Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek"


1 Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek

2 Polymerázová řetězová reakce (PCR) Zavedení PCR v roce 1983 (Kary B. Mullis) Nobelova cena 1993 Metodika umožňující mnohonásobné zmnožení (amplifikaci) specifického úseku DNA in vitro založená na principu replikace K opakující se enzymové syntéze komplementárních řetězců vybraných úseků dvouřetězcové DNA dochází po připojení dvou primerů (které vybraný úsek vymezují) vázajících se na protilehlé řetězce DNA tak, že jejich 3'-OHkonce směřují proti sobě (dovnitř vymezeného úseku)

3 Základní rysy PCR jsou shodné s replikací (přirozenou enzymatickou syntézou) DNA: Jako templát slouží ssdna, podle níž je syntetizován komplementární řetězec K zahájení reakce je zapotřebí primer, který se připojuje na komplementární úseky DNA. Tím je zároveň vymezen úsek DNA, který bude amplifikován Jako templáty pro syntézu mohou sloužit oba řetězce dsdna, po předchozí denaturaci v tom tkví řetězovost PCR Teoreticky lze získat 2n(-1) řetězců (kopií). Pravidelné (cyklické) střídání tří fází: Teplotní denaturace dvouřetězcové DNA Annealing (nasedání, hybridizace) primerů na oddělené řetězce Syntéza nových řetězců DNA polymerázou (elongace primerů) Cyklus číslo Počet nových dvouřetězcových molekul

4 Denaturace vzorku DNA Pro oddělení jednořetězců (94 C, 5 min) Připojení primerů na řetězce DNA (30-65 C, 1 min) Denaturace pro separaci řetězců DNA (94 C, 30 s) Syntéza nových řetězců DNA polymerázou (72 C, 45s - 2 min)

5 Schéma PCR

6 Replikace DNA in vivo vyžaduje mnoho enzymů

7 Replikace DNA in vitro vyžaduje pouze jeden enzym! Reakční směs obsahuje: 1) 2) 3) 4) 5) 6) 7) vodu nukleotidy (dntp) reakční pufr primery termostabilní DNA polymerázu templátovou nukleovou kyselinu (DNA) případné přídatné látky ad 1): voda slouží ke zředění reaktantů na vhodnou koncentraci, resp. doplnění reakční směsi na vhodný objem (z hlediska možnosti manipulace a hospodárnosti) ad 2): nukleotidy (dntp) jednotlivé stavební kameny, které DNA polymeráza spojuje do nového souvislého řetězce na principu komplementarity podle sekvence nukleotidů v templátovém vlákně obvykle ve formě Na+ nebo Li+ solí obvyklá cílová koncentrace 200 μm

8 ad 3) reakční pufr zajišťuje především vhodné podmínky pro činnost DNA polymerázy (optimální ph 8,3 9,0; složení solí, zejména důležitá je koncentrace Mg2+ iontů) Mg2+ především tvoří rozpustný komplex s dntp, který je rozpoznáván polymerázou dále interaguje s primery, templátovou DNA aj., je nutno koncentraci optimalizovat Obvyklá koncentrace 1,5-2 mm ad 4) primery Chemicky syntetizované oligonukleotidy o délce nejčastěji nukleotidů Běžně dostupné komerčně (řádově stovky Kč), netřeba vlastní syntéza Vhodnou volbou primerů zajišťujeme specifitu reakce amplifikaci právě určitého zvoleného úseku; musí tedy být jedinečné: Pro genom o velikosti 3 miliardy bp statisticky vzato jedinečná sekvence o délce 16 N (416); v praxi sekvence genomu není náhodná, proto nutno používat delší úseky, aby byla jedinečnost zajištěna (tj. proto N) Nutno, aby nasedaly do konzervativních oblastí genomu (jinak nemůžeme zaručit úspěšnou syntézu) V praxi často používáme již publikované primery (pro standardizované úseky), při návrhu vlastních primerů musíme dodržet určitá pravidla (vodítka):

9 Pravidla pro navrhování primerů Dobře navržené primery asi nejdůležitějším faktorem pro úspěšnou PCR! Délka: příliš krátké by nebyly jedinečné (specifické), příliš dlouhé zbytečné, větší riziko nežádoucích vlastností (viz níže) Obsah G+C v rozmezí % celkové sekvence primeru Teplota tání (Tm): Teplota, při které dochází k disociaci (uvolnění) molekul primeru z templátových řetězců DNA Závislá především na délce (počtu bazí), koncentraci solí a obsahu G+C (přímá úměra) Měla by být v rozmezí cca C Oba primery by měly mít Tm podobnou!!! (nelišit se o víc než 3 5 C, raději ještě méně) s Tm souvisí optimální Ta

