy inkorporované do metabolických drah pro vybrané metabolity přítomné v leukocytech. Při srovnání skupin ND a CON jsou v leukocytech vidět signifikantní změny v nukleotidovém metabolismu na všech úrovních bází, ribosidů a nukleotidů. Zvýšená hladina meziproduktu purinové de novo syntézy (CAIr) v leukocytech i v plasmě ukazuje na zvýšený obrat této dráhy v případě skupiny ND. Naopak hladiny energeticky bohatých purinových nukleotidů jsou sníženy pravděpodobně z důvodu jejich vyčerpání v onkogenních leukocytech s rychlým metabolickým obratem. Obdobně ukazuje snížený 3-fosfoglycerát v leukocytech na vysokou spotřebu metabolitů glykolytické dráhy (obrázek 5.3). Změny v transportu glukosy u leukemických buněk z důvodu translokace glukosových transportérů (GLUT-1) do membrán [71] jsou prezentovány na úrovni metabolitů zvýšenou hladinou glukosa-1/6-fosfátu a naopak mírným snížením glukosy v plasmě u skupiny ND (obrázek 5.4). Strana 48

49 U skupiny ND byla pozorována významně snížená hladina citrátu a částečně dalších intermediátů citrátového cyklu v leukocytech, což pravděpodobně souvisí se snížením mitochondriální dostupnosti acetyl-coa (prekurzor citrátu) z důvodu inaktivace pyruvát dehydrogenasy [72]. Aktivovaná signální dráha PI3K/Akt/mTOR v leukemických buňkách zvyšuje transport nutričně významných látek (včetně aminokyselin [73]), což potvrzují zvýšené hladiny většiny aminokyselin v leukocytech u skupiny ND při současném mírném snížení v plasmě. Výjimkou je aspartát, který je významně snížený u skupiny ND, což může mít souvislost se spotřebou této aminokyseliny v purinové a pyrimidinové de novo syntetické dráze a omezeným přístupem do buňky [74] (obrázek 5.4). V projektu byly také sledovány změny v metabolických profilech u pacientů léčených IMA dle molekulární odpovědi na léčbu (obrázek 5.5). V S-plotu lze sledovat trend zvýšených hladin aminokyselin a snížených hladin acylovaných karnitinů o střední délce řetězce v leukocytech u neodpovídajících pacientů. V plasmě je trend u výše uvedených skupin metabolitů opačný. Na základě hodnot x-osy S-plotu lze vyhodnotit, že tento fenomén je významnější u leukocytů (2x větší hodnoty na ose x). Experiment však byl proveden na limitovaném množství pacientů a je nezbytné jej ověřit v dalších studiích. Metabolomika pacientů s CML ukazuje potenciál multikomponentní analýzy širokého spektra metabolitů při vysvětlení patobiochemických dějů a má potenciál v hledání nových diagnosticky využitelných biomarkerů. Strana 49

50 pcorr1 pcorr1 A oxoproline lysine alanine phenylserine guanidinobutanoate homocysteine citrulline proline threonine tyrosine C6:1 C14 C12 C4 C10 C12:1 C8 C2DC_C3OH C6-1.0 p1 B C7DC_C8OH C10:2 C16: C12:1 C14:2 C6 C14:1 C C10 C8 C10: oxoproline alanine aparagine glutamine AICAr methionine tyrosine homocysteine isoleucine/allole dihydrouracil -1.0 p1 Obrázek 5.5: S-ploty (OPLS-DA) vzorků leukocytů (A) a plasem (B) pacientů léčených IMA s optimální odpovědí ve srovnání s pacienty se suboptimální odpovědí či selháním léčby. Strana 50

51 6 Závěr Ultra vysokoúčinná kapalinová chromatografie ve spojení s tandemovou hmotnostní spektrometrií poskytuje v současné době efektivní kombinaci pro analýzu léků. S využitím této techniky byla optimalizována citlivá a rychlá metoda pro stanovení čtyř TKI v plasmě. Byl dosažena vysoká robustnost při čase analýzy 2 minuty. Metoda byla zavedena do rutinní praxe a za dobu 6 let bylo analyzováno více než 4000 vzorků plasem pacientů s CML ročně. Zlepšení v citlivosti, rychlosti a robustnosti tandemové hmotnostní spektrometrie na principu trojitého kvadrupólu umožnilo aplikovat metody izotopového zřeďování ve spojení s hmotnostním spektrometrem bez použití separačního systému a tím výrazně zkrátit dobu potřebnou pro analýzu jednoho vzorku. Byly vyvinuty vysoko průstupné metody pro stanovení imatinibu v plasmě s časem analýzy 45 sekund a metoda pro stanovení čtyř TKI v plasmě s časem analýzy až 19 sekund. Vzhledem k matricovým vlivům je citlivost metody snížena téměř o jeden řád. Pro stanovení dasatinibu, který se vyznačuje nízkými plasmatickými hladinami, byla využita lineární iontová past pro tzv. MRM 3 mód, který poskytnul téměř o dva řády lepší citlivost ve srovnání s běžným MRM módem. Online uspořádání extrakce na pevné fázi ve spojení s hmotnostní spektrometrií je perspektivní alternativou k izotopovému zřeďování. Přístup byl aplikován pro stanovení tří TKI - imatinibu, nilotinibu a lapatinibu, pro které metoda vykazovala dostatečnou citlivost. Vzhledem k vysoké afinitě vybraných léků ke stacionární fázi byla metoda optimalizována s délkou analýzy 29 sekund. Za těchto podmínek metoda splňuje všechny validační parametry. Výše uvedené vysoko průstupné metody poskytují alternativní přístupy stanovení TKI k široce používané UHPLC/MS. Po optimalizaci mohou být metody aplikovány pro monitorování hladin dalších skupin léků. Metabolizace léků představuje i v současné době poměrně neprobádanou oblast. Ultra vysokoúčinná kapalinová chromatografie ve spojení s vysoko rozlišující hmotnostní spektrometrií byla využita pro identifikaci nových metabolitů imatinibu v plasmě pacientů Strana 51

52 s CML. Bylo nalezeno 90 metabolitů první a druhé biotransformační fáze, z nichž u většiny byla potvrzena identita MS 2 a MS 3 fragmentačními experimenty. Byly sledovány změny v profilech metabolitů imatinibu u pacientů. Metabolomika umožňuje studium vlivu léků na hladiny endogenních či exogenních metabolitů v biologických vzorcích. Byly sledovány změny v metabolitech u nově diagnostikovaných pacientů a pacientů na léčbě hydroxyureou a TKI za pomocí cílené metabolomiky založené na LC/MS analýze, která detekovala 149 metabolitů v leukocytech a 124 metabolitů v plasmě. Data byla procesována, transformována a následně vyhodnocena jednorozměrnými a vícerozměrnými statistickými metodami. Byly nalezeny statisticky významné změny v glykolýze, citrátovém cyklu a purinovém metabolismu. Změny v metabolických drahách přispěly k pochopení mechanismu účinku a vlivu TKI na buněčný metabolom leukemických buněk. Při srovnání dvou skupin pacientů léčených imatinibem s dobrou a suboptimální odpovědí byly sledovány rozdíly v metabolismu acylovaných karnitinů a aminokyselin. Strana 52

53 7 Výhledy Výsledky metabolomického profilování leukocytů a plasem u pacientů s CML budou využity jako pilotní pro plánovaný multicentrický projekt zahrnující spolupráci s dalšími hematoonkologickými pracovišti v ČR (Praha, Brno, Hradec Králové, Plzeň, Ostrava). Metody budou zahrnovat cílenou i necílenou metabolomiku a cílenou lipidomiku za pomocí LC/MS a GC/MS technologií. Budou studovány početné skupiny pacientů léčených jednotlivými TKI a sledována souvislost metabolomických profilů s odpovědí na léčbu, vznikem rezistence a přítomností nežádoucích účinků. Metabolomické analýzy budou dále využity pro hledání nových charakteristických biomarkerů onemocnění. Druhou oblastí je studium transportních mechanismů TKI v leukocytech. Ve spolupráci s Ústavem pro hematologii a krevní transfuzi (UHKT, Praha) budou stanovovány intracelulární hladiny imatinibu v buněčných liniích s různým stupněm rezistence na léčbu. Výsledky experimentů budou aplikovány na leukocyty pacientů a bude sledována souvislost hladin imatinibu s klinickým stavem. Imatinib je v játrech metabolizován na množství metabolitů, které lze identifikovat v plasmě pacientů s CML. Za pomocí hmotnostní spektrometrie s vysokým rozlišením bude další výzkum směřován do identifikace metabolitů TKI v leukemických buňkách, které jsou přímým cílem TKI. Výzvu bude také představovat objasnění případné toxicity či účinku těchto metabolitů a jejich vliv na léčbu. Pro hledání nových obtížně predikovatelných metabolitů TKI bude aplikován farmakometabolomický přístup, který využívá necíleného metabolomického zpracování dat. Strana 53

54 8 Seznam zkratek ANP CON CML DAS DMP FWHM GC HILIC HU IMA IS LAP LC m/z MRM MS ND NIL OPLS-DA PCA RP SPE SRM TDM TKI UHPLC vodná normální fáze kontrolní vzorky zdravých jedinců chronická myeloidní leukémie dasatinib dědičné metabolické poruchy šířka v polovin výšky plynová chromatografie hydrofilní interakční chromatografie hydroxyurea imatinib interní standard lapatinib kapalinová chromatografie poměr hmotnosti a náboje iontu monitorování vybraných reakcí hmotnostní spektrometrie nově diagnostikovaní pacienti nilotinib ortogonální diskriminační analýza nejmenších čtverců analýza hlavních komponent reverzní fáze extrakce na pevné fázi monitorování vybrané reakce terapeutické monitorování hladin inhibitory tyrosinové kinasy ultra vysokoúčinná kapalinová chromatografie Strana 54

55 9 Seznam použité literatury 1) Harmon D. E. (editor): Leukemia: Current and Emerging Trends in Detection and Treatment. The Rosen Publishing Group-USA, New York (ISBN: ) 2) Lugo T. G., Pendergast A. M., Muller A. J., Witte O. N.: Tyrosine kinase activity and transformation potency of bcr-abl oncogene products. Science 247, (1990). 3) ( ) 4) Faderl S., Talpaz M., Estrov Z., Kantarjian H. M.: Chronic myelogenous leukemia: Biology and therapy. Ann. Intern. Med. 131, (1999). 5) Savage D. G., Szydlo R. M., Goldman J. M.: Clinical features at diagnosis in 430 patients with chronic myeloid leukemia seen at a referral centre over a 16-year period. Br. J. Haematol. 96, (1997). 6) Brincker H. Population-based age- and sex-specific incidence rates in the 4 main types of leukaemia. Scand J Haematol. 29, (1982). 7) Druker B. J., Tamura S., Buchdunger E., Ohno S., Segal G. M., Fanning S., Zimmermann J., Lydon N. B.: Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat. Med. 2, (1996). 8) Namsu L., Kyoung H. K., Sang-Cheol L.: Oral chemotherapeutic agents in current use. J. Korean. Med. Assoc. 54, (2011). 9) Faber E, Indrák K et al. Chronická myeloidní leukemia. Galén-ČR, Praha (ISBN ) 10) ( ) 11) Layne J., Lomas S.: Maximising Core-Shell Performance on Conventional HPLC Systems. Chromatography Today. May/June, (2012). 12) Sweetman L.: Organic acid analysis. In: Hommes F. A. (editor): Techniques in Diagnostic Human Biochemical Genetics Wiley-Liss-USA, New York ) Aubourg P., Bougneres P. F., Rocchiccioli F.: Capillary gas-liquid chromatographicmass spectrometric measurement of very long chain (C22 to C26) fatty acids in microliter samples of plasma. J. Lipid. Res. 26, (1985). 14) Chace D. H., Millington D. S., Terada N., Kahler S. G., Roe C. R., Hofman L. F.: Rapid diagnosis of phenylketonuria by quantitative analysis for phenylalanine and tyrosine in neonatal blood spots by tandem mass spectrometry. Clin. Chem. 39, (1993). 15) Rashed M. S., Ozand P. T., Bucknall M. P., Little D.: Diagnosis of inborn errors of metabolism from blood spots by acylcarnitines and amino acids profiling using Strana 55

56 automated electrospray tandem mass spectrometry. Pediatr. Res. 38, (1995). 16) Nagy K., Takáts Z., Pollreisz F., Szabó T., Vékey K.: Direct tandem mass spectrometric analysis of amino acids in dried blood spots without chemical derivatization for neonatal screening. Rapid. Commun. Mass Spectrom. 17, (2003). 17) De Jesús V. R., Chace D. H., Lim T. H., Mei J. V., Hannon W. H.: Comparison of amino acids and acylcarnitines assay methods used in newborn screening assays by tandem mass spectrometry. Clin. Chim. Acta. 411, (2010). 18) Oglesbee D., Sanders K. A., Lacey J. M., Magera M. J., Casetta B., Strauss K. A., Tortorelli S., Rinaldo P., Matern D.: Second-tier test for quantification of alloisoleucine and branched-chain amino acids in dried blood spots to improve newborn screening for maple syrup urine disease (MSUD). Clin. Chem 54, (2008). 19) Turgeon C. T., Magera M. J., Cuthbert C. D., Loken P. R., Gavrilov D. K., Tortorelli S., Raymond K. M., Oglesbee D., Rinaldo P., Matern D.: Determination of total homocysteine, methylmalonic acid, and 2-methylcitric acid in dried blood spots by tandem mass spectrometry. Clin. Chem. 56, (2010). 20) la Marca G., Malvagia S., Pasquini E., Innocenti M., Donati M. A., Zammarchi E.: Rapid 2nd-tier test for measurement of 3-OH-propionic and methylmalonic acids on dried blood spots: Reducing the false-positive rate for propionylcarnitine during expanded newborn screening by liquid chromatography-tandem mass spectrometry. Clin. Chem. 53, (2007). 21) Dietzen D. J., Weindel A. L., Carayannopoulos M. O., Landt M., Normansell E. T., Reimschisel T. E., Smith C.H.: Rapid comprehensive amino acid analysis by liquid chromatography / tandem mass spectrometry: comparison to cation exchange with post-column ninhydrin detection. Rapid. Commun. Mass Spectrom. 22, (2008). 22) Le A., Ng A., Kwan T., Cusmano-Ozog K., Cowan T. M.: A rapid, sensitive method for quantitative analysis of underivatized amino acids by liquid chromatographytandem mass spectrometry (LC-MS/MS). J Chromatogr. B: Analyt. Technol. Biomed. Life Sci. 944, (2014). 23) Hartmann S., Okun J. G., Schmidt C., Langhans C. D., Garbade S. F., Burgard P., Haas D., Sass J. O., Nyhan W. L., Hoffmann G.F.: Comprehensive detection of disorders of purine and pyrimidine metabolism by HPLC with electrospray ionization tandem mass spectrometry. Clin. Chem. 52, (2006). 24) Haas D., Gan-Schreier H., Langhans C. D., Anninos A., Haege G., Burgard P., Schulze A., Hoffmann G. F., Okun J. G.: Diagnosis and therapeutic monitoring of inborn errors of creatine metabolism and transport using liquid chromatography-tandem mass spectrometry in urine, plasma and CSF. Gene. 538, (2014). Strana 56

57 25) Peng M., Fang X., Huang Y., Cai Y., Liang C, Lin R., Liu L.: Separation and identification of underivatized plasma acylcarnitine isomers using liquid chromatography-tandem mass spectrometry for the differential diagnosis of organic acidemias and fatty acid oxidation defects. J. Chromatogr. A. 1319, (2013). 26) Bajad S. U., Lu W., Kimball E. H., Yuan J., Peterson C., Rabinowitz J. D.: Separation and quantitation of water soluble cellular metabolites by hydrophilic interaction chromatography-tandem mass spectrometry. J. Chromatogr. A. 1125, (2006). 27) Taylor P. J.: Matrix effects: the Achilles heel of quantitative high-performance liquid chromatography-electrospray-tandem mass spectrometry. Clin. Biochem. 38, (2005). 28) ( ) 29) El-Khoury J. M., Reineks E. Z., Wang S.: Progress of liquid chromatography-mass spectrometry in measurement of vitamin D metabolites and analogues. Clin. Biochem. 44, (2011). 30) Taylor A. E., Keevil B., Huhtaniemi I. T.: Mass spectrometry and immunoassay: how to measure steroid hormones today and tomorrow. Eur. J. Endocrinol. 173, D1-12 (2015). 31) Cheng K., Chui H., Domish L., Hernandez D., Wang G.: Recent development of mass spectrometry and proteomics applications in identification and typing of bacteria. Proteomics Clin. Appl. 10, (2016). 32) Maurer H. H.: What is the future of (ultra) high performance liquid chromatography coupled to low and high resolution mass spectrometry for toxicological drug screening? J. Chromatogr. A. 1292, (2013). 33) Rodríguez-Flores J., Berzas J. J., Castaneda G., Rodríguez N.: Direct and fast capillary zone electrophoretic method for the determination of Gleevec and its main metabolite in human urine. J. Chromatogr. B: Analyt. Technol. Biomed. Life Sci. 794, (2003). 34) Rodríguez-Flores J., Berzas Nevado J. J., Contento Salcedo A. M., Cabello Díaz M. P.: Nonaqueous capillary electrophoresis metod for the analysis of gleevec and its main metabolite in human urine. J. Chromatogr. A. 1068, (2005). 35) Widmer N., Béguin A., Rochat B., Buclin T., Kovacsovics T., Duchosal M. A., Leyvraz S., Rosselet A., Biollaz J., Decosterd L. A.: Determination of imatinib (Gleevec) in human plasma by solid-phase extraction-liquid chromatography-ultraviolet absorbance detection. J. Chromatogr. B: Analyt. Technol. Biomed. Life Sci. 803, (2004). 36) Vivekanand V. V., Sreenivas Rao D., Vaidyanathan G., Sekhar N. M., Avijit Kelkar S., Ramachandra Puranik P.: A validated LC method for imatinib mesylate. J Pharm. Biomed. Anal. 33, (2003). Strana 57

58 37) Pursche S., Ottmann O. G., Ehninger G., Schleyer E.: High-performance liquid chromatography with ultraviolet detection for the quantification of the BCR-ABL inhibitor nilotinib (AMN107) in plasma, urine, culture medium and cell preparations. J. Chromatogr. B: Analyt. Technol. Biomed. Life. Sci. 852, (2007). 38) De Francia S., D Avolio A., De Martino F., Pirro E., Baietto L., Siccardi M., Simiele M., Racca S., Saglio G., Di Carlo F., Di Perri G.: New HPLC-MS method for the simultaneous quantification of the antileukemia drugs imatinib, dasatinib and nilotinib in human plasma. J. Chromatogr. B: Analyt. Technol. Biomed. Life Sci. 877, (2009). 39) Haouala A., Zanolari B., Rochat B., Montemurro M., Zaman K., Duchosal M. A., Ris H. B., Leyvraz S., Widmer N., Decosterd L. A.: Therapeutic Drug Monitoring of the new targeted anticancer agents imatinib, nilotinib, dasatinib, sunitinib, sorafenib and lapatinib by LC tandem mass spectrometry. J. Chromatogr. B: Analyt. Technol. Biomed. Life Sci. 877, (2009). 40) Andriamanana I., Gana I., Duretz B., Hulin A.: Simultaneous analysis of anti- cancer agents bortezomib, imatinib, nilotinib, dasatinib, erlotinib, lapatinib, sorafenib, sunitinib and vandetanib in human plasma using LC/MS/MS. J. Chromatogr. B: Anal. Technol. Biomed. Life Sci. 926, (2013). 41) Hsieh Y., Galviz G., Zhou Q., Duncan C.: Hydrophilic interaction liquid chromatography/tandem mass spectrometry for the simultaneous determination of dasatinib, imatinib and nilotinib in mouse plasma. Rapid Commun. Mass Spectrom (2009). 42) Mičová K., Friedecký D., Polynková A., Faber E., Adam T.: Stanovení hladiny tyrosinkinasových inhibitorů metodou UHPLC-MS/MS. Chem. Pap. 104, s31 s34 (2010). 43) Rebollido-Fernandez M. M., Castiñeiras D. E., Bóveda M. D., Couce M. L., Cocho J., Fraga J. M.: Development of electrospray ionization tandem mass spectrometry methods for the study of a high number of urine markers of inborn errors of metabolism. Rapid Commun. Mass Spectrom. 26, (2012). 44) Pitt J. J., Eggington M., Kahler S. G.: Comprehensive screening of urine samples for inborn errors of metabolism by electrospray tandem mass spectrometry. Clin. Chem. 48(11), (2002) 45) Fuhrer T., Heer D., Begemann B., Zamboni N.: High-throughput, accurate mass metabolome profiling of cellular extracts by flow injection-time-of-flight mass spectrometry. Anal. Chem. 83(18), (2011). 46) González-Domínguez R., García-Barrera T., Vitorica J., Gómez-Ariza J. L.: Application of metabolomics based on direct mass spectrometry analysis for the elucidation of altered metabolic pathways in serum from the APP/PS1 transgenic model of Alzheimer's disease. J. Pharm. Biomed. Anal. 107, (2015). Strana 58

