Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:



1 POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek DNA je ohraničen tzv. primery (oligonukleotidy), což jsou fragmenty DNA o nukleotidech, které si díky své komplementaritě přisedají právě ke koncům vybraného úseku. Od přisedlých primerů probíhá syntéza DNA. Samotnou syntézu provádí termostabilní DNA polymeráza, izolovaná nejčastěji z bakterie Thermus aquaticus, odtud označení Taq polymeráza. Jelikož je tento enzym termostabilní, uchovává si svou aktivitu i přes několikeré působení teploty blížící se teplotě varu. Při reakci je využíváno cyklických změn teplot, které umožňují denaturaci DNA (její rozvolnění na jednořetězce), přisedání primerů a syntézu DNA Princip PCR Při PCR je využíváno podobného principu, na jakém dochází k syntéze DNA během replikace DNA v buňce. Tzn., DNA polymeráza k jednořetězcovému úseku DNA syntetizuje druhý, komplementární řetězec, přičemž se při svém startu potřebuje odrazit od krátkého oligonukleotidu, který je díky své komplementaritě navázán na templátový, jednořetězcový úsek. Tak vzniká z jednořetězcové molekuly dvouřetězcová, která je následnou denaturací separována na dvě jednořetězcové molekuly, které jsou v dalším kole DNA polymerázou opět doplněny na dvouřetězcové. Tyto kroky se při PCR cyklicky opakují, takže teoreticky např. z původně jedné molekuly DNA po 32 cyklech vzniká 1 miliarda molekul DNA Využití PCR amplifikace DNA detekce DNA o určité sekvenci ve vzorku (s pomocí využití primerů specifických k dané sekvenci), např. ve forenzní genetice či molekulární diagnostice kvantifikace na hladině DNA či transkripce

2 Reakční fáze při PCR 1. Denaturace dvouřetězcová (dvouvláknová) molekula DNA se po dobu sekund zahřívá na teplotu C. Při této teplotě dochází k rozrušení vodíkových můstků v dvouřetězcové molekule DNA a k rozvolnění této dvoušroubovice. Vznikají tak dvě jednořetězcové (jednovláknové) molekuly DNA, na které mohou v dalším kroku nasednout primery. 2. Nasednutí primerů - teplota se sníží na C, což umožňuje nasednutí primerů na specifická místa DNA. Na dvouvláknové úseky DNA/primer se váže DNA polymeráza. 3. Syntéza DNA - teplota použitá v této fázi závisí na použité DNA polymeráze. Nejběžnější Taq polymeráza má optimum aktivity při C. V tomto kroku dochází k samotné syntéze DNA. Ve směru od 5' konce ke 3' konci přirůstá vlákno DNA komplementární k původní molekule DNA. Tyto kroky se cyklicky opakují. Pro dostatečnou amplifikaci původní molekuly DNA obvykle postačuje 30 cyklů. PCR probíhá v zařízení zvaném termocykler, které je zkonstruováno tak, aby dokázalo během několika sekund zvýšit nebo snížit teplotu o několik desítek stupňů Celsia Základní kroky při provádění PCR 1. krok: Znalost sekvence DNA v amplifikovaném úseku (prostřednictvím DNA databází či na základě vlastního sekvenování 2. krok: Navržení sekvence primerů 3. krok: Komerční výroba primerů 4. krok: Výpočet optimální teploty primerů, navržení složení a profilu reakce 5. krok: Provedení reakce 6. krok: Kontrola reakce na elektroforéze (ELFO), případně purifikace reakčního produktu a sekvenování

3 Primery Primery jsou krátké oligonukleotidy (20 25 nt), které jsou komplementární k sekvenci na koncích amplifikovaného úseku. Tzn., že při PCR po denaturaci dvouřetězcové molekuly nasedají na konce amplifikované oblasti. Primery jsou jedním z klíčových komponent pro správný výsledek PCR. Délka a sekvence primerů: Primery jsou obvykle nt dlouhé. Primery v daném páru musí mít srovnatelný počet GC:AT párů. Upřednostňujeme primery s 50-60% obsahem GC nebo AT párů. Sekvence mezi oběma primery nesmí být výrazně komplementární, protože by se primery v reakci párovaly mezi sebou a méně nebo případně vůbec by nenasedaly ke komplementární sekvenci v templátové DNA (vznikaly by tzv. dimery). Rovněž nesmí být komplementarita v rámci sekvence primeru. Došlo by ke vzniku vlásenky (viz. obr.) či jiných sekundárních struktur a primer by tak nefungoval. Vždy je bezpodmínečně nutné, aby nasedání primerů bylo bezchybné alespoň v 3 oblasti primeru. Navržení primerů Pro standardní PCR navrhujeme primery v párech přední, tzv. forward primer a zadní tzv. reverse primer. Primery můžete navrhnout pomocí některého ze softwarů volně dostupných na internetu nebo si je velmi snadno můžete navrhnout ručně. Při navrhování primerů je třeba si uvědomit, že v běžném zápisu sekvence DNA se zapisuje horní vlákno z dvouřetězcové molekuly DNA, a to ve směru 5 ->3. Primery se navrhují podle sekvence horního vlákna, tj. sekvence, která se při běžném zápisu DNA používá. Sekvence předního ( forward ) primeru je totožná se sekvencí běžně zapisovaného, tj. horního vlákna. Přední primer umožňuje syntézu horního vlákna podle templátového spodního vlákna. Zadní ( reverse ) primer se navrhuje jako komplementární sekvence k hornímu vláknu, která je navíc v reverzní orientaci, tzn., že je zapisovaná ve směru 3 ->5. Takže při navrhování sekvence reverse primeru podle horního řetězce, musíme číst sekvenci primeru odzadu. Reverse primer umožňuje syntézu dolního vlákna podle templátového horního vlákna. Při navrhování sekvence primeru musíme mít na paměti, že oba primery musí mít aspoň přibližně stejnou teplotu nasedání. Teplotu nasedání primerů lze ovlivnit samotnou sekvencí primerů, resp. GC/AT obsahem a délkou primerů.