10 Pravidla pro navrhování primerů nesmí obsahovat příliš dlouhé komplementární úseky (zejména na 3 konci!, ani v rámci jednotlivých primerů ani v celém primerovém páru) vznik duplexů primerů, nepoužijí se pro tvorbu žádoucího produktu nesmí vytvářet vnitřní sekundární struktury (vlásenky) tentýž důvod Když už se tyto struktury vyskytují, musí mít nízkou Tm nebo ne příliš vysokou disociační energii (ΔG) Na 3 konci 1 2 zbytky G nebo C (silnější vazba na templát, zajišťují přesnost/specifičnost a efektivitu syntézy polymeráza syntetizuje od tohoto zbytku) Navrhování usnadněno mnoha dostupnými programy (OLIGO, Geneious ), které dokážou na základě vložené cílové sekvence navrhnout vhodné primerové páry, pak zpravidla ručně doladíme

11 slabé vlásenky Příliš odlišné Tm 3 dimer!!!

12 ad 5) termostabilní DNA polymeráza Odolávají teplotám až 98 C Původně izolovány přímo ze zdrojových organismů (termofilní bakterie, např. Thermus aquaticus Taq polymeráza), dnes metodami genového inženýrství příslušné geny upraveny a vloženy do jiných druhů bakterií; komerční produkce enzymů s výhodnými vlastnostmi Obvyklé množství 0,5 2,5 U / 50 μl reakční směsi Dnes často používána hot start polymeráza s přídavkem teplotně nestabilních látek, které ji inhibují při pokojové teplotě až při počáteční denaturaci se látky uvolní a polymeráza se aktivuje; to brání předčasné nespecifické amplifikaci v průběhu přípravy reakční směsi ad 6) templátová DNA Množství výchozího materiálu může být velmi nízké; teoreticky stačí jediná molekula Doporučovaná minimální množství pro standardní PCR (pro modifikace jako real-time PCR stačí ještě méně): lidská genomová DNA ng, bakteriální DNA 1 10 ng, plazmidová DNA 0,1 1 ng Kvalita templátu může přímo ovlivnit výsledek PCR (příliš mnoho RNA vyváže Mg2+ z roztoku, přítomnost inhibitorů polymerázy některé proteiny, detergenty, EDTA, vysoká koncentrace DNA! atd.); záleží na aplikaci

13 ad 7) přídatné látky mohou v některých případech pozitivně ovlivnit účinnost a specifičnost reakce obvykle nutno stanovit experimentálně albumin z bovinního séra (BSA) dimetylsulfoxid (DMSO) redukuje nespecifickou vazbu primerů, používán tam, kde nelze specifity dosáhnout manipulací s Ta detergenty (Tween 20) glycerol spermidin Minerální olej není přímo součástí směsi, zakápnutí shora, brání odpařování reakční směsi během reakce; dnes už většinou nepoužívaný (vyhřívání víka termocycleru má stejný efekt)

14 Praktické provedení PCR Termocycler: zařízení, ve kterém lze automaticky měnit teplotu v naprogramovaných časových intervalech Celá řada různě kapacitních modelů pro paralelní zpracování mnoha vzorků Jádrem je vyhřívaná destička (často pokovení rychlý přenos tepla) Nutné předpoklady přesnost a rychlost změny teploty Zpravidla možnost vyhřívání víka vzorek tak zahříván shora i zdola, nedochází ke kondenzaci na víčku zkumavky Jednoduchý počítač a interface pro zadávání a úpravu programů (teplotních režimů) Existuje základní poměrně robustní obecné schéma (program), které je často nutno pro amplifikaci konkrétního úseku PCR optimalizovat V principu 6 základních kroků:

15 Praktické provedení PCR 1) Počáteční denaturace DNA Nutná kompletní denaturace (úplné oddělení vláken) Obvykle zahřátí na 95 C / 2 5 min Částečná denaturace by vedla k rychlé renaturaci templátu, nespecifické vazbě primerů a možným nespecifickým produktům Vlastní řetězová reakce cyklické opakování tří kroků (obvykle 25-35x) 2) Denaturační krok (separace) řetězců C / s Závisí na objemu reakce, tloušťce stěn zkumavek Příliš krátká denaturace primery nemohou nasednout, příliš dlouhá snižujeme aktivitu DNA polymerázy (stabilní cca 2 hod / 98 C) v pozdějších cyklech by tedy nezbyla žádná funkční polymeráza