59 47) Draper J., Lloyd A. J., Goodacre R., Beckmann M.: Flow infusion electrospray ionisation mass spectrometry for high throughput, non-targeted metabolite fingerprinting: a review. Metabolomics, 9(S1), 4 29 (2012) 48) Mičová K., Friedecký D., Faber E., Polýnková A., Adam T. Flow injection analysis vs. ultra high performance liquid chromatography coupled with tandem mass spectrometry for determination of imatinib in human plasma. Clin. Chim. Acta. 411(23-24), (2010). 49) Mičová K., Friedecký D., Faber E., Adam T.: Isotope dilution direct injection mass spectrometry method for determination of four tyrosine kinase inhibitors in human plasma. Talanta. 93, (2012). 50) Cesari N., Fontana S., Montanari D., Braggio S.: Development and validation of a high-throughput method for the quantitative analysis of D-amphetamine in rat blood using liquid chromatography/ms3 on a hybrid triple quadrupole-linear ion trap mass spectrometer and its application to a pharmacokinetic study. J. Chromatogr. B: Analyt. Technol. Biomed. Life Sci. 878, (2010). 51) Wright M. J., Thomas R. L., Stanford P. E., Horvath A. R.: Multiple reaction monitoring with multistage fragmentation (MRM3) detection enhances selectivity for LC-MS/MS analysis of plasma free metanephrines. Clin. Chem. 61(3), (2015). 52) Jian W., Romm M. V., Edom R. W., Miller V. P., LaMarr W. A., Weng N.: Evaluation of a high-throughput online solid phase extraction-tandem mass spectrometry system for in vivo bioanalytical studies. Anal. Chem. 83, (2011). 53) Grote-Koska D., Czajkowski S., Brand K.: Performance of the New RapidFire System for Therapeutic Monitoring of Immunosuppressants. Ther. Drug Monit. 37, (2015). 54) Danso D., Jannetto P. J., Enger R. Langman L. J.: High-Throughput Validated Method for the Quantitation of Busulfan in Plasma Using Ultrafast SPE-MS/MS. Ther. Drug. Monit. 37, (2015). 55) Shimada T., Kelly J., LaMarr W. A., van Vlies N., Yasuda E., Mason R. W., Mackenzie W., Kubaski F., Giugliani R., Chinen Y., Yamaguchi S., Suzuki Y., Orii K. E., Fukao T., Orii T., Tomatsu S.: Novel heparan sulfate assay by using automated highthroughput mass spectrometry: Application to monitoring and screening for mucopolysaccharidoses. Mol. Genet. Metab. 113, (2014) 56) Vrobel I., Janečková H., Faber E., Bouchalová K., Mičová K., Friedecký D., Adam T.: Ultra-fast online SPE-MS/MS method for quantification of three tyrosine kinase inhibitors in human plasma. Přijato k publikaci v Ther. Drug Monit. 57) Picard S., Titier K., Etienne G., Teilhet E., Ducint D., Bernard M. A., Lassalle R., Marit G., Reiffers J., Begaud B., Moore N., Molimard M., Mahon F.X.: Trough imatinib plasma levels are associated with both cytogenetic and molecular responses to standard-dose imatinib in chronic myeloid leukemia. Blood. 109, (2007). Strana 59

60 58) Larson R. A., Druker B. J., Guilhot F., O'Brien S. G., Riviere G. J., Krahnke T., Gathmann I., Wang Y., IRIS (International Randomized Interferon vs STI571) Study Group: Imatinib pharmacokinetics and its correlation with response and safety in chronic-phase chronic myeloid leukemia: a subanalysis of the iris study. Blood. 111, (2008). 59) Golabchifar A. A., Rezaee S., Ghavamzadeh A., Alimoghaddam K., Dinan N. M., Rouini M. R.: Population pharmacokinetics of imatinib in Iranian patients with chronic-phase chronic myeloid leukemia. Cancer Chemother. Pharmacol. 74, (2014). 60) Faber E., Friedecký D., Mičová K., Rožmanová S., Divoká M., Jarošová M., Indrák K., Adam, T.: Imatinib trough plasma levels do not correlate with the response to therapy in patients with chronic myeloid leukemia in routine clinical setting. Ann. Hematol. 91(6), (2012). 61) Faber E., Friedecký D., Mičová K., Divoká M., Katrincsáková B., Rozmanová S., Jarosová M., Indrák K., Adam T.: Imatinib dose escalation in two patients with chronic myeloid leukemia, with low trough imatinib plasma levels measured at various intervals from the beginning of therapy and with suboptimal treatment response, leads to the achievement of higher plasma levels and major molecular response. Int. J. Hematol. 91(5), (2010). 62) Gschwind H.P., Pfaar U., Waldmeier F., Zollinger M.,Sayer C., Zbinden P., Hayes M., Pokorny R., Seiberling M., Ben-Am M., Peng B., Gross G.: Metabolism and disposition of imatinib mesylate in healthy volunteers. Drug Metab. Dispos. 33, (2005). 63) Marull M., Rochat B.: Fragmentation study of imatinib and characterization of new imatinib metabolites by liquid chromatography-triple-quadrupole and linear ion trap mass spectrometers. J. Mass Spectrom. 41, (2006) 64) Rochat B., Fayet A., Widmer N., Lahrichi S.L., Pesse B., Décosterd L.A., Biollaz J.: Imatinib metabolite profiling in parallel to imatinib quantification in plasma of treated patients using liquid chromatography-mass spectrometry, J. Mass Spectrom. 43, (2008). 65) Friedecký D., Mičová K., Faber E., Hrdá M., Široká J., Adam T.: Detailed study of imatinib metabolization using high-resolution mass spectrometry. J. Chromatogr. A. 1409, (2015). 66) Chen W.L., Wang J.H., Zhao A.H., Xu X., Wang Y. H., Chen T.L., Li J. M., Mi J. Q., Zhu Y. M., Liu Y. F., Wang Y. Y., Jin J., Huang H., Wu D. P., Li Y., Yan X. J., Li J. Y., Wang S., Huang X. J., Wang B. S., Chen Z., Chen S. J., Jia W.: A distinct glucose metabolism signature of acute myeloid leukemia with prognostic value. Blood, 124(10), (2014) 67) Wang Y., Zhang L., Chen W. L., Wang J. H., Li N., Li J. M., Mi J. Q., Zhang W. N., Li Y., Wu S.F., Jin J., Wang Y. G., Huang H., Chen Z., Chen S. J., Tang H.: Rapid diagnosis Strana 60

61 and prognosis of de novo acute myeloid leukemia by serum metabonomic analysis. J. Proteome Res. 12, (2013) 68) Bai Y., Zhang H., Sun X., Sun C., Ren L.: Biomarker identification and pathway analysis by serum metabolomics of childhood acute lymphoblastic leukemia. Clin. Chim. Acta. 436, (2014) 69) Bannur Z., Teha L.K., Hennesy T., Rosli W.R.W., Mohamadd N., Nasir A., Ankathil R., Zakaria Z.A., Baba A., Salleh M.Z.: The differential metabolite profiles of acute lymphoblastic leukaemic patients treated with 6-mercaptopurine using untargeted metabolomics approach. Clin. Biochem. 47, (2014). 70) Karliková R., Široká J., Friedecký D., Faber E., Hrdá M., Mičová K., Fikarová I., Gardlo A., Janečková H., Vrobel I., Adam T.: Metabolite profiling of the plasma and leukocytes of chronic myeloid leukamia patients. Probíhá recenzní řízení v J. Proteom Res. 71) Kominsky D. J., Klawitter J., Brown J. L., Boros L. G., Melo J. V., Eckhardt S. G., Serkova N. J.: Abnormalities in Glucose Uptake and Metabolism in Imatinib- Resistant Human BCR-ABL-Positive Cells. Clin. Cancer Res. 15, (2009). 72) Schulze, A., Downward J. Flicking the Warburg switch-tyrosine phosphorylation of pyruvate dehydrogenase kinase regulates mitochondrial activity in cancer cells. Mol Cell. 44: (2011). 73) DeBerardinis R. J., Lum J. J., Hatzivassiliou G., Thompson C. B.: The biology of cancer: Metabolic reprogramming fuels cell growth and proliferation. Cell. Metab. 7, (2008). 74) Jain M., Nilsson R., Sharma S., Madhusudhan N., Kitami T., Souza A. L., Kafri R., Kirschner M. W., Clish C. B., Mootha V. K.: Metabolite Profiling Identifies a Key Role for Glycine in Rapid Cancer Cell Proliferation. Science 336, (2012). Strana 61

62 10 Přílohy Seznam publikací tvořících přílohy habilitační práce 1) Faber, E., Friedecký, D., Micová, K., Divoká, M., Katrincsáková, B., Rozmanová, S., Jarošová, M., Indrák, K., Adam, T. Imatinib dose escalation in two patients with chronic myeloid leukemia, with low trough imatinib plasma levels measured at various intervals from the beginning of therapy and with suboptimal treatment response, leads to the achievement of higher plasma leveles. International Journal of Hematology, 91, (2010) 2) Mičová, K., Friedecký, D., Faber, E., Polýnková, A., Adam, T. Flow injection analysis vs. ultra high performance liquid chromatography coupled with tandem mass spectrometry for determination of imatinib in human plasma. Clinica Chimica Acta, 411, (2010). 3) Mičová, K., Friedecký, D., Polýnková, A., Faber, E., & Adam, T. Stanovení hladiny tyrosinkinasových inhibitorů metodou UHPLC/MS. Chemical Papers, 34, (2010). 4) Faber, E., Friedecký, D., Mičová, K., Rožmanová, S., Divoká, M., Jarošová, M., Indrák, K., Adam, T. Imatinib trough plasma levels do not correlate with the response to therapy in patients with chronic myeloid leukemia in routine clinical setting. Annals of Hematology, 91, (2012). 5) Mičová, K., Friedecký, D., Faber, E., Adam, T. Isotope dilution direct injection mass spectrometry method for determination of four tyrosine kinase inhibitors in human plasma. Talanta, 93, (2012). 6) Friedecký, D., Mičová, K., Faber, E., Hrdá, M., Široká, J., Adam, T. Detailed study of imatinib metabolization using high-resolution mass spectrometry. Journal of Chromatography A, 1409, (2015). 7) Vrobel, I., Janečková, H., Faber, E., Bouchalová, K., Mičová, K., Friedecký, D., Adam, T. Ultra-Fast Online SPE-MS/MS Method for Quantification of Three Tyrosine Kinase Inhibitors in Human Plasma. Therapeutic Drug Monitoring, (2016). (akceptováno k publikaci) 8) Karlíková, R., Široká, J., Friedecký, D., Faber, E., Hrdá, M., Mičová, K., Fikarová, I., Gardlo, A., Janečková, H., Vrobel, I., Adam, T. Metabolite profiling of the plasma and leukocytes of chronic myeloid leukemia patients. J Protem Res (2016). (zasláno k recenznímu řízení) Strana 62

63 Příloha 1 Faber, E., Friedecký, D., Micová, K., Divoká, M., Katrincsáková, B., Rozmanová, S., Jarošová, M., Indrák, K., Adam, T. Imatinib dose escalation in two patients with chronic myeloid leukemia, with low trough imatinib plasma levels measured at various intervals from the beginning of therapy and with suboptimal treatment response, leads to the achievement of higher plasma leveles. International Journal of Hematology, 91, (2010)

64 Int J Hematol (2010) 91: DOI /s y CASE REPORT Imatinib dose escalation in two patients with chronic myeloid leukemia, with low trough imatinib plasma levels measured at various intervals from the beginning of therapy and with suboptimal treatment response, leads to the achievement of higher plasma levels and major molecular response Edgar Faber David Friedecký Kateřina Mičová Martina Divoká Beata Katrincsáková Šárka Rožmanová Marie Jarošová Karel Indrák Tomáš Adam Received: 25 February 2010 / Revised: 13 April 2010 / Accepted: 14 April 2010 / Published online: 1 May 2010 Ó The Japanese Society of Hematology 2010 Abstract Despite the prognostic value of trough imatinib plasma levels (IPL) identified in some studies, no recommendations for the use of IPL results in routine management of CML patients have been issued. We report two patients in whom daily imatinib dose was increased from 400 to 600 or 800 mg because of low IPL found at various intervals from the beginning of treatment (7 measurements; mean IPL values = and ng/ml, respectively). Both patients achieved suboptimal response according to the European LeukemiaNet criteria (complete cytogenetic response was not achieved after 1 year of treatment in patient 1 and major molecular response after 47 months of standard-dose imatinib therapy in patient 2). In addition, we have demonstrated low hoct-1 expression at diagnosis in both patients, retrospectively. Escalation of imatinib daily dose resulted in a significant increase of IPL (6 measurements; mean = 1790 and ng/ml, respectively) and in the achievement of complete cytogenetic response in patient 1 after 3 months and major molecular response within 15 and 6 months in both patients. Our cases demonstrate that low IPL identified at various non-predefined intervals from the beginning of E. Faber (&) M. Divoká B. Katrincsáková Š. Rožmanová M. Jarošová K. Indrák Department of Hemato-Oncology, Faculty of Medicine and Dentistry, University Palacky in Olomouc, Faculty Hospital Olomouc, IP Pavlova 6, Olomouc, Czech Republic edgar.faber@fnol.cz D. Friedecký K. Mičová T. Adam Department of Biochemistry and Immunogenetics, Laboratory of Inherited Metabolic Disorders, Faculty of Medicine and Dentistry, Palacky University in Olomouc, Faculty Hospital Olomouc, Olomouc, Czech Republic therapy may be used for deciding on dose escalation in selected CML patients in the routine clinical setting, especially in cases with suboptimal treatment response. Keywords Chronic myeloid leukemia Imatinib Plasma levels Treatment response 1 Introduction Imatinib mesylate has become the drug of choice for firstline treatment of patients with chronic myeloid leukemia (CML). Most patients achieve optimal treatment response that comprises complete cytogenetic response (CCyR) and major molecular response (MMoR) after months of therapy [1]. Patients with suboptimal response to therapy probably represent a heterogenous group with variable prognosis depending on the time of suboptimal response identification: they may have inferior overall survival, progression-free survival and an increased risk for subsequent loss of CCyR [2, 3]. Among the causes of suboptimal response, low trough imatinib plasma levels (IPL) have been suggested. IPL were shown to be associated with cytogenetic and molecular response in two major and a few smaller studies [4 7]. White et al. found a correlation between suboptimal response to imatinib and low expression of the human organic cation transporter (hoct-1), responsible for the influx of imatinib into the cells. They suggested that in this situation, imatinib dose escalation may overcome the low expression of hoct-1 [8]. However, some authors found no correlation between IPL and treatment response [9, 10]. Therefore, no definite recommendations for IPL in routine clinical practice have been issued yet. IPL are generally suggested as useful for the assessment of patients with poor compliance, those who do 123

65 898 E. Faber et al. not respond well to treatment or those with excessive imatinib toxicity [11]. It has been concluded that further studies are needed to achieve consensus on the exact role of IPL in CML management [11]. In a recently issued statement of the European LeukemiaNet, no recommendations on IPL have been implemented [1]. Among other evidence lacking, there is no conclusive report about the success of imatinib dose escalation in patients with low IPL associated with suboptimal treatment response. We provide this evidence in two patients now. 2 Methods 2.1 Cytogenetics and FISH Cytogenetic examinations were performed according to standard procedure from bone marrow cells at the time of starting imatinib therapy and then once a year. FISH with LSI BCR/ABL ES and/or LSI BCR/ABL Dual Fusion probes (Abbott-Vysis, Downers Grove, IL, USA) was applied at the beginning of imatinib treatment and than at least once in 6 months. In case of additional cytogenetic abnormalities, FISH with centromeric (Abbott-Vysis) and/ or painting probes (Cambio Ltd., Cambridge, UK) was performed. Cytogenetic response was classified as complete (0% Ph-positive mitoses or interphase cells using FISH), major (1 34%), minor (35 67%) and minimal (68 99%) as described previously [12]. 2.2 Quantitation of BCR/ABL mrna Quantitative reverse-transcriptase polymerase chain reactions (RQ-PCR) for BCR/ABL mrna transcript levels were performed using the LightCycler Instrument (Roche Diagnostics, Mannheim, Germany). Total leukocyte RNA was extracted from peripheral blood and/or bone marrow aspirate after lysis of red blood cells according to standard protocol [13]. RNA was reverse transcribed to cdna with Transcriptor Reverse Transcriptase (Roche Diagnostics, Mannheim, Germany) using random hexamers. Primers and TaqMan probe sequences published in the EAC network protocol were used for RQ-PCR [14]. Briefly, 100 ng cdna was added to 2 ll Master Mix (LightCycler Fast- Start DNA Master Hybridization Probes; Roche Diagnostics, Mannheim, Germany) in 20 ll total reaction volume with final concentration of 4 mm MgCl 2, 300 nm primers and 200 nm TaqMan probe. The PCR program included an initial denaturation step for 10 min at 95 C and 50 cycles (95 C, 10 s, 20 C/s)/(60 C, 30 s, 20 C/s). BCR/ABL and ABL assays were performed in duplicate. Mean crossing points (Cp) were used to interpolate standard curves and to calculate the transcript copy number. Normalized levels were calculated as the BCR ABL/ABL ratio and expressed as percentage. The standard curve was generated using serial dilutions of a linearized plasmid, containing BCR/ ABL insert FGRS10 (Ipsogen, Marseille, France). The plasmid used to quantify the endogenous control gene ABL was CGRS01 (Ipsogen, Marseille, France). 2.3 Measurement of imatinib plasma levels Imatinib plasma concentrations were measured by ultraperformance liquid chromatography tandem mass spectrometry assay [15] using UHPLC UltiMate 3000 RS (Dionex, USA) coupled with a API 4000 tandem mass spectrometer (Applied Biosystems, USA). Samples were obtained at routine clinical checkups at h after the latest dose of imatinib in both patients, with the exception of two measurements in patient 1 that were taken h after the latest imatinib dose. 2.4 Sequencing analysis of BCR/ABL kinase domain RNA and cdna were prepared as described [13, 14]. cdna was amplified by nested PCR using primers located in the BCR (external 5 0 -GCTACGGAGAGGCTGAAG AAG-3 0 and internal 5 0 -CAGATGCTGACCAACTCGT GT-3 0 ) and ABL (external 5 0 -GCTCGCATGAGTTCAT AGACC-3 0 and internal 5 0 -CTTCTCTAGCAGCTCATAC ACC-3 0 ) regions of the BCR/ABL gene. The amplicons cover the region flanked by amino acids , according to GenBank accession no. M PCR products were directly sequenced using forward (5 0 -AGAGAT CAAACACCCTAACC-3 0 ) and reverse (5 0 -GTTCTCCC CTACCAGGCAG-3 0 ) primers and ABI PRISM Genetic Analyzer 3100 (Applied Biosystems, Foster City, CA, USA) using Chromas, Version 1.5 sequence analysis software (Technelysium Pty Ltd., Queensland, Australia). 2.5 Measurement of hoct1 mrna levels by real-time quantitative reverse-transcriptase polymerase chain reaction To assess the expression of hoct1 (SLC22A1) in CML patients, total RNA was isolated and subjected to RNase-free DNase treatment performed according to the manufacturer s instructions (Ambion, Austin, TX, USA). DNase-free RNA was reverse transcribed into cdna using SuperScript VILO cdna Synthesis Kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer s recommendations. Quantitative reverse-transcriptase polymerase chain reaction (qrt- PCR) was performed using EXPRESS SYBR GreenER qpcr SuperMix (Invitrogen, Carlsbad, CA, USA) on LightCycler 480 instrument (Roche Diagnostics, Mannheim, Germany) using the following conditions: 95 C for 123

66 Imatinib dosage based on plasma levels min followed by 40 cycles at 95 C for 10 s, 60 C for 10 s and 72 C at 20 s. Primers described by White et al. [8] were used to amplify the hoct1 gene. The ABL1 gene was amplified as an internal control using the primers designed as follows: CCAACCTTTTCGTTGCACTGTA (ABL1_F) and CATTTTTGGTTTGGGCTTCAC (ABL1_R). The samples were analyzed in triplicate, and data were assessed using the comparative Ct method (DDCt) using expression of hoct1 in healthy volunteers as a calibrator. Briefly, a total of eight normal peripheral blood samples were pooled, treated with DNase and reverse transcribed into cdna as described above to be used as a calibrator to assess hoct1 expression in CML patients. qrt-pcr data were analyzed using LightCycler Software Version (Roche Diagnostics, Mannheim, Germany). PCR conditions were optimized to obtain a single peak on melting curve analysis for both genes. PCR products were directly sequenced to ensure 100% match with the target gene. The hoct1 gene expression levels were normalized with the ABL1 gene expression levels in the same sample. Next, hoct1 gene expression was normalized between samples by relating them to the respective hoct1 expression level in the peripheral blood of healthy volunteers (calibrator), in which expression of hoct1 was arbitrarily scored as Results Clinical features, history of CML and imatinib therapy in both patients are depicted in Table 1. Both patients were diagnosed on the basis of standard bone marrow cytogenetic examination that confirmed the presence of the Philadelphia chromosome without any additional chromosomal changes. Both patients had their liver transaminases, bilirubin, albumin, creatinine and glomerular filtration within normal limits. After the introduction of hoct-1 gene expression measurement in our laboratory in March 2010, we assessed the patients samples taken at the diagnosis. In both cases, low normalized hoct-1 gene expression was demonstrated ( and , respectively). Both patients signed informed consent with IPL blood sampling. In both patients, standard treatment with 400 mg of imatinib daily was initiated after cytoreduction with hydroxyurea. Patient 1 did not achieve CCyR before imatinib dose escalation, but achieved it after 3 months of escalated dosage. Patient 2 achieved CCyR after 12 months with a standard dose of imatinib 400 mg daily, but did not achieve MMoR after 18 months. At the time of this suboptimal response, we were not able to demonstrate any mutation in BCR ABL tyrosine kinase domain using DNA sequencing in neither patient. Repeated IPL measurements revealed low IPL (7 examinations; mean values and 764.5, range and ng/ml, respectively) and the patients did not Table 1 Clinical and laboratory characteristics of patients and their course of treatment achieve optimal response to standard imatinib treatment (see Table 2; Fig. 1). Therefore, it was decided to escalate the dose to 800 and 600 mg daily. Assessments of IPL were performed at routine checkups at non-predefined time intervals from the beginning of therapy. Repeated IPL measurements after imatinib dose escalation confirmed the achievement of higher IPL (mean values 1790 and ng/ml, respectively; see Table 2). After 3 months from the start of the escalated dosage, CCyR was achieved in patient 1, while after 15 and 6 months of escalated dosage, MMoR was achieved in both patients (see Table 1, Fig. 1 for molecular, cytogenetic and IPL monitoring of the patients). Both patients had already experienced grade 3 hypophosphatemia according NCI toxicity scale after standard dosage of imatinib. Escalation of a daily imatinib dose to 800 mg was associated with macrocytosis, grade 1 hypokalemia, significant fluid retention and peripheral edema with a need for diuretic therapy in patient 1, whereas in patient 2, grade 1 elevation of ALT and grade 1 hypokalemia were observed after imatinib dose escalation to 600 mg daily with no clinical side effects. No hematologic toxicity was recorded. Both patients had very good compliance with imatinib therapy irrespective of the dosage applied. 4 Discussion Patient 1 Patient 2 Sex Male Male Age at the time of diagnosis Weight (kg) Body surface area (m 2 ) Sokal index Hasford index Albumin (g/l; normal range: 35 50) Glomerular filtration according to MDRD (normal range: ) Time from diagnosis to start 7 39 of imatinib therapy (400 mg daily) (days) Time from diagnosis to CCyR (months) Time from diagnosis to imatinib dose escalation (months) Dose after escalation (mg daily) Time from imatinib dose escalation 15 6 to MMoR (months) Time from diagnosis to the latest follow-up (months) Picard et al. [5] showed for the first time that IPL may have a prognostic value in patients with CML treated with firstline imatinib. They measured IPL in 68 patients in chronic 123