4 Teplota nasedání primerů (teplota annealingu ): Od délky primerů a počtu GC párů se odvíjí teplota nasedání primerů. Čím větší délka a vyšší obsah GC párů, tím je teplota nasedání vyšší (viz. přiložená tabulka). Teplota nasedání primerů musí být dostatečně vysoká, aby nedošlo k nespecifickému nasedání primerů k templátové DNA, pokud by ale byla příliš vysoká, primery by nenasedaly vůbec. Je třeba, aby teplota nasedání byla optimální pro oba primery a obsah GC párů v obou primerech byl srovnatelný, tzn., aby byla srovnatelná teplota nasedání obou primerů. Pro výpočet teploty primerů můžete použít některý ze softwarů volně dostupný na internetu nebo můžete použít níže přiloženou tabulku. Objednání a výroba primerů: na trhu existuje několik výrobců či dodavatelů primerů, u kterých lze syntézu primerů objednat. Ředění primerů: Primery přicházejí od výrobce v lyofilizovaném (vysušeném) stavu a je třeba naředit. Při ředění postupujeme takto: 1. Zkumavku s primerem nejprve krátce centrifugujeme. 2. Primer naředíme na koncentraci 100 pmol/µl (tj. 0,1 mm). Pro ředění používáme sterilní vodu, přednostně používáme špičky s filtrem. Množství vody se odvíjí od množství primeru, které bylo dodáno a které je definováno množstvím molů v protokolu, který výrobce zasílá spolu s primerem. Např. pokud je výtěžek 21,9 nmol, toto množství rozpustíme v 219 µl vody a získáme tak 0,1 mm roztok. Při ředění primeru postupujeme tak, že do zkumavky s primerem přidáme dané množství vody, zkumavku uzavřeme a důkladně zvortexujeme. Získáme tak 0,1 mm (100 pmol/µl) zásobní roztok primeru. 3. Zásobní roztok dále ředíme 10x, tj. do 90 µl vody přidáme 10 µl zásobního roztoku. Získáme tak 10 µm (10 pmol/µl) pracovního roztoku. Roztoky s primery jsou skladovány v C.

5 Teplota nasedání primerů pro daný počet bazí a GC párů bp Počet GC párů Objem a složení reakce Objem reakce: ve většině případů se reakce připravuje v objemu 25-ti µl, ale může se připravovat i v jiných objemech jako 50 µl nebo 100 µl. V některých případech, jako je třeba metoda Klontest, kdy testujeme velké množství vzorků a chceme šetřit materiálem pro PCR a postačuje menší množství produktu, můžeme reakci provádět i v 10 µl. Složení reakce: Reakci tvoří tyto komponenty: Templátová DNA: množství templátové DNA může být nepatrné, příliš velké množství DNA naopak způsobuje v reakci problémy, jako např. nespecifické nasedání primerů. Primery: obvyklá koncentrace každého z primerů v reakci je 0,1-1 µm (tj. 0,1-1 pmol/µl). Tzn., pokud máme připravený pracovní roztok 10 pmol/µl (tj. 10 µm) (viz. část o ředění primerů), pro 25 µl reakci použijeme 0,25-2,5 µl z obou primerů. Množství primerů musí být optimální. Příliš vysoká koncentrace vede k nespecifickému nasedání primerů na templátovou DNA nebo párování primerů navzájem. Příliš nízká koncentrace primerů může vést k nedostatečnému množství produktu. dntp směs: je směs datp, dctp, dgtp a dttp. Obvyklá koncentrace každého dntp v reakci je 200 µm (0,2 mm). Množství použité dntp směsi se odvíjí od koncentrace zásobního roztoku. Většinou je zásobní roztok dntp směsi o koncentraci 10 mm pro každý dntp. Tedy pokud připravujeme 100 µl PCR reakci, použijeme 2 µl 10 mm dntp, u 25 µl reakce použijeme 0,5 µl dntp. MgCl 2 : obvyklá koncentrace je 1,5 mm. MgCl 2 je nutný pro procesivitu a přesnost Taq polymerázy. Koncentrace MgCl 2 se odvíjí od koncentrace dntp a platí, že pro specificitu reakce koncentrace MgCl 2 musí převyšovat koncentraci dntp. Pokud máme koncentraci jednotlivých dntp 200, 400, 600 nebo 800 µl, koncentrace MgCl 2 musí být 1,5, 2, 3, 4 nebo 5 mm. Nicméně poměr MgCl 2 /dntp lze v určitých případech pozměňovat (viz. odstavec o reakčních problémech), kdy pro zvýšení specificity reakce zvyšujeme koncentraci MgCl 2, a to až k 5 mm, přičemž koncentraci dntp držíme stále na stejné úrovni. Někteří výrobci Taq polymerázy dodávají MgCl 2 zahrnuté do reakčního pufru. Reakční pufr: obvyklé složení je 50 mm KCl a 10 mm Tris-HCl, ph 8,3. Reakční pufry jsou dodávány spolu s Taq polymerázou jako 10x koncentrované. Tzn. pro 25 µl reakci použijeme 2,5 µl dodaného pufru. Reakční pufr dodá reakci potřebnou koncentraci solí a potřebné ph. Koncentrace solí ovlivňuje specificitu reakce, protože ovlivňuje specificitu nasedání primerů. U některých výrobců reakční pufr obsahuje rovnou i 1,5 mm MgCl 2.

