Metodika analýzy mléčných výrobků a jejich sójových analogů na přítomnost RoundUp Ready sóji

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "Metodika analýzy mléčných výrobků a jejich sójových analogů na přítomnost RoundUp Ready sóji"


1 Zuzana Tesařová, Dana Šídová, Aleš Vráblík, Jan Hodek, Jaroslava Ovesná Metodika analýzy mléčných výrobků a jejich sójových analogů na přítomnost RoundUp Ready sóji METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i.

2 Metodika byla vypracována pracovníky Národní Referenční laboratoře pro identifikaci GMO a DNA fingerprinting díky finančnímu přispění NAZV, projekt číslo: QI101B267 a výzkumného záměru MZE Výzkumný ústav rostlinné výroby, v.v.i., 2013 ISBN

3 Autoři: Ing. Zuzana Tesařová Mgr. Dana Šídová Ing. Aleš Vráblík Mgr. Jan Hodek RNDr. Jaroslava Ovesná, CSc. Název: Metodika analýzy mléčných výrobků a jejich sójových analogů na přítomnost RoundUp Ready sóji Vydal: Výzkumný ústav rostlinné výroby, v.v.i. Drnovská 507, Praha 6 Ruzyně Náklad: 50 ks Vyšlo v roce: 2013 Kontakt na autory: Výzkumný ústav rostlinné výroby, v.v.i., 2013 ISBN

4 OBSAH : 1. Cíl metodiky 5 2. Vlastní popis metodiky Termíny a definice Princip metody Rušivé vlivy inhibitory Přístrojové vybavení Chemikálie a roztoky Extrakce DNA pomocí CTAB metody Kontrola kvality izolované DNA Princip elektroforetické separace na agarózovém gelu Příprava 0,8% agarózového gelu Vizualizace DNA po elektroforetické separaci High resolution melting (HRM) Příprava pracovního prostoru Příprava chemikálií Pracovní postup pro HRM Krok amplifikace Krok HRM analýzy Vyhodnocení HRM Analýza přítomnost RoundUp Ready sóji MON Příprava pracovního prostoru Příprava chemikálií Pracovní postup pro detekci GM sóji MON metodou PCR Vyhodnocení detekce GM sóji MON metodou PCR Příprava 2% agarózového gelu Vizualizace DNA po elektroforetické separaci Příklad HRM analýzy Příklad detekce GM sóji MON metodou PCR Závěr 31 3 Srovnání novosti postupů 31 4 Popis uplatnění certifikované metodiky 32 5 Ekonomické aspekty 32 6 Literatura 33 7 Seznam publikací, které předcházely metodice 33 Příloha č

5 1. Cíl metodiky Mléčné výrobky bývají často předmětem falšování. Při falšování mléčných výrobků bývá nahrazována smetana (mléčný tuk) jakožto drahá surovina např. přídavkem rostlinných tuků 1. Výrobky označované jako smetanové tak mohou obsahovat nižší podíl smetany, než je deklarováno na obale či nařízeno vyhláškou 77/2003 Sb. 2, kterou se stanoví požadavky pro mléko a mléčné výrobky, mražené krémy a jedlé tuky a oleje. Mléko obecně může být ve výrobku nahrazeno např. výluhem ze sójových bobů nebo přídavkem nejrůznějších aditiv (barviv, stabilizátorů, emulgátorů, plnidel) k zajištění požadovaných technologických a organoleptických vlastností. Nahrazování živočišných produktů v mléčných výrobcích sójou nedochází jen ke klamání spotřebitele, ale také k jeho potenciálnímu ohrožení vzhledem k tomu, že sója patří mezi nejsilnější alergeny. Alergie na sóju navíc patří mezi ty s nejčastějším výskytem 3. Nevědomá konzumace falšovaných potravin, kdy je ve výrobku nahrazena dražší surovina sójou nebo sójovým produktem, může být proto zdrojem nežádoucích alergických reakcí, ke kterým u alergiků dochází i při konzumaci potraviny s jen nepatrnou příměsí sóji 4. Podle vyhlášky 113/2005 Sb. 5 o způsobu označování potravin a tabákových výrobků, musí být rovněž výrobek, který obsahuje alergenní složku řádně označen. Cílem metodiky je poskytnutí postupu pro diagnostické analýzy mléčných výrobků vzhledem k záchytu jejich sójových analogů. Metodika je současně rozšířena o optimalizovanou metodu analýzy geneticky modifikované RoundUp Ready sóji MON , která patří mezi světově nejvíce používané GM plodiny. Metodika je dedikována Národní agentuře pro zemědělský výzkum, projekt číslo QI101B267 a výzkumnému záměru MZE

6 Metodika analýzy mléčných výrobků a jejich sójových analogů na přítomnost RoundUp Ready sóji Mléčné výrobky mohou být předmětem falšování. Dražší suroviny (např. smetana) jsou v těchto případech nahrazovány přídavkem rostlinných tuků. Mléko obecně pak může být ve výrobcích nahrazeno např. výluhem ze sójových bobů. Jelikož se sója řadí mezi silné alergeny a alergie na sóju je poměrně častá, kromě klamání spotřebitele hrozí také v případě falšování mléčných výrobků sójou alergické reakce. Je tedy důležité disponovat vhodnou metodou pro její detekci. Tato práce uvádí metodiku pro detekci sóji v mléčných výrobcích a analýzu, zda se jedná o geneticky modifikovanou RoundUp Ready sóju. Detekce sóji v mléčných výrobcích je založena na analýze profilu teploty tání amplifikačních produktů metodou High Resolution Melting (HRM). Analýza, zda se jedná o geneticky modifikovanou RoundUp Ready sóju, probíhá detekcí specifických úseků DNA metodou polymerázové řetězcové reakce (PCR). Methodology for Analysis of dairy products and their soy analogues for the presence of RoundUp Ready soybean Dairy products may be subject to adulteration, where there is a relatively expensive raw material (e.g. cream) replaced by the addition of vegetable fats. Milk can be replaced in dairy products for example by soybean extract. Because soy belongs among strong allergens and the incidence of allergy is rather high. Therefore it is necessary to have a method for its detection. This work introduces the method for detection of soy, including analysis of genetic modified RoundUp Ready soybean. Detection of soybean in dairy products is based on analysis of amplification products melting profiles by High Resolution Melting (HRM) method. Analysis of geneticaly modified RoundUp Ready soybean is based on DNA detection via Polymerase Chain Reaction (PCR). Oponenti: Ing. Přemysl Landa, PhD. Ústav experimentální botaniky AV ČR, Laboratoř biotechnologie rostlin, Rozvojová 263, Praha 6 - Lysolaje MVDr. Kateřina Staňková Ústřední kontrolní a zkušební ústav zemědělský, Národní referenční laboratoř, Oddělení mikrobiologie a biochemie, Hroznová 2, Brno 6

7 2. Vlastní popis metodiky 2.1 Termíny a definice Amplifikace zesílení, v případě DNA zmnožení Amplikon ohraničený amplifikovaný úsek DNA DNA deoxyribonukleová kyselina HRM (High Resolution Melting) post-pcr metoda používaná k identifikaci změn v sekvencích DNA. Je založena na detekci malých rozdílů v disociačních křivkách (křivkách tání) DNA. Nejprve dochází k navázání fluorescenčního barviva na dsdna. Během postupného zahřívání dochází k tavení dvoušroubovice DNA, čímž se z ní barvivo uvolňuje a dochází k poklesu fluorescence. Výsledkem je graf křivka tání, který znázorňuje pokles fluorescence při zvyšování teploty. PCR (Polymerase Chain Reaction) polymerázová řetězová reakce je in vitro technika používaná pro enzymatickou amplifikaci specifického úseku DNA, ohraničeného párem primerů. Reakční směs (MasterMix) se tvoří z: DNA (templát) dntps stavební kameny DNA (datp = deoxyadenosin trifosfát, dgtp = deoxyguanosin trifosfát, dttp = deoxy thymidin trifosfát, DTP = deoxycytidin trifosfát) specifické primery (forvard a reverse) oligonukleotidy o délce cca 20 bází nesoucí sekvenci komplementární k části templátové DNA pracovní pufr roztok MgCl 2 DNA polymeráza Cyklus PCR se skládá ze tří základních kroků. 7