67 900 E. Faber et al. Table 2 Imatinib dosage (absolute and calculated per kg of body weight and per m 2 of body surface area) and imatinib plasma levels before and after imatinib daily dose escalation from 400 to 600 or 800 mg Patient 1 Patient 2 Initial imatinib daily dose (mg) Daily dose per kg body weight (mg/kg) Daily dose per m 2 (mg/m 2 ) Trough imatinib plasma levels before dose escalation (ng/ml) [month of the sample from the beginning of imatinib therapy] 507 [9], 728 [12], 614 [15] Mean = [30], 850 [33], 898 [36], 661 [42] Mean = Imatinib daily dose after escalation (mg) Daily dose per kg body weight after escalation (mg/kg) Daily dose per m 2 after escalation (mg/m 2 ) Trough imatinib plasma levels after dose escalation (ng/ml) [month of the sample from the beginning of imatinib therapy] 1010 [18], 2040 [21]*, 2320 [24]* Mean = [48], 1460 [51], 1400 [54] Mean = Samples were taken h after the dose in patient 1 and h after the dose in patient 2 * Samples were taken h after ingestion of the previous dose (dosage 400 mg twice daily) Fig. 1 Results of molecular (a), cytogenetic (CYR) and trough imatinib plasma level (IPL; b) monitoring in both patients. Imatinib daily dosage is shown in the middle. F cultivation failure or accelerated phase CML treated with 400 or 600 mg imatinib daily at unspecified time intervals from the start of imatinib treatment and found significantly higher IPL in patients achieving CCyR and MMoR [5]. Their observation was confirmed by Larson et al. [4], who reported the results of the pharmacokinetic part of the IRIS study using day 29 IPL measurements and found IPL to be associated not only with CCyR and MMoR, but also with significantly different progression-free survival of patients divided into four groups according to IPL. Both studies confirmed high inter-patient variability of IPL that may be influenced by various factors including drug absorption, different binding to plasma proteins, variability in metabolizing liver enzymes and patients demographic factors [11]. Also our team was able to confirm the correlation of IPL with the probability of achieving MMoR in a small group of patients [7]. However, there were at least two other studies that found no correlation between IPL and patients 123

68 Imatinib dosage based on plasma levels 901 prognosis [9, 10]. Despite speculations that IPL could assist in decisions on increasing imatinib dose, IPL measurement is recommended as helpful in situations where poor adherence to treatment is suspected, severe side effects are observed or drug interactions need to be ruled out [11]. Further studies are awaited to confirm prospectively the link between IPL and response to treatment and to define effective trough concentrations in different patient populations [11]. No clear recommendation has been issued regarding IPL estimations in CML patients in the recent statement paper of ELN experts [1]. Among other lacking evidence, the usefulness of imatinib dose escalation due to low IPL for subsequent achievement of optimal treatment response has not been reported in a full article. In a recent abstract, Australian authors published the results of the TIDEL II prospective study that used IPL measured at day 22 of imatinib therapy in 74 CML patients for subsequent dosage adjustment [16]. In 11 (15%) patients, IPL lower than 1000 ng/ml was found and 7 (9.5%) of them were able to have their imatinib daily dose escalated to 800 mg. These patients achieved comparable mean IPL with the rest of the group at 3 and 6 months and their molecular response also improved [16]. Our two patients were identified among 12 patients with suboptimal treatment response from 40 patients treated with first-line imatinib at our center since Only these two patients (5%) were shown to display significantly lower than recommended IPL (\1000 ng/ml) assessed at various time points between months 9 and 42 of therapy. Both patients showed an increase of IPL after imatinib dose escalation and also achievement of optimal treatment response. Of interest in both our patients, low expression of hoct-1 gene at diagnosis as the other possible cause of suboptimal treatment response was retrospectively demonstrated. White et al. [8] have shown the association of low expression of hoct-1 with suboptimal treatment response and suggested imatinib dose escalation as a suitable strategy for its management. The population of patients suitable for imatinib dose management according to IPL may not be large, as most patients respond well to imatinib first-line treatment and in non-responding patients several other causes of resistance may play a role. However, we believe that our report showing that IPL estimated at various time points of treatment may be used for dose adjustment in individual patients has important implications for optimization of routine management of CML patients outside clinical trials. Acknowledgments The work was supported by grants NS9627-3, NS (Ministry of Health, the Czech Republic), MSM and MSM (Ministry of Education, Youth and Sports, the Czech Republic). We are grateful to Mgr. Pavel Kurfürst for editorial help with the manuscript. References 1. Baccarani M, Cortes J, Pane F, Niederwieser D, Saglio G, Apperley J, et al. Chronic myeloid leukemia: an update of concepts and management recommendations of European LeukemiaNet. J Clin Oncol. 2009;27: Alvarado Y, Kantarjian H, O Brien S, Faderl S, Borthakur G, Burger J, et al. Significance of suboptimal response to imatinib, as defined by the European LeukemiaNet, in the long-term outcome of patients with early chronic myeloid leukemia in chronic phase. Cancer. 2009;115: Marin D, Milojkovic D, Olavarria E, Khorashad JS, de Lavallade H, Reid AG, et al. European LeukemiaNet criteria for failure or sub-optimal response reliably identify patients with CML in early chronic phase treated with imatinib whose eventual outcome is poor. Blood. 2008;112: Larson RA, Druker BJ, Guilhot F, O Brien SG, Riviere GJ, Krahnke T, et al. for the IRIS (International Randomized Interferon vs. STI571) Study Group. Imatinib pharmacokinetics and its correlation with response and safety in chronic phase chronic myeloid leukemia: a subanalysis of the IRIS study. Blood. 2008;111: Picard S, Titier K, Etienne G, Teilhet E, Ducint D, Bernard M-A, et al. Trough imatinib plasma levels are associated with both cytogenetic and molecular responses to standard dose imatinib in chronic myeloid leukemia. Blood. 2007;109: Singh N, Kumar L, Meena R, Velpandian T. Drug monitoring of imatinib levels in patients undergoing therapy for chronic myeloid leukaemia: comparing plasma levels of responders and nonresponders. Eur J Clin Pharmacol. 2009;65: Faber E, Friedecky D, Tomkova J, Rozmanova S, Rohon P, Skoumalova I, et al. Imatinib plasma levels correlate with molecular response in CML patients. Haematologica. 2008; 93(Suppl. 1): (Abstract 0543). 8. White DL, Saunders VA, Dang P, Engler J, Venables A, Zrim S, et al. Most CML patients who have suboptimal response to imatinib have low OCT-1 activity: higher doses of imatinib may overcome the negative impact of low OCT-1 activity. Blood. 2007;110: Forrest DL, Trainor S, Brinkman RR, Barnett MJ, Hogge DE, Nevill TJ, et al. Cytogenetic and molecular responses to standarddose imatinib in chronic myeloid leukemia are correlated with Sokal risk scores and duration of therapy but not trough imatinib plasma levels. Leukemia Res. 2009;33: Davies A, Hayes AK, Giannoudis A, Lucas CM, Knight K, Watmough SJ, et al. A study of plasma levels of imatinib and its bioactive metabolite CGP reveals no correlation with subsequent clinical outcome in imatinib-treated chronic myeloid leukemia. Haematologica. 2009;94(Suppl 2):259 (Abstract 0637). 11. Cortes JE, Egorin MJ, Guilhot F, Molimard M, Mahon F-X. Pharmacokinetic/pharmacodynamic correlation and blood-level testing in imatinib therapy for chronic myeloid leukemia. Leukemia. 2009;23: The Italian Cooperative Study Group on chronic myeloid leukemia. Interferon alfa-2a as compared with conventional chemotherapy for the treatment of chronic myeloid leukemia. N Engl J Med. 1994;330: Chomczynski P, Sacchi N. Single-step method of RNA isolation by quanidium thiocyanate phenol chloroform extraction. Anal Biochem. 1987;162: Gabert J, Beillard E, van der Velden VHJ, Bi W, Grimwade D, Pallisgaard N, et al. Standardization and quality control studies of real-time quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia A Europe Against Cancer Program. Leukemia. 2003;17:

69 902 E. Faber et al. 15. Parise RA, Ramanathan RK, Hayes MJ, Egorin MJ. A sensitive high-performance liquid chromatography mass spectrometry assay for quantitation of imatinib and its main metabolite (CGP 74588) in plasma. J Chromatology B. 2003;791: Osborn MP, White DL, Saunders VA, Cambareri B, Branford S, Menelaou A, et al. Early dose-escalation in chronic myeloid leukaemia patients with low plasma imatinib levels leads to equivalent BCR ABL values and drug levels at 6 months to those with optimal drug levels: first analysis from the TIDEL II trial of de-novo patients treated with 600 mg imatinib. Blood. 2009; 114(22):Abstract

70 Příloha 2 Mičová, K., Friedecký, D., Faber, E., Polýnková, A., Adam, T. Flow injection analysis vs. ultra high performance liquid chromatography coupled with tandem mass spectrometry for determination of imatinib in human plasma. Clinica Chimica Acta, 411, (2010).

71 Clinica Chimica Acta 411 (2010) Contents lists available at ScienceDirect Clinica Chimica Acta journal homepage: Flow injection analysis vs. ultra high performance liquid chromatography coupled with tandem mass spectrometry for determination of imatinib in human plasma Kateřina Mičová a, David Friedecký a,, Edgar Faber b, Adriana Polýnková a, Tomáš Adam a a Laboratory of Inherited Metabolic Disorders, University Hospital and Palacký University in Olomouc, I.P. Pavlova 6, CZ Olomouc, Czech Republic b Department of Hemato-Oncology, Faculty of Medicine and Dentistry, Palacký University in Olomouc, I.P. Pavlova 6, CZ Olomouc, Czech Republic article info abstract Article history: Received 10 June 2010 Received in revised form 29 July 2010 Accepted 6 August 2010 Available online 13 August 2010 Keywords: Imatinib Human plasma Mass spectrometry Flow injection analysis Liquid chromatography Therapeutic drug monitoring Background: The aim of this study was to develop, validate and compare flow injection analysis (FIA) and ultra-high-performance liquid chromatography (LC)/tandem mass spectrometry methods for the determination of imatinib in plasma from patients with chronic myeloid leukemia. Methods: The plasma for analysis by both methods was deproteinated by methanol containing d8-imatinib. The separation was achieved on a 1.7 μm C18 column with a linear gradient (4 mm ammonium formiate and acetonitrile, ph 3.2). FIA was performed at flow rate of 0.03 ml/min (0.1% formic acid in methanol). Multiple reaction monitoring mode on the tandem mass spectrometer (API 4000, AB Sciex) in positive ESI were used for detection. Results: The total analysis times were 3.2 (LC) and 0.75 min (FIA). Both methods were successfully validated and applied to the plasma patients samples. The limits of quantification were 4.1 and 30.8 ng/ml; imprecisions were less than 5.7% and recovery ranged between 93 and 105%, for the LC and FIA, respectively. The methods revealed an agreement with a mean difference of 1.46 ng/ml (SD ng/ml). Conclusions: The high-throughput methods that were developed are suitable for the therapeutic drug monitoring of imatinib in plasma. They can be used in routine clinical practice Elsevier B.V. All rights reserved. 1. Introduction Thanks to the growing understanding of the molecular mechanism and patophysiology of chronic myeloid leukemia (CML), a new era of cancer therapy has started. This so-called targeted therapy with imatinib (IM, Glivec ), the first of the tyrosine kinase inhibitors, is characterized by its high specificity and selectivity, almost exclusively within the leukemic clone. CML is a chronic myeloproliferative disease caused by the transformation of the hematopoietic stem cell, characterized by chromosomal abnormality and, simultaneously, a diagnostic hallmark the Philadelphia chromosome (Ph) [1]. This truncated chromosome is the result of a reciprocal translocation between chromosomes 9 and 22 t(9; 22)(q34; q11) and contain a new leukemic gene BCR/ABL1, arising from the fusion of the gene BCR ( Breakpoint Cluster Region ) on chromosome 22 and the gene ABL1 ( Abelson Tyrosine Kinase ) on chromosome 9. This leukemic fusion gene leads to the production of constitutively active tyrosine kinase, Bcr/Abl1, with a molecular mass of 210 kd. This kinase activates signal transduction pathways, leading to the uncontrolled proliferation of leukemic cells, the inhibition of apoptosis, and the full CML disease phenotype [2]. Corresponding author. Tel.: , ; fax: address: david.friedecky@gmail.com (D. Friedecký). IM, formally 4-[(4-methylpiperazin-1-yl) methyl]-n-[4-methyl-3- [(4-pyridin-3-ylpyrimidin-2-yl)amino]phenyl]benzamide or STI 571, is a small molecule operating as a competitive inhibitor of the Bcr/ Abl1 and c-kit tyrosine kinases. It interacts with the ATP-binding pocket of the protein and inhibits the phosphorylation of tyrosine kinase substrates, which induce the formation and unregulated proliferation of immature myeloid cells [3]. Recently it has become the front-line therapy in Ph-positive CML and gastrointestinal stromal tumours [4]. Although most patients have an excellent response to this therapy, in many cases clinical resistance can appear. Usually, resistance is caused by additional genetic changes in the leukemic clone or point mutation in the ATP-binding place, leading to the reduced affinity of the protein to IM and the reactivation of Bcr/Abl1 tyrosine kinase [5]. However, the low bioavailability of the drug in leukemic cells as a result of low plasma drug concentrations has been discussed as a possible cause of primary IM resistance in CML [6]. Measuring the drug concentration in body fluids (therapeutic drug monitoring, TDM) has therefore become an important tool for the management of CML patients. TDM can be useful to evaluate patient adherence to daily oral therapy, potential drug drug interactions, treatment efficacy, and severe drug-related adverse events [7]. IM in body fluids can be determined by various separation techniques (e.g. HPLC or HPCE). Several methods based on capillary zone electrophoresis for the determination of IM and its main metabolites in human urine were developed. Analyses were performed /$ see front matter 2010 Elsevier B.V. All rights reserved. doi: /j.cca

72 1958 K. Mičová et al. / Clinica Chimica Acta 411 (2010) in fused silica capillaries in acidic phosphate buffer [8]. Another method uses capillary electrophoretic mode in a non-aqueous setting under a basic acetate buffer dissolved in methanol and acetonitrile [9]. The most frequently used technique in clinical praxis is liquid chromatography with spectrophotometric or mass spectrometric detection. Usually a reverse phase separation system on short C18 columns is applied with elution by a mobile phase consisting of acid buffer/methanol or acetonitrile. For ionization in a mass spectrometer electrospray ionization in positive mode is used, and the compounds are detected in multiple reaction monitoring (MRM) mode and quantified by isotope diluting or using an internal standard (e.g. quinoxaline or clozapine) [10 12]. Several approaches utilizing a solid-phase extraction procedure, liquid/liquid extraction to a nonpolar solvent and acidic deproteinization were applied for sample preparation prior to analysis [11,13,14]. With respect to similar structural features of other tyrosine kinase inhibitors, methods for the simultaneous determination of nilotitnib, dasatinib, sunitinib, sorafenib, and lapatinib were developed [10,15]. Recently, the determination of IM in blood serum, plasma, urine and even in bone marrow has been suggested to be of possible diagnostic significance [9,16]. In this work we present the development, validation, and comparison of two methods flow injection analysis (FIA) and ultra-performance liquid chromatography (LC) with tandem mass spectrometry to determine the IM in plasma samples taken from patients with CML undergoing IM therapy. 2. Materials and methods 2.1. Chemicals Imatinib mesylate, d8-imatinib mesylate (d8im, deuterated internal standard), and desmethylated imatinib mesylate (desim, major metabolite) (Fig. 1) were kindly provided by Novartis Pharmaceuticals (East Hanover, NJ, USA). Formic acid, ammonium hydroxide, and methanol were all LC/MS grade and purchased from Sigma (St. Louis, MO, USA). Deionized water was prepared with an EASY pure LF (Werner Reinstwassersysteme, Leverkusen, Germany) Standard solutions Stock solutions of IM, desim, and d8im were prepared by dissolving them in methanol to yield concentrations of 0.5 mg/ml expressed as free substances. IM was further diluted with methanol to obtain solutions at concentration levels in the range ,000 ng/ml. The internal standard was finally diluted to a working concentration of 30 ng/ml. The calibration standards and controls were prepared in addition to drug-free plasma from healthy volunteers. All the solutions were stored at 20 C Sample preparation This study was conducted in accordance with the Declaration of Helsinki, and the protocol was reviewed by the hospital ethics committee. All examined patients gave their informed consent with participation in the study before blood sampling. The plasma samples were prepared from blood with an anticoagulation additive (EDTA) of control healthy volunteers and patients treated with IM by centrifuging (1200 g; 5 min). On the basis of previously published methods [10,17], the plasma (0.02 ml) was deproteinated by methanol containing internal standard d8im (0.18 ml). The sample was sonicated (1 min), shaken (5 min), frozen (30 min; 20 C), and centrifuged (14,500 g; 5 min). The prepared supernatant was displaced into vials and directly analyzed or stored at 20 C prior to analysis Ultra high performance liquid chromatography/flow injection analysis For both methods IM plasma levels were measured using UltiMate 3000 RS (Dionex, Sunnyvale, CA). The processed samples were maintained at +5 C in a thermostated autosampler rack during analysis by LC and FIA methods. Chromatographic separations were performed at 40 C on a reverse phase analytical column Acquity BEH C μm, mm (Waters, Milford, MA). The mobile phase consisted of acetonitrile (B) and 4 mm ammonium formiate buffer; ph=3.2 (A). During the first minute the mobile phase consisted of 17% B; min linear gradient of acetonitrile from 17 to 50% was applied; mobile phase consisted of 50% B. Then the system was set to its initial conditions in 0.1 min and was conditioned for 1 min before the next injection. The analysis proceeded at a flow rate of 0.5 ml/min and 2 μl of the samples were injected into the system. The total run time of the analysis was 3.2 min, including the autosampler wash. The mobile phase consisted of methanol and 0.1% formic acid during FIA. The flow was set at 0.3 ml/min for min and min; in the measuring period between 0.1 and 0.4 min it was reduced to 0.03 ml/min. The volume of the injected sample was 0.5 μl and the total run time of the analysis, including the autosampler wash, was 45 s. Fig. 1. Structures and fragmentation of IM and desim.

73 K. Mičová et al. / Clinica Chimica Acta 411 (2010) Tandem mass spectrometry All the experiments were performed on an API 4000 tandem mass spectrometer (Applied Biosystems, Foster City, CA, USA) with electrospray ionization in positive mode. The mass spectrometer was operated in multiple reaction monitoring mode (MRM). The dwell time was adjusted to a time of 200 ms for each mass transition between the precursor and product ion. The ion source settings consisted of a temperature of 450 C, capillary voltage of 5500 V, nebulizer gas 40/20 psi (LC/FIA method), auxiliary gas 40 psi, curtain gas 20/14 psi (LC/FIA method) and highpurity nitrogen as the collision gas 6 psi. Characteristic mass spectrometry parameters of declustering potential (70 V for desim and 115 V for all other compounds), collision energy (35 V), and collision exit potential (10 V) were determined for all the analytes using standard solutions (1000 ng/ml) dissolved in methanol. The tandem mass spectrometer was set to unit and low resolution for the LC and FIA methods, respectively. Transitions m/z (IM), m/z (desim) and m/z (d8im) were used for LC method. Transitions m/z (IM) and m/z (d8im) were used for quantification in FIA method. In order to identify possible interferences of the FIA method, a ratio of the two m/z transitions and was set at The quantification of the LC analysis was done with the Analyst 1.5 software (Applied Biosystems, USA) by the ratio of the corrected peak area of IM and d8im. The FIA analysis were quantified by the ratio of average intensities of IM and d8im (30 data points per analyze) in the Chemoview 2.0 software (Applied Biosystems, USA) Method validation The methods validation was based on the recommendations published by the Food and Drug Administration FDA (FDA) [18], recommendations of the Conference Report of the Washington Conference on Analytical methods validation: Bioavailability, Bioequivalence and Pharmacokinetic studies [19] and Matuzewski's et al. studies were also considered [20]. The plasma of healthy volunteers, with the addition of 100, 300, 500, 1000, 3000, and 5000 ng/ml of IM in triplicates, was used for the construction of the calibration curve. The linear regression model (least-square method) with the inversion of concentration as the weighting factor (1/x2) was chosen for the calculation of the dependence between the peak area/intensity (for LC/FIA method) ratio of IM/d8IM and concentration. In order to determine the linearity slope, the difference, correlation coefficient, and standard deviations were calculated. The sensitivity of the methods was determined on plasma samples with IM added with low concentration near to LOQ (50 ng/ml) and calculated as a signal-to-noise ratio of 3 and 10 for LOD and LOQ, respectively. For calculated LOQ bias and coefficient of variation were determined (n=6, spiked plasma). Intra- and inter-day imprecisions and recoveries were measured in blank plasma and in plasma samples with the addition of 300, 1000, and 3000 ng/ml of IM in six replicates within one day and six consecutive days, respectively. The ANOVA method was used for the calculation of means and standard deviations. Recovery was expressed as a percentage of the target value. The specificity of this method was investigated by analyzing six different blank plasma samples from healthy volunteers without IM intake. Each blank sample was tested to check the lack of interferences with IM or d8im using the presented method. The stability of IM at different conditions has been previously reported in many articles [11,15,21]. Imatinib in plasma samples is stable at least 12 month in the freezer ( 20 C) with decomposition less than 3.3%. Stability of plasma and blood is better than 95% at room temperature for 96 h [13]. Ion suppression was explored by the post-column continuous infusion of IM into the tandem mass spectrometer during the chromatographic analysis of eight blank human plasma extracts. The concentration of the standard solution was 1000 ng/ml and it was infused at a flow rate of 10 μl/min. Subsequently, the quantitative determination of the matrix effects was also assessed for both methods. Blank plasma samples were prepared by a standard procedure and subsequently the supernatant was spiked with IM to three final concentrations of 300, 1000, and 3000 ng/ml. Ion suppression was calculated by an equation (Eq. A.1) comparing the signal intensities of the standard solutions in methanol and blank plasma extract with identical amount of IM added. In order to compare the methods that were developed, 120 plasma samples from patients suffering from CML and treated with IM were analyzed and the results were evaluated by the Bland & Altman plot and regression analysis. The equation of linear regression, correlation coefficient, mean difference from zero, and standard deviation were calculated. Validation characteristics were calculated and plotted with the QC Expert 3.0 software (Trilobyte, Czech Republic). 3. Results 3.1. Ultra high performance liquid chromatography For the separation of IM mostly conventional LC columns filled with C18 stationary phase with particles with 5-μm dimensions are used, with a common retention time of IM about 4 min [10 13]. In order to achieve a short time of analysis we used a C18 column filled with 1.7-μm BEH particles (Waters), which provide higher resolution and faster separation. Therefore IM was separated in 1.61 min with a high separation efficiency of more than 250,000 theoretical plates per meter under a back-pressure of bar. In addition, the column allows fast re-equilibration during 1.5 min. Ion suppression by the post-column injection method was studied with eight plasma samples. We observed chromatograms with possible areas of expressive ion suppression and no significant reduction of the signal at the time of 1.61 min was found. Only the region of min, corresponding to dead volume containing salts and other analytes without retention, was significantly suppressed (Fig. 2). Representative chromatogram patient suffering from CML during IM therapy is shown in Fig. 3. Apart from IM and d8im, the transition of main metabolite desim is also recorded Flow injection analysis In order to minimize the analysis time and costs a method using the direct infusion of the sample to a mass spectrometer was developed. For the analysis the same preparation of samples, consisting of only plasma deproteination, is applied, without any additional cleaning steps. Signal intensities that were approximately five times lower were caused by ion suppression, but it has no influence on the precision and accuracy of the method as a result of the use of internal standard d8im. More accurate results were achieved by reducing the flow rate during the measurement of the signal from 0.30 to 0.03 ml/min, which offers a longer time and more points for the measurement of the signal. In addition, the low resolution of the first and the third quadrupoles offers intensities that are more than three times higher. For all patients samples analyzed we found no data ratio of IM m/z transitions outside the set limits and variation of intensity of d8im was less than 6.6%. Considering variation of sample injection of 5.5% (for 0.5 μl) interferences in real samples are negligible. Representative flow injection analysis of patient suffering from CML and treated with IM is shown in Fig. 3. The total analysis time