16 Praktické provedení PCR 3) Připojení primerů (annealing, nasedání) obvykle cca C / s Naprosto klíčový krok určující specifitu reakce!!! (příliš nízká teplota nespecifické produkty, příliš vysoká žádný produkt) Nutno stanovit empiricky (vyzkoušet); orientačně bývá cca o 5 C nižší než Tm primerů 4) Syntéza nového řetězce (polymerace, elongace primerů) 72 C / s Závislé na délce syntetizovaného produktu (Taq polymeráza syntetizuje rychlostí cca 60 bází za sekundu) Návrat k bodu 2, nové řetězce slouží jako templáty

17 Praktické provedení PCR 5) Závěrečná extenze 72 C / 5 10 min Po posledním cyklu, slouží k dokončení syntézy a renaturaci jednořetězcových produktů do dsdna 6) Chlazení 4 (10) C / dle potřeby obvykle nečekáme u termocycleru, až reakce doběhne Uchování produktů PCR ve stabilním stavu před dalším zpracováním (nebo přemístěním do ledničky/skladovacích prostor)

18 Optimalizace PCR Obecné teplotní schéma a složení reakční směsi je nutno optimalizovat pro konkrétní reakci tak, aby bylo dosaženo maximálního množství co nejčistšího produktu Přesné hodnoty teploty (zejmény teploty annealingu, Ta) a doba trvání jednotlivých kroků Příliš nízká teplota primery budou nasedat i do oblastí DNA, které nejsou plně komplementární vznik nespecifických produktů Příliš vysoká teplota primery se na DNA nenavážou Často nutný kompromis teplota, při které výtěžek žádoucího produktu sice není maximální, ale nevyskytují se žádné nespecifické produkty Optimální teplotu obvykle stanovujeme v gradientu termocycler umožňuje nastavení různých teplot v různých místech výhřevné destičky, lze tedy simultánně testovat relativně široké rozmezí teplot paralelně Počet cyklů Obvykle 25 35, vzácně až 40 cyklů; příliš velký počet významně narůstá podíl nespecifických produktů

19 Rostoucí teplota annealingu nutno použít co nejvyšší Ta

20 Rostoucí teplota annealingu Kvalitní produkt při všech testovaných teplotách

21 Optimalizace PCR Koncentrace Mg2+ Volné ionty ovlivňují aktivitu enzymu a zvyšují Tm dsdna Optimální koncentrace se liší reakci od reakce, v rozmezí 1 5 mm, často nutno stanovit experimentálně Obvyklá koncentrace 1,5 2 mm (pro 200 μm dntp) Koncentrace primerů sekvence a koncentrace primerů významně ovlivňují výsledek; optimální koncentrace obvykle 0,1 0,6 µm, vzácně až 1 µm Příliš nízká koncentrace předčasné vyčerpání primerů, snížení výtěžku (protože v posledních cyklech primery chybí)


23 (Bez)chybovost syntézy Proces není úplně bezchybný; Taq polymeráza příležitostně zařazuje nekomplementární (chybný) nukleotid (cca 1 na bp). Frekvence chyb in vitro závislá na ph, koncentraci reaktantů (zejména Mg2+) a vyváženosti koncentrace všech čtyř dntp. In vivo v buňce opravné mechanismy, in vitro nefungují (Taq nemá proofreading aktivitu), začlenění chybné báze někdy vede k terminaci syntézy Při běžném použití v diagnostice není důležité, protože molekuly s chybnou bází tvoří jen zlomek z celkového počtu Důležité, pokud PCR produkty klonovány každý klon odvozen z jediné molekuly případnou chybu nese veškeré potomstvo; problém při navazujících procesech typu exprese in vitro Jedno z řešení použití dvou polymeráz, jedna z nich s proofreadingovou aktivitou (3 -exonukleázovou)


25 Limity PCR Standardně amplifikovány cílové úseky do 4 kb Delší amplikony nižší látkové množství produktu Hlavní omezení nesprávně začleněné nukleotidy, nespolehlivost polymerázy Omezení lze obejít právě použitím dvou polymeráz, Taq + Ttw (Tth, Pwo, ) s proofreadingovou aktivitou (2-6x nižší chybovost) Stačí stopové množství (1 %) Proč ne jen jedna (ta s proofreadingem)? Způsobuje degradaci primerů, v nadbytku tedy musí být obyčejná polymeráza Amplifikace úseků s délkou i přes 20 kb

26 Hlavní problém PCR - kontaminace Vzhledem k citlivosti i jediná molekula exogenní/neznámé DNA stačí pro získání falešného signálu Nutno dodržovat standardní postupy: sterilní zkumavky, špičky, roztoky jednorázové rukavice separace reakčních složek od templátu/vzorků alikvotování reagencií/vzorků v případě kontaminace jednoho alikvotu jsou ostatní nadále použitelné přidávat DNA do reakce jako poslední UV světlo odstranění NK z pracovní plochy nevracet se s hotovými produkty do místnosti, kde se připravují nové reakční směsi

27 Hlavní problém PCR - kontaminace Vždy dělat pozitivní (musí po PCR obsahovat produkt ověření, že reagencie a program jsou v pořádku) a negativní kontrolu (templát nahrazen vodou, nesmí po PCR obsahovat produkt)!!! Při pochybnostech zopakovat experiment, s pečlivým dodržováním postupů a kontrolami Jakmile podezření na kontaminaci, zkusit najít zdroj. Nejčastěji: Přenos dříve amplifikovaných produktů (zpracování předchozích vzorků) Vzájemná kontaminace zdrojových materiálů/reagencií (voda? primery? dlouhodobě používané roztoky) Zejména důležité u nízkokopiových templátů a degradovaných vzorků (relativně snazší projev kontaminace, která konkuruje templátu) Při dlouhodobých problémech možnosti prevence, např. použití dutp místo dttp a uracil-n-glykosylázy odbourá případné produkty předchozích PCR, nebudou použitelné jako templát


29 Využití PCR v hygieně potravin Nesmírně široké ať už jako samostatná metoda nebo jako předstupeň dalších metod (RFLP, sekvenování ) Celá řada výhod: rychlost, specifita, citlivost, pružnost, nízká cena Velmi často použitelná i na zpracované potraviny, směsi atd. (např. tepelná úprava - DNA sice degradována na kratší kousky, ale snažíme-li se amplifikovat dostatečně krátký fragment, můžeme uspět) V nejjednodušší podobě simplex PCR - použití jednoho páru primerů specifického pro cílovou sekvenci/druh Buď získáme produkt nebo ne -> cílové agens je v testovaném vzorku přítomno/nepřítomno

30 Využití PCR v hygieně potravin - příklady Přítomnost patogenů v potravě bakterie, viry, plísně, paraziti detekce úseku DNA specifického pro daný patogen/skupinu patogenů Složení potravin podvody/nesprávná identifikace potravin např. záměna kaviáru z jeseterů za nejdražší kaviár z vyzy detekce nežádoucích příměsí v potravinách (alergeny, přídavek koňského masa do hamburgerů, přídavky vepřového masa do hovězích produktů ) GMO specifická detekce přítomnosti transgenu v produktech ze sóji či kukuřice

31 Ilhak & Arslan 2007;


MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční



DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit





Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje






POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek



DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby


2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné:

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné: Výběrové otázky: 1. Součástí všech prokaryotických buněk je: a) DNA, plazmidy b) plazmidy, mitochondrie c) plazmidy, ribozomy d) mitochondrie, endoplazmatické retikulum 2. Z následujících tvrzení, týkajících


Hybridizace nukleových kyselin

Hybridizace nukleových kyselin Hybridizace nukleových kyselin Tvorba dvouřetězcových hybridů za dvou jednořetězcových a komplementárních molekul Založena na schopnosti denaturace a renaturace DNA. Denaturace DNA oddělení komplementárních


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi


Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární


Molekulární základy dědičnosti. Ústřední dogma molekulární biologie Struktura DNA a RNA

Molekulární základy dědičnosti. Ústřední dogma molekulární biologie Struktura DNA a RNA Molekulární základy dědičnosti Ústřední dogma molekulární biologie Struktura DNA a RNA Ústřední dogma molekulární genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace DNA RNA



REPLIKACE A REPARACE DNA REPLIKACE A REPARACE DNA 1 VÝZNAM REPARACE DNA V MEDICÍNĚ Příklad: Reparace DNA: enzymy reparace nukleotidovou excizí Onemocnění: xeroderma pigmentosum 2 3 REPLIKACE A REPARACE DNA: Replikace DNA: 1. Podstata


Globální pohled na průběh replikace dsdna

Globální pohled na průběh replikace dsdna Globální pohled na průběh replikace dsdna 3' 5 3 vedoucí řetězec 5 3 prodlužování vedoucího řetězce (polymerace ) DNA-ligáza směr pohybu enzymů DNA-polymeráza I DNA-polymeráza III primozom 5' 3, 5, hotový


Izolace nukleových kyselin

Izolace nukleových kyselin Izolace nukleových kyselin Požadavky na izolaci nukleových kyselin V nativním stavu z přirozeného materiálu v dostatečném množství požadované čistotě. Nukleové kyseliny je třeba zbavit všech látek, které


Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin





Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin


Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace


Struktura a funkce nukleových kyselin

Struktura a funkce nukleových kyselin Struktura a funkce nukleových kyselin ukleové kyseliny Deoxyribonukleová kyselina - DA - uchovává genetickou informaci Ribonukleová kyselina RA - genová exprese a biosyntéza proteinů Složení A stavební


cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)


Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:


Enzymy používané v molekulární biologii

Enzymy používané v molekulární biologii Enzymy používané v molekulární biologii Rozdělení enzymů 1. Podle substrátové specifity: většina metod molekulární biologie je závislá na použití enzymů, jejichž substrátem jsou nukleové kyseliny. Tyto


4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie.