8 V prvním kroku je templát (dvoušroubovicová DNA sloužící polymeráze jako vzor pro kopírování) rozdělen v zahřáté reakční směsi na dvě samostatná vlákna (denaturace C). V druhém kroku se reakční směs mírně ochladí v závislosti na možnostech primerů, které začnou na uvolněná vlákna templátu nasedat (annealing C). Ve třetím kroku termostabilní Taq polymeráza umožní prodlužováním primerů vytvoření kopie požadované sekvence DNA (extenze C). Cyklus se opakuje v závislosti na množství přítomné DNA a délce amplikonu, vzniklé DNA produkty pak slouží jako templář pro nový reakční cyklus. Výsledný počet kopií c po amplifikaci je dán vztahem c=2 n, kde n je počet cyklů. 2.2 Princip metody Metoda zahrnuje postup extrakce DNA z potravinářského mléčného produktu CTAB metodou. Přítomnost sóji v analyzovaném mléčném produktu je vyšetřena metodou High Resolution Melting (HRM). S použitím specifických primerových párů dojde nejprve k amplifikaci úseku DNA, který je pro sóju specifický. V reakční směsi je přitom obsaženo fluorescenční interkalační barvivo MeltDoctor (Applied Biosystems, Carlsbad, USA). Produkty amplifikace jsou pak vyšetřeny metodou HRM, kdy dochází k pozvolnému zahřívání vzorku ze 60 C na 95 C s rychlostí nárůstu teploty 0,3% se současným odečtem fluorescenčního signálu. V případě, že vyšetřovaný vzorek obsahoval DNA sóji, je ve výsledném grafu vidět křivka teploty tání analyzovaného amplifikačního produktu s charakteristickým profilem i hodnotou teploty tání. Obsahoval-li vyšetřovaný mléčný výrobek DNA sóji, proběhne klasickou metodou PCR analýza na přítomnost geneticky modifikované RoundUp Ready sóji MON

9 Vhodnost vybrané CTAB metody pro extrakci DNA i celý postup vyšetření přítomnosti sóji byl ověřen na řadě mléčných výrobků (viz Tabulka 1) a celý postup analýzy na nich bude demonstrován. Tabulka 1. Testované mléčné výrobky. Označení výrobku A B C D E F G H I J K L M Popis výrobku sójový kysaný nápoj sójový dezert vanilka Krajanka vaječný likér pribináček kakaový tvarohový jogurtový dezert Pacholík Cottage sýr jogurt bílý Cavalier jogurt s jahodovou složkou Florián kefír dětská kaše 2.3 Rušivé vlivy inhibitory Výchozí metodou analýzy přítomnosti sóji v mléčných výrobcích je PCR. V případě, že reakce neproběhne, není umožněna ani následná HRM analýza. Inhibitory PCR jsou látky různé chemické povahy. Mohou být přítomné přímo v analyzovaných vzorcích nebo do nich vniknou během manipulace se vzorky či reagenciemi. Tyto látky jsou schopné výrazně omezit, případně zcela zastavit aktivitu Taq polymerázy, a tím znemožnit amplifikaci DNA během probíhající PCR. 9

10 Prokázanými inhibitory PCR jsou prostředky používané na vysypávání ochranných gumových rukavic (talek, škrobový pudr) a zbytky fosfátů z mycích prostředků na laboratorním skle. V potravinářských matricích mohou mít inhibiční účinek například kationty Ca 2+, Fe 2+, těžké kovy a dále pak další látky uvedené v Tabulce 2. Tabulka 2. Vybrané inhibitory PCR inhibitor EDTA Ethanol Fenol CH3COONa Isopropanol NaCl Dodecylsulfát (SDS) sodný koncentrace > 0,5 mm > 1% (v/v) > 0,2% (v/v) > 5 mm > 1% (v/v) > 25 mm > 0,005% (w/v) 2.4 Přístrojové vybavení autokláv OT 032 centrifuga Rotina 420R centrifuga Universal 32R fotodokumentační zařízení hlubokomrazící box (- 80 C) horizontální DNA elektroforézy SCIE-PLAS horkovzdušný laboratorní sterilizátor FN 120 lednice (4 C) Mastercycler Nexus gradient Nüve, Turecko Hettich Zentrifugen, Německo Boeco, Německo BioTech, Česká republika New Brunswick Scientific, Anglie Labnet, Česká republika Nüve, Turecko Whirlpool, USA Eppendorf, Německo 10

11 mikropipety mikrovlnná trouba mini centrifuga SPECTRAFUGE mrazící box (- 20 C) nanophotometer ph metr předvážky Navigátor StepOnePlus Real-Time PCR systems thermomixer confort vodní lázeň LWB vortex mixer VX-200 zdroj k elektroforézám Nichiryo, Japonsko Daewoo, Jižní Korea Labnet, Česká republika Liebherr, Německo Implen GmbH, Německo Hamilton, USA Ohaus corporation, Švýcarsko Applied Biosystems, USA Eppendorf, Německo Labtech, Česká republika Labnet, Česká republika Consort, Belgie 2.5 Chemikálie a roztoky Agarose Serva Ethanol ethidium bromid GeneRuler 100 bp DNA Ladder H 2 O pro PCR (DNase and RNase free) MeltDoctor Syntetické oligonukleotidy (primery) TRIS HCl TRIS base λ DNA/Hind III marker SERVA, Německo Analytika, Česká republika SIGMA-ALDRICH, USA MBI Fermentas, Kanada SIGMA-ALDRICH, USA Applied Biosystems, USA Generi Biotech, Česká republika SERVA, Německo SERVA, Německo MBI Fermentas, Kanada 2.6 Extrakce DNA pomocí CTAB metody naváží se 200 mg homogenizovaného vzorku do 2 ml sterilní mik rozkumavky přidá se 400 µl sterilní neionizované vody, ihned po přidání se jednotlivé vzorky jemně promíchají kličkou tak, aby vznikla ho mogenní suspense a ponechají se 5 minut rehydratovat 11

12 přidá se 1,3 ml CTAB extrakčního pufru předehřátého na 65 C a vzorky se vortexují přidá se 10 µl RNázy A a vzorky se opatrně promíchají; probíhá inkubace 30 minut při teplotě 65 C, každých 10 minut se vzorky promíchají převracením mikrozkumavky přidá se 10 µl proteinázy K, vzorky se jemně promíchají obrace ním zkumavky a nechají se inkubovat 30 minut při teplotě 65 C, každých 10 minut se vzorky promíchají převracením mikrozku mavky centrifugace v odstředivce 10 minut při ot./min. do dvou nových 2 ml mikrozkumavek přenést 600 µl supernatan tu, přidat stejný objem směsi chloroform : isoamylalkohol (24 : 1) a důkladně v ruce třepat cca 1 minutu centrifugace v odstředivce 15 minut při ot./min. do nové 2 ml mikrozkumavky se přenese horní (vodní) fáze přidají se 2 objemy CTAB precipitačního pufru inkubace 60 minut při laboratorní teplotě bez jakéhokoli míchání centrifugace v odstředivce 15 minut při ot./min. pipetou se odstraní supernatant (popřípadě opatrně vylít) pelet nemusí být viditelný vysrážená DNA se rozpustí přidáním 450 µl roztoku 1,2 M NaCl a roztok se opatrně promíchá přidá se 450 µl směsi chloroform : isoamylalkohol (24 : 1) a 1 minutu se důkladně protřepává rukou centrifugace v odstředivce 20 minut při ot./min. horní vodní fáze se přenese do nové 1,5 ml mikrozkumavky přidat 0,6 objemu 99,8% isopropan-2-olu, jemně promíchat pře vracením mikrozkumavky a nechat inkubovat 20 minut při labo atorní teplotě centrifugace v odstředivce 15 minut při ot./min. vylitím nebo pipetováním se odstraní supernatant přidá se 500 µl 70% etanolu a několikrát převracením mikrozku mavky promíchá (toto je nejdůležitější krok dokončující komplet ní odstranění CTAB) centrifugace v odstředivce 10 minut při ot./min. 12

13 vylitím nebo pipetováním se odstraní supernatant vysuší se pelet DNA při laboratorní teplotě (cca 30 minut) a zno vu se nechá rozpustit v 60 µl vody při teplotě 4 C po dobu min. 12 hodin 2.7 Kontrola kvality izolované DNA Princip elektroforetické separace na agarózovém gelu Kontrola kvality DNA probíhá pomocí elektroforetické separace na agarózovém gelu s přídavkem ethidium bromidu. DNA se separuje elektroforeticky na základě svého náboje a molekulární hmotnosti. Délka doby elektroforetické separace je závislá na požadované délce dráhy migrace, protékajícím elektrickém proudu, použitém elektroforetickém pufru a na koncentraci agarózy v gelu. Ethidium bromid se naváže na DNA a při excitaci UV zářením vyzařu je oranžové fluorescenční záření Příprava 0,8% agarózového gelu Potřebné množství TAE pufru se naředí na pracovní koncentraci (zásobní roztok 50x TAE se naředí neionizovanou vodou v poměru 1:50). Takto naředěný pufr lze uchovávat maximálně 14 dní. Podle počtu vzorků se připraví navážka agarózy. Objem pufru, navážka agarózy a objem ethidia bromidu v závislosti na velikosti formy pro gel podle počtu vzorků je uveden v Tabulce 3. 13

14 Tabulka 3. Množství komponent agarózového gelu podle počtu vzorků pufr 1x TAE koncentrace gelu [w/v] agaróza [g] ethidium bromid [µl] počet vzorků 70 0,8% 0,56 0, ,8% 1,92 2,4 více než 36 Postup přípravy gelu: na analytických vahách se naváží na vážence potřebné množství agarózy navážená agaróza se převede do Erlenmayerovy baňky a zalije se potřebným objemem 1x TAE pufru baňka s pufrem a agarózou se umístí na otočný talíř mikro vlnné trouby, nastaví se stupeň ohřevu (nejvyšší pro 240 ml gelu, střední pro 70 ml gelu) a čas 2-3 minuty; v průběhu zahřívání agarózy je třeba roztok několikrát krouživým po hybem promíchat; je třeba dbát na to, aby var nebyl skrytý a agaróza nevzkypěla a nevystříkla mimo baňku ohřev se ukončí po cca 1 minutě varu, baňka se vyjme z mikrovlnné trouby a opatrně se její obsah krouživým po hybem ještě jednou promíchá baňka se postaví na elektromagnetickou míchačku v digestoři a vloží se do ní míchadélko během míchání agarózového gelu se připraví forma na gel s hřebínkem pro vytvoření nanášecích jamek v gelu když teplota roztoku v baňce klesne na cca 60 C (baňku lze udržet v ruce), přidá se k roztoku agarózy požadovaný ob jem ethidia bromidu a roztok se nechá ještě cca 1 minutu míchat míchadélko se z baňky vyjme pomocí magnetu a ještě hor ký tekutý roztok agarózy se nalije do formy na gel a nechá se vychladnout, takže dojde ke gelifikaci 14

15 (cca minut); je třeba dbát na to, aby po nalití do for my nezůstaly v gelu bublinky vzduchu po vychladnutí a ztuhnutí gelu se opatrně vyjme hřebínek, v gelu zůstanou jamky pro nanášení vzorků Postup nanášení vzorků na gel: z roztoku izolované DNA se odeberou 3 µl, k nim se přidá 7 µl sterilní deionizované vody a 3 µl 6x Loading Dye So lution, každý vzorek se promíchá 2x protažením špičkou pipety připravený elektroforetický gel se vloží do elektroforetické vany a převrství se (cca 5 mm) 1 x TAE pufrem do první a poslední dráhy se nanese 6 µl délkového standar du DNA Ladder HIND III do dalších drah se nanáší vždy 13 µl každého vzorku po ukončení nanášení vzorků se elektroforetická vana uza vře ví kem a nastaví se hodnota elektrického napětí pro 0,8 % agarózový gel 30V elektroforéza probíhá cca minut po ukončení elektroforézy se gel vyjme i s formou z vany a přenese se k fotodokumentačnímu zařízení se zdrojem UV záření Vizualizace DNA po elektroforetické separaci Vizualizace DNA po elektroforetické separaci probíhá s pomocí UV záření. Hledaný produkt se v UV světle vizualizuje v podobě svítícího proužku, podle srovnání pozice tohoto proužku s pozicí DNA fragmentů délkového standardu je pak určena délka produktu a stupeň jeho degradace. 15

16 2.8 High resolution melting (HRM) Příprava pracovního prostoru Otřou se pracovní plochy a pipety čerstvě připraveným 20% roztokem SAVA, otřou se pracovní plochy a pipety 70% roztokem etanolu. Je vhodné vystavit pracovní plochu germicidnímu záření UV lampy po dobu minimálně 15 minut Příprava chemikálií Všechny roztoky, uchovávané v mrazáku, se předem musí rozmrazit buď při laboratorní teplotě (v tomto případě se musí ukončit rozmrazování ihned po rozpuštění posledního tuhého kusu) nebo v lednici/na ledu. Obsah zkumavky se promíchá jejím převracením a krátkým vortexováním a krátce se všechny položky centrifugují na stolní minicentrifuze. Kontrola chemikálií pro HRM: 1. Ultra Pure H 2 O pro PCR 2. MeltDoctor MasterMix 3. Syntetické oligonukleotidy (Tabulka 4) 16

17 Tabulka 4. Použité oligonukleotidové sekvence (primery) název primeru COI-F 6 COI-R 6 lec118-f lec118-r nukleotidová sekvence (5-3 ) GAACTCTGCTCGGAGAC- GAC AGCACCAATTATTAGGG- GAAC GTGACCTCCTCGGGAA- AGTT CGGTTTCTTTGTCCCAAATG velikost produktu (bp) 134 bp 118 bp Pracovní postup pro HRM Analýzy HRM probíhá ve dvou krocích. Nejprve musí dojít amplifikaci cílových sekvencí DNA. V tomto prvním kroku nedochází k měření fluorescence, ale je nezbytně nutný pro možnost HRM analýzy. V druhém kroku (vlastní měření HRM) dochází k záznamu změn fluorescenčního signálu během zahřívání produktů amplifikační reakce, připravených v předchozím kroku. Oba kroky jsou od sebe oddělené a předpřipravené amplifikační produkty lze po kratší dobu (ideálně maximálně 24h) uchovávat při cca +4 C, případně po delší dobu (měsíce) při cca -20 C, v obou případech je nutné uchovávat vzorky v temnu. Pro analýzu přítomnosti sóji v mléčných výrobcích jsou v této metodice uvedeny 2 primerové páry. První primerový pár pro amplifikaci úseku DNA hovězího genu pro podjednotku 1 cytochrom oxidázy (primery COI) slouží jako kontrola přítomnosti DNA v analyzovaném vzorku a také pro ověření její funkčnosti při PCR. Je očekávaný pozitivní výsledek amplifikace s použitím tohoto primerového páru v případě, že analyzovaná DNA byla extrahována z potravinářského produktu, který obsahuje alespoň 0,5% kravského mléka či jiného produktu (smetana, sýr apod.), který je z tohoto mléka vyroben. 17

18 Druhý primerový pár slouží k amplifikaci úseku DNA, který je specifický pro sóju. Pozitivní výsledek značí, že analyzovaný vzorek obsahuje DNA sóji, negativní výsledek znamená, že vzorek DNA sóji neobsahuje. Z důvodu spolehlivého vyhodnocení je požadováno, aby HRM analýza byla provedena minimálně ve 3 opakováních pro každý vzorek Krok amplifikace požadované množství komponent potřebné pro PCR se ne chá roztát, jemně se promíchá a krátce centrifuguje; chemi kálie se udržují na ledu při teplotě 1 4 C do 1,5 ml mikrozkumavky pro MasterMix se pipetují jed notlivé složky MasterMixu (Tabulka 5) připravený MasterMix se důkladně, ale jemně promíchá pomocí vortexu a pipetuje se do 96 jamkové destičky do 96 jamkové destičky se k 15 µl MasterMixu přidá 5 µl templátové DNA destička se stočí na centrifuze po dobu 1 min destička se vzorky se vloží do přístroje StepOnePlus Real- Time PCR System a po nastavení teplotního profilu (Tabulka 6) se přístroj spustí Tabulka 5. Složení reakční směsi pro amplifikaci DNA pro HRM analýzu složka koncentrace zásobního roztoku objem do jedné reakce [µl] finální koncentrace v reakční směsi H 2 O - 3,8 - primer F 10 µm 0,6 300 nm primer R 10 µm 0,6 300 nm Melt Doctor 2x 10,0 1x roztok DNA maximálně 40 ng/µl 5,0-18

19 Tabulka 6. Teplotní profil amplifikace DNA pro HRM analýzu Teplota [ C] Čas [s] Počet cyklů Krok HRM analýzy po proběhnutí amplifikační části analýzy se destička z přístroje vyndá a stočí se na centrifuze po dobu 1 min destička se vloží zpět do přístroje StepOnePlus Real-Time Teplota [ C] PCR System, nastaví se typ experimentu Melt Curve, detekce cílové sekvence Melt Doctor, zruší se měření pasivní reference (označení None ) a po nastavení teplot ního profilu (Tabulka 7) se přístroj spustí Čas [s] Rychlost změny teploty Měření fluorescence % ,3% ano % Tabulka 7. Teplotní profil HRM 19

20 Vyhodnocení HRM HRM analýza se provádí s použitím počítačového programu High Resolution Melt Software (Applied Biosystems, Carlsbad, USA). V uvedeném programu se otevře soubor s výsledky měření HRM a nechá se proběhnout HRM analýza. Program vyhodnotí teplotní profily křivek tání a rozřadí je do klastrů na základě jejich podobnosti/ rozdílnosti. Pro analýzu je vhodné mít k sadě vzorků přiřazeny také referenční vzorky v tomto případě nějaký vzorek DNA sóji a ověřeného mléčného výrobku, který sóju neobsahuje. 2.9 Analýza přítomnost RoundUp Ready sóji MON Příprava pracovního prostoru Otřou se pracovní plochy a pipety čerstvě připraveným 20% roztokem SAVA, otřou se pracovní plochy a pipety 70% roztokem etanolu. Je vhodné vystavit pracovní plochu germicidnímu záření UV lampy po dobu minimálně 15 minut Příprava chemikálií Všechny roztoky, uchovávané v mrazáku, se předem musí rozmrazit buď při laboratorní teplotě (v tomto případě se musí ukončit rozmrazování ihned po rozpuštění posledního tuhého kusu) nebo v lednici/na ledu. Obsah zkumavky se promíchá jejím převracením a krátkým vortexováním a krátce se všechny položky centrifugují na stolní minicentrifuze. Kontrola chemikálií pro detekci GM sóji MON : 1. Ultra Pure H 2 O pro PCR 2. Syntetické oligonukleotidy (Tabulka 8) 20

21 3. 10x PCR Gold pufr vyjmout z mrazáku, rozmrazit, umístit do ledu, před použitím promíchat vortexem a ihned lehce stočit na centrifuze 4. MgCl 2 pro ApliTaqGold vyjmout z mrazáku, rozmrazit, umístit do ledu, před použitím promíchat vortexem a ihned lehce stočit na centrifuze 5. Směs 10mM dntp vyjmout z mrazáku, rozmrazit, umístit do ledu, před použitím promíchat vortexem a ihned lehce stočit na centrifuze 6. AmpliTaqGold Polymeráza vyjmout z mrazáku těšně před použitím, lehce stočit na centrifuze, umístit do ledu Tabulka 8. Použité oligonukleotidové sekvence (primery) název primeru nukleotidová sekvence (5-3 ) MON F 7 TGATGTGATATCTC- CACTGAC MON TGTATCCCTTGAGCCAT- -R 7 GTTGT velikost produktu (bp) 172 bp Pracovní postup pro detekci GM sóji MON metodou PCR Detekce GM sóji MON probíhá metodou klasické PCR s detekcí očekávaného produktu na 2% agarózovém gelu. Pozitivní reakce poskytne produkt o délce 172 bp. Pro ověření správné funkčnosti PCR je nezbytné k analyzovaným vzorkům zařadit vhodný pozitivní referenční materiál, např. certifikované referenční materiály IRMM-410S-0 (0% RR sója), IRMM-410S-1 (0,1% RR sója) a IRMM -410S-3 (1% RR sója). 21

22 Pro zajištění dostatečné spolehlivosti je vhodné provést analýzu ve dvou nezávislých opakováních pro každý vzorek. požadované množství komponent potřebné pro PCR se ne chá roztát, jemně se promíchá a krátce centrifuguje; chemi kálie se udržují na ledu při teplotě 1 4 C do 1,5 ml mikrozkumavky pro MasterMix se pipetují jed notlivé složky MasterMixu (Tabulka 9) připravený MasterMix se důkladně, ale jemně promíchá pomocí vortexu a pipetuje se do 0,2 ml tenkostěnných mik rozkumavek pro PCR k 20 µl MasterMixu se přidá 5 µl templátové DNA mikrozkumavky se stočí na stolní centrifuze mikrozkumavky se vloží do přístroje Mastercycler nexus gradient a po nastavení teplotního profilu (Tabulka 10) se přístroj spustí Tabulka 9. Složení reakční směsi pro amplifikaci MON metodou PCR složka koncentrace zásobního roztoku objem do jedné reakce [µl] finální koncentrace v reakční směsi H 2 O - 12,8-10x PCR Gold pufr 10x 2,5 1x MgCl 2 25 mm 3 3 mm dntp 10 mm 0,5 0,2 mm primer F 10 µm 0,5 200 nm primer R 10 µm 0,5 200 nm AmpliTaqGold Polymeráza roztok DNA 5U/ µl 0,2 - maximálně 20 ng/ µl 5,0-22

23 Tabulka 10. Teplotní profil pro amplifikaci MON metodou PCR Teplota [ C] Čas [s] Počet cyklů Vyhodnocení detekce GM sóji MON metodou PCR Příprava 2% agarózového gelu Potřebné množství TAE pufru se naředí na pracovní koncentraci (zásobní roztok 50x TAE se naředí neionizovanou vodou v poměru 1:50). Takto naředěný pufr lze uchovávat maximálně 14 dní. Podle počtu vzorků se připraví navážka agarózy. Objem pufru, navážka agarózy a objem ethidia bromidu v závislosti na velikosti formy pro gel podle počtu vzorků je uveden v Tabulce 11. Tabulka 11. Množství komponent agarózového gelu podle počtu vzorků pufr 1x TAE [ml] koncentrace gelu [w/v] agaróza [g] ethidium bromid [µl] 40 počet vzorků 70 2% 1,4 0, % 4,8 2,4 více než 36 23

24 Postup přípravy gelu: na analytických vahách se naváží na vážence potřebné množství agarózy navážená agaróza se převede do Erlenmayerovy baňky a zalije se potřebným objemem 1x TAE pufru baňka s pufrem a agarózou se umístí na otočný talíř mik rovlnné trouby, nastaví se stupeň ohřevu (nejvyšší pro 240 ml gelu, střední pro 70 ml gelu) a čas 2-3 minuty; v průběhu zahřívání agarózy je třeba roztok několikrát krouživým pohybem promíchat; je třeba dbát na to, aby var nebyl skrytý a agaróza nevzkypěla a nevystříkla mimo baňku ohřev se ukončí po cca 1 minutě varu, baňka se vyjme z mikrovlnné trouby a opatrně se její obsah krouživým pohybem ještě jednou promíchá baňka se postaví na elektromagnetickou míchačku v digestoři a vloží se do ní míchadélko během míchání agarózového gelu se připraví forma na gel s hřebínkem pro vytvoření nanášecích jamek v gelu když teplota roztoku v baňce klesne na cca 60 C (baňku lze udržet v ruce), přidá se k roztoku agarózy požadovaný objem ethidia bromidu a roztok se nechá ještě cca 1 minu tu míchat míchadélko se z baňky vyjme pomocí magnetu a ještě hor ký tekutý roztok agarózy se nalije do formy na gel a nechá se vychladnout, takže dojde ke gelifikaci (cca mi nut); je třeba dbát na to, aby po nalití do formy nezůstaly v gelu bublinky vzduchu po vychladnutí a ztuhnutí gelu se opatrně vyjme hřebínek, v gelu zůstanou jamky pro nanášení vzorků Postup nanášení vzorků na gel: Do mikrozkumavky s reakční směsí se přidají 3 µl 6x Loading Dye Solution, vzorek se promíchá (např. 2x pro 24

25 tažením špičkou pipety) připravený elektroforetický gel se vloží do elektroforetic ké vany a převrství se (cca 5 mm) 1 x TAE pufrem do první a poslední dráhy se nanesou 4 µl délkového stan dardu GeneRuler 100 bp DNA Ladder do dalších drah se nanáší vždy 25 µl každého vzorku po ukončení nanášení vzorků se elektroforetická vana uza vře víkem a nastaví se hodnota elektrického napětí pro 2 % agarózový gel 60V elektroforéza probíhá cca minut po ukončení elektroforézy se gel vyjme i s formou z vany a přenese se k fotodokumentačnímu zařízení se zdrojem UV záření Vizualizace DNA po elektroforetické separaci Vizualizace DNA po elektroforetické separaci probíhá s pomocí UV záření. Hledaný produkt se v UV světle vizualizuje v podobě svítícího proužku o délce 172 bp podle srovnání s použitým délkovým standardem Příklad HRM analýzy Obrázek 1. Teplotní profily amplifikačních produktů s použitím COI primerů 25

26 Podle této metodiky byla analyzována DNA vzorků, uvedených v Tabulce 1. Prvním krokem byla amplifikace a HRM analýza s použitím primerů COI. Grafy teplotních profilů amplifikačních produktů s použitím primerů COI jsou uvedeny na Obrázku 1. Z obrázku je patrné rozdělení vzorků do 2 skupin (viz barevné odlišení modrá a červená-fialová) podle charakteristiky křivky teploty tání jejich amplifikačních produktů. Třetí skupinu tvořily vzorky bez amplifikačního produktu (na obrázku označeno hnědou barvou). V Tabulce 12 jsou uvedeny teploty tání amplifikačních produktů a přiřazení vzorku do dané skupiny na základě HRM analýzy. Jako pozitivní a negativní referenční materiál (očekávaný výsledek podle použitých primerů) byla ke vzorkům zařazena DNA sóji a kukuřice, pro kontrolu kontaminace reakční směsi byla ke vzorkům zařazena MasterMixová kontrola (CTRL NEG). 26

27 Tabulka 12. Teploty tání amplifikačních produktů s použitím primerů COI, zařazení do skupin dle HRM analýzy Označení výrobku Popis výrobku Teplota tání HRM [ C] Skupina dle HRM analýzy kukuřice sója A sójový kysaný nápoj 76,1 1 B sójový dezert vanilka 76,1 1 C Krajanka vaječný likér 76,0 1 D pribináček kakaový 75,9 1 E tvarohový jogurtový dezert 76,1 1 F Pacholík 76,0 1 G Cottage sýr 76,0 1 H jogurt bílý 76,0 1 I Cavalier 75,2 2 J jogurt s jahodovou složkou 75,9 1 K Florián 75,5 2 L kefír 76,1 1 M dětská kaše 76,0 1 CTRL NEG

Metodika detekce vnitřního genu hrachu setého lektinu pomocí PCR

Metodika detekce vnitřního genu hrachu setého lektinu pomocí PCR Aleš Vráblík, Jan Hodek, Jaroslava Ovesná Metodika detekce vnitřního genu hrachu setého lektinu pomocí PCR METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2012 Metodika byla vypracována pracovníky


Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová,

Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová, Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová, METODIKA DETEKCE GENETICKY MODIFIKOVANÉHO TABÁKU VIRŽINSKÉHO (Nicotina tabacum L. cv. Samsun) S VNESENÝM KVASINKOVÝM MITOTICKÝM AKTIVÁTOREM (gen SpCdc25 z



Jan Hodek, Jaroslava Ovesná, Lucie Pavlátová. METODIKA DETEKCE GENETICKY MODIFIKOVANÉ PAPÁJI LINIÍ 55-1 a 63-1 METODIKA PRO PRAXI Jan Hodek, Jaroslava Ovesná, Lucie Pavlátová METODIKA DETEKCE GENETICKY MODIFIKOVANÉ PAPÁJI LINIÍ 55-1 a 63-1 METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2008 Metodika byla vypracována pracovníky



Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová. KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2009 Metodika byla vypracována pracovníky









Jaroslava Ovesná, Jan Hodek METODY EXTRAKCE DNA Z ČERSTVÉHO PLODU PAPÁJI A Z KANDOVANÉ PAPÁJI METODIKA PRO PRAXI Jaroslava Ovesná, Jan Hodek METODY EXTRAKCE DNA Z ČERSTVÉHO PLODU PAPÁJI A Z KANDOVANÉ PAPÁJI METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2010 Metodika byla vypracována pracovníky Národní


TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně


cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)


Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU 5-VINYL - 2-THIOOXAZOLIDONU (GOITRINU) METODOU GC

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU 5-VINYL - 2-THIOOXAZOLIDONU (GOITRINU) METODOU GC Národní referenční laboratoř Strana 1 STANOVENÍ OBSAHU 5-VINYL - 2-THIOOXAZOLIDONU (GOITRINU) METODOU GC 1 Rozsah a účel Metoda specifikuje podmínky pro stanovení vinylthiooxazolidonu (dále VOT) v krmivech.



VYUŽITÍ AFLP PRO DNA GENOTYPIZACI ROSTLIN RNDr. Jaroslava Ovesná, CSc. Mgr. Jan Hodek VYUŽITÍ AFLP PRO DNA GENOTYPIZACI ROSTLIN METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2007 Metodika byla vypracována pracovníky Národní Referenční



Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MELAMINU A KYSELINY KYANUROVÉ METODOU LC-MS Národní referenční laboratoř Strana 1 STANOVENÍ OBSAHU MELAMINU A KYSELINY KYANUROVÉ METODOU LC-MS 1 Rozsah a účel Postup je určen pro stanovení obsahu melaminu a kyseliny kyanurové v krmivech. 2 Princip


Hmotnostní detekce biologicky významných sloučenin pro biotechnologie část 3 - Provedení štěpení proteinů a následné analýzy,

Hmotnostní detekce biologicky významných sloučenin pro biotechnologie část 3 - Provedení štěpení proteinů a následné analýzy, Laboratoř Metalomiky a Nanotechnologií Hmotnostní detekce biologicky významných sloučenin pro biotechnologie část 3 - Provedení štěpení proteinů a následné analýzy, vyhodnocení výsledků, diskuse Anotace


Jednotné pracovní postupy zkoušení krmiv STANOVENÍ PŘÍTOMNOSTI GMO METODOU PCR

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ PŘÍTOMNOSTI GMO METODOU PCR Národní referenční laboratoř Strana 1 1 Rozsah a účel STANOVENÍ PŘÍTOMNOSTI GMO METODOU PCR Postup slouží k detekci přítomnosti genetických modifikací/geneticky modifikovaných organismů ve vzorcích krmiv,



DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit



Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU PROBIOTICKÝCH BAKTERIÍ RODU ENTEROCOCCUS Národní referenční laboratoř Strana 1 STANOVENÍ OBSAHU PROBIOTICKÝCH BAKTERIÍ RODU ENTEROCOCCUS 1 Rozsah a účel Postup slouží ke stanovení počtu probiotických bakterií v doplňkových látkách, premixech


Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MYKOTOXINŮ METODOU LC-MS - FUMONISIN B 1 A B 2

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MYKOTOXINŮ METODOU LC-MS - FUMONISIN B 1 A B 2 Národní referenční laboratoř Strana 1 STANOVENÍ OBSAHU MYKOTOXINŮ METODOU LC-MS - FUMONISIN B 1 A B 2 1 Rozsah a účel Metoda je vhodná pro stanovení fumonisinů B 1 a B 2 v krmivech. 2 Princip Fumonisiny


Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie

Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie IZOLACE GENOMOVÉ DNA Deoxyribonukleová kyselina (DNA) představuje základní genetický materiál většiny


Obsah Protein Gel Electrophoresis Kitu a jeho skladování

Obsah Protein Gel Electrophoresis Kitu a jeho skladování Obsah Protein Gel Electrophoresis Kitu a jeho skladování Protein Gel Electrophoresis Kit obsahuje veškerý potřebný materiál provádění vertikální polyakrilamidové gelové elektroforézy. Experiment provádějí


Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Inovace praktických cvičení molekulárně-biologických předmětů o sekvenční úlohy PRACOVNÍ PROTOKOL PRO PŘEDMĚT GENETCKÁ DIVERZITA Vypracováno


Polymorfismus délky restrikčních fragmentů

Polymorfismus délky restrikčních fragmentů Polymorfismus délky restrikčních fragmentů Princip: Chemikálie: PCR produkt z předchozího praktického cvičení Endonukleáza KpnI 10 U μl -1 Pufr pro KpnI 10 koncentrovaný (Tris-HCl 100 mmol l -1 ph 7,5,


Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU VITAMÍNU D METODOU LC/MS

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU VITAMÍNU D METODOU LC/MS Národní referenční laboratoř Strana 1 STANOVENÍ OBSAHU VITAMÍNU D METODOU LC/MS 1 Účel a rozsah Tento postup specifikuje podmínky pro stanovení vitamínu D3 v krmivech metodou LC/MS. 2 Princip Zkušební





Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Charakteristika testu: Set AMPLICOR HPV vyráběný firmou Roche je určený pro detekci vysoko-rizikových typů lidských


Sure-MeDIP I. with magnetic beads and MNase.

Sure-MeDIP I. with magnetic beads and MNase. Sure-MeDIP I with magnetic beads and MNase 1 Obsah soupravy a skladování MeDIP souprava obsahuje reagencie na provedení 25 reakcí. Souprava je rozdělen do dvou částí, jedna je distribuována



POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek



RNA Blue REAGENS PRO RYCHLOU PŘÍPRAVU ČISTÉ A NEDEGRADOVANÉ RNA (katalogové číslo R011, R012, R013) RNA Blue REAGENS PRO RYCHLOU PŘÍPRAVU ČISTÉ A NEDEGRADOVANÉ RNA (katalogové číslo R011, R012, R013) Upozornění: RNA Blue obsahuje fenol a další toxické komponenty. Při kontaktu s kůží je nutné omytí velkým


Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách

Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách Teorie Stanovení celkových proteinů Celkové množství proteinů lze stanovit pomocí několika metod; například: Hartree-Lowryho





NRAS StripAssay. Kat. číslo 5-610. 20 testů 2-8 C

NRAS StripAssay. Kat. číslo 5-610. 20 testů 2-8 C NRAS StripAssay Kat. číslo 5-610 20 testů 2-8 C Popis stripu: Pracovní postup 1. Izolace DNA Pro izolaci DNA musí být použita vhodná metoda vzhledem k typu tkáně vzorku. Pro doporučení vhodné metody kontaktujte


EGFR XL StripAssay. Kat. číslo 5-630. 20 testů 2-8 C

EGFR XL StripAssay. Kat. číslo 5-630. 20 testů 2-8 C EGFR XL StripAssay Kat. číslo 5-630 20 testů 2-8 C Popis stripu Pracovní postup 1. Izolace DNA Pro izolaci DNA použijte vhodný izolační kit. Doporučené kity jsou následující: Pro izolaci čerstvých nebo


Western blotting. 10% APS 20,28 µl 40,56 µl 81,12 µl 20,28 µl 40,56 µl 81,12 µl

Western blotting. 10% APS 20,28 µl 40,56 µl 81,12 µl 20,28 µl 40,56 µl 81,12 µl Western blotting 1. Příprava gelu složení aparatury hustotu gelu volit podle velikosti proteinů příprava rozdělovacího gelu: 10% 12% počet gelů 1 2 4 1 2 4 objem 6 ml 12 ml 24 ml 6 ml 12 ml 24 ml 40% akrylamid


Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje


Laboratorní úlohy z molekulární biologie

Laboratorní úlohy z molekulární biologie ČESKÁ ZEMĚDĚLSKÁ UNIVERZITA V PRAZE FAKULTA TROPICKÉHO ZEMĚDĚLSTVÍ Katedra tropických a subtropických plodin a agrolesnictví Laboratoř molekulární biologie Laboratorní úlohy z molekulární biologie Plant



ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN Fragmenty nukleových kyselin lze dle jejich velikosti rozdělit elektroforézou. Elektroforéza využívá rozdílné pohyblivosti jednotlivých fragmentů, danou právě


α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction


Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody

Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody Návod k použití souprav Wipe test Kontaminační kontrola Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody REF 7091 40 reakcí 1. Popis výrobku V posledních letech se



ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce


Písemná zpráva zadavatele

Písemná zpráva zadavatele Písemná zpráva zadavatele veřejné zakázky zadávané dle zákona č. 137/2006 Sb., o veřejných zakázkách, ve znění účinném ke dni zahájení zadávacího řízení (dále jen ZVZ ). Veřejná zakázka Název: Ostatní





Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU KVASINEK RODU SACCHAROMYCES

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU KVASINEK RODU SACCHAROMYCES Národní referenční laboratoř Strana 1 STANOVENÍ OBSAHU KVASINEK RODU SACCHAROMYCES 1 Rozsah a účel Metodika slouží ke stanovení počtu probiotických kvasinek v doplňkových látkách, premixech a krmivech.



Téma: IZOLACE DNA Z ROSTLIN, DIRECT A NESTED PCR SPECIFICKÝMI A UNIVERZÁLNÍMI PRIMERY, RFLP. Ing. Jana Fránová, Dr., Biologické centrum AV ČR v.v.i. Téma: IZOLACE DNA Z ROSTLIN, DIRECT A NESTED PCR SPECIFICKÝMI A UNIVERZÁLNÍMI PRIMERY, RFLP Ing. Jana Fránová, Dr., Biologické centrum AV ČR v.v.i. Teorie: Zatímco do devadesátých let minulého století



PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER Trojan V., Hanáček P., Havel L. Department of Plant Biology, Faculty of Agronomy, Mendel University of Agriculture and Forestry in Brno, Zemedelska


Verze: 1.2 Datum poslední revize: 24.9.2014. Nastavení real-time PCR cykleru. Light Cycler 480 Instrument. (Roche) generi biotech

Verze: 1.2 Datum poslední revize: 24.9.2014. Nastavení real-time PCR cykleru. Light Cycler 480 Instrument. (Roche) generi biotech Verze: 1.2 Datum poslední revize: 24.9.2014 Nastavení real-time PCR cykleru Light Cycler 480 Instrument (Roche) generi biotech OBSAH 1. Nastavení teplotního profilu...3 1.1. Nastavení nového teplotního


Druhy. a složení potravin. Cvičení č. 1. Vyučující: Martina Bednářová. Druhy a složení potravin cvičení č. 1

Druhy. a složení potravin. Cvičení č. 1. Vyučující: Martina Bednářová. Druhy a složení potravin cvičení č. 1 Druhy Cvičení č. 1 Vyučující: Martina Bednářová a složení potravin 1 2 Požadavky na splnění předmětu Druhy a složení potravin - cvičení 1x za 14 dní, (celkem 7 cvičení) 2x 45 min. (90 min) Absence 1x omluvená


Metodika stanovení kyselinové neutralizační kapacity v pevných odpadech

Metodika stanovení kyselinové neutralizační kapacity v pevných odpadech Metodika stanovení kyselinové neutralizační kapacity v pevných odpadech 1 Princip Principem zkoušky je stanovení vodného výluhu při různých přídavcích kyseliny dusičné nebo hydroxidu sodného a následné





LP č. 6 - BÍLKOVINY. Autor: Mgr. Stanislava Bubíková. Datum (období) tvorby: 28. 2. 2013. Ročník: devátý

LP č. 6 - BÍLKOVINY. Autor: Mgr. Stanislava Bubíková. Datum (období) tvorby: 28. 2. 2013. Ročník: devátý LP č. 6 - BÍLKOVINY Autor: Mgr. Stanislava Bubíková Datum (období) tvorby: 28. 2. 2013 Ročník: devátý Vzdělávací oblast: Člověk a příroda / Chemie / Organické sloučeniny 1 Anotace: Žáci prakticky ověří



Jednotné pracovní postupy testování odrůd STANOVENÍ OBSAHU TANINŮ V ČIROKU SPEKTROFOTOMETRICKY 5321.1 Stanovení obsahu taninů v čiroku Strana 1 STANOVENÍ OBSAHU TANINŮ V ČIROKU SPEKTROFOTOMETRICKY 1 Účel a rozsah Postup je určen pro stanovení obsahu taninů v zrnech čiroku. 2 Princip Taniny se ze


Sure-MeDIP II. with agarose beads and Mse I.

Sure-MeDIP II. with agarose beads and Mse I. Sure-MeDIP II with agarose beads and Mse I 1 Obsah soupravy a skladování MeDIP souprava obsahuje reagencie na provedení 25 reakcí. Souprava je rozdělen do dvou částí, jedna je distribuována


1. Metodika. Protokol č. F1-4 Metodika: Srovnávací analýza efektivity přípravy rekombinantního proteinu ve fermentoru

1. Metodika. Protokol č. F1-4 Metodika: Srovnávací analýza efektivity přípravy rekombinantního proteinu ve fermentoru Protokol č.: F1-4 Datum: 20.12.2010 Metodika: analýza efektivity přípravy výběr z výsledků ze zkušebních provozů výroby antigenů. Vypracoval: Ing. Václav Filištein, Mgr. Tereza Chrudimská, Spolupracující


Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU VITAMÍNU D METODOU HPLC

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU VITAMÍNU D METODOU HPLC Národní referenční laboratoř Strana 1 STANOVENÍ OBSAHU VITAMÍNU D METODOU HPLC 1 Rozsah a účel Tato metoda specifikuje podmínky pro stanovení vitamínu D v premixech pro výrobu krmných směsí metodou HPLC.



ČESKÁ TECHNICKÁ NORMA ČESKÁ TECHNICKÁ NORMA ICS 67.100.10 2006 Mléko - Stanovení obsahu močoviny - Enzymatická metoda s použitím změny v ph (Referenční metoda) ČSN ISO 14637 57 0102 Únor Milk - Determination of urea content


Spektrofotometrické stanovení fosforečnanů ve vodách

Spektrofotometrické stanovení fosforečnanů ve vodách Spektrofotometrické stanovení fosforečnanů ve vodách Úkol: Spektrofotometricky stanovte obsah fosforečnanů ve vodě Chemikálie: 0,07165 g dihydrogenfosforečnan draselný KH 2 PO 4 75 ml kyselina sírová H


OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14 OBSAH DNA polymerázy pro PCR a pufry.................. 3 Taq DNA polymeráza 4 Taq DNA polymeráza Unis 5 TaqPurple DNA polymeráza 6 Taq DNA polymeráza 1.1 7 Combi Taq DNA polymeráza 8 LA DNA Polymerases


CVD-T StripAssay. Kat. číslo 4-360. 20 testů 2-8 C

CVD-T StripAssay. Kat. číslo 4-360. 20 testů 2-8 C CVD-T StripAssay Kat. číslo 4-360 20 testů 2-8 C Popis stripu Pracovní postup Izolace DNA Použijte čerstvou nebo zmraženou krev s EDTA nebo citrátem, jako antikoagulans, vyhněte se krvi s obsahem heparinu.


Identifikace mikroorganismů pomocí sekvence jejich genu pro 16S rrna

Identifikace mikroorganismů pomocí sekvence jejich genu pro 16S rrna Praktická úloha Identifikace mikroorganismů pomocí sekvence jejich genu pro 16S rrna Pro spolehlivou identifikaci mikroorganismů pomocí genetických metod se velmi často využívá stanovení nukleotidové sekvence



STUDIE GENOMON VÝSKYT GENETICKY MODIFIKOVANÝCH POTRAVIN V TRŽNÍ SÍTI V ČR V ROCE 2010. M. Mendlová, V. Ostrý, J. Ruprich STUDIE GENOMON VÝSKYT GENETICKY MODIFIKOVANÝCH POTRAVIN V TRŽNÍ SÍTI V ČR V ROCE 2010 M. Mendlová, V. Ostrý, J. Ruprich Státní zdravotní ústav v Praze Centrum zdraví, výživy a potravin Oddělení analýzy


Alergeny v potravinách ve vztahu k systému HACCP

Alergeny v potravinách ve vztahu k systému HACCP Alergeny v potravinách ve vztahu k systému HACCP 27. duben 2012 Ing. Milena Musilová SYSTÉM HACCP Hazard Analysis and Critical Control Points Systém řízení zdravotní nezávadnosti


Postup ke stanovení báze metamfetaminu metodou GC-FID

Postup ke stanovení báze metamfetaminu metodou GC-FID Postup ke stanovení báze metamfetaminu metodou GC-FID Důvodem pro vypracování postup je nutnost přesného a striktního definování podmínek pro kvantitativní stanovení obsahu báze metamfetaminu v pevných


Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování



PROTOKOL WESTERN BLOT WESTERN BLOT 1. PŘÍPRAVA ELEKTROFORETICKÉ APARATURY Saponátem a vodou se důkladně umyjí skla, plastové vložky a hřebínek, poté se důkladně opláchnou deionizovanou/destilovanou vodou a etanolem a nechají


Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU VITAMÍNU A A VITAMÍNU E METODOU HPLC

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU VITAMÍNU A A VITAMÍNU E METODOU HPLC Národní referenční laboratoř Strana 1 STANOVENÍ OBSAHU VITAMÍNU A A VITAMÍNU E METODOU HPLC 1 Účel a rozsah Postup specifikuje podmínky pro stanovení vitamínu A a vitamínu E v krmivech a premixech. 2 Princip


Problematika molekulárněmikrobiologické diagnostiky

Problematika molekulárněmikrobiologické diagnostiky Problematika molekulárněmikrobiologické diagnostiky Jaroslav Hrabák Téma jednání 1. Nepodkročitelná minima vybavení molekulárněmikrobiologické laboratoře Schválení dokumentu 1. Vzdělávání v molekulární


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi


Diagnostické metody v analýze potravin. Matej Pospiech, FVHE Brno

Diagnostické metody v analýze potravin. Matej Pospiech, FVHE Brno Diagnostické metody v analýze potravin Matej Pospiech, FVHE Brno Důvody diagnostiky potravin Dodržování legislativních požadavků Vlastní kontrola v provozu Národní legislativa Evropská a mezinárodní legislativa


Výzkumný ústav rostlinné výroby Praha Ruzyně

Výzkumný ústav rostlinné výroby Praha Ruzyně Výzkumný ústav rostlinné výroby Praha Ruzyně Optimalizovaná metodika PAGE pro analýzu esteráz v hlízách brambor (Solanum tuberosum L.) Vypracovaná jako výstup projektu 1B 44011 VÝVOJ A TESTOVÁNÍ SYSTÉMU


Chelatometrie. Stanovení tvrdosti vody

Chelatometrie. Stanovení tvrdosti vody Chelatometrie Stanovení tvrdosti vody CHELATOMETRIE Cheláty (vnitřně komplexní sloučeniny; řecky chelé = klepeto) jsou komplexní sloučeniny, kde centrální ion je členem jednoho nebo více vznikajících kruhů.


Úloha č. 1 Odměřování objemů, ředění roztoků Strana 1. Úkol 1. Ředění roztoků. Teoretický úvod - viz návod

Úloha č. 1 Odměřování objemů, ředění roztoků Strana 1. Úkol 1. Ředění roztoků. Teoretický úvod - viz návod Úloha č. 1 Odměřování objemů, ředění roztoků Strana 1 Teoretický úvod Uveďte vzorec pro: výpočet směrodatné odchylky výpočet relativní chyby měření [%] Použitý materiál, pomůcky a přístroje Úkol 1. Ředění


Úloha č. 9 Stanovení hydroxidu a uhličitanu vedle sebe dle Winklera

Úloha č. 9 Stanovení hydroxidu a uhličitanu vedle sebe dle Winklera Úloha č. 9 Stanovení hydroxidu a uhličitanu vedle sebe dle Winklera Princip Jde o klasickou metodu kvantitativní chemické analýzy. Uhličitan vedle hydroxidu se stanoví ve dvou alikvotních podílech zásobního


PP Master Mixy... 13 PPP Master Mix 14 Plain PP Master Mix 15 Combi PPP Master Mix 16 new Plain Combi PP Master Mix 17

PP Master Mixy... 13 PPP Master Mix 14 Plain PP Master Mix 15 Combi PPP Master Mix 16 new Plain Combi PP Master Mix 17 Obsah DNA polymerázy pro PCR a pufry............................... 5 Taq DNA polymeráza 6 Taq DNA polymeráza Unis 7 TaqPurple DNA polymeráza 8 Taq DNA polymeráza 1.1 9 Combi Taq DNA polymeráza 10 LA DNA



Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU VÁPNÍKU, DRASLÍKU, HOŘČÍKU, SODÍKU A FOSFORU METODOU ICP-OES Národní referenční laboratoř Strana 1 STANOVENÍ OBSAHU VÁPNÍKU, DRASLÍKU, HOŘČÍKU, SODÍKU A FOSFORU METODOU ICP-OES 1 Rozsah a účel Metoda je určena pro stanovení makroprvků vápník, fosfor, draslík, hořčík


Metody molekulární biologie v rostlinné ekologii a systematice

Metody molekulární biologie v rostlinné ekologii a systematice Protokoly a návody pro praktikum Metody molekulární biologie v rostlinné ekologii a systematice Laboratoř molekulární biologie rostlin, PřF JCU, Branišovská 31, České Budějovice 2008, Miroslava Herbstová,


C V C. Návod k použití pro Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revize 2. Červenec 2014

C V C. Návod k použití pro Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revize 2. Červenec 2014 DOT130v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Strana 1 / 7 Návod k použití pro Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revize 2 Červenec 2014 DOT130v1



Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU HYDROXYPROLINU SPEKTROFOTOMETRICKY Strana 1 STANOVENÍ OBSAHU HYDROXYPROLINU SPEKTROFOTOMETRICKY 1 Rozsah a účel Postup specifikuje podmínky pro stanovení obsahu hydroxyprolinu v živočišných tkáních spektrofotometrickou metodou. 2 Princip


Metody molekulární biologie v rostlinné ekologii a systematice

Metody molekulární biologie v rostlinné ekologii a systematice Protokoly a návody pro praktikum Metody molekulární biologie v rostlinné ekologii a systematice (verze 2013 2014) Laboratoř molekulární biologie rostlin Přírodovědecká fakulta JU Petr Koutecký & Jiří Košnar


generi biotech nastavení real-time PCR cykleru Applied Biosystems 7300 a 7500 Fast Real-Time System (Applied Biosystems)

generi biotech nastavení real-time PCR cykleru Applied Biosystems 7300 a 7500 Fast Real-Time System (Applied Biosystems) Verze: 1.2 Datum poslední revize: 24.9.2014 nastavení real-time PCR cykleru Applied Biosystems 7300 a 7500 Fast Real-Time System (Applied Biosystems) generi biotech OBSAH 1. Nastavení nového teplotního



DODATEČNÉ INFORMACE K ZADÁVACÍM PODMÍNKÁM DODATEČNÉ INFORMACE K ZADÁVACÍM PODMÍNKÁM Zadavatel: Česká zemědělská univerzita v Praze Sídlo: Praha Suchdol, Kamýcká 129, PSČ 165 21 IČ: 604 60 709 Zastoupený: Ing. Janou Vohralíkovou, kvestorkou Profil


Laboratorní přístrojová technika

Laboratorní přístrojová technika Laboratorní přístrojová technika Co najdeme v laboratoři? Přístroje pro obecné použití centrifugy, třepačky, pipety, biohazard boxy Trocha teorie o DNA a PCR Analytické přístroje a příprava vzorků elektroforézy


Dovednosti/Schopnosti. - orientuje se v ČL, který vychází z Evropského lékopisu;

Dovednosti/Schopnosti. - orientuje se v ČL, který vychází z Evropského lékopisu; Jednotka učení 4a: Stanovení obsahu Ibuprofenu 1. diferencování pracovního úkolu Handlungswissen Charakteristika pracovní činnosti Pracovní postup 2. HINTERFRAGEN 3. PŘIŘAZENÍ... Sachwissen Charakteristika


Základní praktická cvičení z molekulární biologie

Základní praktická cvičení z molekulární biologie Univerzita Palackého Přírodovědecká fakulta Základní praktická cvičení z molekulární biologie Kolektiv autorů: Doc. RNDr. Milan Navrátil, CSc. RNDr. Lenka Uvírová Mgr. Petr Nádvorník, Ph.D. Ing. Marie


Základy laboratorní techniky

Základy laboratorní techniky Předmět: Biologie ŠVP: prokaryotní organismy, genetika Doporučený věk žáků: 16 18 let Doba trvání: 2 x 45 min. Specifické cíle: naučit studenty pracovat s laboratorními pomůckami a přístroji Seznam pomůcek:





Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR Mikrobiologický ústav AV ČR Příloha 6 Havarijní plán 1/5 Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR a) Adresa pracoviště Mikrobiologický ústav AV ČR


FD-DVS R-703 phage Control

FD-DVS R-703 phage Control FD-DVS R-703 phage Control Informace o výrobku Verze: 3 PI-EU-EN 11-23-2011 Popis Taxanomie Mezofilní homofermentativní kultura typu O. Kultury ze série phage Control jsou vysoce rezistentní vůči fágům


Včetně poslední změny: nařízení vlády č. 238/2009 Sb. s účinností 1. 8. 2009. 1 Předmět úpravy

Včetně poslední změny: nařízení vlády č. 238/2009 Sb. s účinností 1. 8. 2009. 1 Předmět úpravy Nařízení vlády č. 205/2004 Sb., kterým se v rámci společné organizace trhu s mlékem a mléčnými výrobky stanoví bližší podmínky poskytování podpory a národní podpory spotřeby mléka a mléčných výrobků žáky,



ČESKÁ TECHNICKÁ NORMA ČESKÁ TECHNICKÁ NORMA ICS 67.100.99, 07.100.30 2004 Jogurt - Identifikace charakteristických mikroorganismů - (Lactobacillus delbrueckii subsp. bulgaricus a Streptococcus thermophilus) ČSN ISO 9232 57


Návod k použití HISTO TYPE SSP Kits

Návod k použití HISTO TYPE SSP Kits Návod k použití HISTO TYPE SSP Kits 0123 IVD Testovací soupravy pro tkáňovou typizaci HLA alel na molekulárně genetickém základě (třída I: HLA-A, B, C, třída II: HLA-DR, DQ) prealiquotováno a připraveno


Mykologická analýza potravin

Mykologická analýza potravin Mykologická analýza potravin a. Souhrn V roce 2010 byl zahájen druhý dvouletý cyklus nově uspořádaného Monitoringu dietární expozice člověka a tím i pozměněného projektu "MYKOMON". Vzhledem k detailnějšímu



PO STOPÁCH BAKTERIÍ V/KOLEM NÁS PO STOPÁCH BAKTERIÍ V/KOLEM NÁS Jana Spáčilová, UK v Praze, PřF, Katedra buněčné biologie Svět bakterií je nesmírně druhově bohatý a máme ho blíž než před očima. Mikroskopickými metodami můžeme obdivovat


LABORATORNÍ PŘÍRUČKA. Laboratoř HLA systému a PCR diagnostiky

LABORATORNÍ PŘÍRUČKA. Laboratoř HLA systému a PCR diagnostiky LABORATORNÍ PŘÍRUČKA Transfuzní oddělení Laboratoř systému a PCR diagnostiky Účinnost od 15. 9. 2015 Verze č. 4 Tímto předpisem se ruší Verze č. 3, platnost od 1. 4. 2014 Odborný garant Jméno a příjmení,


Devyser AZF. Návod k použití

Devyser AZF. Návod k použití Devyser AZF Kat.č. 8-A019 Pro in vitro diagnostiku Návod k použití Devyser AZF, Návod k použití, 7-A012-CZ, May-2012 Strana 1 z 20 Devyser AZF, Návod k použití, 7-A012-CZ, May-2012 Strana 2 z 20 Obsah


Výzkumný ústav rostlinné výroby Praha Ruzyně

Výzkumný ústav rostlinné výroby Praha Ruzyně Výzkumný ústav rostlinné výroby Praha Ruzyně Optimalizovaná metodika PAGE pro analýzu peroxidáz v hlízách brambor (Solanum tuberosum L.) Vypracovaná jako výstup projektu 1B 44011 VÝVOJ A TESTOVÁNÍ SYSTÉMU



ČESKÁ TECHNICKÁ NORMA ČESKÁ TECHNICKÁ NORMA ICS 67.050 2008 Potraviny - Metody pro detekci geneticky modifikovaných organismů a odvozených produktů - Metody založené na stanovení proteinů ČSN EN ISO 21572 56 9901 Leden idt


Výzkumný ústav rostlinné výroby Praha Ruzyně. Metodika byla vypracována jako výstup výzkumného záměru MZe č. 0002700602. Autor: Ing.

Výzkumný ústav rostlinné výroby Praha Ruzyně. Metodika byla vypracována jako výstup výzkumného záměru MZe č. 0002700602. Autor: Ing. Výzkumný ústav rostlinné výroby Praha Ruzyně Optimalizovaná metodika SDS-PAGE pro analýzu LMW podjednotek gluteninů pšenice Metodika byla vypracována jako výstup výzkumného záměru MZe č. 0002700602 Autor:


Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MYKOTOXINŮ METODOU HPLC - ZEARALENON

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MYKOTOXINŮ METODOU HPLC - ZEARALENON Národní referenční laboratoř Strana 1 STANOVENÍ OBSAHU MYKOTOXINŮ METODOU HPLC - ZEARALENON 1 Rozsah a účel Metoda specifikuje podmínky pro stanovení zearalenonu v krmivech. 1 Zearalenon (ZON) je charakterizován


Geneticky modifikované potraviny a krmiva

Geneticky modifikované potraviny a krmiva Geneticky modifikované potraviny a krmiva Co je to geneticky modifikovaný organismus (GMO)? Za GMO je považován organismus, s výjimkou člověka, jehož dědičná informace uložená v DNA byla změněna pomocí



PROTOKOL NORTHERNOVA HYBRIDIZACE ! NORTHERNOVA HYBRIDIZACE Vzhledem k tomu, že se při Northern hybridizaci pracuje s RNA a RNA je extrémně citlivá na působení RNáz, je zapotřebí se vyvarovat jakékoliv kontaminace RNázami. Pro snížení


Falšování potravin. MVDr. Matej Pospiech, Ph.D.

Falšování potravin. MVDr. Matej Pospiech, Ph.D. Falšování potravin MVDr. Matej Pospiech, Ph.D. Mendelova univerzita, 31.10.2013 Obsah přednášky úvod, historie co považujeme za falšování specifika falšování potravin nejčastější způsoby falšování u jednotlivých



STANOVENÍ MYKOTOXINŮ V OBILOVINÁCH METODOU ELISA Národní referenční laboratoř Strana 1 STANOVENÍ MYKOTOXINŮ V OBILOVINÁCH METODOU ELISA 1 Účel a rozsah Metoda specifikuje podmínky pro stanovení přítomnosti, případně obsahu jednotlivých mykotoxinů metodou