6 H 2 O: voda musí být sterilní a purifikovanu. Vodou doplňujeme reakci na požadovaný objem. Všechny komponenty jsou skladovány v C Reakce Reakce se obvykle provádí ve 30 cyklech. Každý cyklus je tvořen denaturací, nasedáním primerů a syntézou. Cyklickou reakci předchází úvodní denaturace a ukončuje závěrečná extenze. Obecně: ÚVODNÍ DENATURACE [DENATURACE-NASEDÁNÍ PRIMERŮ-EXTENSE] 30X 30X ZÁVĚREČNÁ EXTENSE Úvodní denaturace: je důležitá především u genomové DNA, a to vzhledem k její délce. Dostatečná délka úvodní denaturace zajistí, že dvouvlákna DNA jsou pro reakci plně rozpletena. Provádí se při teplotě 95 0 C po dobu 3-5 min. Při dalších cyklech PCR stačí již krátké časy denaturace, protože v reakci je již přítomna templátová DNA vzniklá z prvního cyklu reakce, která bývá o dostatečně krátké velikosti a je tedy snadno denaturovatelná. Denaturace: se provádí při 95 0 C 0,5 1 min Nasedání primerů ( annealing ) teplota závisí na sekvenci primerů (viz. tabulka). Doba nasedání je obvykle 30 s, ale může se dle potřeby měnit. Zvýšením doby nasedání primeru můžeme zvýšit výtěžek reakce, ale zároveň také můžeme snížit specificitu nasedání primerů, a naopak. Extense: se provádí při 72 0 C, délka závisí na rychlosti polymerázy (informace od výrobce) a délce produktu. Obvykle, pokud je délka produktu bp, extense je 30 s, do 1,5 kb je extense 1 min. Závěrečná extense: se provádí při 72 0 C 4 min. Tato fáze zajistí, že všechny produkty jsou plně dosyntetizovány. Pro většinu aplikací můžeme doporučit toto obecné schéma profilu PCR:

7 Příprava reakce Reakci připravujeme na ledu, tzn. všechny komponenty a reakční směsi máme na ledu, kromě Taq polymerázy. Taq polymerázu máme buď ve speciálním stojánku, který udržuju teplotu okolo C nebo ji vyndáme z mrazáku těsně před použitím a umístíme ji na led. Používáme preferenčně špičky s filtrem pro zamezení kontaminace. Používáme negativní a pozitivní kontrolu, pokud je to možné. V negativní kontrole použijeme místo testovaného vzorku vodu, tzn., negativní kontrola neobsahuje testovanou DNA. Pozitivní kontrola naopak obsahuje takovou DNA, která nám zajistí vznik požadovaného produktu. Pokud připravujeme více vzorků, připravíme si tzv. master mix. Tzn., pokud připravujeme 25 µl reakcí pro deset různých vzorků DNA, reakční směs si namícháme najednou pro všechny vzorky kromě DNA. Vždy počítáme s jednou reakcí navíc (někdy se stane, že kvůli nepřesnosti pipetování pro poslední vzorek není dostatek reakční směsi). Takže pokud budeme provádět reakci pro 10 vzorků DNA, počítáme reakční komponenty pro 11 vzorků. Takže např. místo 1 µl primeru (který bychom dávali na jednu reakci) přidáme do master mixu 11 µl primeru, místo 2 µl dntp směsi (kterou bychom dávali na jednu reakci) přidáme 22 µl dntp směsi, atd. Připravenou reakci důkladně promícháme a rozpipetujeme do připravených PCR zkumavek, do kterých poté přidáme testovanou DNA. Pro PCR reakce používáme speciální, tenkostěnné zkumavky na PCR. Příklad přípravy PCR reakce: Komponenta (koncentrace) Komponenta (finální koncentrace) H 2 O 18,6 µl Templátová DNA 0,5 µl 10x PCR pufr (již s obsahem MgCl 2 ) 2,5 µl (1x) Primer 1 (10µM) 1 µl (0,4 µm) Primer 2 (10µM) 1 µl (0,4 µm) dntp mix (10mM) 0,5 µl (0,2 mm) Taq DNA polymeráza (5U/µl) 0,125 µl (0,2U/ µl) CELKEM 25µl