74 1960 K. Mičová et al. / Clinica Chimica Acta 411 (2010) Fig. 2. Ion suppression study continuous infusion of IM to eight blank plasma analyses (A), and separation of IM standard (B). between two injections (45 s) consisted of the acquisition time of the mass spectrometer (30 s) and the washing of the autosampler (25 s), which begins during the twentieth second from the start of the analysis Validation The linear correlation between the analyte and internal standard peak area or intensity and concentration was determined in the range ng/ml; each concentration was measured 3 times within 1 day. The equations of the calibration curves were: y= ; (R =0.998) and y= ; (R = ); LOD was assessed at 1.24 and 9.2 ng/ml, and the LOQ values were 4.12 and 30.8 ng/ml (bias 7.96 and 15.21%; CV and 14.32%) for LC and FIA methods, respectively. Inter-day and intra-day imprecision, ion suppression, and the analytical recoveries of the methods were determined using blank plasma added to low, medium, and high concentrations (300, 1000, and 3000 ng/ml). Both of the methods provided comparable results; recoveries varied between and % and and % and inter/intra-day imprecisions were less than 5.72% for the LC and FIA methods, respectively (Table 1). The assay of six blank plasma samples did not show any interference in the retention time of all the analytes (data not shown). Ion suppressions were significantly higher in the FIA method ( %) compared to the LC method ( %) because, together with IM, a number of suppressing species were ionized in the ion source during the same analysis time. The matrix effects were fully eliminated by the use of d8im Comparison of the methods Both methods (LC vs. FIA) were compared by Bland Altman plot and regression analysis. Plasma samples from 120 patients with CML on IM therapy were analyzed by paired tests. Regression analysis provided a correlation equation of y= and a correlation coefficient of The comparison by Bland Altman plot showed mean difference of 1.46 ng/ml and standard deviation of ng/ml (Fig. 4). 4. Discussion Over the last years, tandem mass spectrometry with liquid chromatography has been an expanding technique in clinical chemistry laboratories. In particular, methods based on isotope dilution are widespread. We developed, validated, and compared the FIA and LC methods for the determination of IM in plasma samples from patients suffering from CML. Our LC method utilizes the recently Table 1 Mean values of imprecision, recovery and ion suppression of plasma samples with IM added (300, 1000 and 3000 ng/ml). Concentration (ng/ml) Imprecision (CV,%) Inter-day Intra-day Recovery (%), (CV,%) LC-MS/MS (5.71) (5.05) (2.99) Ion suppression (%) Fig. 3. Analysis of plasma samples from patient on long-term IM therapy (400 mg) by FIA (A, 895 ng/ml, 20 h after dose) and LC method (B, 1153 ng/ml, 25 h after dose). FIA-MS/MS (5.00) (4.44) (2.56) 85.79

75 K. Mičová et al. / Clinica Chimica Acta 411 (2010) Fig. 4. Bland Altman plot of IM difference between LC and FIA method. introduced columns filled with sub-two-micron particles, which allow fast separations at high efficiency. In the last year, more than one thousand samples of plasma samples have been analyzed on one column and no change in the retention time and only a slight decrease in separation efficiency resulted. An excellent sample throughput of up to 80 samples per hour was achieved with the use of the FIA method that was developed. The exclusion of the separation step speeds up the analysis and creates a lower requirement for consumable expenditures. In our laboratory the FIA method is currently in use due to higher throughput and also easier method switching. The methods are fully comparable and applicable for blood level testing in the range ng/ml of IM achieved at clinically used dosages. Although the clinical trials of CML patients with high IM plasma levels has been reported [22,23], in routine clinical practice levels close 5000 ng/ml are never reached even at maximum IM dose 800 mg/day. In more than one thousand samples analyzed we found only one sample above 5000 ng/ml in a patient who has taken 1600 mg/day of IM by an error when switching from 100 mg to 400 mg tablets. 5. Conclusions Bioanalytical high-throughput methods (LC and FIA coupled to MS/MS) for determination of IM in plasma samples from patients with CML undergoing Glivec therapy were developed, validated and compared. Both methods use a simple sample preparation method using deproteination with an organic solvent. Methods fulfill FDA validation criteria and provide comparable results based on the Bland Altman test. The methods allow high-throughput, sensitive, and specific quantification useful for the therapeutic drug monitoring of patients treated with IM. Acknowledgments This study was supported by grants from The Ministry of Health IGA MZCR NS9627, The Ministry of Education, Youth and Sports MSM and from Iceland, Liechtenstein and Norway through the EEA Financial Mechanism A/CZ0046/2/0011. Appendices Ion suppression % = 1 I std in blank I blank I std in MeOH 100 ða:1 :Þ References [1] Nowell PC, Hungerford DA. A minute chromosome in human chronic granulocytic leukaemia. Science 1960;132: [2] Lugo TG, Pendergast AM, Muller AJ, Witte ON. Tyrosne kinase activity and transformation potency of bcr abl oncogene products. Science 1990;340: [3] Druker BJ, Tamura S, Buchdunger E, et al. Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr Abl positive cells. Nat Med 1996;2: [4] Baccarani M, Saglio G, Goldman JM, et al. Evolving concepts in the management of chronic myeloid leukemia. Recommendations from an expert panel on behalf of the European Leukemia Net. Blood 2006;108: [5] Gorre ME, Mohammed M, Ellwood K, et al. Clinical resistance to STI-571 cancer therapy caused by BCR ABL gene mutation or amplification. Science 2001;293: [6] Picard S, Titier K, Etienne G, et al. Trough imatinib plasma levels are associated with both cytogenetic and molecular responses to standard-dose imatinib in chronic myeloid leukemia. Blood 2007;109: [7] Cortes JE, Egorin MJ, Guilhot F, Molimard M, Mahon FX. Pharmacokinetic/ pharmacodynamic correlation and blood-level testing in imatinib therapy in chronic myeloid leukemia. Leukemia 2009;23: [8] Rodríguez-Flores J, Berzas JJ, Castaneda G, Rodríguez N. Direct and fast capillary zone electrophoresic method for the determination of Gleevec and its main metabolite in human urine. J Chromatogr B 2003;794: [9] Rodríguez-Flores J, Berzas Nevado JJ, Contento Salcedo AM, Cabello Díaz MP. Nonaqueous capillary electrophoresis metod for the analysis of gleevec and its main metabolite in human urine. J Chromatogr A 2005;1068: [10] De Francia S, D'Avolio A, De Martino F, et al. New HPLC-MS method for the simultaneous quantification of the antileukemia drugs imatinib, dasatinib, and nilotinib in human plasma. J Chromatogr B 2009;877: [11] Titier K, Picard S, Ducint D, et al. Quantification of imatinib in human plasma by high-performance liquid chromatography-tandem mass spectrometry. Ther Drug Monit 2005;27: [12] Parise RA, Ramanathan RK, Hayes MJ, Egorin MJ. Liquid chromatographic-mass spectrometric assay for quantitation of imatinib and its main metabolite (CGP 74588) in plasma. J Chromatogr B 2003;791: [13] Widmer N, Béguin A, Rochat B, et al. Determination of imatinib (Gleevec ) in human plasma by solid-phase extraction liquid chromatography ultraviolet absorbance detection. J Chromatogr B 2004;803: [14] Roth O, Spreux-Varoquaux O, Bouchet S, et al. Imatinib assay by HPLC with photodiode-array UV detection in plasma from patients with chronic myeloid leukemia: comparison with LC-MS/MS. Clin Chim Acta 2010;411: [15] Haouala A, Zanolari B, Rochat B, et al. Therapeutic Drug Monitoring of new targeted anticancer agents imatinib, nilotinib, dasatinib, sunitinib, sorafenib and lapatinib by LC tandem mass spectrometry. J Chromatogr B 2009;877: [16] Kutsev S, Kravchenko E, Turkina A. Imatinib blood level test in Russian federation. EUTOS Blood Level Testing Summit, November 16 17, 2009, Bordeaux, France (lecture). [17] Velpandian T, Mathru R, Agarwal NK, Arora B, Kumar L, Gupta SK. Development and validation of a simple liquid chromatographic method with ultraviolet detection for the determination of imatinib in biological samples. J Chromatogr B 2004;804: [18] FDA. Guidance for IndustryBioanalytical Method Validation.; [19] Shah VP, Midha KK, Findlay JWA, Hill HM, et al. Bioanalytical method validation a revisit with a decade of progress. Pharmaceut Res 2000;17:

76 1962 K. Mičová et al. / Clinica Chimica Acta 411 (2010) [20] Matuszewski BK, Constanzer ML, Chavez-Eng CM. Strategies for the assessment of matrix effect in quantitative bioanalytical methods based on HPLC-MS/MS. Anal Chem 2003;75: [21] Bakhtiar R, Khemani L, Hayes M, Bedman T, Tse F. Quantification of the antileukemia drug STI571 (Gleevec ) and its metabolite (CGP 74588) in monkey plasma using a semi-automated solid phase extraction procedure and liquid chromatography-tandem mass spectrometry. J Pharm Biomed Anal 2002;28: [22] le Coutre P, Kreuzer KA, Pursche S, et al. Pharmacokinetics and cellular uptake of imatinib and its main metabolite CGP Cancer Chemother Pharmacol 2004;53: [23] Widmer N, Decosterd LA, Csajka C, et al. Population pharmacokinetics of imatinib and the role of α 1 -acid glycoprotein. Br J Clin Pharmacol 2006;62:

77 Příloha 3 Mičová, K., Friedecký, D., Polýnková, A., Faber, E., & Adam, T. Stanovení hladiny tyrosinkinasových inhibitorů metodou UHPLC/MS. Chemical Papers, 34, (2010).

78 Chem. Listy 104, s31 s34 (2010) Cena Merck 2010 STANOVENÍ HLADINY TYROSINKINASOVÝCH INHIBITORŮ METODOU UHPLC-MS/MS KATEŘINA MIČOVÁ a *, DAVID FRIEDECKÝ a *, ADRIANA POLÝNKOVÁ a, EDGAR FABER b a TOMÁŠ ADAM a a Laboratoř dědičných metabolických poruch, Lékařská fakulta, Univerzita Palackého v Olomouci, I.P. Pavlova 6, Olomouc, b Hemato-onkologická klinika, Fakultní nemocnice Olomouc, I.P. Pavlova 6, Olomouc K.Micova@seznam.cz * autoři přispěli práci stejným dílem Klíčová slova: tyrosinkinasové inhibitory, karcinom prsu, leukemie, vysokoúčinná kapalinová chromatografie, tandemová hmotnostní spektrometrie Úvod Díky novým poznatkům v biologii a patofyziologii některých onemocnění byla v poslední době vyvinuta řada léků působících přímo na molekulární úrovni více-méně selektivně v cílových buňkách. K těmto lékům se řadí také inhibitory tyrosinkinas (TKI), které způsobily průlom v léčbě některých nádorových onemocnění, jako například imatinib (Glivec) v léčbě gastrointestinálního stromálního tumoru (GIST). Imatinib společně s dasatinibem (Sprycel) a nilotinibem (Tasigna) zaznamenal rovnež velký úspěch v léčbě chronické myeloidní leukemie (CML) a lapatinib (Tykerb) v léčbě karcinomu prsu (obr. 1). Ukazuje se, že léčebná odpověď na TKI může souviset s jejich dosaženými plasmatickými hladinami. Práce byla zaměřena na stanovení TKI v krevní plasmě pacientů s CML a karcinonem prsu na terapii imatinibem, nilotinibem, dasatinibem a lapatinibem technikou vysoce účinné kapalinové chromatografie ve spojení s tandemovou hmotnostní spektrometrií. Chronická myeloidní leukemie CML je klonální myeloproliferativní onemocnění vznikající transformací hemopoetické kmenové buňky. Toto onemocnění tvoří 1/4 všech leukemií dospělého věku. Fúzí genu BCR na 22. chromosomu s genem ABL na 9. chromosomu vzniká tzv. chromosom Philadelphia (Ph) obsahující onkogen BCR/ABL1, který exprimuje protein p210 konstitutivně aktivní tyrosinkinasu aktivující řadu signálních transdukčních drah, které podporují množení buněk a blokují apoptózu. Dřívější možnosti léčby (interferon alfa, alogenní transplantace krvetvorných buněk) nezaznamenaly takový úspěch jako v posledních letech nově vyvinuté selektivní TKI cíleně inhibující proliferaci nádorového klonu. K těmto novým přípravkům řadíme deriváty 2-fenylaminopyrimidinu imatinib, dasatinib a nilotinib 3,4. Imatinib (IM) a nilotinib jsou účinné inhibitory tyrosinkinasy Bcr/Abl. IM dále interferuje s recep-torem pro Obr. 1. Strukturní vzorce TKI s31

79 Chem. Listy 104, s31 s34 (2010) Cena Merck 2010 stem cell factor (c-kit) a receptorem pro růstový faktor odvozený z destiček (PDGF platelet-derived growth factor), proto se využívá i v léčbě GIST, systémové mastocytosy, hypereozinofilního syndromu a chronické eozinofilní leukemie 5,6,8,9. Dasatinib je navíc účinný inhibitor kinas rodiny Src, které mohou přispívat k proliferaci a přežívání myeloidní řady buněk exprimujících BCR/ABL1 (cit. 7,9 ). Karcinom prsu Karcinom prsu je jedním z nejčastějších zhoubných onemocnění postihující ženskou část populace. Jeho incidence neustále stoupá, ovšem díky novým diagnostickým a terapeutickým možnostem dochází ve vyspělých zemích včetně ČR k poklesu úmrtí způsobených tímto onemocněním. Pro cílenou molekulární biologickou léčbu je nutné znát strukturu molekuly proteinu, jehož inhibicí dochází k narušení základních signálních drah vedoucích k maligní transformaci buňky. Tento typ léčby již není pouze předmětem výzkumu, ale je již s úspěchem používán v klinické praxi. Základními nástroji terapie jsou monoklonální protilátky a nízkomolekulární tyrosinkinasové inhibitory, jako např. lapatinib 1. Lapatinib je selektivní duální inhibitor tyrosinkinas ErbB-1 (EGFR; je zodpovědný za regulaci normálního buněčného růstu, jeho porucha vede k neregulovatelné proliferaci a potenciální malignizaci procesu) a ErbB-2 (HER2; onkogen zaručující predispozici ke karcinomu, je pomalu aktivovatelný a má dlouhodobý vliv na proliferaci). Řadí se mezi cytostatika účinná v léčbě mozkových metastáz díky tomu, že prochází hematoencefalitickou bariérou 1,2,9. Mechanismus účinku TKI spočívá v reverzibilní vazbě na intracelulární cytoplasmatické ATP-vazebné místo tyrosinkinasové Abl domény a zablokování fosforylace tyrosinu bílkovin, které patří k substrátům onkoproteinů, čímž dochází ke znemožnění přenosu signálů vedoucích k maligní transformaci a proliferaci buněk 1 7. Experimentální část Pacientům s CML (n = 682, Hemato-onkologické oddělení FN Olomouc) byla odebrána nesrážlivá krev do zkumavek s EDTA v průměru 24 ± 6 hodin po užití poslední dávky léku. Krev byla poté zcentrifugována a získaná plasma byla zamražena na 20 C. Imatinib, deuterovaný imatinib, desmethylovaný imatinib (Novartis; Curych, Švýcarsko), dasatinib, nilotinib a lapatinib (LC Laboratories; Woburn, MA, USA) byly rozpuštěn v methanolu na výslednou koncentraci 10 3 mol l 1. Tyto standardní roztoky byly použity pro přípravu všech ostatních standardů. Všechny reagencie měly analytický stupeň čistoty a byly získány od firmy Sigma (St. Louis, MO, USA). Plasma (20 l) byla deproteinována methanolem (180 l) s přídavkem interního standardu deuterovaného Obr. 2. Fragmentace IM, separace standardů jednotlivých TKI imatinibu (D8IMA). Poté byl vzorek 3 min třepán na vortexu a následně 5 min centrifugován při RPM. Supernatant byl analyzován technikou UHPLC-MS/MS. Analýzy byly prováděny na přístroji UHPLC (Dionex Ultima 3000 RS). Studované analyty byly separovány na koloně s reverzní fází Acquity BEH C18 1,7 m (2,1 50 mm; Waters). Mobilní fáze se skládala z formiátu amonného o koncentraci 4 mmol l 1 a ph 3,2 (A) a acetonitrilu (B). V čase 0 1 min bylo složení mobilní fáze 17 % B; 1 až 2 min byl aplikován gradient % B; 2,0 2,1 obsahovala mobilní fáze 50 % B a v 2,1 2,2 min byly nastaveny iniciální podmínky. Na koloně termostatované na 40 C byla nastavena průtoková rychlost 0,5 ml min 1. Pro detekci a kvantifikaci byl použit tandemový hmotnostní spektrometr (API 4000, Applied Biosystems) s ionizací elektrosprejem. Podmínky sběru dat jsou shrnuty v tab. I. Za optimálních podmínek byly separovány standardy TKI s celkovou dobou analýzy 2,2 min (obr. 2). Výsledky Metoda byla aplikována na vzorky pacientů s CML a karcinomem prsu na terapii imatinibem (obr. 3), nilotinibem, dasatinibem a lapatinibem. Analyty byly kvantifikovány pomocí interního standardu D8IM. Dále byla práce zaměřena na stanovení korelace mezi plasmatickou hladi- s32

80 Chem. Listy 104, s31 s34 (2010) Cena Merck 2010 Tabulka I Optimalizace MS/MS Analyt MRM přechod [m/z] Čas [ms] měření DP [V] CE [V] CXP [V] IM ,00 116,00 37,00 26,00 D8IM ,00 116,00 37,00 26,00 desim ,00 126,00 37,00 28,00 NIL ,00 101,00 41,00 20,00 LAP ,00 111,00 47,00 24,00 DAS ,00 86,00 45,00 28,00 CAD: 6,00 psi CUR: 20,00 psi GS1: 50,00 psi GS2: 50,00 psi IS: 5500,00 V TEM: 500,00 C EP 10,00 V Typ skenu: MRM Polarita: pozitivní Iontový zdroj: Turbo Spray nou imatinibu a molekulární odpovědi. Bylo zpracováno 600 vzorků od 120 pacientů, jimž byla krev odebírána v průměru 24 ± 6 hodin od poslední podané dávky 400 mg. Data byla zlogaritmována za účelem dosažení normálního rozdělení a poté byla porovnána pomocí dvou nezávislých výběrů (QC Expert, P = 0,05). Skupina pacientů s dobrou odpovědí na léčbu vykazovala statisticky významně vyšší hladiny IM v plasmě; průměrné hodnoty byly 1010 ng ml 1 pro optimální a 785 ng ml 1 pro suboptimální odpověď (obr. 4). Závěr Obr. 3. Analýzy reálných vzorků pacientů s CML na terapii IM; pacient s nízkou (A), střední (B) a vysokou hladinou (C) Tato práce byla zaměřena na vývoj nové metody pro stanovení TKI v krevní plasmě pacientů trpících chronickou myeloidní leukemií a rakovinou prsu, a to technikou ultraúčinné kapalinové chromatografie ve spojení s tandemovou hmotnostní spektrometrií. Metoda se v současné době dostává do rutinní praxe v laboratoři dědičných metabolických poruch, Oddělení klinické biochemie, FN Olomouc. Výsledky plasmatických hladin pomáhají při individuálním rozhodování o změně dávkování léčby především u pacientů se suboptimální odpovědí a nízkou hladinou IM nebo na druhé straně u pacientů s vysokou hladinou IM při úplné molekulární odpovědi. Provádění stanovení hladin TKI má velmi důležitou roli v posouzení compliance nemocných. Další výzkum bude směřován do oblasti stanovení imatinibu v leukocytech pacientů s CML. Předpokládá se, že stanovení hladiny intracelulárního IM a v kombinaci se stanovením plasmatické hladiny při současném vyšetření aktivity transportních systémů umožní lépe předpovědět vznik rezistence na IM a bude mít lepší praktický dopad na rozhodování o léčbě u nemocných s CML léčených IM. Nově vyvinutá metoda pro stanovení TKI v krevní plasmě metodou UHPLC-MS/MS je vysoce účinná a časově nenáročná. Autoři děkují za finanční podporu projektům IGA MZCR NS9627, MSM a A/CZ0046/2/0011. Obr. 4. Krabicové grafy logaritmů koncentrací imatinibu v plasmě u pacientů s optimální (A) a suboptimální molekulární odpovědí (B) Zkratky ABL BCR Abelson tyrosin kinase gen breakpoint cluster region s33

81 Chem. Listy 104, s31 s34 (2010) Cena Merck 2010 CAD CE CML CUR CXP D8IM DAS desim DP Dwell EGFR EP GIST GS1 GS2 HER2 IM IS LAP MRM NIL PDGF Src TEM TKI LITERATURA kolizní plyn kolizní energie chronická myeloidní leukemie curtain gas výstupní potenciál kolizní cely deuterovaný imatinib dasatinib desmethylovaný imatinib deklasterizační pitenciál čas přechodu receptor pro epidermální růstový faktor vstupní potenciál gastrointestinální stromální tumor zmlžovací plyn sušící plyn lidský epidermální receptor imatinib napětí na vstupní kapiláře lapatinib multiple reaction monitoring nilotinib destičkový růstový faktor rodina nereceptorových (celulárních) tyrosinkinas podílející se na růstu buňky teplota zmlžujícího plynu tyrosinkinasové inhibitory 1. Petruželka L., Petruželková L.: Farmakologie 5, 483 (2008). 2. Petráková K., Demlová R.: Remedia 18, 13 (2008). 3. Faderl S., Talpaz M., Estrov Z., Kantarjian H. M.: Ann. Intern. Med. 131, 207 (1999). 4. Kantarjian H. M., Talpaz M., Giles F., O Brien S., Cortes J.: Ann. Intern. Med. 145, 913 (2006). 5. Faber E.: Farmakoterapie 3, 233 (2005). 6. Kantarjian H. M., Giles F., Gattermann N., Bhalla K., Alimena G., Palandri F., Ossenkoppele G. J., Nicolini F. E., O Brien S. G., Litzow M., Bhatia R., Cervantes F., Haque A., Shou Y., Resta D. J., Weitzman A., Hochhaus A., le Coutre P.: Blood 110, 3540 (2007). 7. Quintas-Cardama A., Kantarjian H., Jones D., Nicaise C., O'Brien S., Giles F., Talpaz M., Cortes J.: Blood 109, 497 (2007). 8. Titier K., Picard S., Ducint D., Teilhet E., Moore N., Berthaud P., Mahon F.X., Molimard M.: Ther Drug Monit. 27, 634 (2005). 9. Haouala A., Zanolari B., Rochat B., Montemurro M., Zaman K., Duchosal M. A., Ris H. B., Leyvraz S., Widmer N., Decosterd L. A.: J. Chromatogr., B 877, 1982 (2009). K. Mičová a, D. Friedecký a, A. Polýnková a, E. Faber b, and T. Adam a ( a Laboratory for inherited metabolic disorders, University Hospital and Palacky University Olomouc; b Hemato-oncological clinic, University Hospital, Olomouc): Determination of Tyrosine Kinase Inhibitors in Human Plasma by UHPLC-MS/MS The aim of this study was to develop new rapid and sensitive UHPLC method with tandem mass spectrometry detection for determination and quantification of plasma concentration of tyrosine kinase inhibitiors nilotinib, lapatinib, imatinib and its main metabolite (CGP74588). Pacients' plasma (20 l) was deproteinated by 180 l of methanol with addition of internal standard (deuterated imatinib), sample was shaken, centrifugated 5 min at RPM and supernatant was analysed. Chromatographic separation of drugs and internal standard was achieved on a reverse phase analytical column Acquity BEH C m (2,1 50 mm; Waters). Mobile phase consisted of acetonitrile (B) and 4mM ammonium formiate; ph 3,2 (A). The total run time of the analysis was 2,2 min at a flow rate 0,5 ml min 1. A triple quadrupole detector (API 4000, Applied Biosystems) with electrospray ionization in positive mode was used for detection. Mass spectrometer was operated in multiple-reaction monitoring (MRM) mode (m/z transitions for IM , CGP , D8-IM , NIL , and for LAP ). We demonstrated the suitability of this assay for TKIs using to quantify their concentrations in plasma of patients with chronic myeloid leukemia on imatinib and nilotinib therapy and for patients with breast cancer on lapatinib therapy. s34

82 Příloha 4 Faber, E., Friedecký, D., Mičová, K., Rožmanová, S., Divoká, M., Jarošová, M., Indrák, K., Adam, T. Imatinib trough plasma levels do not correlate with the response to therapy in patients with chronic myeloid leukemia in routine clinical setting. Annals of Hematology, 91, (2012).

83 Ann Hematol (2012) 91: DOI /s x ORIGINAL ARTICLE Imatinib trough plasma levels do not correlate with the response to therapy in patients with chronic myeloid leukemia in routine clinical setting Edgar Faber & David Friedecký & Kateřina Mičová & Šárka Rožmanová & Martina Divoká & Marie Jarošová & Karel Indrák & Tomáš Adam Received: 20 April 2011 / Accepted: 18 December 2011 / Published online: 11 January 2012 # Springer-Verlag 2012 Abstract Association of trough imatinib plasma levels (IPL) with cytogenetic or molecular response to treatment in patients with chronic myeloid leukemia (CML) was repeatedly reported. We analyzed their value in the routine clinical setting in 131 patients with chronic phase CML in whom imatinib was applied as first- or second-line treatment. A total of 1,118 measurements were obtained by ultraperformance liquid chromatography tandem mass spectrometry assay in patients treated with daily dose of imatinib ranging from 100 to 800 mg. Samples were obtained from 1 to 96 h after drug ingestion. High inter (36%) and intraindividual variability (9 33%) of IPL was observed. For analysis of correlation of IPL with treatment response, two sets of samples were selected according to the European LeukemiaNet (ELN) criteria. The first set consisted of 241 samples taken 24±2 h after dosing in 54 patients, and the second one consisted of 329 samples taken 24±4 h after imatinib ingestion in 84 patients. In both sets, only patients treated with 400 mg imatinib once daily for at least 18 months were included. From multiple measurements in Faber and Friedecký contributed equally to the work. E. Faber (*) : Š.Rožmanová : M. Divoká : M. Jarošová : K. Indrák Department of Hemato-Oncology, Faculty of Medicine and Dentistry, Palacký University Olomouc, University Hospital Olomouc, IP Pavlova 6, CZ Olomouc, Czech Republic edgar.faber@fnol.cz D. Friedecký : K. Mičová : T. Adam Department of Biochemistry and Immunogenetics, Laboratory of Inherited Metabolic Disorders, Faculty of Medicine and Dentistry, Palacký University Olomouc, University Hospital Olomouc, IP Pavlova 6, CZ Olomouc, Czech Republic individual patients, mean IPL were used. In both sets, we were not able to demonstrate a statistically significant correlation between IPL and response to treatment according to the ELN. We believe that this was due to the differences in patients compliance, leukemia biology, and other variables that are difficult to eliminate in the routine clinical practice. The use of IPL for prognostic estimation in CML treatment outside the clinical trials is probably limited. Keywords Chronic myeloid leukemia. Imatinib. Plasma levels. Treatment response Introduction Imatinib mesylate has become the drug of choice for firstline treatment of patients with chronic myeloid leukemia (CML). Most patients achieve optimal treatment response according to the European LeukemiaNet (ELN) criteria that comprises complete cytogenetic response (CCyR) at 12 months and major molecular response (MMoR) at 18 months of therapy [1]. Trough imatinib plasma levels (IPL) have been shown to be associated with cytogenetic and molecular responses in two major and a few smaller studies [2 5]. However, other authors found no correlation between IPL and treatment response [6, 7]. Therefore, no definite recommendations for IPL in routine clinical practice have been issued yet. IPL are generally suggested as useful for the assessment of patients with poor compliance, those who do not respond well to treatment. or those with excessive imatinib toxicity [8]. It has been concluded that further studies are needed in order to achieve consensus on the exact role of IPL in the routine clinical CML management [8]. In a recently issued statement of the ELN, no

84 924 Ann Hematol (2012) 91: recommendations on IPL have been implemented [1]. In this study, the prognostic value of IPL for achievement of molecular response in patients in chronic phase CML treated with imatinib for more than 18 months in a single center was analyzed. Patients and methods Patients The study was conducted in accordance with the ethical standards based upon the 1964 Declaration of Helsinki. All patients consecutively treated at the department and who gave informed consent approved by the local ethics committee were included into this retrospective study. Diagnosis of CML was established in each case from the findings in blood count and bone marrow and was confirmed by the demonstration of Philadelphia chromosome by standard cytogenetics and/or BCR-ABL fusion gene by fluorescence in situ hybridization (FISH) or reverse transcriptase polymerase chain reaction. The phase of disease at diagnosis was identified according to the ELN criteria [9]. Sokal score was calculated according to the formula in the original publication [10]. At the beginning of the treatment, standard dosage of 400 mg daily in one dose was given to all patients. Due to hematologic or nonhematologic toxicity, the dose was individually reduced to 300, 200, or 100 mg daily, and in some patients, intermittent dosage was used in addition [11]. In cases of suboptimal response, the dose of imatinib was escalated to 500, 600, or 800 mg daily. Median duration of imatinib treatment was 82 months (range, ) in the second-line treatment after interferon and 59 months (range, 21 99) when imatinib was given as the front-line therapy. IPL results in all 131 patients were analyzed for the impact of absolute given dose of imatinib and interval from the ingestion of imatinib to blood sampling on IPL. However, only samples taken in two groups of 54 and 84 patients treated with 400 mg of imatinib in one daily dose in whom sampling of the blood was performed 24±2 and 24 ±4 h after ingestion of the drug, respectively, were included into the analysis of IPL and gender, age, body weight, body surface area, and response to treatment correlation. Hematologic, cytogenetic, and molecular responses to treatment were assessed according to the ELN criteria [9]. Cytogenetics and FISH Cytogenetic examinations were performed according to the standard procedure from bone marrow cells at the time of starting imatinib therapy and then once a year or at the time of progression. FISH with LSI BCR-ABL ES and/or LSI BCR-ABL Dual Fusion probes (Abbott-Vysis, Downers Grove, IL, USA) was applied at the beginning of imatinib treatment and then at least once in 6 months. In case of additional cytogenetic abnormalities, FISH with centromeric (Abbott-Vysis) and/or painting probes (Cambio Ltd., Cambridge, UK) was performed. Cytogenetic response was classified as complete (0% Ph-positive mitoses), major (1 34%), minor (35 67%), and minimal (68 99%) as described previously [12]. Interphase FISH was used for the assessment of the response in cases of culture failure. In that case, finding up to 1% of positive cells represented a complete cytogenetic response in the study. RQ-PCR for BCR-ABL Quantitative reverse transcriptase polymerase chain reactions (RQ-PCR) for BCR-ABL mrna transcript levels were performed using the LightCycler instrument (Roche Diagnostics, Mannheim, Germany). Total leukocyte RNA was extracted from peripheral blood and/or bone marrow aspirate after lysis of red blood cells according to the standard protocol [13]. RNA was reverse transcribed to cdna with transcriptor reverse transcriptase (Roche Diagnostics, Mannheim, Germany) using random hexamers. Primers and TaqMan probe sequences published in the EAC network protocol were used for RQ-PCR [14]. Briefly, 100 ng cdna was added to 2 μl master mix (LightCycler FastStart DNA Master Hybridization Probes; Roche Diagnostics, Mannheim, Germany) in 20 μl total reaction volume with final concentration of 4 mm MgCl 2, 300 nm primers, and 200 nm TaqMan probe. The PCR program included initial denaturation step for 10 min at 95 C and 50 cycles (95 C, 10 s, 20 C/s)/(60 C, 30 s, 20 C/s). BCR-ABL and ABL assays were performed in duplicate. Mean crossing points were used to interpolate standard curves and to calculate the transcript copy number. Normalized levels were calculated as the BCR-ABL/ABL ratio and expressed as percentage. The standard curve was generated using serial dilutions of a linearized plasmid, containing BCR-ABL insert FGRS10 (Ipsogen, Marseille, France). The plasmid used to quantify the endogenous control gene ABL was CGRS01 (Ipsogen, Marseille, France). Results of RQ-PCR were set on international scale (IS) with conversion factor estimated during European LeukemiaNet external quality control. MMoR was defined as BCR-ABL 0.1% IS (at least 1,000 copies of ABL), corresponding to a 3-log reduction [1]. Measurement of imatinib plasma levels Imatinib plasma concentrations were measured by ultraperformance liquid chromatography tandem mass spectrometry assay [15] using the UHPLC UltiMate 3000 RS (Dionex, USA) coupled with the API 4000 tandem mass spectrometer (Applied Biosystems, USA). Samples were

85 Ann Hematol (2012) 91: obtained from 1 to 96 h after drug ingestion. In order to assess correlation between IPL and treatment response, two sets of samples were analyzed. First set consisted of 241 samples taken 24±2 h after 400 mg was given in one daily dose in 54 patients. Second set consisted of 329 samples taken 24±4 h after imatinib ingestion in 84 patients. Both groups have been treated with imatinib for at least 18 months. From multiple measurements in individual patients, mean IPL were used for statistical assessment. Patients with BCR-ABL kinase domain mutations that caused the resistance to treatment were excluded from the first set. In order to perform statistical evaluation of measured data regression analysis, t statistics and description statistics were applied. Results Characteristics of our cohorts of CML patients are depicted in Table 1. In both groups of patients used for evaluation of IPL and treatment response, only two and seven patients, respectively, did not achieve complete cytogenetic response, and therefore, the impact of IPL on probability of achievement of cytogenetic response could not have been estimated. According to the ELN criteria, 28 (52%) and 46 (55%) patients, respectively, achieved optimal cytogenetic response. Optimal molecular response according to the ELN recommendations was achieved in 20 (37%) and 31 (37%) patients from both sets, respectively. A total of 1,118 measurements were obtained by ultraperformance liquid chromatography tandem mass spectrometry assay in 131 patients (79 males, 52 females) treated with various regimens ranging from 100 to 800 mg daily, interval between last dose administration and blood taking varied from 1 to 96 h, and IPL reached 2 10,800 ng/ml (Table 2). In most patients, IPL were measured at several occasions: in 4 (3%) patients, only once; in 5 (4%) patients, twice; in 19 (14%) patients, 3 to 5 times; and in 103 (79%) patients, more than 5 times. Assessments of IPL were performed at routine checkups at non-predefined time intervals Table 1 Baseline characteristics of patients cohorts at sampling time of 24±2 h (A), 24±4 h (B), and 0 96 h (C) A B C Number of patients no. (%) 54 (100) 84 (100) 131 (100) Male 32 (59) 50 (60) 79 (60) Female 22 (41) 34 (40) 52 (40) Age Median (years) Range (years) Body weight Median (kg) Range (kg) Body surface area Median (m 2 ) Range (m 2 ) Phase of disease at diagnosis Chronic phase 54 (100) 83 (99) 126 (96) Accelerated phase 0 (0) 1 (1) 4 (3) Blastic phase 0 (0) 0 (0) 1 (1) Sokal score no. (%) Low risk (<0.8) 22 (41) 31 (37) 51 (39) Medium risk ( ) 19 (35) 34 (40) 47 (36) High risk (>1.2) 10 (18) 16 (19) 29 (22) Unknown 3 (6) 3 (4) 4 (3) Presence of BCR-ABL mutations 0 (0) 1 (1) 5 (4) Presence of additional cytogenetic abnormalities 2 (4) 5 (6) 12 (9) Imatinib dose 400 mg once daily 54 (100) 84 (100) 103 (78.5) Lower than 400 mg daily 0 (0) 0 (0) 10 (7.5) Higher than 400 mg daily 0 (0) 0 (0) 18 (14) Patients pretreated with interferon-α no. (%) 32 (59) 41 (49) 58 (44)

86 926 Ann Hematol (2012) 91: Table 2 Response to the treatment and IPL in the subgroup of patients at sampling time of 24±2 h (A), 24±4 h (B), and 0 96 h (C) A B C Response to the treatment Number of patients no. (%) IPL, ng/ml (min max; median) Number of patients no. (%) IPL, ng/ml (min max; median) Number of patients no. (%) IPL, ng/ml (min max; median) Group of the patients 54 (100) 396 2,012; (100) 139 3,460; (100) 2 10,800; 1,140 analyzed Cytogenetic response no. (%) Complete (irrespective of 52 (96) 396 2,012; (92) 139 2,957; (89) 17 10,800; 1,935 time of achievement) Complete achieved within 28 (52) 396 2,012; (55) 139 2,012; (49) 2 5,650; 1, months Not achieved 2 (4) ; (7) 607 2,407; 1, (11) 27 3,732; 953 Molecular response no. (%) Major (irrespective of time 40 (74) 396 1,710; (71) 139 3,460; (70) 2 6,770; 1,100 of achievement) Major achieved within 20 (37) 396 1,608; (37) 139 3,460; (34) 2 6,770; 1, months Not achieved 14 (26) 503 2,012; (29) 473 2,407; (30) 27 10,800; 1,190 from the beginning of the therapy. Selected 241 samples were taken 24±2 h after 400 mg was given in one daily dose in 54 patients, and they were used for the following analyses: relation between IPL of males (mean, ng/ml; SD ng/ml) and females (mean, ng/ml; SD ng/ml; P00.898), relation between IPL and body weight (R ), body surface area (BSA) (R E 05), dose per kilogram (R ), and dose per square meter (R E 05). No significant tendencies were observed. Associations of IPL with age were also estimated, and weak correlation (R ) was found. We observed a high interindividual variability (36%), but in several cases, we also observed intraindividual variability (means between 9 33%, n>5) of IPL. We confirmed a correlation of IPL with absolute dose (R , Fig. 1) and interval between ingestion and sampling (R , exponential correlation; Fig. 2). However, we were not able to demonstrate a clear correlation between IPL and MMoR (P00.673). IPL in patients with (n040; ±314.52, mean±sd) and without (n014, ±403.71) MMoR were almost equal to each other. We also were not able to confirm any statistically significant difference between IPL in patients with optimal (888.4± 344.4, mean±sd; n025) and suboptimal (1083.2±400.0, n013) treatment responses (P ) and IPL in patients with treatment failure (935.2±245.3, n016, P ) according to the ELN when both criteria for cytogenetic and molecular responses were applied simultaneously (Fig. 3). A separate comparison between IPL in patients pretreated with interferon (n032) who achieved MMoR (n023) and those who did not achieve MMoR (n09) also gained statistically insignificant results despite certain difference in IPL (1,022± and 836±336.74, median±medsd; P00.960). Finally, we performed analysis in the second set of samples (n0329) collected from 84 patients 24±4 h after imatinib dose administration. Into this analysis, samples of patients with mutations in BCR-ABL kinase domain were also included, but other conditions for inclusion were not changed (a single dose of 400 mg per day and duration of the treatment was at least 18 months). No correlation between IPL and body weight (R ), BSA (R ), dose per kilogram (R ), and dose per square meter (R ) was found. IPL in men and women did not differ significantly (P00.456). A weak correlation was observed between IPL and age (P00.131). Also, in this extended group of patients and samples, we did not find any relation between IPL and MMoR (P00.761). Finally, we did not find any association between IPL and treatment response according to the ELN (Fig. 4). Discussion Fig. 1 Relation between IPL and dose of imatinib (R ) Picard et al. showed for the first time that IPL may have a prognostic value in patients with CML treated with first-line imatinib [3]. They measured IPL in 68 patients in chronic or

87 Ann Hematol (2012) 91: Fig. 2 Correlation between IPL and interval between drug administration and blood sampling (n01,118 samples) accelerated phase CML treated with 400 or 600 mg of imatinib daily at unspecified time intervals from the start of imatinib treatment, and they found significantly higher IPL in patients achieving CCyR and MMoR [3]. Their observation was confirmed by Larson et al. who reported the results of a pharmacokinetic part of the IRIS study using day 29 IPL measurements and found IPL to be associated not only with CCyR and MMoR but also with significantly different progression-free survival of patients divided into four groups according to IPL [2]. Both studies confirmed high interpatient variability of IPL that may be influenced by various factors including drug absorption, different binding to plasma proteins, variability in metabolizing liver enzymes, and patients demographic factors [8]. Also, our team was able to confirm the correlation of IPL with the probability of achieving MMoR in a small group of patients [5]. However, there are at least two other studies that found no correlation between IPL and patients prognosis [6, 7]. Despite speculations that IPL could assist with decisions about whether to increase an imatinib dose, IPL measurement is recommended as helpful in situations when poor adherence to treatment is suspected, severe side effects are observed, or drug interactions should be ruled out [8]. Further studies are awaited to confirm prospectively the link between IPL and response to treatment and to define effective trough concentrations in different patient populations [8]. No clear recommendation has been issued regarding IPL estimations in CML patients in the recent statement paper of ELN experts [1]. Major overlap of IPL between patients with optimal and suboptimal responses that was observed in our study and even in the studies that found significant difference in IPL between responding and failure patients represents a significant obstacle to the use of IPL for clear prognostic discrimination and for dosage adjustments in the routine clinical setting. Fig. 3 Comparison between IPL in patients with optimal (A; 888.4± 344.4, n025) and suboptimal (B; ±400.0, n013) treatment responses and also in patients with treatment failure (C; 935.2± 245.3, n016) according to the ELN (54 patients; A vs B: P00.126, AvsC:P00.640) Fig. 4 Comparison between IPL in patients with optimal (A; ± 651.4, n038) and suboptimal (B; ±404.6, n022) treatment responses and also in patients with treatment failure (C; ± 479.2, n024) according to the ELN (84 patients; A vs B: P00.990, AvsC:P00.949)

88 928 Ann Hematol (2012) 91: To our best knowledge, there is only one prospective study that uses low IPL for routine escalation of the dosage. Osborn and coworkers published the interim results of the TIDEL II prospective study that used IPL measured at day 22 of imatinib therapy in 74 CML patients for subsequent dosage adjustment [16]. In 11 (15%) patients, IPL lower than 1,000 ng/ml was found, and seven (9.5%) of them were able to escalate the imatinib daily dose to 800 mg. These patients achieved mean IPL comparable with the rest of the group at 3 and 6 months, and their molecular response also improved [16]. We were able to identify seven patients with IPL lower than the recommended concentration (<1,000 ng/ml) among 13 patients with suboptimal treatment response according to ELN from 54 patients treated with first-line imatinib at our center since Furthermore, only eight patients in a group with optimal treatment response (n025) achieved IPL higher than 1,000 ng/ml. Only in the case of two patients, we escalated therapeutic dose of imatinib and obtained an increase of IPL, and also, optimal treatment response was achieved [17]. Our results might have been influenced by the number of patients analyzed including lower proportion of suboptimal or failure patients. Irrespective to that limitation, we believe that our failure to demonstrate the correlation between IPL and molecular response to imatinib is caused by difference in patients compliance, leukemia biology, and other variables that are difficult to eliminate in routine clinical practice. IPL may be used for identification of patients with poor compliance or in cases of excluding prominent toxicity, but their use for prognostic estimate outside the clinical trials might be limited. Our observed data confirmed correlation between IPL and absolute dose as also reported in several studies [3, 18, 19]. These data do not provide any additional information useful for the management of CML treatment of patients with suboptimal response. Acknowledgments The work was supported by grants of European LeukemiaNet, NT /2011 (Ministry of Health, the Czech Republic), MSM , and MSM (Ministry of Education, Youth and Sports, the Czech Republic) and LFUP We are grateful to Mgr. Pavel Kurfürst for editorial help with the manuscript. The infrastructural part of this project (Institute of Molecular and Translational Medicine) was supported from the Operational programme Research and Development for Innovations (project CZ.1.05/2.1.00/ ). References 1. Baccarani M, Cortes J, Pane F, Niederwieser D, Saglio G, Apperley J et al (2009) Chronic myeloid leukemia: an update of concepts and management recommendations of European LeukemiaNet. J Clin Oncol 27: Larson RA, Druker BJ, Guilhot F, O Brien SG, Riviere GJ, Krahnke T, for the IRIS (International Randomized Interferon vs. STI571) Study Group et al (2008) Imatinib pharmacokinetics and its correlation with response and safety in chronic phase chronic myeloid leukemia: a subanalysis of the IRIS study. Blood 111: Picard S, Titier K, Etienne G, Teilhet E, Ducint D, Bernard M-A et al (2007) Trough imatinib plasma levels are associated with both cytogenetic and molecular responses to standard dose imatinib in chronic myeloid leukemia. Blood 109: Singh N, Kumar L, Meena R, Velpandian T (2009) Drug monitoring of imatinib levels in patients undergoing therapy for chronic myeloid leukaemia: comparing plasma levels of responders and non-responders. Eur J Clin Pharmacol 65: Faber E, Friedecky D, Tomkova J, Rozmanova S, Rohon P, Skoumalova I et al (2008) Imatinib plasma levels correlate with molecular response in CML patients. Haematologica 93 (suppl 1): , Abstract Forrest DL, Trainor S, Brinkman RR, Barnett MJ, Hogge DE, Nevill TJ et al (2009) Cytogenetic and molecular responses to standard-dose imatinib in chronic myeloid leukemia are correlated with Sokal risk scores and duration of therapy but not trough imatinib plasma levels. Leukemia Res 33: Davies A, Hayes AK, Giannoudis A, Lucas CM, Knight K, Watmough SJ et al (2009) A study of plasma levels of imatinib and its bioactive metabolite CGP reveals no correlation with subsequent clinical outcome in imatinib-treated chronic myeloid leukemia. Haematologica 94(suppl 2):259, Abstract Cortes JE, Egorin MJ, Guilhot F, Molimard M, Mahon F-X (2009) Pharmacokinetic/pharmacodynamic correlation and blood-level testing in imatinib therapy for chronic myeloid leukemia. Leukemia 23: Baccarani M, Saglio G, Goldman J, Hochhaus A, Simmonsson B, Appelbaum F et al (2006) Evolving concepts in the management of chronic myeloid leukemia: recommendations from an expert panel on behalf of the European LeukemiaNet. Blood 108: Sokal JE, Cox EB, Baccarani M, Tura S, Gomez GA, Robertson JE et al (1984) Prognostic discrimination in good-risk chronic granulocytic leukemia. Blood 63: Faber E, Naušová J, Jarošová M, Egorin MJ, Holzerová M, Rožmanová Š et al (2006) Intermittent dosage of imatinib mesylate in CML patients with history of significant hematologic toxicity after standard dosing. Leuk Lymphoma 47: The Italian Cooperative Study Group on Chronic Myeloid Leukemia (1994) Interferon alfa-2a as compared with conventional chemotherapy for the treatment of chronic myeloid leukemia. N Engl J Med 330: Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: Gabert J, Beillard E, van der Velden VHJ, Bi W, Grimwade D, Pallisgaard N et al (2003) Standardization and quality control studies of real-time quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia a Europe against cancer program. Leukemia 17: Mičová K, Friedecký D, Faber E, Polýnková A, Adam T (2010) Flow injection analysis vs. ultra high performance liquid chromatography coupled with tandem mass spectrometry for determination of imatinib in human plasma. Clin Chim Acta 411: Osborn MP, White DL, Saunders VA, Cambareri B, Branford S, Menelaou A, et al (2009) Early dose-escalation in chronic myeloid leukaemia patients with low plasma imatinib levels leads to equivalent BCR-ABL values and drug levels at 6 months to those with optimal drug levels: first analysis from the TIDEL II trial of denovo patients treated with 600 mg imatinib. Blood 114(22); Abstract Faber E, Friedecký D, Mičová K, Divoká M, Katrincsáková B, Rožmanová Š et al (2010) Imatinib dose escalation in two patients with chronic myeloid leukemia with low trough imatinib plasma

89 Ann Hematol (2012) 91: levels measured at various intervals from the beginning of therapy and with suboptimal treatment response lead to the achievement of higher plasma levels and major molecular response. Int J Hematol 91: Ishikawa Y, Kiyoi H, Watanabe K, Miyamura K, Nakano Y, Kitamura K et al (2010) Trough plasma concentration of imatinib reflects BCR-ABL kinase inhibitory activity and clinical response in chronic-phase chronic myeloid leukemia: a report from the BINGO study. Cancer Sci 101: Sakai M, Miyazaki Y, Matsuo E, Moriuchi Y, Hata T, Fukushima T et al (2009) Long-term efficacy of imatinib in a practical setting is correlated with imatinib trough concentration that is influenced by body size: a report by the Nagasaki CML Study Group. Int J Hematol 89:

90 Příloha 5 Mičová, K., Friedecký, D., Faber, E., Adam, T. Isotope dilution direct injection mass spectrometry method for determination of four tyrosine kinase inhibitors in human plasma. Talanta, 93, (2012).

91 Talanta 93 (2012) Contents lists available at SciVerse ScienceDirect Talanta j ourna l ho me page: Isotope dilution direct injection mass spectrometry method for determination of four tyrosine kinase inhibitors in human plasma K. Mičová a,1, D. Friedecký a,1, E. Faber b, T. Adam a, a Laboratory for Inherited Metabolic Disorders, University Hospital and Palacký University in Olomouc, I.P. Pavlova 6, CZ Olomouc, Czech Republic b Department of Hemato-Oncology, Faculty of Medicine and Dentistry, Palacký University in Olomouc, I.P. Pavlova 6, CZ Olomouc, Czech Republic a r t i c l e i n f o Article history: Received 6 January 2012 Received in revised form 9 February 2012 Accepted 16 February 2012 Available online 22 February 2012 Keywords: Tyrosine kinase inhibitors Human plasma Chronic myeloid leukemia Therapeutic drug monitoring Direct injection Tandem mass spectrometry a b s t r a c t Background: Therapeutic drug monitoring is recommended for the optimal management of patients with several malignant diseases. The aim of this study was to develop and validate an isotope dilution direct injection mass spectrometry method for the high throughput determination of tyrosine kinase inhibitors in plasma from leukemic and cancer patients. Methods: The plasma for analysis was deproteinated by methanol and the centrifuged supernatant was directly injected to mass spectrometer without separation step. Multiple reaction monitoring modes on a hybrid triple quadrupole linear ion trap mass spectrometer (5500 QTRAP) were used for the detection and quantification of imatinib, nilotinib, lapatinib, and dasatinib. Results: We developed a fast method with analysis time of 55 s and 19 s in multiple injection setting. The method was successfully validated and applied to the patient plasma samples. In order to overcome insufficient sensitivity of dasatinib, multiple reaction monitoring cube mode in linear ion trap (MRM 3 ) was successfully applied. The limits of quantification were in the range ng/ml. Imprecisions were lower than 6.9% and the accuracy of the quality control samples ranged between 99.0 and 107.9%. Conclusions: Isotope dilution direct injection mass spectrometry method allows high-throughput therapeutic drug monitoring of tyrosine kinase inhibitors in plasma. The method offers low-cost analyses as a result of its speed and the exclusion of separation step and can be advantageously used in routine clinical practice. The method can be applied on various drugs and biochemical markers with the use of triple quadrupole instruments Elsevier B.V. All rights reserved. 1. Introduction Cancer is one of the most extensive causes of death in the world. Thanks to advanced understanding of cancer cell biology e.g. signaling pathways that are deregulated in tumor cells as well as finding of mutations in oncogenes and grow suppressor genes, novel multiple targets and approaches for the treatment of malignancies have been identified. Particularly small molecule inhibitors of mutant tyrosine kinases became significant promise for upcoming era of targeted therapy. Tyrosine kinases (TKs) play central role in regulation of essential processes in cell cycle especially in differentiation, proliferation, growth and apoptosis. Any disturbance of TK activity leads to several human disorders including leukemia, and solid tumors such as gliomas, tumors of bladder, lung, head, neck and breast [1,2]. Corresponding author. Tel.: ; fax: address: tomasadam@gmail.com (T. Adam). 1 Both authors contributed equally to the work. X-ray crystallographic studies of the TKs tertiary structure enabled and accelerated selective drug development [3]. In recent years, a large number of tyrosine kinase inhibitors (TKIs) have been developed and many preclinical and clinical studies have been reported. Imatinib mesylate (formerly STI571) has been developed as the first and currently has been the most extensively investigated TKI. This small molecule inhibits c-abl, PDGFR, and c-kit TKs, hence it is used for the treatment of gastrointestinal stromal tumors, mastocytosis, hypereosinophilic syndrome and myeloproliferative disorders, especially chronic myeloid leukemia [1,4]. Resistance or intolerance of imatinib (IMA) remains the most serious problem associated with the failure of treatment in patients with suboptimal response. Second-generation tyrosine kinase inhibitors (TKIs) such as dasatinib (DAS) and nilotinib (NIL) are a possible solution of this problem. Both of these have shown significant clinical activity in patients with CML who became resistant or intolerant to IMA or other therapies [5,6]. Other TKIs such as lapatinib (LAP), erlotinib, gefitinib, trastuzumab and others are used for the treatment of many disorders e.g. breast, colon, lung and other solid tumors [2,7]. Therapeutic drug monitoring (TDM) is widely useful important tool for improving the treatment benefits by evaluation of patient /$ see front matter 2012 Elsevier B.V. All rights reserved. doi: /j.talanta

92 308 K. Mičová et al. / Talanta 93 (2012) compliance with therapy, individualizing daily dosage because of inter-patient variability, diagnosing of undertreatment, avoiding toxicity, monitoring and detecting of drug drug or food drug interactions and guiding withdrawal of therapy. TDM has also been shown to be cost-advantageous for many drugs [8]. Several studies proved correlation between IMA through plasma levels and clinical response [9 14]. In general, patients with optimal treatment response have higher IMA plasmatic concentration than patients with suboptimal response. Methods for the detection and quantification of IMA and other TKIs in human plasma have been published [15 18]. The most commonly used technique is liquid chromatography coupled with single or triple quadrupole mass spectrometry. Sample preparation is usually based on simple protein precipitation by organic solvents. Separations are performed on short C18 RP columns with a typical particle size of 5 m. Analyses for simultaneous quantification of TKIs take several minutes, including the column wash and re-equilibration steps [15,16]. We developed an ultra-high-performance liquid chromatographic method for TKI determination with a separation time of 2.2 min. High effectivity was made possible by 1.7 m C18 RP particles [17]. Another approach covers separation on HILIC column with short analysis time of 1 min [18]. Compounds are usually ionized by electrospray in positive mode. In tandem mass spectrometry, products of molecular ion fragmentation are detected in multiple reaction monitoring (MRM) mode. Quantification is mostly based on the addition of deuterated internal standards [16,17]. Isotope dilution direct injection method coupled with tandem mass spectrometry became one of the essential techniques for quantitative determination of small molecules in clinical practice. It is extensively used in newborn screening programs [19 21] and plays significant role in diagnosing of various metabolic disorders. Number of metabolites in human body fluids serves as biomarkers for many types of diseases including prostate and colorectal cancer [22,23], Crohn s disease [24], cardiologic defects [25] or selected metabolic disorders [26 29]. Commonly MRM mode is used for accurate measurement. However some small analytes offer poor analytical parameters due to interferences in biological extracts and MRM 3 mode can be applied with advance. This approach provides easy, highly selective and extremely sensitive analyses [30 32]. In this work we developed and validated a fast and inexpensive isotope dilution direct injection method coupled with tandem mass spectrometry for the simultaneous determination of TKIs in human plasma without the need of chromatographic separation using common sample preparation. 2. Materials and methods 2.1. Chemicals and reagents Imatinib mesylate, nilotinib, and dasatinib were purchased from LC Laboratories (Woburn, MA, USA) and deuterated standards (D8-imatinib, D6-nilotinib, D8-dasatinib, D4-lapatinib-ditosylate) and lapatinib from TLC PharmaChem (Vaughan, Ontario, Canada). Formic acid, ammonium hydroxide, water, and methanol were all LC/MS grade and were purchased from Sigma (St. Louis, MO, USA); dimethylsulfoxide (DMSO) was obtained from Lachema (Brno, Czech Republic). Plasma samples of healthy volunteers and patients in tri-potassium salts of ethylenediaminetetraacetic acid (K 3 EDTA) were obtained from Hemato-Oncology Clinic, University Hospital Olomouc (Czech Republic). The internal quality control (IQC) samples for imatinib, nilotinib, and dasatinib were obtained from Chromsystems (Munich, Germany), and the external quality control (EQC) samples for imatinib were obtained from Service de pharmacologie clinique (Center Hospitalier Universitaire de Bordeaux, France) Standard solutions, quality control samples Stock solutions of IMA mesylate and D8-IMA were prepared by dissolving them in methanol to a yield concentration of 1 mg/ml expressed as free substances. IMA was further diluted in methanol to obtain solutions with concentration levels in the range g/ml. The internal standard was finally diluted in methanol to a working concentration of 22.5 ng/ml. NIL, DAS, LAP, and their deuterated internal standards (D6-NIL, D8-DAS, D4-LAP-ditosylate) were dissolved in DMSO to a yield concentration of 1 mg/ml expressed as free substances. All the drugs were subsequently diluted in methanol to obtain a concentration of g/ml for DAS, g/ml for NIL, g/ml for LAP, 50 ng/ml for D8-DAS, 100 ng/ml for D6-NIL, and 75 ng/ml for D4-LAP. The calibration standards and controls were prepared from drug-free plasma from healthy volunteers enriched with particular analytes to the required concentration. All the solutions were stored at 20 C. Lyophilized IQC samples were dissolved in 2 ml of pure water and the definite aliquot was processed by a standard procedure as described below. The EQC plasma sample aliquots were processed in the same way Sample preparation This study was conducted in accordance with the Helsinki Declaration, and the protocol was reviewed by the hospital ethics committee. All the patients who were examined gave their informed consent to participation in the study before blood sampling. The blood from healthy control volunteers and patients treated with TKI was put into a test tube with the addition of an anticoagulant (EDTA), and subsequently centrifuged (1200 g; 5 min). A small volume of the plasma (20 L) was precipitated by methanol enriched by an adequate internal standard (180 L) in 1.5 ml Eppendorff tubes. Subsequently, the sample was put into a sonicator for 1 min, shaken for 5 min, cooled for 30 min at 20 C, and centrifuged for 5 min at 14,300 g. The supernatant was placed into 350 L glass vial (12 mm 32 mm, fused insert) and directly injected into a mass spectrometer or stored in a freezer at 20 C before analysis Isotope dilution direct injection analysis TKI plasma levels were measured using UltiMate 3000 RS (Dionex, Sunnyvale, CA). The samples were maintained in a thermostated autosampler rack with the temperature set to +5 C during analysis. In order to prevent carryover of plasma samples and enhance ionization organic solvents with addition of formic acid are commonly used for direct injection analyses [33]. Based on the physical and chemical properties of TKIs and deproteination solvent the mobile phase consisting of methanol and 0.1% formic acid was chosen. The flow rate was set at 0.30 ml/min for min and min; in the measuring period between 0.12 and 0.40 min the flow rate was reduced to 0.03 ml/min. The samples (0.5 L) were injected directly into a mass spectrometer without using chromatographic separation. In order to obtain maximum sample throughput with optimized multiple injection in one analysis the flow rate was increased to 0.5 ml/min and injections of all samples were performed in sequence every 19 s.

93 K. Mičová et al. / Talanta 93 (2012) Table 1 Optimized mass spectrometry parameters for analyzed compounds. MRM transition DP (V) CE (V) CXP (V) IMA IMA D8-IMA D8-IMA NIL NIL D6-NIL D6-NIL DAS DAS D8-DAS D8-DAS LAP LAP D4-LAP D4-LAP Tandem mass spectrometry All the experiments were performed on a QTRAP 5500 triple quadrupole instrument (AB Sciex, Foster City, CA, USA). Mass spectrometric detection of the analytical run was monitored in positive MRM and MRM 3 modes. The dwell times of two MRM transitions between the precursors and product ions for each compound and each appropriate internal standard were set to 30 ms. The parameters of the ion source were optimized to the following settings: an ionization spray voltage of 5500 V, curtain gas of 30 psi, heater gas of 40 psi, turbo ion spray gas of 40 psi, a source temperature of 350 C, and entrance potential of 10 V. High-purity nitrogen was used as the collision gas. The gas pressure for collision-activated dissociation was adjusted to medium settings. Declustering potential, collision energy, and collision cell exit potential were optimized on standards of the analytes under study in a methanolic solution of 0.1% formic acid. All the parameters are detailed in Table 1. Both quadrupoles (Q1 and Q3) were set to unit resolution. The Analyst software (AB Sciex, USA) was used for tuning the mass spectrometry parameters and data evaluation and quantification on the basis of the ratio of the corrected peak area of the compound and its deuterated internal standard. In order to exclude possible interferences the ratios of the two m/z transitions for each analyte and its deuterated standard were determined. Due to low signal-to-noise ratio in MRM mode of DAS the MRM 3 mode was used to improve sensitivity and the selectivity of the method. In order to achieve secondary fragmentation of first product ion, the third quadrupole operated in the linear ion trap (LIT) mode. In this experiment, the protonated DAS (m/z 488.0) was isolated as a first precursor in the first quadrupole and fragmented in collision cell (the second quadrupole) to a first product using collision gas flow at the medium instrument setting, a collision energy of 41 V, and a declustering potential of 50 V. The first product was subsequently trapped in the third quadrupole (working in LIT mode) using a dynamic LIT fill time of up to 250 ms and an excitation time of 25 ms and fragmented under an excitation energy of 0.13 V, giving the most intensive second product ion at m/z Finally, the MRM 3 ion transition of was monitored for the quantification of DAS. LIT was set to perform a mass scan centered at m/z with a mass window of 0.5 Da ( Da) Method validation The method validation was based on the recommendations published by the Food and Drug Administration (FDA) [34], and European Medicine Agency [35]. Validation procedure was performed for all inhibitors in one method by the use of 0.3 and 0.03 ml/min flow rate. In order to obtain maximum speed, finally we tested multiinjection method with flow rate of 0.5 ml/min and compared it with LC MS/MS method Linearity, limit of detection, limit of quantification The plasma of healthy volunteers, with the addition of 10, 30, 100, 300, 1000, 3000, and 10,000 ng/ml of IMA and NIL, 3, 10, 30, 100, 300, and 1000 ng/ml of DAS, and 25, 50, 250, 500, 2500, 5000, and 10,000 of LAP in triplicates was used for the construction of the calibration curves. For the quantification and calculation of the linear regression model (least-square method) fitted by 1/x weighting, the concentration as dependence between the peak area ratio of the TKI/internal standard and concentration was used. The linearity slope, intercept, correlation coefficient, and standard deviation were calculated. The sensitivity of the method was determined on blank plasma with addition of low TKI standard concentration: 30 and 10 ng/ml for IMA and NIL, 10 and 5 ng/ml for DAS, and 25 and 10 ng/ml for LAP to reflect the lowest clinically relevant concentrations based on previously published pharmacokinetics data [36]. The limit of detection (LOD) and limit of quantification (LOQ) were calculated as a signal-to-noise ratio of 3 and 10, respectively; the bias and coefficient of variation were determined on LOD/LOQ concentration levels (n = 10, spiked plasma) Imprecision, recovery, accuracy Intra- and inter-day imprecision and recoveries were measured using plasma samples added to 3000, 1000, and 300 ng/ml for IMA and NIL, 300, 100 and 30 ng/ml for DAS, and 5000, 2500, and 500 ng/ml for LAP in six replicates within one day and consecutive six days, respectively. Means and standard deviations were calculated by the ANOVA method; recovery was expressed as a percentage of target value on IQC samples. Accuracy was measured using IQC for IMA, NIL, DAS on two concentration levels, and EQC in 15 samples for IMA Ion suppression Quantitative determination of matrix effects was performed on six different blank plasma samples with the addition of TKIs to the same final concentration as for imprecision evaluation. Ion suppression was calculated as the ratio of signal intensities of a plasma sample supplemented by TKIs to the final concentration equal to the standard solution and the standard solution of TKIs dissolved in methanol.

94 310 K. Mičová et al. / Talanta 93 (2012) Fig. 1. Representative direct injection analysis-data of IQC (IMA, c = 1911 ng/ml; NIL, c = 1184 ng/ml; DAS, c = 252 ng/ml) and added plasma (LAP, c = 2500 ng/ml) samples measured in MRM mode. Dotted, dot-dashed, full and dashed lines correspond to first and second transitions of analytes and deuterated internal standards, respectively (see Table 1) Comparison of the direct injection method with liquid chromatography Developed method was compared with our previously published LC MS/MS method [17,37]. Plasma samples (n = 28) were analyzed and the results were evaluated by Bland Altman plot and regression analysis. The equation of linear regression, correlation coefficient, mean difference from zero, and standard deviation were calculated. 3. Results and discussion 3.1. Sample preparation On the basis of previously published methods [15,38,39] we chose an easy, cheap, and effective way to prepare the plasma samples for direct injection into a mass spectrometer with high efficiency. This simple sample preparation by protein precipitation using organic solvent without any additional cleaning steps is sufficient and usable for the high-throughput bioanalysis of TKIs in human plasma. In order to remove proteins before analysis deproteination by organic solvents compatible with mass spectrometry were tested. In comparison to acetonitrile tenfold amount of methanol followed by cooling offered homogenous precipitate with clear supernatant. Under these conditions we analyzed more than 1000 plasma samples without any reduction in the mass spectrometer sensitivity Isotope dilution direct injection method The developed method allows the simultaneous determination of the most commonly used tyrosine kinase inhibitors in chronic Fig. 2. Mass spectrum and MRM 3 direct injection analysis-data of dasatinib (c = 252 ng/ml).

95 K. Mičová et al. / Talanta 93 (2012) Table 2 Validation linearity (n = 3), LOD (n = 10) and LOQ (n = 10) of TKIs. Analyte Linearity y = a (SD) x + b (SD) LOD (ng/ml) LOQ (ng/ml) (bias, CV, %) IMA y = 1.37e 4 (1.68e 6 ) x e 4 (1.64e 3 ) (r = ) ( 12.58, 24.04) NIL y = 3.39e 4 (5.91e 6 ) x e 3 (1.88e 3 ) (r = ) ( 5.90, 12.22) DAS y = 1.12e 2 (1.22e 4 ) x e 2 (3.54e 3 ) (r = ) (9.59, 12.22) LAP y = 6.24e 4 (1.15e 5 ) x e 2 (3.04e 2 ) (r = ) (14.33, 10.67) myeloid leukemia and breast cancer treatment IMA, NIL, DAS, and LAP in human plasma by flow injection analysis coupled with tandem mass spectrometry. A representative direct injection analysis data of the plasma samples of particular TKIs is shown in Fig. 1. Transitions of IMA, NIL, and LAP offer a high signal-to-noise ratio and MRM mode is fully suitable for determination in plasma samples from patients. The transition of DAS provides significantly lower ionization and higher noise, which results in insufficient sensitivity in MRM mode (Fig. 1 DAS). In addition, plasma samples from patients on DAS treatment contain concentration levels that are ten times lower as a result of the lower dosage and faster pharmacokinetics. Therefore we applied MRM 3 mode and we obtained excellent sensitivity with high selectivity of DAS. On the other hand, for one transition an MRM 3 period consumes a cycle time of 2.0 s. Together with the MRM period, we obtained 2.6 s per one cycle and 14 data points in one analysis. As a result of time consumption, MRM 3 mode has limited use in fast multianalyte chromatographic analyses where it is necessary to achieve more than ten data points per compound. Mass spectrum and direct injection analysis data for DAS are shown in Fig. 2. Whereas the analyses for the frequently used LC MS/MS methods for simultaneous TKI determination take few minutes, the total analysis time of the isotope dilution direct injection method we developed is 55 s. This includes injection of the sample (20 s) and measurement with a washing step (35 s). Signal intensities are one order lower in comparison with liquid chromatography methods as a result of the higher ion suppression. But this has negligible effect on the accuracy and precision of the method because of the utilization of an deuterated internal standard. In order to obtain more sensitive and accurate results, the flow rate was reduced from 0.3 ml/min to 0.03 ml/min ( min). This affords longer time and more points for the data acquisition and lower ion suppression. For compounds measured in MRM mode the acceptable ratios of peak areas of two transitions were set to , , , , , and for IMA, D8-IMA, NIL, D6-NIL, LAP, and D4-LAP, respectively. We found no data ratio of m/z transitions outside the set limits for any of the measured samples. The variation in the peak area of internal standards was in the range % (intra-day). Multiinjection analysis that we developed by the use of higher flow rate of 0.5 ml/min enables measuring of 32 samples during 10 min (Fig. 3). Calculated concentrations were compared with results from routine used UHPLC MS/MS method by Bland Altman graph and regression analysis. Calibrators, quality control samples and patient plasma samples on IMA therapy were analyzed by pair test. Comparison by Bland Altman plot showed mean difference of 4.27 ng/ml and standard deviation of ng/ml. Regression analysis provided correlation equation of y = x and a correlation coefficient of High throughput of the method is caused by no delay of new analysis start and direct samples injection in sequence of each 19 s. Dwell time of 150 ms for IMA measurement offers 15 points per peak which is reliable for accurate and precise quantitation Validation In order to validate the linearity of the method, LOD, LOQ, imprecision, analytical recovery, and accuracy were determined. The method offers linear dependences over entire ranges with correlation coefficients r > The limits of quantification better than 6 ng/ml for analytes measured in MRM mode (IMA, NIL, LAP) are well below the clinically relevant range of concentration encountered in patients (typically > 100 ng/ml). In the case of DAS MRM 3 mode LOQ was five times lower, which corresponds to the requirement of higher sensitivity as a result of lower plasma levels (Table 2). Intra- and inter-day imprecisions and accuracies expressed as variation coefficient and bias are summarized in Table 3. Applied to IQC and EQC blood samples, the method offers excellent bias and standard deviation (Table 4). The stability of TKIs at different conditions was described in previously published studies. All of the analytes are stable in plasma at least five months stored at 20 C with maximum loss of 10% of the nominal concentration [15,16]. Ion suppression determined using plasma samples added to low, medium, and high concentrations of TKI in six replicates was significantly higher in comparison to liquid chromatography methods as a result of the ionization of many suppressing substances in the Table 3 Intra- and inter-day imprecision and accuracy (n = 6). Analyte Concentration (ng/ml) Imprecision (CV, %) Accuracy (bias, %) Intra-day Inter-day Intra-day Inter-day Fig. 3. Flow multipleinjection analysis of IMA plasma samples. Intenzities of dashed line of internal standard correspond to differences in ion suppressions in the plasma samples which is about 25%. IMA NIL DAS LAP

96 312 K. Mičová et al. / Talanta 93 (2012) Table 4 Accuracy of IQC and EQC blood samples. Analyte Level (ng/ml) Accuracy (bias, %) (CV, %) IMA-iqc NIL-iqc DAS-iqc IMA-eqc ion source during the same analysis time. Ion suppressions were %, %, %, and % for IMA, NIL, DAS, and LAP, respectively. Thanks to the use of deuterated internal standards, the matrix effects were eliminated. The direct injection analysis and LC methods were compared by Bland Altman plots and regression analysis. Quality controls and samples from patients were analyzed by paired test. Bland Altman plot showed mean difference of 12.5, 0.02, 2.55, ng/ml and standard deviation of 39.22, 21.73, 8.36 and ng/ml for IMA, NIL, DAS and LAP, respectively. Regression analyses provided a linear correlation with slope of 1.023, 1.005, 0.995, 1.029, intercept of 3.158, 4.395, 2.881, and correlation coefficient of 0.997, 0.999, and for IMA, NIL, DAS and LAP, respectively. 4. Conclusions Targeted therapy using IMA, NIL, DAS, and LAP, based on the inhibition of protein tyrosine kinases, represents an evolving concept in therapeutic strategies. The monitoring of TKI plasma levels has become an essential tool for the evaluation of response to the treatment and for the management of CML or breast cancer patients. The aim of our study was to develop a high-throughput method for the determination of TKI plasma levels. In comparison with previously published methods using HPLC MS/MS, our method has a short analysis time of 55 or 19 s in multiple injection settings as a result of the exclusion of the separation step, and sample preparation based on deproteination with an organic solvent is relatively simple. Therefore, the determination of several major anticancer drugs in plasma with the isotope dilution direct injection mass spectrometry method is rapid, sensitive, selective, and high-throughput, requires a small amount of plasma sample, and has a markedly reduced requirement for consumable expenditures. In addition, we applied MRM 3 mode on the 5500 QTRAP in order to achieve the significantly better selectivity and sensitivity that is necessary for the correct quantification of low-level DAS. MRM 3 mode can be a new approach to the determination of drugs with a low concentration level, where MRM mode detection is not sufficient as a result of the poor ionization or the presence of interferences. In laboratories this method can be used instead of conventional HPLC MS/MS because of easier method switching. The criteria for linearity, precision, accuracy, and recovery have been proven to be within the recommendations of the FDA and EMEA guidelines for the validation of bioanalytical methods [33,34]. Consequently, this method is suitable for the use in routine clinical practice and it could be useful for the therapeutic drug monitoring of patients treated with IMA, NIL, DAS, or LAP, especially for the evaluation of patient adherence to daily oral therapy, the efficacy of treatment, severe drug-related adverse events, drug drug interaction, or the relationship between pharmacokinetics and pharmacodynamics. Conflict of interest statement The authors stated that there are no conflicts of interest regarding the publication of this article. Acknowledgements This study was supported by grants IGA MZCR NS and NT12218 (Ministry of Health of the Czech Republic), MSM , LF UP and LF UP (Ministry of Education, Youth, and Sports of the Czech Republic). The infrastructural part of this project (Institute of Molecular and Translational Medicine) was supported from the Operational programme Research and Development for Innovations (project CZ.1.05/2.1.00/ ). References [1] S. Madhusudan, T.S. Ganesan, Clin. Biochem. 37 (2004) [2] S.J. Baker, E.P. Reddy, Mt. Sinai J. Med. 77 (2010) [3] D. Fabbro, S. Ruetz, E. Buchdunger, S.W. Cowan-Jacob, G. Fendrich, J. Liebetanz, J. Mestan, T. O Reilly, P. Traxler, B. Chaudhuri, H. Fretz, J. Zimmermann, T. Meyer, G. Caravatti, P. Furet, P.W. Manley, Pharmacol. Ther. 93 (2002) [4] D.G. Savage, K.H. Antman, N. Engl. J. Med. 346 (2002) [5] P. Ramirez, J. DiPersio, Oncologist 13 (2008) [6] K.L. McFarland, G.A. Wetzstein, Cancer Control 16 (2009) [7] M. Scheffler, P. Di Gion, O. Doroshyenko, J. Wolf, U. Fuhr, Clin. Pharmacokinet. 50 (2011) [8] J.S. Kang, M.H. Lee, Korean J. Intern. Med. 24 (2009) [9] S. Picard, K. Titier, G. Etienne, E. Teilhet, D. Ducint, M.A. Bernard, R. Lassalle, G. Marit, J. Reiffers, B. Begaud, N. Moore, M. Molimard, F.X. Mahon, Blood 109 (2007) [10] N. Singh, L. Kumar, R. Meena, T. Velpandian, Eur. J. Clin. Pharmacol. 65 (2009) [11] R.A. Larson, B.J. Druker, F. Guilhot, S.G. OǐBrien, G.J. Riviere, T. Krahnke, I. Gathmann, Y. Wang, IRIS (International Randomized Interferon vs STI571) Study Group, Blood 111 (2008) [12] N. Takahashi, H. Wakita, M. Miura, S.A. Scott, K. Nishii, M. Masuko, M. Sakai, Y. Maeda, K. Ishige, M. Kashimura, K. Fujikawa, M. Fukazawa, T. Katayama, F. Monma, M. Narita, F. Urase, T. Furukawa, Y. Miyazaki, N. Katayama, K. Sawada, Clin. Pharmacol. Ther. 88 (2010) [13] A. Awidi, A.O. Ayed, N. Bsoul, A. Magablah, R. Mefleh, M. Dweiri, M. Ramahi, E. Arafat, M. Bishtawi, L. Marie, Leuk. Res. 34 (2010) [14] Y. Ishikawa, H. Kiyoi, K. Watanabe, K. Miyamura, Y. Nakano, K. Kitamura, A. Kohno, I. Sugiura, T. Yokozawa, A. Hanamura, K. Yamamoto, H. Iida, N. Emi, R. Suzuki, K. Ohnishi, T. Naoe, Cancer Sci. 101 (2010) [15] S. De Francia, A. D Avolio, F. De Martino, E. Pirro, L. Baietto, M. Siccardi, M. Simiele, S. Racca, G. Saglio, F. Di Carlo, G. Di Perri, J. Chromatogr. B: Analyt. Technol. Biomed. Life Sci. 877 (2009) [16] A. Haouala, B. Zanolari, B. Rochat, M. Montemurro, K. Zaman, M.A. Duchosal, H.B. Ris, S. Leyvraz, N. Widmer, L.A. Decosterd, J. Chromatogr. B: Analyt. Technol. Biomed. Life Sci. 877 (2009) [17] K. Mičová, D. Friedecký, A. Polýnková, E. Faber, T. Adam, Chem. Pap. 104 (2010) s31 s34. [18] Y. Hsieh, G. Galviz, Q. Zhou, C. Duncan, Rapid Commun. Mass Spectrom. 23 (2009) [19] S.N. Joshi, P. Venugopalan, Brain Dev. 29 (2007) [20] C. Turgeon, M.J. Magera, P. Allard, S. Tortorelli, D. Gavrilov, D. Oglesbee, K. Raymond, P. Rinaldo, D. Matern, Clin. Chem. 54 (2008) [21] T.H. Zytkovicz, E.F. Fitzgerald, D. Marsden, C.A. Larson, V.E. Shih, D.M. Johnson, A.W. Strauss, A.M. Comeau, R.B. Eaton, G.F. Grady, Clin. Chem. 47 (2001) [22] M. Osl, S. Dreiseitl, B. Pfeifer, K. Weinberger, H. Klocker, G. Bartsch, G. Schäfer, B. Tilg, S. Graber, C. Baumgartner, Bioinformatics 24 (2008) [23] S.A. Ritchie, P.W.K. Ahiahonu, D. Jayasinghe, D. Heath, J. Liu, Y. Lu, W. Jin, A. Kavianpour, Y. Yamazaki, A.M. Khan, M. Hossain, K.K. Su-Myat, P.L. Wood, K. Krenitsky, I. Takemasa, M. Miyake, M. Sekimoto, M. Monden, H. Matsubara, F. Nomura, D.B. Goodenowe, BMC Med. 8 (2010) 13. [24] J. Jansson, B. Willing, M. Lucio, A. Fekete, J. Dicksved, J. Halfvarson, C. Tysk, P. Schmitt-Kopplin, PLoS ONE 4 (2009) e6386. [25] A.T. Turer, R.D. Stevens, J.R. Bain, M.J. Muehlbauer, J. van der Westhuizen, J.P. Mathew, D.A. Schwinn, D.D. Glower, C.B. Newgard, M.V. Podgoreanu, Circulation 119 (2009) [26] D.W. Johnson, Clin. Biochem. 43 (2010) [27] S. Forni, X. Fu, S.E. Palmer, L. Sweetman, Mol. Genet. Metab. 101 (2010) [28] H. Janečková, K. Hron, P. Wojtowicz, E. Hlídková, A. Barešová, D. Friedecký, L. Žídková, P. Hornik, D. Behúlová, D. Procházková, H. Vinohradská, K. Pešková, P. Bruheim, V. Smolka, S. Št astná, T. Adam, J. Chromatogr. A 1226 (2012) [29] C. Carducci, S. Santagata, V. Leuzzi, C. Carducci, C. Artiola, T. Giovanniello, R. Battini, I. Antonozzi, Clin. Chim. Acta 364 (2006)

97 K. Mičová et al. / Talanta 93 (2012) [30] N. Cesari, S. Fontana, D. Montanari, S. Braggio, J. Chromatogr. B: Analyt. Technol. Biomed. Life Sci. 878 (2010) [31] L.A. Leuthold, C. Grivet, M. Allen, M. Baumert, G. Hopfgartner, Rapid Commun. Mass Spectrom. 18 (2004) [32] ( ). [33] D.H. Chace, T.A. Kalas, E.W. Naylor, Clin. Chem. 49 (2003) [34] FDA, Guidance for Industry: Bioanalytical Method Validation 2001, Guidances/ucm pdf ( ). [35] Guideline on bioanalytical method validation, European Medicines Agency, Committee for Medicinal Products for Human Use 2011, GB/document library/scientific guideline/ 2011/08/WC pdf ( ). [36] N.P. van Erp, H. Gelderblom, H.J. Guchelaar, Cancer Treat. Rev. 35 (2009) [37] K. Mičová, D. Fridecký, E. Faber, A. Polýnková, T. Adam, Clin. Chim. Acta 411 (2010) [38] T. Velpandian, R. Mathru, N.K. Agarwal, B. Arora, L. Kumar, S.K. Gupta, J. Chromatogr. B: Analyt. Technol. Biomed. Life Sci. 804 (2004) [39] R. Bakhtiar, J. Lohne, L. Ramos, L. Khemani, M. Hayes, F. Tse, J. Chromatogr. B: Analyt. Technol. Biomed. Life Sci. 768 (2002)

98 Příloha 6 Friedecký, D., Mičová, K., Faber, E., Hrdá, M., Široká, J., Adam, T. Detailed study of imatinib metabolization using high-resolution mass spectrometry. Journal of Chromatography A, 1409, (2015).

99 Journal of Chromatography A, 1409 (2015) Contents lists available at ScienceDirect Journal of Chromatography A j o ur na l ho me page: Detailed study of imatinib metabolization using high-resolution mass spectrometry David Friedecký a,b,, Kateřina Mičová a,b, Edgar Faber c, Marcela Hrdá a, Jitka Široká a, Tomáš Adam a,b,d a Institute of Molecular and Translational Medicine, Faculty of Medicine and Dentistry, Palacky University in Olomouc, Czech Republic b Laboratory for Inherited Metabolic Disorders, Faculty of Medicine and Dentistry, Palacky University in Olomouc, University Hospital Olomouc, Czech Republic c Department of Hemato-Oncology, Faculty of Medicine and Dentistry, Palacky University in Olomouc, University Hospital Olomouc, Czech Republic d Department of Clinical Chemistry, University Hospital Olomouc, Czech Republic a r t i c l e i n f o Article history: Received 2 April 2015 Received in revised form 8 July 2015 Accepted 9 July 2015 Available online 13 July 2015 Keywords: Drug metabolization Tyrosine kinase inhibitor Orbital ion trap Fragmentation Exact mass a b s t r a c t Modern high resolution mass spectrometry offers unique identification capability in drug metabolism studies. In this work detailed imatinib metabolization in the plasma of patients with chronic myeloid leukemia is presented. The metabolites were separated by liquid chromatography on a C18 column with mass spectrometry detection via an Orbitrap Elite instrument (Thermo Scientific) based on exact mass measurement. A scan range of m/z resolution of 60,000 was applied (mass accuracy of 5 ppm). The data were evaluated using the advanced software for mass spectrometry Mass Frontier and Met- Works. In all plasma samples, studied 90 metabolites in the concentration range of mol/l were identified by m/z values and confirmed by exact mass measurement of the MS 2 and MS 3 fragmentations. In order to achieve optimal clinical response and avoid toxicity, current therapeutic monitoring of parent drug is a useful tool for the individualization of treatment. Current high-resolution mass spectrometry possesses the potential to broaden this approach by monitoring number of potentially clinically relevant drug metabolites Elsevier B.V. All rights reserved. 1. Introduction The determination of drugs in body fluids is widely applied in clinical practice to individualize the treatment of patients in terms of achieving a good clinical response and avoiding adverse events resulting from high levels of xenobiotics in the bloodstream. The therapeutic monitoring of imatinib (IMA) and its main demethylated metabolite in plasma levels has been the object of many studies [1 6] aimed at the improvement and individualization of therapy for patients with chronic myeloid leukemia (CML). In general, higher IMA plasma levels are associated with a complete cytogenetic and major molecular response and a better clinical outcome. For a typical IMA oral dosage (400 mg/d), a steadystate plasma level of 1000 ng/ml is recommended [7 9]. But the Corresponding author at: Institute of Molecular and Translational Medicine, University Hospital Olomouc, Palacky University in Olomouc, FN Olomouc, I. P. Pavlova 6, Olomouc, Czech Republic. Tel.: ; address: david.friedecky@gmail.com (D. Friedecký). connection between IMA metabolite levels and clinical outcomes has not been studied closely yet. The basic principle of biotransformation is to enhance drug excretion from the body by converting it to more hydrophilic and less toxic forms. The metabolic pathways are divided into phase I and phase II reactions. The most common phase I biotransformation reactions are dealkylation, oxidation, hydrolysis and reduction [10]. In some cases, phase I metabolites are more active in comparison with the parent drug, for example tamoxifen versus its metabolite endoxifen [11], and codeine versus morphine [12]. Phase I metabolites are most often the preliminary point for further biotransformations via conjugation reactions, which are the main pathways of phase II metabolism. The major pathway is glucuronide conjugation, which can proceed at one or more places in a molecule. Sulfate, acyl, glutathione and amino acid conjugation reactions are also important. Most of these reactions are catalyzed by a number of enzymes, such as cytochrome P450 (CYP) isoforms in phase I reactions and uridine diphosphate glucuronyltransferase (UGT) or sulfotrabsferase (SULT) in phase II metabolism [10]. As a consequence of drug-metabolizing enzyme activity, bioactive or toxic metabolites of clinical relevance may be produced / 2015 Elsevier B.V. All rights reserved.

100 174 D. Friedecký et al. / J. Chromatogr. A 1409 (2015) Therefore, the determination of the parent drug and its metabolites could be important in patient prognosis and the individualization of therapy. Imatinib metabolization has only been studied in a few papers. In the study of Gschwind et al., reverse phasehigh performance liquid chromatography (RP-HPLC) coupled with a quadrupole-time of flight-mass spectrometry (QTOF-MS) for a metabolization study of IMA in human plasma was used. Fourteen main metabolites in the pathways of N-demethylation, oxidations in various positions, the loss of piperazine moiety by oxidative deamination, the rapid further oxidation of the intermediate aldehyde to carboxylic acid metabolite and glucuronide conjugation with the majority of phase I metabolites were found[13]. Another study was aimed at the fragmentation of imatinib and the identification of new metabolites from microsomal incubations with CYP isozymes. Using hydrophobic interaction liquid chromatography coupled with triple-quadrupole and linear ion trap mass spectrometers, one demethylated, two hydroxyl- and three N-oxide metabolites were resolved. Various rates of metabolite formation were observed among the CYP isozymes that were identified. The elucidation of the structure of the metabolites was completed with a deuterium oxide-containing mobile phase or the incorporation of 18 O from H 2 18 O added to the incubations [14]. A similar study by Rochat et al. was focused on imatinib metabolite profiling in parallel to imatinib quantification in plasma and comparison with human liver microsomal incubation. They identified about thirty IMA metabolite candidates and detected that some metabolites in vivo are products of sequential biotransformation pathways. Only fourteen metabolites in plasma samples from 38 patients showed sufficient intensity suitable for the quantification [15]. A further study dealing with imatinib metabolite characterization and the characterization of hydroxylation and N-oxidation was performed by Ma et al. by LC MS with APCI ionization. Finally, nine metabolites were found in the incubation of imatinib with rat liver microsomes [16]. High-resolution mass spectrometry (HRMS) instruments with accurate mass measurement have become more available for many laboratories focused on various fields of bioanalysis, including clinical investigations. In comparison to quadrupoles or ion traps with unit resolution which are widely used for the identification of metabolites, the high accuracy with high resolution provides better selectivity and sensitivity and the advantage of elucidation of the structure. Our study was performed on a hybrid linear ion trap (LTQ) Orbitrap Elite instrument (Thermo Fisher Scientific, San Jose, CA, USA) which combines a high-field Orbitrap analyzer with a dualpressure linear ion trap. It allows parallel MS and MS n analysis using various fragmentation techniques. We present a detailed study of imatinib metabolization in patients suffering from CML who were treated with IMA. This work demonstrates the capability of highly sensitive advanced HRMS to find and confirm the deep ocean of IMA metabolites in plasma. 2. Materials Imatinib mesylate was purchased from LC Laboratories (Woburn, MA, USA) and deuterated standard (D8-imatinib) from TLC PharmaChem (Vaughan, Ontario, Canada). Glivec (Gleevec ) tablets with IMA as active substance were obtained from Novartis (Basel, Switzerland). The formic acid, ammonium hydroxide, water, dimethylsulfoxide (DMSO), acetonitrile and methanol were all LC MS grade and were purchased from Sigma Aldrich (St. Louis, MO, USA). Plasma samples of the patients obtained from the Department of Hemato-Oncology, University Hospital Olomouc (Czech Republic) were collected into tri-potassium salts of ethylenediaminetetraacetic acid (K 3 EDTA). 3. Sample preparation This study was conducted in accordance with the Helsinki Declaration, and the protocol was reviewed by the hospital ethics committee. All the patients who were examined gave their informed consent to participation in the study before the blood sampling. The blood samples were collected during 6 months before the experiment. The blood from the patients treated with IMA was transferred into a test tube containing an anticoagulant (EDTA) and transported to laboratory within 30 min at 4 C. The plasma was separated from the whole blood by centrifugation at 3000 g for 5 min and then prepared for the analysis or stored at 50 C. The plasma (50 L) was precipitated by methanol (150 L) with the addition of an internal standard D8-Imatinib (100 ng/ml). Subsequently, the samples were put into a sonicator for 1 min, shaken for 1 min, frozen for 30 min at 20 C, and centrifuged for 15 min at 14,300 g. The supernatant was placed into a glass vial and directly analyzed or stored in a freezer at 20 C before analysis. As a blank sample pooled plasma from healthy adults was prepared identically. 4. Methods 4.1. Samples of patients Overall, 37 plasma samples from patients with different daily dosages of IMA ( mg) and sampling times since the last dose (2 48 h) were collected. In a first part of experiment a general metabolization transformations in raw data of whole group of patients under different conditions (daily dosage, sampling time, IPL) were investigated (data not shown). For further experiments and data evaluation eight patients with doses of 400 mg/d under standardized conditions for IMA therapeutic monitoring of sampling times of 24 ± 4 h after the last dose (steady state) were chosen LC MS system The LC MS system consisted of an UltiMate 3000 RS (Dionex, Sunnyvale, CA, USA) coupled with an LTQ Orbitrap Elite mass spectrometer (Thermo Fisher Scientific, San Jose, CA, USA). The mass spectrometer was controlled by the Xcalibur 2.2 SP1 software (Thermo Fisher Scientific, San Jose, CA, USA). The chromatographic system was controlled by the Chromeleon Xpress 6.80 and DCM- SLink 2.12 software (Thermo Fisher Scientific, San Jose, CA, USA) Chromatographic conditions The separation was performed on a Phenomenex Kinetex C18 column (100 mm 2.1 mm; 100 Å; 1.7 m; Torrance, CA, USA) at 40 C. Ten microliters of the sample was injected into the column. The temperature of the autosampler was set at 10 C. For the separation of the IMA metabolites three mobile phases were examined: 4 mmol/l ammonium formate ph 3.2; 10 mmol/l ammonium formate ph 4.0 and 20 mmol/l ammonium acetate ph 9.0 as mobile phase A and acetonitrile as mobile phase B. The efficiency of the separation and signal intensity depending on the degree of ionization were studied. The best results were obtained using 10 mmol/l ammonium formate ph 4.0, which was chosen for the further experiments (data not shown). Gradient elution was applied at a flow rate of 0.4 ml/min. The column was maintained at initial conditions of 5% B for 3 min, followed by a linear gradient to 40% for 10 min, then from 40% to 95% for 0.5 min, then held at 95% B till 18 min and then reduced over a period of 0.5 min to 5% B and equilibrated under the initial conditions till the end of the analysis. The total analysis time was 20 min.

101 D. Friedecký et al. / J. Chromatogr. A 1409 (2015) Fig. 1. Metabolite profiles of (A) IMA standard and (B) Glivec tablet. Analyses represent extracted ion chromatograms of selected metabolizations (a) parent drug with m/z , (b) desaturation with m/z , (c) desaturation + oxidation with m/z , (d) oxidation with m/z , (e) demethylation with m/z and (f) methylation with m/z *, Metabolites not present in plasma sample from patients with CML; **, metabolites generated in ion source from IMA Mass spectrometry conditions The LTQ Orbitrap Elite was operated in a positive heating electrospray ionization mode. The mass spectrometer ion source parameters were adjusted as follows: electrospray voltage of +1.5 kv, ion source heater temperature of 360 C, capillary temperature of 350 C and flow rates of 35, 10 and 0 arbitrary units for the sheath, auxiliary and sweep gas, respectively; the S-lens RF level was set to 60%. Three different settings were applied. The search for molecular ions of the metabolites was performed in full scan mode, ranging from m/z 350 to 1200 at a resolution of 60,000 FWHM. For confirmation of the identities of the metabolites MS 2 exact mass fragmentation of the phase I metabolites and MS 3 fragmentation of the phase II metabolites (conjugates) in the orbitrap mass analyzer were performed. The energy for collision-induced dissociation (CID) was set at 35 ev, with an isolation width of m/z 1. The fragmentation spectra were collected within m/z at a resolution of 30,000 FWHM. The mass spectrometer was externally calibrated from 100 to 2000 Da using a Pierce LTQ Velos ESI Positive Ion Calibration Solution (ThermoFisher Scientific). The ion m/z (diisooctylphtalate) was used as an internal lock mass to provide an exact mass accuracy below 5 ppm for all the analyses. The list of potential metabolites was designed with the MetWorks 1.3 SP3 software (ThermoFisher Scientific, Table 1). The identification of the fragments and elucidation of the structure were processed in the Mass Frontier 7.0 software (ThermoFisher Scientific). 5. Results and discussion 5.1. Quality assurance For accuracy control of chromatographic conditions and sample preparation, internal standard D8-imatinib was added to precipitation agent (methanol), at a concentration of 100 ng/ml. Coefficients of variation of D8-IMA were 8.69% and 0.05% (n = 8) for peak areas and retention time, respectively. Mass spectrometry conditions were controlled by using internal lock mass (m/z ; diisooctylphtalate). Mass accuracy better than 0.59 ppm for D8-IMA (m/z , n = 8) was achieved. Therefore, mass accuracy better than 5 ppm was set for MS/MS 2 /MS 3 experiments Analysis of Glivec tablet and standard powder In the first part of the study a Glivec tablet (Novartis) containing 100 mg of IMA mesylate and standard IMA powder were analyzed. In order to perform trace analysis of impurities from the drug synthesis, the samples were dissolved in methanol to a final concentration of 10 g/ml. This is ten times higher concentration compared to the common levels found in plasma samples from CML patients (samples taken 24 h after a dose of 400 mg/d). Using the Metworks 1.3 software, several peaks corresponding to oxidation (+O), desaturation ( 2H), oxidation + desaturation (+O 2H), methylation (+CH 2 ) and demethylation ( CH 2 ) of the imatinib were observed (Fig. 1). In Fig. 1a extracted ion chromatograms of the parent drug that are three orders of magnitude more abundant compared to the impurities are shown. Thus, the content of impurities that were observed is less than 0.1%. Three peaks (Nos. 7, 11 and 15) representing oxidative impurities were present in the Glivec tablet compared to ten peaks with one order of abundance less in the standard powder (Fig. 1d). According to the evidence of the retention times and fragmentation spectra, these impurities were identical with the metabolites detected in the plasma. Fig. 1b and c shows extracted ion chromatograms of desaturation and desaturation + oxidation. The major peaks in retention time (RT) (marked **) were found in all the samples that were

102 176 D. Friedecký et al. / J. Chromatogr. A 1409 (2015) Table 1 List of metabolites found in plasma of patients treated by IM. Each biotransformation product is described by molecular formula [M + H] + and exact m/z modification formula with corresponding mass shift and number of metabolite observed in chromatographic profile (see Figs. 2 and 3). Modification Modification Formula m/z m/z shift Metabolite Imatinib C 29H 31N 7O Imatinib + glucuronidation +C 6H 8O 6 C 35H 39N 7O Demethylation CH 2 C 28H 29N 7O Demethylation + glucuronidation CH 2 + C 6H 8O 6 C 34H 37N 7O Oxidation +O C 29H 31N 7O Oxidation + glucuronidation +O + C 6H 8O 6 C 35H 39N 7O Demethylation + oxidation CH 2 + O C 28H 29N 7O Demethylation + oxidation + glucuronidation CH 2 + O + C 6H 8O 6 C 34H 37N 7O Dioxidation +O 2 C 29H 31N 7O Dioxidation + glucuronidation +O 2 + C 6H 8O 6 C 35H 39N 7O Desaturation H 2 C 29H 29N 7O Demethylation + desaturation CH 2 H 2 C 28H 27N 7O Desaturation + oxidation +O H 2 C 29H 29N 7O Desaturation + oxidation + glucuronidation +O H 2 + C 6H 8O 6 C 35H 37N 7O Dioxidation + desaturation +O 2 H 2 C 29H 31N 7O Dioxidation + desaturation + glucuronidation +O 2 H 2 + C 6H 8O 6 C 35H 37N 7O Oxidation + hydrolysis +H 2O 2 C 29H 33N 7O Oxidation + hydrolysis + glucuronidation +H 2O 2 + C 6H 8O 6 C 35H 41N 7O Methylation +CH 2 C 30H 33N 7O Oxidation + methylation +CH 2O C 30H 33N 7O Demethylation + desaturation + oxidation +O CH 2 H 2 C 28H 27N 7O Demethylation + desaturation + oxidation + glucuronidation +O CH 2 H 2 + C 6H 8O 6 C 34H 35N 7O Glycine conjugation OH + C 2H 4NO 2 C 31H 34N 2O Glucuronidation + decarboxylation +C 5H 8O 5 C 34H 39N 7O analyzed (including the plasma from the patients) with a consistent intensity ratio to IMA. Ion source fragmentation is unlikely to apply because the exact masses of metabolite molecular ions are not part of the IMA fragmentation spectra. This suggests a theory of the electrochemical process of desaturation and desaturation + oxidation of IMA in the ion source. This phenomenon was verified by analysis under different separation conditions (ph of mobile phase adjusted to 3, 4 and 5; data not shown), where IMA, desaturated (m/z ) and desaturated + oxidized (m/z ) compounds eluted in the same retention time with the same intensity ratios. The three peaks Nos. 7, 11 and 15 (Fig. 1b) found in the Glivec tablet are the results of the ion source fragmentation of oxidative metabolites (Fig. 1d). The fragmentation spectra of these metabolites contain a main fragment with an m/z of and they were verified by experiments with the mobile phase with a different ph (data not shown). In summary, in the Glivec tablet two desaturated + oxidized (Nos. 60 and 61), one demethylated (No. 4) and two unidentified methylated (marked with asterisks) impurities were present. The standard powder differs from a Glivec tablet especially in the profiles and intensities of the oxidative, demethylated and methylated metabolites (Fig. 1d f). All of these compounds were confirmed by fragmentation spectra measured in an orbital ion trap with high resolution and the accuracy and fragments were identified with the Mass Frontier 7.0 software Metabolite profile of plasma samples from patients with CML Eight plasma samples from patients on standard therapy of 400 mg per day were used for the analysis. In the extracted ion chromatograms generated with the Metworks 1.3 software more than 180 unique chromatographic peaks in the range 8.14 and min with specific m/z values were found. For the subsequent evaluation, those peaks that were products of ion source fragmentation and electrochemical conversion (see Section 5.2) and those peaks with a very low intensity observed in less than a half of the plasma samples were excluded. Finally, 90 detected peaks corresponding to the first- and second-phase metabolites were used for the subsequent confirmation of identity and calculations (Table 1). The intensity ratios of the metabolites compared to the IMA (100%) in the plasma samples were in the range of % with average metabolite and IMA intensities of and counts, respectively (Supplementary Table 1). On the basis of these results a summarizing scheme of metabolization, including the relative content of metabolites, was designed (Fig. 6). The calculated concentrations for all the metabolites derived from the concentration of IMA in the plasma were in the range 0.1 nmol/l 1 mol/l. The majority of polar metabolites elute earlier than IMA, as expected in a reverse phase liquid chromatography system (Figs. 2 and 3); however, four oxidative metabolites (Nos. 15, 16, 48 and 49) were retained more in comparison to the IMA. These metabolites offer significantly different fragmentation spectra in comparison with the other oxidative metabolites, Nos and 37 47, and are in accordance with the previously published results [14]. Glucuronides as representatives of second phase metabolites offer weaker retention as a result of the higher polarity of the glucuronide part. The retention time shift correlations between the metabolites of the first phase and the corresponding glucuronides for IMA (Nos. IMA/1 3), demethylation (No. 4/5), oxidation (Nos. 6 16/17 21), demethylation + oxidation (Nos /34 36) and dioxidation (Nos /5-57) were observed (Fig. 2). The metabolite profiles of the selected biotransformations were surprisingly very similar, e.g., oxidation vs. demethylation + oxidation (Fig. 3 g). On the evidence of the relative intensities, the contributions of the impurities from the tablet to the metabolite intensities present in the plasma from the patients with CML were less than 20%. Differences in metabolic profiles were observed between the plasma samples. Fig. 4 shows the extracted ion chromatograms of selected metabolizations from two patients with the same treatment (400 mg per day). Compared to IMA, there are differences in the relative intensities of demethylation (Fig. 4b, metabolite No. 4), oxidation (Fig. 4c, metabolites Nos. 6 and 15), demethylation + oxidation (Fig. 4e, metabolite No. 22) and dioxidation (Fig. 4f, metabolites Nos. 48 and 49). Furthermore, the samples differ in terms of the overall intensities of all the metabolites of the selected metabolizations. Metabolic profiles can be influenced by diverse activities of liver enzymes (e.g. cytochrome P450 family), physiological (e.g. age, gender, nutrition, polymorphisms) and pathophysiological factors (e.g. hypoxia, oxidative stress,

103 D. Friedecký et al. / J. Chromatogr. A 1409 (2015) Fig. 2. First part of complete metabolite profile of patient on Glivec dose of 400 mg/day (blood taken 24 h after dose). Analyses represent extracted ion chromatograms of selected metabolizations (a) glucuronidation with m/z , (b) IMA with m/z , (c) demethylation + glucuronidation with m/z , (d) demethylation with m/z , (e) oxidation + glucuronidation with m/z , (f) oxidation with m/z , (g) oxidation + demethylation + glucuronidation with m/z , (h) oxidation + demethylation with m/z , (i) dioxidation + glucuronidation with m/z , (j) dioxidation with m/z , (k) desaturation + demethylation with m/z and (l) desaturation with m/z inflammation, infection, diabetes, oncogenic diseases, environmental pollutants) Confirmation of metabolite identity In order to confirm the identity, MS 2 fragmentation of all the phase I metabolites including IMA was performed. The phase II metabolites were identified by MS 3 fragmentation of molecular ions through the unconjugated ions corresponding to the phase I metabolites. The fragments from the MS 2 and MS 3 experiments were measured at high resolution in the orbital ion trap and the exact m/z values were processed and compared with the theoretical predicted fragments generated by the Mass Frontier 7.0 software (Fig. 6, Supplementary Table 1 and Supplementary Fig. 1). In order to achieve standard reproducible conditions of fragmentation, collision-induced dissociation (CID) offering less complex MS 2 fragmentation spectra was applied. The CID-MS 2 fragmentation of IMA is well described in previously published articles [14 17]. In our experiment three main fragments with abundance higher than 1% were observed: m/z , and Three other low-abundance fragments are present in the spectra: m/z ; ; The structures of all six fragments were designed by the Mass Frontier software (Supplementary Fig. 1). For many metabolites parallel fragments with m/z values corresponding to the m/z shift of the appropriate metabolization were detected, easily identified and confirmed by the assigned structure (Supplementary Table 1 and Supplementary Fig. 1). The transformation of IMA to a demethylated product ( CH 2 ) is the main metabolic conversion. In the CID-MS 2 fragmentation spectra of the demethylated metabolite fragments that correspond to the fragments of the parent molecule of IMA with a mass shift of m/z : ; were observed. The MS 2 spectra for oxidation/hydroxylation (+O) include characteristic fragments with a mass shift m/z = : ; ; The main fragment of m/z = arises by the neutral loss of piperazine ring (m/z ) from the parent molecule , like the IMA For selected oxidative

104 178 D. Friedecký et al. / J. Chromatogr. A 1409 (2015) Fig. 3. Second part of complete metabolite profile of patient on Glivec dose of 400 mg/day (blood taken 24 h after dose). Analyses represent extracted ion chromatograms of selected metabolizations (m) oxidation + desaturation + glucuronidation with m/z , (n) oxidation + desaturation with m/z , (o) dioxidation + desaturation + glucuronidation with m/z , (p) dioxidation + desaturation with m/z , (q) oxidation + hydrolysis + glucuronidation with m/z , (r) oxidation + hydrolysis with m/z , (s) oxidation + methylation with m/z , (t) methylation with m/z , (u) oxidation + demethylation + desaturation + glucuronidation with m/z , (v) oxidation + demethylation + desaturation with m/z , (w) glucuronidation + decarboxylation with m/z and (x) glycine conjugation with m/z metabolites characteristic uncommon radical ions corresponding to cleavage on the piperazine ring were found (m/z = , and ; see Fig. 5). Dioxidation (+2O) with a mass shift m/z = offers similar fragmentation behavior: (loss of from the parent molecule ). Other observed biotransformations include demethylation + hydroxylation ( CH 2 + O; mass shift m/z = ), desaturation + hydroxylation ( 2H + O; mass shift m/z = ), dioxidation + desaturation (+2O 2H; mass shift m/z = ), hydroxylation/oxidation + hydrolysis (+2H + 2O; mass shift m/z = ) and demethylation + desaturation + oxidation/hydroxylation ( CH 2 2H + O; mass shift m/z = ). All of these biotransformations, including IMA itself, undergo glucuronidation (+C 6 H 8 O 6 ) with a subsequent mass shift m/z = Methylation (+CH 2 ; mass shift m/z = ), methylation + oxidation/hydroxylation (+CH 2 + O; mass shift m/z = ) and glycine conjugation ( OH + C 2 H 4 NO 2 ; mass shift m/z = ) are other significant metabolic reactions. The last reaction, comprising decarboxylation after IMA glucuronidation (+C 5 H 8 O 5 ; mass shift m/z = ), can be mentioned but the decarboxylation proceeds in the glucuronide part. The structures of all the fragments proposed by the Mass Frontier 7.0 software are shown in the supplementary data (Supplementary Fig. 1). Chromatographic peaks corresponding to desaturation (2H loss) were identified and characterized by an m/z shift from the parent molecule IMA. Similarly, in the MS 2 spectra characteristic fragments were observed: ; and Since these compounds arise from electrospray ion source fragmentation or electrochemical conversion of the main oxidative metabolites, they were therefore not included in the list of metabolites and scheme of metabolization. Seventy-four metabolites arising from metabolization described in previous section were fully characterized. Due to limited sensitivity of the instrument, 16 metabolites with low intensity peaks in the range were not confirmed by fragmentation MS 2 spectra (Supplementary Data 1). Most of them are

105 D. Friedecký et al. / J. Chromatogr. A 1409 (2015) Fig. 4. Metabolite profiles of two different patients on Glivec dose of 400 mg/day (blood taken 24 h after dose). Analyses represent extracted ion chromatograms of selected metabolizations (a) parent drug with m/z , (b) demethylation with m/z , (c) oxidation with m/z , (d) desaturation + oxidation with m/z , (e) demethylation + oxidation with m/z and (f) dioxidation with m/z Fig. 5. Fragmentation of two different oxidative metabolites (A) No. 6 (t r = 10.12) (a) and (B) No. 15 (t r = 12.31); F, fragment selected by line.

106 180 D. Friedecký et al. / J. Chromatogr. A 1409 (2015) Fig. 6. Scheme of IMA metabolization in plasma from patients with CML on therapy by Glivec. glucuronides present in lower levels compared to metabolites of first phase. 6. Conclusion We presented the use of high-resolution/accurate mass spectrometry in full scan mode and MS 2 /MS 3 fragmentations for a detailed study of IMA metabolization in plasma samples from patients suffering from chronic myeloid leukemia and treated with Glivec. Ninety metabolites were identified and 74 of them were fully characterized by the MS 2 /MS 3 fragmentation spectra measured with high resolution. Confirmation of 16 metabolites was limited as a result of the low abundance of chromatographic peaks and lack of fragmentation spectra. Compared to previously published results including state-of-the-art and highly sensitive triple quadrupoles [4 7], the Orbitrap Elite mass spectrometer together with a sub-2- m reversed phase chromatographic system offers significantly better sensitivity, with the advantage of acquiring fragmentation spectra at high resolution. In order to interpret the fragmentation spectra, Mass Frontier 7.0 was successfully utilized and the majority of exact m/z values were assigned to the supposed structure of fragments as well as whole metabolites. As shown by our results, all metabolization studies should cover the analysis of the tablet, which could contain many metabolites or impurities arising as minor products during the synthesis of the drugs. Other phenomena such as ion source fragmentation and electrochemical conversion also have to be taken into account when analyzing minor metabolites. With regard to the sensitivity of today s mass spectrometers, it is important to exclude these false metabolites to prevent incorrect interpretation of the results. Differences in the metabolite profiles were observed. Therefore, the potential of this study lies in subsequent studies focused on large cohort analysis of samples and finding relationships between the levels of metabolites and clinical signs of the patients, such as good/poor response to treatment, adverse reactions and the failure of the treatment, respectively. Identification of IMA metabolites was a subject of several studies performing the analyses predominantly using mass spectrometers with low resolution. Number of identified metabolites reached approximately 30 at maximum. Major metabolic pathways included demethylation and oxidation/hydroxylation reactions. In our study with high-resolution mass spectrometer (HRMS) Orbitrap Elite we have found ninety products of IMA metabolism. 7. Summary The study illustrated how complex the in vivo metabolization of drugs could be and how high-resolution/accurate mass spectrometry and exact mass metabolite fragmentations with advanced software tools would help with the identification and confirmation of the structures of the metabolites. Acknowledgements The work was supported by a grant of the Internal Grant Agency of Ministry of Health, Czech Republic NT /2011, the European Social Fund Project No. CZ.1.07/2.3.00/ , and Ministry of Education, Youth and Sports MSMT-7778/2014 (LO1304 Support of sustainability of the Institute of Molecular and Translational Medicine).