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. 4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. Od genu k proteinu - centrální dogma biologie Geny jsou zakódovány v DNA - Jakým způsobem? - Jak se projevují? Již v roce 1902


Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD

Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD Dana Vejmelková, Milan Šída, Kateřina Jarošová, Jana Říhová Ambrožová VODÁRENSKÁ BIOLOGIE, 1. 2. 2017 ÚVOD Sledované parametry,


PCR - polymerázová řetězová reakce (princip metody)

PCR - polymerázová řetězová reakce (princip metody) PCR - polymerázová řetězová reakce (princip metody) PCR umožňuje získat požadovanou sekvenci bez klonování, navíc zcela specifickou. PCR využívá základních rysů replikace DNA: Jako templát slouží ssdna,


Molekulární genetika

Molekulární genetika Molekulární genetika Genetické inženýrství Technologie rekombinantní DNA Vektor Genomová DNA Štěpení RE Rozštěpení stejnou RE, lepivé konce Ligace Transformace Bakteriální chromozóm Rekombinantní vektor


Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování



REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK Molekulární základy dědičnosti - rozšiřující učivo REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK REPLIKACE deoxyribonukleové kyseliny (zdvojení DNA) je děj, při kterém se tvoří z jedné dvoušoubovice DNA dvě nová


Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,


Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Inovace laboratorních úloh genetických předmětů metodikami pracujícími s ribonukleovými kyselinami pšenice Metodické návody pro laboratorní


TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Přehled Molekulárně-biologický úvod, DNA struktura, replikace, DNA polymerasa Princip procesu PCR Optimalizace PCR Typy PCR Aplikace


Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace


Metody studia exprese mrna. jádro a genová exprese 2007

Metody studia exprese mrna. jádro a genová exprese 2007 Metody studia exprese mrna Buněčné jádro a genová exprese 2007 Aktivita genu je primárn ě vyjád ř ena jeho transkripcí-prvním krokem vedoucím k syntéze kódovaného proteinu. Cíle metod Ur č ení mno ž ství


První testový úkol aminokyseliny a jejich vlastnosti

První testový úkol aminokyseliny a jejich vlastnosti První testový úkol aminokyseliny a jejich vlastnosti Vysvětlete co znamená pojem α-aminokyselina Jaký je rozdíl mezi D a L řadou aminokyselin Kolik je základních stavebních aminokyselin a z čeho jsou odvozeny


Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2 http://www.paternityexperts.com/basicgenetics.html


Izolace RNA. doc. RNDr. Jan Vondráček, PhD..

Izolace RNA. doc. RNDr. Jan Vondráček, PhD.. Izolace RNA doc. RNDr. Jan Vondráček, PhD.. Metodiky izolace RNA celková buněčná RNA ( total RNA) zahrnuje řadu typů RNA, které se mohou lišit svými fyzikálněchemickými vlastnostmi a tedy i nároky na jejich


Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny



ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce


Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014

Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014 Molekulárně biologické metody v mikrobiologii Mgr. Martina Sittová Jaro 2014 Harmonogram 1. den Izolace DNA 2. den Měření koncentrace DNA spektrofotometricky, real-time PCR 3. den Elektroforéza Molekulární



Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální


Pokročilé biofyzikální metody v experimentální biologii

Pokročilé biofyzikální metody v experimentální biologii Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 1/1 Proč biofyzikální metody? Biofyzikální metody využívají fyzikální principy ke studiu biologických systémů Poskytují kvantitativní


Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.:

Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.: Yi TPMT Diagnostická souprava Návod k použití Výrobce: YBUX s.r.o. Haasova 27 Brno 616 00 Česká republika IČ 63487951 tel.: +420 541 423 710 e-mail: ybux@ybux.eu Název: Yi TPMT Popis: Diagnostická souprava


Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován



KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR) KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR) Metoda Real-time PCR slouží pro kvantifikaci DNA a transkripce. Metoda je založena na klasické PCR, ovšem s využitím speciálního cycleru, který v průběhu PCR


Microfluidic systems, advantages and applications Monika Kremplová, Mgr.

Microfluidic systems, advantages and applications Monika Kremplová, Mgr. Název: Školitel: Microfluidic systems, advantages and applications Monika Kremplová, Mgr. Datum: 21. 6. 2013 Reg.č.projektu: CZ.1.07/2.3.00/20.0148 Název projektu: Mezinárodní spolupráce v oblasti "in


IZOLACE, SEPARACE A DETEKCE PROTEINŮ I. Vlasta Němcová, Michael Jelínek, Jan Šrámek

IZOLACE, SEPARACE A DETEKCE PROTEINŮ I. Vlasta Němcová, Michael Jelínek, Jan Šrámek IZOLACE, SEPARACE A DETEKCE PROTEINŮ I Vlasta Němcová, Michael Jelínek, Jan Šrámek Studium aktinu, mikrofilamentární složky cytoskeletu pomocí dvou metod: detekce přímo v buňkách - fluorescenční barvení


Enterotoxiny Staphylococcus aureus. Jana Kotschwarová Andrea Koťová

Enterotoxiny Staphylococcus aureus. Jana Kotschwarová Andrea Koťová Enterotoxiny Staphylococcus aureus Jana Kotschwarová Andrea Koťová Obsah Charakteristika Staphylococcus aureus Vlastnosti Faktory virulence Enterotoxiny Patogeneze Výskyt Metody stanovení Prevence výskytu


Uživatelská příručka

Uživatelská příručka PGM Barcoding Set 1-8 Navrženo pro PGM ION-TORRENT KÓD PRODUKTU: 2001 (1-8) BALEN9: 32 testů Uživatelská příručka Rev02.2015 Str. 1 Rejstřík 1. POUŽITÍ VÝROBKU 3 2. OBSAH KITU 4 3. SKLADOVÁNÍ 4 4. STABILITA



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,



MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Využití živých organismů pro uskutečňování definovaných chemických procesů pro průmyslové nebo komerční aplikace Organismus je geneticky upraven metodami genetického


Sure-MeDIP I. with magnetic beads and MNase. www.krd.cz

Sure-MeDIP I. with magnetic beads and MNase. www.krd.cz Sure-MeDIP I with magnetic beads and MNase www.krd.cz 1 Obsah soupravy a skladování MeDIP souprava obsahuje reagencie na provedení 25 reakcí. Souprava je rozdělen do dvou částí, jedna je distribuována


OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14 OBSAH DNA polymerázy pro PCR a pufry.................. 3 Taq DNA polymeráza 4 Taq DNA polymeráza Unis 5 TaqPurple DNA polymeráza 6 Taq DNA polymeráza 1.1 7 Combi Taq DNA polymeráza 8 LA DNA Polymerases


Nukleové kyseliny. DeoxyriboNucleic li Acid

Nukleové kyseliny. DeoxyriboNucleic li Acid Molekulární lární genetika Nukleové kyseliny DeoxyriboNucleic li Acid RiboNucleic N li Acid cukr (deoxyrobosa, ribosa) fosforečný zbytek dusíkatá báze Dusíkaté báze Dvouvláknová DNA Uchovává genetickou


DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod.

DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. Od 1.1.2014 DYNEX jediným OFICIÁLNÍM (autorizovaným) distributorem společnosti


Elektroforéza Sekvenování

Elektroforéza Sekvenování Elektroforéza Sekvenování Výsledek PCR Elektroforéza V molekulární biologii se používá k separaci nukleových kyselin a bílkovin Principem je pohyb nabitých molekul v elektrickém poli Gelová, polyakrylamidová


Univerzita Palackého v Olomouci. Bakalářská práce

Univerzita Palackého v Olomouci. Bakalářská práce Univerzita Palackého v Olomouci Bakalářská práce Olomouc 2012 Eliška Růžičková Univerzita Palackého v Olomouci Přírodovědecká fakulta Katedra buněčné biologie a genetiky Real-time PCR a jeho využití pro


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Vztah struktury a funkce nukleových kyselin. Replikace, transkripce

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Vztah struktury a funkce nukleových kyselin. Replikace, transkripce Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Vztah struktury a funkce nukleových kyselin. Replikace, transkripce Nukleová kyselina gen základní jednotka informace v živých systémech,


a) Primární struktura NK NUKLEOTIDY Monomerem NK jsou nukleotidy

a) Primární struktura NK NUKLEOTIDY Monomerem NK jsou nukleotidy 1 Nukleové kyseliny Nukleové kyseliny (NK) sice tvoří malé procento hmotnosti buňky ale významem v kódování genetické informace a její expresí zcela nezbytným typem biopolymeru všech živých soustav a)


Centrální dogma molekulární biologie

Centrální dogma molekulární biologie řípravný kurz LF MU 2011/12 Centrální dogma molekulární biologie Nukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Mendel) 1869 objev nukleových kyselin (Miescher) 1944 genetická informace v nukleových


Detekce Leidenské mutace

Detekce Leidenské mutace Detekce Leidenské mutace MOLEKULÁRNÍ BIOLOGIE 3. Restrikční štěpení, elektroforéza + interpretace výsledků Restrikční endonukleasy(restriktasy) bakteriální enzymy štěpící cizorodou dsdna na kratší úseky


Bílkoviny a rostlinná buňka

Bílkoviny a rostlinná buňka Bílkoviny a rostlinná buňka Bílkoviny Rostliny --- kontinuální diferenciace vytváření orgánů: - mitotická dělení -zvětšování buněk a tvorba buněčné stěny syntéza bílkovin --- fotosyntéza syntéza bílkovin


Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip


Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie

Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie Leona Leišová Přírodovědecká fakulta UK, Praha 2009 Metody kvantifikace: Nepřímé metody odhad míry


STAFYLOKOKOVÉ ENTEROTOXINY. Zdravotní nezávadnost potravin. Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336

STAFYLOKOKOVÉ ENTEROTOXINY. Zdravotní nezávadnost potravin. Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336 STAFYLOKOKOVÉ ENTEROTOXINY Zdravotní nezávadnost potravin Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336 OBSAH: Základní charakteristika Staphylococcus aureus Stafylokokové enterotoxiny


Polymorfizmy detekované. polymorfizmů (Single Nucleotide

Polymorfizmy detekované. polymorfizmů (Single Nucleotide Polymorfizmy detekované speciálními metodami s vysokou rozlišovací schopností Stanovení jednonukleotidových polymorfizmů (Single Nucleotide Polymorphisms - SNPs) Příklad jednonukleotidových polymorfizmů


Vzdělávací materiál. vytvořený v projektu OP VK CZ.1.07/1.5.00/34.0211. Anotace. Biosyntéza nukleových kyselin. VY_32_INOVACE_Ch0219.

Vzdělávací materiál. vytvořený v projektu OP VK CZ.1.07/1.5.00/34.0211. Anotace. Biosyntéza nukleových kyselin. VY_32_INOVACE_Ch0219. Vzdělávací materiál vytvořený v projektu OP VK Název školy: Gymnázium, Zábřeh, náměstí Osvobození 20 Číslo projektu: Název projektu: Číslo a název klíčové aktivity: CZ.1.07/1.5.00/34.0211 Zlepšení podmínek


6. Nukleové kyseliny

6. Nukleové kyseliny 6. ukleové kyseliny ukleové kyseliny jsou spolu s proteiny základní a nezbytnou složkou živé hmoty. lavní jejich funkce je uchování genetické informace a její přenos do dceřinné buňky. ukleové kyseliny



NÁVOD K POUŽITÍ PRO HER2 DNA QUANTIFICATION KIT IČ: 80 DIČ: CZ80 sales@intellmed.eu NÁVOD K POUŽITÍ PRO HER DNA QUANTIFICATION KIT IČ: 80 DIČ: CZ80 sales@intellmed.eu OBSAH Návod k použití pro HER DNA QUANTIFICATION KIT.... Úvod.... Označení.... Rozsah


GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu


1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.


Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Modifikace PCR, sekvenování Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Multiplex PCR Reakční směs obsahuje ne jeden, ale několik párů primerů rozpoznávajících různé cílové sekvence


Gymnázium, Brno, Elgartova 3

Gymnázium, Brno, Elgartova 3 Gymnázium, Brno, Elgartova 3 Šablona: III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Název projektu: GE Vyšší kvalita výuky Číslo projektu: CZ.1.07/1.5.00/34.0925 Autor: Mgr. Hana Křivánková Téma:


TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně



MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Termín biotechnologie byl poprvé použit v roce 1917 Procesy, při kterých se na tvorbě výsledného produktu podílejí živé organismy Širší definice: biotechnologie


Serologické vyšetřovací metody

Serologické vyšetřovací metody Serologické vyšetřovací metody Serologické reakce Přímý průkaz Nepřímý průkaz průkaz antigenu průkaz nukleové kyseliny průkaz protilátek Nepřímý průkaz = průkaz specifických protilátek neboli průkaz serologický


Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie

Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie IZOLACE GENOMOVÉ DNA Deoxyribonukleová kyselina (DNA) představuje základní genetický materiál většiny


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní



MODERNÍ BIOFYZIKÁLNÍ METODY: MODERNÍ BIOFYZIKÁLNÍ METODY: POKROČILÉ PRAKTICKÉ VZDĚLÁVÁNÍ V EXPERIMENTÁLNÍ BIOLOGII Operační program Vzdělávání pro konkurenceschopnost Číslo projektu: CZ.1.07/2.3.00/09.0046 Praktický kurz pokročilých


Nukleové kyseliny (NK)

Nukleové kyseliny (NK) Eva Roubalová B10 2007/2008 Předmět: - Obecná biologie - Biologie a genetika Zdroj velké části materiálů: učebnice Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava


DY D NE N X Hana Vlastníková

DY D NE N X Hana Vlastníková DYNEX Hana Vlastníková Molekulární biologie: Vybavení laboratoře na klíč Přístrojová technika Kompatibilní diagnostické soupravy Profesionální přístup SOP Technická podpora Servis Přístrojové vybavení:


Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží


Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Mgr. Klára Vilimovská Dědečková, Ph.D. Synlab genetics s.r.o. Molekulární


C V C. Návod k použití pro Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revize 2. Červenec 2014

C V C. Návod k použití pro Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revize 2. Červenec 2014 DOT130v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Strana 1 / 7 Návod k použití pro Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revize 2 Červenec 2014 DOT130v1


Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Využití techniky RACE (Rapid amplification of complementary DNA ends) pro identifikaci genů pro metalothioneiny Metodické návody pro





Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8


Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký

Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký Kapitola 3 Biomolecular Design and Biotechnology Překlad: Jaroslav Krucký Problémy chemie a biologie mohou být velmi nápomocné, jestliže se naše schopnost vidět to, co děláme, a dělat věci na atomární





Environmentální aplikace molekulární biologie

Environmentální aplikace molekulární biologie Environmentální aplikace molekulární biologie Petra Jančová, Kristýna Maršálková, Jana Šerá, Hana Pištěková Ústav Inženýrství Ochrany Životního Prostředí, Fakulta Technologická, Univerzita Tomáše Bati


Kras XL StripAssay. Kat. číslo 5-680. 20 testů 2-8 C

Kras XL StripAssay. Kat. číslo 5-680. 20 testů 2-8 C Kras XL StripAssay Kat. číslo 5-680 20 testů 2-8 C Popis stripu: Pracovní postup 1. Izolace DNA Musí být použity vhodné metody extrakce DNA, v závislosti na typu vzorku, který má být vyšetřován. Doporučení



ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN Fragmenty nukleových kyselin lze dle jejich velikosti rozdělit elektroforézou. Elektroforéza využívá rozdílné pohyblivosti jednotlivých fragmentů, danou právě


4) pokračování struktury nukleových kyselin

4) pokračování struktury nukleových kyselin Denaturace a renaturace DNA 4) pokračování struktury nukleových kyselin Genofor, chromozom, genom Genofor struktura nesoucí geny seřazené za sebou (DNA nebo RNA) a schopná replikace. U prokaryot, eukaryot



BUŇKA ZÁKLADNÍ JEDNOTKA ORGANISMŮ BUŇKA ZÁKLADNÍ JEDNOTKA ORGANISMŮ SPOLEČNÉ ZNAKY ŽIVÉHO - schopnost získávat energii z živin pro své životní potřeby - síla aktivně odpovídat na změny prostředí - možnost růstu, diferenciace a reprodukce


Přednáška kurzu Bi4010 Základy molekulární biologie, 2016/17 Replikace DNA

Přednáška kurzu Bi4010 Základy molekulární biologie, 2016/17 Replikace DNA Přednáška kurzu Bi4010 Základy molekulární biologie, 2016/17 Replikace DNA Jan Šmarda Ústav experimentální biologie, PřF MU 1 Buněčné dělení a reprodukce každá buňka potřebuje svou úplnou sadu genů: rodičovská



Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Popis Column DNA Lego Kit je základ moderní stavebnicové (Lego) soupravy pro izolaci čisté DNA různého



KVANTIFIKACE ZMĚN GENOVÉ EXPRESE KVANTIFIKACE ZMĚN GENOVÉ EXPRESE Northern bloty pracné a zdlouhavé Genové čipy nákladné; http://www.molbio.upol.cz/ Semikvantitativní RT-PCR qpcr nepřesné metodiky real-time PCR vysoké dynamické rozpětí


NUKLEOVÉ KYSELINY. Složení nukleových kyselin. Typy nukleových kyselin:

NUKLEOVÉ KYSELINY. Složení nukleových kyselin. Typy nukleových kyselin: NUKLEOVÉ KYSELINY Deoxyribonukleová kyselina (DNA, odvozeno z anglického názvu deoxyribonucleic acid) Ribonukleová kyselina (RNA, odvozeno z anglického názvu ribonucleic acid) Definice a zařazení: Nukleové