8 Řešení problémů s PCR Produkt v negativní kontrole: Způsobeno kontaminací buď při přípravě reakce nebo kontaminací přímo v některé chemikálii. Žádný nebo slabý produkt: Snižte teplotu nasedání primerů Zvyšte koncentraci primerů nebo množství templátové DNA nebo Taq polymerázy. Změňte koncentraci KCl. Zvyšte koncentraci, pokud očekávaný produkt je kratší než 1 kb, nebo koncentraci snižte, pokud očekávaný produkt je delší než 1 kb. Přidejte BSA na koncentraci 0,1-0,8 µg/µl. Zkontrolujte správnost sekvence primerů. Můžete zkusit kombinaci bodů 1-5. Dlouhé nespecifické produkty: Snižte čas nasedání primerů. Zvyšte teplotu nasedání primerů. Snižte čas extense. Snižte teplotu extense na C. Zvyšte koncentraci KCl 1,2x - 2x, ale zachovejte koncentraci MgCl 2 na 1,5 2 mm. Zvyšte koncentraci MgCl 2 na 3-4,5 mm ale zachovejte koncentraci dntp stejnou. Použijte méně primerů nebo templátu nebo Taq polymerázy. Kombinujte body 1-7. Krátké nespecifické produkty: Zvyšte čas nasedání primerů. Zvyšte teplotu nasedání primerů. Zvyšte čas extense. Zvyšte teplotu extense na C.

9 Snižte koncentraci KCl 0,7-0,8x, ale zachovejte koncentraci MgCl 2 na 1,5 2 mm. Zvyšte koncentraci MgCl 2 na 3-4,5 mm ale zachovejte koncentraci dntp stejnou. Použijte méně primerů nebo templátu nebo Taq polymerázy. Kombinujte body MODIFIKACE PCR hot-start PCR zvyšuje specificitu reakce, tím, že je využita speciálně upravená, tzv. hot-start polymeráza, která pro svou aktivizaci vyžaduje aktivační teplotu, tj. teplotu okolo 95 o C.Při PCR, obvykle během zahřívání vzorku na teplotu počáteční denaturace, může docházet k nespecifickému nasedání primerů na templátovou DNA, a pokud je použita standardní Taq polymeráza, mohou z takto nespecificky nasednutých primerů vznikat nespecifické PCR produkty. Proto enzym, který je využit při hot-start PCR, je za nízkých teplot, na rozdíl od běžných polymeráz, zcela neaktivní. Enzym se aktivizuje až v průběhu reakce, tj. při počáteční denaturační teplotě. Odpadá tedy riziko vzniku PCR produktu z nespecificky nasednutých primerů při nízkých teplotách v průběhu přípravy reakce. Dalším způsobem hot-start PCR je přidání polymerázy až po první denaturaci. touchdown PCR využívá postupně se snižující se teploty nasedání primerů. V počátečních cyklech je teplota nasedání vysoká, čímž brání nespecifickému nasedání primerů, ale postupně se v dalších cyklech snižuje. Při dostatečně nízké teplotě dochází k nasedání primerů na specifická místa a vzniká PCR produkt. Ačkoliv se teplota nasedání primerů může v dalších cyklech ještě dále snižovat, specifický produkt, který vznikl v předcházejících cyklech, zajistí po zbytek reakce vznik pouze specifických produktů. nested PCR slouží pro zvýšení specificity reakce, kdy se využívají dva páry primerů. Jeden pár vnějších primerů a jeden pár vnitřních primerů. Vnitřní primery nasedají na sekvenci, která je ohraničena vnějšími primery. Nejprve se provede reakce s vnějšími páry primerů a vzniklý produkt je využit jako templát pro reakci s vnitřními primery. Kombinací dvou párů primeru se zvýší pravděpodobnost amplifikace pouze daného, specifického úseku. inverzní PCR je využívaná pro izolaci a identifikaci neznámé sekvence, uvnitř níž leží známá sekvence. DNA je štěpená restrikčním enzymem, který ovšem nesmí štípat uvnitř známé sekvence. Získané fragmenty se poté ligací cirkularizují. Vzniklé cirkulární formy jsou štěpeny restrikčním enzymem štěpícím ve známé sekvenci, čímž se molekula linearizuje. Úseky známé sekvence se při linearizaci dostávají na konce molekuly. Neznámá sekvence leží uprostřed molekuly. Známá sekvence na koncích molekuly poté slouží jako templátová sekvence pro PCR. asymetrická PCR slouží k produkci preferenčně jednoho vlákna, např. pro sekvenování. Vzniku jednoho vlákna je nejčastěji docíleno poměrem primerů, který je 1:50 až 1:100.

10 multiplex PCR metoda využívá v jedné reakci více než jeden pár primerů, které se váží k různým úsekům templátové DNA. Reakce tedy běží s více primery nejednou, vzniká více různých produktů, které potom analyzujeme. kvantitativní real-time PCR metoda kvantifikace DNA či kvantifikace transkripce. Kvantifikace je na základě fluorescence, a to buď pomocí fluorescenčního substrátu, který se zabudovává do dvouřetězcového PCR produktu v průběhu reakce nebo se využívá speciálních fluorescenčně značených sond. RT-PCR PCR, kdy se jako templát využívá cdna, tj. molekula DNA vzniklá přepisem RNA pomocí reverzní transkriptázy. Využívá se při vyhodnocování genové exprese. alelově-specifická PCR na základě sekvence primerů se tato metoda využívá k identifikaci mutací v sekvenci DNA. Na základě změny v sekvenci, se primery váží/neváží k templátové sekvenci a tím produkt vzniká/nevzniká, což udává přítomnost/ nepřítomnost dané mutace v testované sekvenci. mutageneze pomocí PCR metoda se využívá ke vnášení změn do sekvence DNA připravovaného PCR produktu, a to pomocí pozměněné sekvence primerů (na jejich 3 konci).








DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby


MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční


Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje



DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit


Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Zavedení PCR v roce 1983 (Kary B. Mullis) Nobelova cena 1993 Metodika


OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14 OBSAH DNA polymerázy pro PCR a pufry.................. 3 Taq DNA polymeráza 4 Taq DNA polymeráza Unis 5 TaqPurple DNA polymeráza 6 Taq DNA polymeráza 1.1 7 Combi Taq DNA polymeráza 8 LA DNA Polymerases



KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR) KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR) Metoda Real-time PCR slouží pro kvantifikaci DNA a transkripce. Metoda je založena na klasické PCR, ovšem s využitím speciálního cycleru, který v průběhu PCR


cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)


Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární


Hybridizace nukleových kyselin

Hybridizace nukleových kyselin Hybridizace nukleových kyselin Tvorba dvouřetězcových hybridů za dvou jednořetězcových a komplementárních molekul Založena na schopnosti denaturace a renaturace DNA. Denaturace DNA oddělení komplementárních


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi





2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné:

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné: Výběrové otázky: 1. Součástí všech prokaryotických buněk je: a) DNA, plazmidy b) plazmidy, mitochondrie c) plazmidy, ribozomy d) mitochondrie, endoplazmatické retikulum 2. Z následujících tvrzení, týkajících


TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Přehled Molekulárně-biologický úvod, DNA struktura, replikace, DNA polymerasa Princip procesu PCR Optimalizace PCR Typy PCR Aplikace


Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,


Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Inovace laboratorních úloh genetických předmětů metodikami pracujícími s ribonukleovými kyselinami pšenice Metodické návody pro laboratorní



NÁVOD K POUŽITÍ PRO HER2 DNA QUANTIFICATION KIT IČ: 80 DIČ: CZ80 sales@intellmed.eu NÁVOD K POUŽITÍ PRO HER DNA QUANTIFICATION KIT IČ: 80 DIČ: CZ80 sales@intellmed.eu OBSAH Návod k použití pro HER DNA QUANTIFICATION KIT.... Úvod.... Označení.... Rozsah


Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní


Molekulární genetika

Molekulární genetika Molekulární genetika Genetické inženýrství Technologie rekombinantní DNA Vektor Genomová DNA Štěpení RE Rozštěpení stejnou RE, lepivé konce Ligace Transformace Bakteriální chromozóm Rekombinantní vektor


Uživatelská příručka

Uživatelská příručka PGM Barcoding Set 1-8 Navrženo pro PGM ION-TORRENT KÓD PRODUKTU: 2001 (1-8) BALEN9: 32 testů Uživatelská příručka Rev02.2015 Str. 1 Rejstřík 1. POUŽITÍ VÝROBKU 3 2. OBSAH KITU 4 3. SKLADOVÁNÍ 4 4. STABILITA



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,



PO STOPÁCH BAKTERIÍ V/KOLEM NÁS PO STOPÁCH BAKTERIÍ V/KOLEM NÁS Jana Spáčilová, UK v Praze, PřF, Katedra buněčné biologie Svět bakterií je nesmírně druhově bohatý a máme ho blíž než před očima. Mikroskopickými metodami můžeme obdivovat


Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD

Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD Dana Vejmelková, Milan Šída, Kateřina Jarošová, Jana Říhová Ambrožová VODÁRENSKÁ BIOLOGIE, 1. 2. 2017 ÚVOD Sledované parametry,


PP Master Mixy... 13 PPP Master Mix 14 Plain PP Master Mix 15 Combi PPP Master Mix 16 new Plain Combi PP Master Mix 17

PP Master Mixy... 13 PPP Master Mix 14 Plain PP Master Mix 15 Combi PPP Master Mix 16 new Plain Combi PP Master Mix 17 Obsah DNA polymerázy pro PCR a pufry............................... 5 Taq DNA polymeráza 6 Taq DNA polymeráza Unis 7 TaqPurple DNA polymeráza 8 Taq DNA polymeráza 1.1 9 Combi Taq DNA polymeráza 10 LA DNA


TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně


Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 5. Metody molekulární biologie II DNA footprinting hledání interakcí DNA s proteiny Polymerázová řetězová reakce (Polymerase chain reaction PCR) Malé



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin


Univerzita Palackého v Olomouci. Bakalářská práce

Univerzita Palackého v Olomouci. Bakalářská práce Univerzita Palackého v Olomouci Bakalářská práce Olomouc 2012 Eliška Růžičková Univerzita Palackého v Olomouci Přírodovědecká fakulta Katedra buněčné biologie a genetiky Real-time PCR a jeho využití pro


Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:


NRAS StripAssay. Kat. číslo 5-610. 20 testů 2-8 C

NRAS StripAssay. Kat. číslo 5-610. 20 testů 2-8 C NRAS StripAssay Kat. číslo 5-610 20 testů 2-8 C Popis stripu: Pracovní postup 1. Izolace DNA Pro izolaci DNA musí být použita vhodná metoda vzhledem k typu tkáně vzorku. Pro doporučení vhodné metody kontaktujte


Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.:

Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.: Yi TPMT Diagnostická souprava Návod k použití Výrobce: YBUX s.r.o. Haasova 27 Brno 616 00 Česká republika IČ 63487951 tel.: +420 541 423 710 e-mail: ybux@ybux.eu Název: Yi TPMT Popis: Diagnostická souprava


Struktura a funkce nukleových kyselin

Struktura a funkce nukleových kyselin Struktura a funkce nukleových kyselin ukleové kyseliny Deoxyribonukleová kyselina - DA - uchovává genetickou informaci Ribonukleová kyselina RA - genová exprese a biosyntéza proteinů Složení A stavební


Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace


Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Gymnázium, Brno, Elgartova 3

Gymnázium, Brno, Elgartova 3 Gymnázium, Brno, Elgartova 3 Šablona: III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Název projektu: GE Vyšší kvalita výuky Číslo projektu: CZ.1.07/1.5.00/34.0925 Autor: Mgr. Hana Křivánková Téma:


Polymorfizmy detekované. polymorfizmů (Single Nucleotide

Polymorfizmy detekované. polymorfizmů (Single Nucleotide Polymorfizmy detekované speciálními metodami s vysokou rozlišovací schopností Stanovení jednonukleotidových polymorfizmů (Single Nucleotide Polymorphisms - SNPs) Příklad jednonukleotidových polymorfizmů



MODERNÍ BIOFYZIKÁLNÍ METODY: MODERNÍ BIOFYZIKÁLNÍ METODY: POKROČILÉ PRAKTICKÉ VZDĚLÁVÁNÍ V EXPERIMENTÁLNÍ BIOLOGII Operační program Vzdělávání pro konkurenceschopnost Číslo projektu: CZ.1.07/2.3.00/09.0046 Praktický kurz pokročilých


Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin


Enzymy používané v molekulární biologii

Enzymy používané v molekulární biologii Enzymy používané v molekulární biologii Rozdělení enzymů 1. Podle substrátové specifity: většina metod molekulární biologie je závislá na použití enzymů, jejichž substrátem jsou nukleové kyseliny. Tyto





Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace



ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce


Izolace nukleových kyselin

Izolace nukleových kyselin Izolace nukleových kyselin Požadavky na izolaci nukleových kyselin V nativním stavu z přirozeného materiálu v dostatečném množství požadované čistotě. Nukleové kyseliny je třeba zbavit všech látek, které


4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie.

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. 4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. Od genu k proteinu - centrální dogma biologie Geny jsou zakódovány v DNA - Jakým způsobem? - Jak se projevují? Již v roce 1902


Environmentální aplikace molekulární biologie

Environmentální aplikace molekulární biologie Environmentální aplikace molekulární biologie Petra Jančová, Kristýna Maršálková, Jana Šerá, Hana Pištěková Ústav Inženýrství Ochrany Životního Prostředí, Fakulta Technologická, Univerzita Tomáše Bati


Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Modifikace PCR, sekvenování Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Multiplex PCR Reakční směs obsahuje ne jeden, ale několik párů primerů rozpoznávajících různé cílové sekvence


Metody studia exprese mrna. jádro a genová exprese 2007

Metody studia exprese mrna. jádro a genová exprese 2007 Metody studia exprese mrna Buněčné jádro a genová exprese 2007 Aktivita genu je primárn ě vyjád ř ena jeho transkripcí-prvním krokem vedoucím k syntéze kódovaného proteinu. Cíle metod Ur č ení mno ž ství



MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Využití živých organismů pro uskutečňování definovaných chemických procesů pro průmyslové nebo komerční aplikace Organismus je geneticky upraven metodami genetického


TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Komponenty nukleových kyselin Nukleotid DNA deoxyguanosid monofosfát (dgmp) Koncept párování bazí je striktně konzervativní Cytosine


Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka



REPLIKACE A REPARACE DNA REPLIKACE A REPARACE DNA 1 VÝZNAM REPARACE DNA V MEDICÍNĚ Příklad: Reparace DNA: enzymy reparace nukleotidovou excizí Onemocnění: xeroderma pigmentosum 2 3 REPLIKACE A REPARACE DNA: Replikace DNA: 1. Podstata


Polymorfismus délky restrikčních fragmentů

Polymorfismus délky restrikčních fragmentů Polymorfismus délky restrikčních fragmentů Princip: Chemikálie: PCR produkt z předchozího praktického cvičení Endonukleáza KpnI 10 U μl -1 Pufr pro KpnI 10 koncentrovaný (Tris-HCl 100 mmol l -1 ph 7,5,


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání


Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková Metody detekce a identifikace MO se zaměřením na PCR a její variace Kamila Zdeňková Metody detekce a identifikace MO rozdělení metod pro mikrobiologické zkoušení potravin přehled rychlých metod detekce


a) Primární struktura NK NUKLEOTIDY Monomerem NK jsou nukleotidy

a) Primární struktura NK NUKLEOTIDY Monomerem NK jsou nukleotidy 1 Nukleové kyseliny Nukleové kyseliny (NK) sice tvoří malé procento hmotnosti buňky ale významem v kódování genetické informace a její expresí zcela nezbytným typem biopolymeru všech živých soustav a)


Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza

Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza Exprese genetického kódu Centrální dogma molekulární biologie - genetická informace v DNA -> RNA -> primárního řetězce proteinu 1) transkripce - přepis z DNA do mrna 2) translace - přeložení z kódu nukleových


Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,



DETEKCE VNITŘNÍHO GENU RÝŽE FOSFOLIPÁZY D POMOCÍ PCR Mgr. Jan Hodek RNDr. Jaroslava Ovesná, CSc. DETEKCE VNITŘNÍHO GENU RÝŽE FOSFOLIPÁZY D POMOCÍ PCR METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2007 Metodika byla vypracována pracovníky Národní


EGFR XL StripAssay. Kat. číslo 5-630. 20 testů 2-8 C

EGFR XL StripAssay. Kat. číslo 5-630. 20 testů 2-8 C EGFR XL StripAssay Kat. číslo 5-630 20 testů 2-8 C Popis stripu Pracovní postup 1. Izolace DNA Pro izolaci DNA použijte vhodný izolační kit. Doporučené kity jsou následující: Pro izolaci čerstvých nebo


Nukleové kyseliny Replikace DNA Doc. MVDr. Eva Bártová, Ph.D.

Nukleové kyseliny Replikace DNA Doc. MVDr. Eva Bártová, Ph.D. Nukleové kyseliny Replikace DNA 2013 Doc. MVDr. Eva Bártová, Ph.D. Nukleové kyseliny 7% cytozin Monomer: NUKLEOTID, tvoří jej: uracil kyselina fosforečná pentóza (ribóza, deoxyribóza) tymin organická dusíkatá


Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8


Přednáška kurzu Bi4010 Základy molekulární biologie, 2016/17 Replikace DNA

Přednáška kurzu Bi4010 Základy molekulární biologie, 2016/17 Replikace DNA Přednáška kurzu Bi4010 Základy molekulární biologie, 2016/17 Replikace DNA Jan Šmarda Ústav experimentální biologie, PřF MU 1 Buněčné dělení a reprodukce každá buňka potřebuje svou úplnou sadu genů: rodičovská


Návod k použití CRC RAScan Combination Kit

Návod k použití CRC RAScan Combination Kit Návod k použití CRC RAScan Combination Kit Souprava SURVEYOR Scan KRAS a NRAS Exons 2, 3 & 4 CE IVD se systémy Tento návod k použití si důkladně přečtěte před použitím tohoto produktu. Uschovejte si tento



Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Popis Column DNA Lego Kit je základ moderní stavebnicové (Lego) soupravy pro izolaci čisté DNA různého


α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction



REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK Molekulární základy dědičnosti - rozšiřující učivo REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK REPLIKACE deoxyribonukleové kyseliny (zdvojení DNA) je děj, při kterém se tvoří z jedné dvoušoubovice DNA dvě nová



NÁVOD K POUŽITÍ PRO KIT BRAF P.VAL600GLU NÁVOD K POUŽITÍ PRO KIT BRAF P.VAL600GLU IntellMed, s.r.o. Šlechtitelů 21 78371 Olomouc IČ: 27780317 DIČ: CZ27780317-18 C 1 2 OBSAH IntellMed, s.r.o., Šlechtitelů 21, 78371 Olomouc Návod k použití pro



KVANTIFIKACE ZMĚN GENOVÉ EXPRESE KVANTIFIKACE ZMĚN GENOVÉ EXPRESE Northern bloty pracné a zdlouhavé Genové čipy nákladné; http://www.molbio.upol.cz/ Semikvantitativní RT-PCR qpcr nepřesné metodiky real-time PCR vysoké dynamické rozpětí



MOLEKULÁRNÍ BIOLOGIE I PŘÍPRAVA TKÁNĚ K IZOLACI DNA Cvičení 9,10,11: MOLEKULÁRNÍ BIOLOGIE Jméno: Skupina: Cíl: Seznámení se se základními metodami, využívanými k analýze DNA 1. izolace DNA 2. amplifikace DNA pomocí PCR 3. restrikční štěpení PCR produktu


Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování


nastavení real-time PCR cykleru Rotor Gene 3000

nastavení real-time PCR cykleru Rotor Gene 3000 Verze: 1.4 Datum poslední revize: 25. 3. 2015 nastavení real-time PCR cykleru Rotor Gene 3000 (Corbett Research) generi biotech OBSAH: 1. Nastavení teplotního profilu a spuštění cykleru... 3 2. Zadání


Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2 http://www.paternityexperts.com/basicgenetics.html


Braf V600E StripAssay

Braf V600E StripAssay Braf V600E StripAssay Kat. číslo 5-570 20 testů 2-8 C Popis stripu: Pracovní postup 1. Izolace DNA Pro izolaci čerstvých nebo mražených biopsií použijte soupravy Qiagen QIAmp DNA Mini nebo Micro. Pro izolaci



MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Termín biotechnologie byl poprvé použit v roce 1917 Procesy, při kterých se na tvorbě výsledného produktu podílejí živé organismy Širší definice: biotechnologie


Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace


MEDELOVA UNIVERZITA V BRNĚ Agronomická fakulta Ústav technologie potravin

MEDELOVA UNIVERZITA V BRNĚ Agronomická fakulta Ústav technologie potravin MEDELOVA UNIVERZITA V BRNĚ Agronomická fakulta Ústav technologie potravin Optimalizace metody polymerázové řetězové reakce pro detekci bakterií druhu Clostridium perfringens Diplomová práce Vedoucí práce:


1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.


Enterotoxiny Staphylococcus aureus. Jana Kotschwarová Andrea Koťová

Enterotoxiny Staphylococcus aureus. Jana Kotschwarová Andrea Koťová Enterotoxiny Staphylococcus aureus Jana Kotschwarová Andrea Koťová Obsah Charakteristika Staphylococcus aureus Vlastnosti Faktory virulence Enterotoxiny Patogeneze Výskyt Metody stanovení Prevence výskytu


Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny


Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Využití techniky RACE (Rapid amplification of complementary DNA ends) pro identifikaci genů pro metalothioneiny Metodické návody pro


Praktické cvičení: Izolace a purifikace rekombinantního proteinu

Praktické cvičení: Izolace a purifikace rekombinantního proteinu Praktické cvičení: Izolace a purifikace rekombinantního proteinu Toto blokové praktické cvičení spočívá v teoretickém i praktickém seznámení s rekombinantními proteiny, jejich izolací, purifikací a využitím.



Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální



CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION AFLP ANALÝZA *** Technika AFLP (Amplification Fragment Lenght Polymorphism - polymorfismus délky amplifikovaných fragmentů) je modifikací RFLP,


Sure-MeDIP II. with agarose beads and Mse I. www.krd.cz

Sure-MeDIP II. with agarose beads and Mse I. www.krd.cz Sure-MeDIP II with agarose beads and Mse I www.krd.cz 1 Obsah soupravy a skladování MeDIP souprava obsahuje reagencie na provedení 25 reakcí. Souprava je rozdělen do dvou částí, jedna je distribuována


Popis výsledku QC1156/01/2004 Identifikace projektu:

Popis výsledku QC1156/01/2004 Identifikace projektu: Popis výsledku QC1156/01/2004 Identifikace projektu: ČÍSLO PROJEKTU QC1156 PROGRAM TÉMA PRIORITA Program I B) Zlepšování biologického potenciálu rostlin a zvířat a jeho efektivní využívání 3) Metody charakterizace


J09 Průkaz nukleové kyseliny

J09 Průkaz nukleové kyseliny J09 Průkaz nukleové kyseliny VLLM0421c (jaro 2016) Osnova využití a metody průkazu NK PCR a její modifikace proces prokazování specifické sekvence NK 2/55 Přímé vs. nepřímé metody přímé hledáme mikroba,


CVD-T StripAssay. Kat. číslo 4-360. 20 testů 2-8 C

CVD-T StripAssay. Kat. číslo 4-360. 20 testů 2-8 C CVD-T StripAssay Kat. číslo 4-360 20 testů 2-8 C Popis stripu Pracovní postup Izolace DNA Použijte čerstvou nebo zmraženou krev s EDTA nebo citrátem, jako antikoagulans, vyhněte se krvi s obsahem heparinu.


Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody

Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody Návod k použití souprav Wipe test Kontaminační kontrola Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody REF 7091 40 reakcí 1. Popis výrobku V posledních letech se


Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Mgr. Klára Vilimovská Dědečková, Ph.D. Synlab genetics s.r.o. Molekulární


UNIVERZITA KARLOVA V PRAZE Přírodovědecká fakulta. Studijní program: Biologie. Katedra antropologie a genetiky člověka.

UNIVERZITA KARLOVA V PRAZE Přírodovědecká fakulta. Studijní program: Biologie. Katedra antropologie a genetiky člověka. UNIVERZITA KARLOVA V PRAZE Přírodovědecká fakulta Studijní program: Biologie Katedra antropologie a genetiky člověka Lenka Dvořáková Využití metod PCR ve forenzní genetické analýze Use of PCR in forensic


Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký

Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký Kapitola 3 Biomolecular Design and Biotechnology Překlad: Jaroslav Krucký Problémy chemie a biologie mohou být velmi nápomocné, jestliže se naše schopnost vidět to, co děláme, a dělat věci na atomární


ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction)


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Vztah struktury a funkce nukleových kyselin. Replikace, transkripce

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Vztah struktury a funkce nukleových kyselin. Replikace, transkripce Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Vztah struktury a funkce nukleových kyselin. Replikace, transkripce Nukleová kyselina gen základní jednotka informace v živých systémech,


Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová,

Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová, Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová, METODIKA DETEKCE GENETICKY MODIFIKOVANÉHO TABÁKU VIRŽINSKÉHO (Nicotina tabacum L. cv. Samsun) S VNESENÝM KVASINKOVÝM MITOTICKÝM AKTIVÁTOREM (gen SpCdc25 z


ELFO: DNA testovaných vzorků společně se značeným velikostním markerem je separovaná standardně použitím agarosové elektroforézy.

ELFO: DNA testovaných vzorků společně se značeným velikostním markerem je separovaná standardně použitím agarosové elektroforézy. SOUTHERNOVA HYBRIDIZACE Existuje celá řada protokolů pro Southernovu hybridizaci. Tyto protokoly se do značné míry totožné co se týče úvodních fází, jako je příprava vzorků elektroforetickou separací,


Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání
