Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC"

Transkript

1 1 Výrobce Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC Tento návod k použití si důkladně přečtěte před použitím tohoto produktu. Uschovejte si tento návod k použití, abyste se k němu mohli v případě potřeby vrátit.

2 Tato stránka je úmyslně ponechána prázdná.

3 Obsah 1 Výrobce Souprava SURVEYOR Scan KRAS Kit Exon 2 CE IVD Použití Indikace pro použití Principy testu pro detekci mutací SURVEYOR Scan KRAS Geny KRAS a NRAS Analýza vzorků pacientů s použitím souprav SURVEYOR Scan Nukleáza SURVEYOR Nuclease Původ kontrol v soupravě Součásti Počet vzorků, které lze testovat pomocí jedné soupravy Sekvenování DNA Další požadované vybavení a reagencie Příprava reagencií Skladování a doba použitelnosti Upozornění a preventivní opatření Získání primárního vzorku, manipulace a uchovávání Postup testu Detekce somatických mutací s použitím souprav SURVEYOR Scan - přehled Pokyny pro jednotlivé kroky POČÁTEČNÍ nastavení/kalibrace systému DHPLC Před analýzou vzorků KRAS Templát Pracovní schéma Amplifikační protokol Program termocykleru pro amplifikační protokol Kontrola kvality produktů PCR Digesce nukleázou SURVEYOR Nuclease Kontrolní postupy Kontrola kvality soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD Použití kontrolních plasmidových DNA Interpretace výsledků Analýza exonu KRAS Exon 2 pomocí nukleázy SURVEYOR Nuclease Kontrola výsledků SURVEYOR Scan Příklady výsledků Co je třeba dodržovat Detekční hladina mutací získaných soupravou SURVEYOR Scan Potvrzení sekvence Omezení testu Příloha A A.1 Návrh uspořádání destičky pro soupravy SURVEYOR Scan A.2 Označení na kontrolní DNA A.3 Požadavky pro denaturaci v systému HPLC (DHPLC) A.4 Uspořádání laboratoře pro testy PCR A.5 Odkazy na literaturu Příloha B Pokyny pro řešení problémů Podrobnosti pro objednávku Kontaktní údaje Překlad Prohlášení Licence, obchodní známky a autorská práva... 33

4 1 Výrobce 1 Výrobce Výrobce Zástupce pro EU M P Transgenomic, Inc Emmet Street, Omaha, NE 68164, USA Tel: Transgenomic Limited 40 Watt Road, Hillington Park, Glasgow G52 4RY, UK Tel: Souprava SURVEYOR Scan KRAS Kit Exon 2 CE IVD 2.1 Použití Pouze pro profesionální použití. Souprava od společnosti Transgenomic SURVEYOR Scan KRAS Kit Exon 2 CE IVD tvoří diagnostický test in vitro zjišťující somatické mutace v části Exon 2 genu KRAS. Tyto mutace jsou indikovány píky, které jsou výsledkem štěpení enzymem SURVEYOR Nuclease a zahrnují mutace známé svým potenciálním klinickým významem. Tato souprava je určena pro použití v klinické diagnostické laboratoři příslušně školenými pracovníky provádějícími testování DNA extrahované z tkání zalitých v parafínu a fixovaných formalinem. Tato souprava (katalogové číslo ) je dodávána jako jedna krabice obsahující níže uvedené komponenty. Tento návod k použití je k dispozici ke stažení na Indikace pro použití Kliničtí pracovníci mohou používat soupravu SURVEYOR Scan KRAS Kit Exon 2 CE IVD se systémem DHPLC jako vodítko k rozhodnutí, zda nádor kolorektálního karcinomu pacienta nebude vykazovat odezvu vůči léčivům na bázi anti-egfr (receptor pro epidermální růstový faktor), jako je panitumumab. Souprava SURVEYOR Scan KRAS Kit Exon 2 CE IVD se používá spolu se soupravami SURVEYOR Scan KRAS Kit Exons 3 & 4 CE IVD a SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD. Souprava SURVEYOR Scan KRAS Kit Exon 2 CE IVD se nesmí používat pro diagnózu kolorektálního nebo jiného karcinomu. Souprava SURVEYOR Scan KRAS Kit Exon 2 CE IVD tvoří test zjišťující přítomnost potenciálních somatických mutací v části Exon 2 genu KRAS, avšak neověřuje sekvenci mutace. Pro potvrzení přesné zjištěné mutace je třeba použít další analytickou metodu, jako je sekvenování DNA. Ačkoli výsledky analýzy získané touto soupravou ukážou mutační stav pacienta, je třeba zvážit i další faktory, včetně mutací v úsecích KRAS Exons 3 & 4 a NRAS Exons 2, 3 & 4. Výsledky získané soupravou SURVEYOR Scan KRAS Kit Exon 2 CE IVD nesmí být jedinou cestou k učinění rozhodnutí o léčbě pacienta s kolorektálním karcinomem. Je důležité mít na mysli, že použití systému DHPLC k identifikaci vzorků pozitivních na mutaci genu KRAS lze brát pouze jako vodítko a všechny mutace musí být potvrzeny další analýzou, jako je např. sekvenování DNA. Návod k použití soupravy SURVEYOR Scan KRAS Kit Exons 3 & 4 CE IVD pro systém DHPLC strana 3

5 3 Principy testu pro detekci mutací SURVEYOR Scan KRAS 3 Principy testu pro detekci mutací SURVEYOR Scan KRAS 3.1 Geny KRAS a NRAS Léčivé přípravky cílící na receptor pro epidermální růstový faktor (EGFR) prokázaly svoji účinnost vůči kolorektálnímu karcinomu. Výzkum ukázal, že přibližně 40% kolorektálních nádorů obsahuje somatické mutace genu KRAS a klinické studie ukázaly, že mutace v úseku KRAS exon 2 (kodony 12 a 13) předpovídají nedostatečnou odezvu vůči léčbě cílené na EGFR. Poslední výzkumné studie ukázaly, že populaci pacientů lze dále specifikovat jako pacienty, jejichž metastazovaný nádor kolorektálního karcinomu obsahuje další mutaci v úseku KRAS exons 3 a 4 a úsek NRAS exons 2, 3 a 4 rovněž vykazoval tendenci k nedostatečné odezvě vůči léčbě cílené na EGFR 1-7. Tato souprava je určena k použití v diagnostické analýze somatických mutací v úseku KRAS Exon 2. Souprava SURVEYOR Scan KRAS Kit Exon 2 CE IVD je testem pro detekci sekvencí a malých změn v důsledku inzerce/delece v úseku Exon 2 genu KRAS. Mutace v kodonech 12 a 13 genu KRAS souvisejí s nedostatečnou účinností přípravku panitumumab. Pro mutace v kodonech 12 a 13 jsou v této soupravě dodány kontroly Positive Controls. V této soupravě je použita chráněná technologie společnosti Transgenomic s názvem SURVEYOR Nuclease, která spolu se systémem DHPLC,poskytuje jednoduchou a citlivou detekci potenciálních mutací. Tato technologie může zjistit 2-5% směs mutantů na pozadí nezmutované DNA. Validační studie ukázaly extrémně vysokou konkordanci se sekvenováním kvalitně charakterizovaných vzorků kolorektálního karcinomu. Použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD sníží pro uživatele nároky na sekvenování a umožní zjištění sekvence, když software pro automatické sekvenování nezjistí přítomnost mutace. Vzhledem vysoké citlivosti tohoto testu ve srovnání se Sangerovou metodou sekvenování se doporučuje uspořádat laboratoř tak, aby se zabránilo příčné kontaminaci vzorků a kontrol. Ukázku optimálního uspořádání laboratoře naleznete v Příloze A.4 Uspořádání laboratoře pro testy PCR. 3.2 Analýza vzorků pacientů s použitím souprav SURVEYOR Scan Soupravu SURVEYOR Scan KRAS Kit Exon 2 CE IVD lze použít pouze v rámci jednoho z níže uvedených pracovních schémat. Pracovní schéma A Vzorek pacienta Vzorek pacienta Pracovní schéma B Provést test v KRAS Exons 2, 3 a 4 a NRAS Exons 2, 3 a 4 Zaznamenat výsledky Provést test v KRAS Exon 2 Výsledek mutace KRAS v kodonu 12 nebo 13 Výsledek KRAS kodon 12 nebo 13 Wild-type Zaznamenat výsledky Provést test v KRAS Exons 3 a 4 a NRAS Exons 2, 3 a 4 Zaznamenat výsledky Obrázek 1 Schémata pro detekci mutací soupravou SURVEYOR Scan při screeningu genů KRAS a NRAS Návod k použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC strana 4

6 3 Principy testu pro detekci mutací SURVEYOR Scan KRAS Návrh uspořádání 96jamkových destiček pro analýzu všech úseků KRAS a NRAS Exons 2-4 naleznete v Příloze A.1 Uspořádání destiček v soupravách SURVEYOR Scan. 3.3 Nukleáza SURVEYOR Nuclease Nukleáza SURVEYOR Nuclease od společnosti Transgenomic je mismatch - specifická (specifická pro chybné párování) endonukleáza z rostlinné DNA, která skenuje známé i neznámé mutace a polymorfismy v heteroduplexní DNA 8.Tento enzym štěpí s vysokou specificitou DNA v místech substituce báze chybným párováním a v místech jiných odchylek. Tato DNA endonukleáza štěpí oba řetězce heteroduplexu DNA na straně 3 chybně párovaného místa. Rozpoznává se chybné párování vzniklé inzercí/delecí a substitucí bází, avšak účinnost štěpení se mění podle sekvence chybného párování. Obrázek 2 Mechanismus účinku nukleázy SURVEYOR Nuclease. Endonukleáza rozpoznává chybné párování a provádí štěpení na straně 3 každé báze v chybném párování. Tím je štěpena dvoušrobovice DNA s přesahující jednou bází na konci 3. Nukleáza SURVEYOR Nuclease byla použita v širokém rozsahu situací pro přesnou detekci mutací a genetického polymorfismu.nukleáza SURVEYOR Nuclease byl například použita k ověření přítomnosti známých mutací v řadě genů spojených s karcinomem ledvin, plic, hlavy a krku, s leukémií, endometriálním karconomem a s předpovědí výsledku radioterapie 9,10,11. Účelem soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD je štěpit chybná párování v úseku KRAS Exon 2 před následnou analýzou systémem DHPLC. Poznámka:Je-li vzorek 100% mutantní DNA, nebudou se tvořit žádné heteroduplexy a vzorek se bude jevit jako Wild-Type. Avšak bioptické vzorky nádorů budou obsahovat vzhledem k heterogenitě nádorů buňky Wild-Type a kontaminující normální tkáň; 5% typ Wild-Type je pomocí této soupravy detekovatelný na křivkách identických s 5% mutantní DNA. Poznámka: Pro tento test lze používat pouze DNA polymerázu dodávanou v soupravě. Poznámka: Dodržujte konkrétní pokyny v příručce pro systém DHPLC. V zájmu úspěšného používání této soupravy důrazně doporučujeme, abyste si tuto příručku důkladně přečetli a pozorně postupovali podle pokynů a návodů v ní obsažených. Uživatelé pracující s touto soupravou poprvé by měli provést kontrolní experimenty uvedené v části Použití kontrolních plasmidových DNA. Máte-li další dotazy nebo potřebujete-li asistenci, zatelefonujte na číslo (888) (pouze pro severní Ameriku), +1 (402) nebo +44 (0) (Evropa) a požádejte o KRAS support (podporu pro KRAS). Další možností je poslat nám na:

7 4 Původ kontrol v soupravě 4 Původ kontrol v soupravě Kontroly dodávané s touto soupravou jsou plasmidové klony sekvencí v KRAS Exon 2. Všechny klony byly sekvenovány, aby byla ověřena věrnost jejich sekvence ve srovnání s referenční NCBI Reference Sequence: NG_ Kontroly mají genetickou známku. Viz Příloha A.2 Označení na kontrolní DNA; tyto varianty sekvence KRAS Wild-Type v úseku, kde se mutace nepředpokládají, lze použít k řešení problémů s kontaminací vzorků pomocí kontrol Positive Controls. Ukázku takové kontaminace ukazuje křivka SURVEYOR Scan v Příloze B - Pokyny pro řešení problémů. Kontrola KRAS Control Wild-Type byla vytvořena syntézou a klonováním sekvence KRAS Exon 2 s použitím výše uvedené sekvence NCBI. Kontrola KRAS Positive Control Exon 2 byla vytvořena syntézou sekvence KRAS Exon 2 s použitím výše referenční sekvence obsahující mutaci G12D. Sekvenováním DNA bylo potvrzeno, že jediná změna v sekvenci je v kodonu 12, a to změna GGT>GAT (mutace G12D). Tento klon je poté zkombinován s DNA KRAS Control Wild-Type za vytvoření heterozygotní směsi. 5 Součásti Souprava SURVEYOR Scan KRAS Kit Exon 2 CE IVD obsahuje (1) krabici se složkami pro digesci SURVEYOR s 10 reagenčními zkumavkami bez prázdných otvorů a (2) složky pro PCR a kontroly s nosičem zkumavek obsahujícím 11 reagenčních zkumavek a 9 prázdných otvorů. Katalogové číslo Komponenta Krabice se složkami pro digesci SURVEYOR Barva víčka zkumavky Objem pro 100 reakcí SURVEYOR Nuclease W růžová 2 x 105 µl SURVEYOR Enhancer W2 černá 105 µl SURVEYOR Enhancer Cofactor růžová 105 µl M MgCl 2 Solution hnědá 105 µl SURVEYOR Stop Solution červená 250 µl F Universal Sequencing Primer 1 (10 µm) oranžová 2 x 125 µl R Universal Sequencing Primer 2 (10 µm) oranžová 2 x 125 µl Krabice se složkami pro PCR a s kontrolami DNA Polymerase červená 100 µl DNA Polymerase 10X PCR Buffer čirá 1 ml dntps (10 mm) čirá 500 µl F KRAS Primer Exon 2 Forward (10 µm) modrá 3 x 90 µl R KRAS Primer Exon 2 Forward (10 µm) modrá 3 x 90 µl KRAS Control Wild-Type žlutá 120 µl KRAS Positive Control Exon 2 zelená 40 µl Návod k použití Lze stáhnout z webu* Návod k použití soupravy SURVEYOR Scan KRAS Kit Exons 3 & 4 CE IVD pro systém DHPLC strana 6

8 5 Součásti 5.1 Počet vzorků, které lze testovat pomocí jedné soupravy Souprava SURVEYOR Scan KRAS Kit Exon 2 CE IVD je určena pro testování 100 reakcí. Celkový počet vzorků, které lze testovat pomocí soupravy, závisí na průměrné velikosti testované dávky, neboť v každé destičce s reakčními směsmi musí být zahrnuta jedna sestava kontrolních reakcí (kontroly Wild-Type Control, Positive Control a kontrola bez templátu). Níže uvedená tabulka ukazuje počet vzorků, které lze analyzovat soupravou KRAS v závislosti na průměrné velikosti dávky vzorků. To zahrnuje (a) 3 kontroly (Wild-Type, Positive Control, kontrolu bez templátu) vyžadované pro každý běh a (b) limit 100 reakcí na soupravu. Poznámka: Analyzuje-li se více destiček, musí být na každé destičce zahrnuta sestava 3 výše uvedených kontrol. Proto dvě destičky budou vyžadovat celkem 6 kontrolních reakcí, 3 destičky budou vyžadovat 9 kontrolních reakcí, atd. Zvýší-li se velikost dávky vzorků, zvýší se tím i počet vzorků, které lze testovat pomocí jedné soupravy a tím se sníží průměrné náklady na reagencie vztažené na jeden vzorek. Níže uvedená tabulka slouží jako vodítko pro počet vzorků, které lze testovat pomocí jedné soupravy. Udává i odhad pravděpodobných ztrát způsobených pipetováním. Velikost dávky vzorků Počet kontrolních reakcí + Počet amplikonů vzorků Počet reakcí vyžadovaný na jeden běh Celkový počet běhů dávek vzorků na soupravu Celkový počet vzorků testovaný na soupravu Sekvenování DNA Pro sekvenování DNA všech testovaných vzorků jsou k dispozici primery Universal Sequencing Primers (PN F a R). Pro sekvenování je třeba používat amplikony PCR vytvořené před digescí nukleázou SURVEYOR Nuclease. Návod k použití soupravy SURVEYOR Scan KRAS Kit Exons 3 & 4 CE IVD pro systém DHPLC strana 7

9 6 Další požadované vybavení a reagencie 6 Další požadované vybavení a reagencie Další komponenty a vybavení požadované pro použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro DHPLC zahrnují následující: Systém DHPLC, kolona, pufry, velikostní standard DNA - viz Příloha A.3.1 Specifikace systému DHPLC pro aplikace SURVEYOR Scan, kde naleznete popis vhodného systému DHPLC pro použití s touto soupravou Voda jakosti pro molekulární biologii 0,2 ml zkumavky pro PCR, pásy nebo 96 jamková destička Mikropipety Pipetové špičky Ledová lázeň Míchadlo vortex Mikrocentrifuga Termocykler Agarózové gely a zařízení pro elektroforézu v agarózovém gelu 10% chlornan nebo podobný čisticí přípravek 7 Příprava reagencií Všechny reagencie dodávané v soupravě jsou připravené k použití. Některé komponenty je nutné před použitím rozmrazit, zamíchat na vortexu nebo odstředit v mikrocentrifuze; příslušné podrobnosti naleznete v níže uvedeném postupu testování. Sloučením reagencií se získají výchozí směsi a reakční směsi; úplné podrobnosti jsou uvedené v níže popsaném postupu testování. 8 Skladování a doba použitelnosti Souprava se skladuje až do použití při teplotě mezi 18 ºC a -25 C v mrazáku s konstantní teplotou. Poznamenejte si datum použitelnosti u každé dodané soupravy. Po vypršení data použitelnosti soupravu nepoužívejte. Směs s nukleázou SURVEYOR Nuclease připravená v kroku 7 Digesce nukleázou SURVEYOR Nuclease se musí použít okamžitě, neboť nukleáza SURVEYOR Nuclease W se v přítomnosti ostatních složek reakční směsi nukleázy SURVEYOR Nuclease během času deaktivuje. 9 Upozornění a preventivní opatření Žádná z reagencií v této soupravě není v dodaném množství nebezpečná pro lidské zdraví. Dokument společnosti Transgenomic pod číslem MSD lze stáhnout z Souprava neobsahuje žádné látky lidského nebo živočišného původu, které by mohly způsobit infekci. Tuto soupravu mohou používat pouze osoby, které jsou vyškolené v příslušných laboratorních metodách. Při práci s komponentami této soupravy vždy používejte laboratorní plášť, jednorázové rukavice a ochranu očí. Po použití soupravy zlikvidujte komponenty, jako je např. nemocniční odpad, v souladu s místními pravidly a předpisy. Alikvotní množství reagencií odpipetovaná ze zkumavek v soupravě jsou určená pouze pro jedno použití. Komponenty soupravy zůstávají stabilní i po 25 cyklech zmrazení-rozmrazení. Po překročení tohoto počtu cyklů zmrazení-rozmrazení soupravu nepoužívejte. Návod k použití soupravy SURVEYOR Scan KRAS Kit Exons 3 & 4 CE IVD pro systém DHPLC strana 8

10 10 Získání primárního vzorku, manipulace a uchovávání 10 Získání primárního vzorku, manipulace a uchovávání Souprava SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC je validována pro použití s DNA extrahovanou ze vzorků nádorů kolorektálního karcinomu zalitých v parafínu a fixovaných formalinem (FFPE). V zájmu optimální extrakce DNA je třeba tkáň hodin před zalitím v parafinu fixovat ve formalinu. Biopsie z nádorů jsou heterogenní směsi nádorových a nenádorových buněk. Nádor samotný je navíc heterogenní směsí národových buněk s mutacemi a nádorových buněk bez mutací. Vzhledem k tomu, že tyto somatické mutace nemusí být rozptýleny v nádoru rovnoměrně, mohou být výsledné analýzy mutací z různých částí stejného nádoru různé. Aby se zvýšila pravděpodobnost detekce mutace, je třeba izolovat DNA z nádorové části tkáně oddělením pouze nádorové části ze sklíčka pomocí nově sterilizovaného skalpelu pro každé nové sklíčko. V zájmu úspěšného použití této soupravy musí extrahovaná DNA splňovat kritéria v části Templát. POZNÁMKA:Extrahované vzorky DNA neurčené k okamžité analýze je třeba uchovávat zmražené při teplotě od -20 ºC do -80 ºC. 11 Postup testu 11.1 Detekce somatických mutací s použitím souprav SURVEYOR Scan - přehled Detekce mutace a potvrzení nukleázou SURVEYOR Nuclease zahrnuje tři kroky: Krok 1 - Připravte amplikony PCR z mutantní (testované) a normální (referenční) DNA, v návaznosti na konečný amplifikační cyklus PCR rozpusťte veškeré dvoušroubovice a poté pomalu ochlazujte, čímž dojde k optimalizované tvorbě heteroduplexů a homoduplexů (heteroduplexy se tvoří, když jeden řetězec se sekvencí Wild-Type se spáruje s jedním řetězcem mutantní sekvence). Krok 2 - Aplikujte na směs spárovaných heteroduplexů/homoduplexů nukleázu SURVEYOR Nuclease. SURVEYOR Nuclease rozštěpí oba dva řetězce heteroduplexní DNA za vzniku fragmentů DNA. DNA Control Wild-Type, vystavená obdobnému postupu, slouží jako kontrola na pozadí. Krok 3 - Proveďte analýzu fragmentů DNA v systému DHPLC. Tvorba nových produktů štěpení je v důsledku jednoho nebo více chybných párování indikována přítomností dodatečných chromatických píků. Migrační časy produktů štěpení indikují velikost fragmentů a tím i umístění chybného nebo více chybných párování.

11 12 Pokyny pro jednotlivé kroky 12 Pokyny pro jednotlivé kroky 12.1 POČÁTEČNÍ nastavení/kalibrace systému DHPLC Při přípravě destičky SURVEYOR Nuclease pro analýzu v DHPLC se obraťte na Přílohu A.3 Požadavky pro denaturaci v systému HPLC (DHPLC) Před analýzou vzorků KRAS Před analýzou vzorků v systému DHPLC se musí provést běh s velikostním standardem DNA, aby se ověřila správná funkce systému. Před analýzou musí laboratorní pracovník používající přístroj zkontrolovat kvalitu rozlišení velikostního standardu DNA Templát 1. U izolované templátové FFPE DNA proveďte pomocí běžných laboratorních postupů kvalitativní a kvantitativní vyhodnocení extrahované DNA, aby bylo jisté, že je k dispozici dostatečné množství templátu pro PCR. 2. Poměr absorbance 260/280 musí být >1, Pro optimální nastavení PCR musí být pracovní koncentrace templátu přibližně 12,5 ng/µl. Je-li třeba, zřeďte templátovou DNA ve vodě o jakosti pro molekulární biologii. Návod k použití soupravy SURVEYOR Scan KRAS Kit Exons 3 & 4 CE IVD pro systém DHPLC strana 10

12 12 Pokyny pro jednotlivé kroky 12.4 Pracovní schéma Souprava umožňuje analýzu 100 reakcí. Lze analyzovat i menší dávky vzorků, avšak s každou dávkou vzorků musí být zahrnuty kontroly ze soupravy i kontrola bez templátu. Souprava obsahuje dostatečný materiál pro kontrolu 100 reakcí všech kombinací používaných velikostí dávek vzorků. Zpracování vzorků musí být všeobecně prováděno od zahájení až do konce podle popisu v tomto návodu k použití. Musí-li být před dokončením celého postupu zpracování vzorku zastaveno, je nutné DNA uložit do -20 C, jak je ukázáno. Avšak zmrazené vzorky nemají být vystavovány opakovanému zmrazování a rozmrazování a zmrazená DNA amplifikovaná pomocí PCR ani produkty digesce nukleázou SURVEYOR Nuclease nemají být skladovány při teplotě od -18 do - 25 C po delší dobu (>1 týden). Analýza vzorku se provádí podle níže znázorněného pracovního schématu: Oddělení tkáně 1 Izolace DNA a PCR 2 Gelová elektroforéza 3 Vyhodnocení robustní/slabá PCR 5 Neúspěšný SURVEYOR Scan SURVEYOR Scan Pozitivní 4 SURVEYOR Nuclease a analýza v DHPLC SURVEYOR Scan Negativní 7 6 Potvrzení sekvence NVD (varianta nedetekována) 8 Kvalita sekvence neúspěšná Kvalita sekvence prošla 9 Mutace v kodonech G12 nebo G13 NVD Obrázek 3 Pracovní schéma analýzy pomocí soupravy SURVEYOR Scan KRAS Návod k použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC strana 11

13 12 Pokyny pro jednotlivé kroky Poznámky k obrázku 3 1. DNA izolujte z FFPE (tkáň zalitá v parafínu a fixovaná formalinem) podle standardních laboratorních postupů. 2. Proveďte PCR a ověřte kvalitu DNA gelovou elektroforézou., 3. Vyhodnoťte a proveďte záznam, zda je proužek PCR Robustní ( 20 ng/µl) nebo Slabý (<20 ng/µl). Dojde-li k vytvoření více proužků PCR, připravte čerstvou genomickou DNA z FFPE. 4. U vzorků vyhodnocených po amplifikaci pomocí PCR buď jako Robustní PCR nebo Slabá PCR proveďte krok s nukleázou SURVEYOR Nuclease a analýzu v systému DHPLC. Se slabou PCR může být množství DNA k získání smysluplných výsledků systémem DHPLC nedostatečné, avšak může být dostatečné pro sekvenování. 5. Viz Příloha B Pokyny k řešení problémů, kde naleznete příklady neúspěšných výsledků ze SURVEYOR Scan. Všechny vzorky s neúspěšným výsledkem ze SURVEYOR Scan musí být znovu zpracovány jedním z následujících způsobů: a. opakování PCR, zbývá-li dostatečné množství genomické DNA b. nová extrakce DNA z FFPE; to by měla být až sekundární volba, neboť obvykle není žádoucí řezat další blok FFPE. c. použije-li se další řez nebo blok, musí být celý test znovu opakován, neboť vzhledem k heterogenní povaze nádoru může dojít k odchylkám při digesci. 6. Nejsou-li žádné viditelné píky v důsledku štěpení, zaznamenejte si negativní výsledek ze SURVEYOR Scan, tj. NVD = varianta nedetekována. 7. Ukazuje-li vzorek produkty štěpení enzymem SURVEYOR Nuclease (neshodující se s příslušnou kontrolou Wild-Type Control), je třeba je předat k ověření sekvenováním. 8. Je-li ověřovací analýza sekvence nevyhovující, poté zvolte jeden z následujících kroků: a. opakujte PCR, zbývá-li dostatečné množství genomické DNA b. proveďte novou extrakci DNA z FFPE; to by měla být až sekundární volba, neboť obvykle není žádoucí oddělovat další řezy z bloku FFPE. 9. Je-li ověřovací analýza sekvence vyhovující, potom výsledky znamenají jedno z následujícího: a. Sekvence Wild-Type, tzn. varianta nedetekována (NVD); nebo b. Varianta detekována. Ukazuje-li ověření sekvence jakoukoli změnu báze s výsledkem změny aminokyseliny: i. kodon 12; nebo ii. kodon 13 vyhodnoťte jako pozitivní mutaci v KRAS. Poznámka: je možné získat pozitivní výsledek ze SURVEYOR Scan, který bude sekvenováním zároveň potvrzen jako varianta nedetekována. Hladina detekce (LOD) pro SURVEYOR Nuclease v systému DHPLC je pro některé mutace 2% mutantů v 98% typu Wild-Type, zatímco hodnota LOD sekvenování je přibližně 10-25% mutantů v 90-75% typu Wild-Type. Pozn: Je-li vzorek 100% mutantní DNA, nebudou se tvořit žádné heteroduplexy a vzorek se bude jevit jako Wild-Type. Avšak vzorky z biopsie nádoru budou obsahovat buňky typu Wild-Type v důsledku heterogenity nádoru nebo kontaminace normální tkání; 5% typ Wild-Type lze touto soupravou detekovat křivkami identickými s 5% mutantní DNA. Poznámka: pozitivní výsledky se SURVEYOR Scan mohou být způsobeny jinými změnami bází, než jsou ty, které jsou považovány za KRAS aktivující. Tyto mutace jsou sice vzácné, avšak je nutné potvrzení další metodou, jako je např. sekvenování DNA, aby se určilo, zda pozitivní výsledek ze SURVEYOR Scan je či není KRAS aktivující mutací. Návod k použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC strana 12

14 12 Pokyny pro jednotlivé kroky Pozn: proces fixace ve formalinu, požívaný při přípravě FFPE, může vést k deaminaci cytosinů. Během této deaminace se cytosin převádí na uracil. Polymeráza bude detekovat tento uracil jako thymin a začlení do kopírovaných řetězců adenin. To může být považováno za mutaci, při které se normální G nahrazuje za A s výsledkem mutace G/C na A/T, což je uměle vytvořená mutace, nikoli skutečná somatická mutace. Jedná se o vzácné případy, avšak dojde-li k brzkému kopírování při cyklování PCR, mohou být považovány za mutace. Při duplikované analýze se neopakují. Příklady potenciálních mutací vyvolaných deaminací cytosinu, které by byly zvažovány při rozhodování o léčbě pacienta, jsou: - Kodon 12: AGT (G12S) a GAT (G12D) - Kodon 13: AGC (G13S), GAC (G13D) a GGT (G13G, tichá mutace) Proto se doporučuje ověřit takové mutace duplikovanou analýzou stejné genomické DNA nebo podrobením všech vzorků duplikované analýze od začátku analýzy Amplifikační protokol 1. K dispozici je předmíchaný roztok dntp od Transgenomic (kat. č ) s celkovou pracovní koncentrací deoxynukleotidů 10 mm (2,5 mm na každý ze čtyř deoxynukleotidů). 2. Primery pro PCR KRAS Exon 2 Forward a Reverse (PN F/R) jsou dodány o koncentraci 10 µm. 3. Vyjměte 10 µm primery, 10mM dntps a pufr DNA Polymerase 10X PCR Buffer (kat. č ) z mrazáku a nechte rozmrazit na ledu. 4. Po rozmrazení důkladně promíchejte všechny složky soupravy na vortexu (~10 sekund), krátce odstřeďte (~10 sekund), aby na víčkách zkumavek nezůstala žádná kapalina, a umístěte do ledu. 5. Na ledu připravte výchozí směs. 6. Při přípravě výchozí směsi pro reakce s KRAS Exon 2 použijte jako vodítko následující tabulku: Počet reakcí: 10 Výpočet objemu: Objem vody (µl) 330** DNA Polymerase 10X PCR Buffer (µl) 50 dntps (µl) 40 KRAS Primer Exon 2 Forward (µl) 25 KRAS Primer Exon 2 Reverse (µl) 25 DNA Polymerase (µl) 10 Celkový objem výchozí směsi 48,0 **Poznámka:Je třeba dosáhnout minimálního množství 25 ng DNA na 50 µl reakční směsi. Je-li koncentrace extrahované DNA nižší než 12,5 ng/µl, zvyšte úměrně objem extrahované DNA, abyste zajistili množství 25 ng na reakční směs. Rovněž snižte odpovídajícím způsobem objem vody ve výchozí směsi, abyste získali 50 µl na reakční směs. Ve všech vzorcích připravených s použitím této výchozí směsi bude muset být extrahovaná DNA naředěna na přibližně stejnou nejnižší hladinu koncentrace. Nedoporučuje se používat extrahovanou DNA o koncentraci <5 ng/µl. 7. Pro každou hlavní směs vypočítejte požadované objemy s použitím výše uvedené tabulky a dbejte na následující: Pro tuto výchozí směs budou zapotřebí tři další reakce pro kontroly KRAS Wild-Type, KRAS Positive Control Exon 2 a kontrolu bez templátu 2 (NTC). Poznámka: vezměte na vědomí, že bude zapotřebí mírně větší objem výchozí směsi, aby se tak kompenzovaly ztráty během pipetování. Návod k použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC strana 13

15 12 Pokyny pro jednotlivé kroky 8. Označte 0,2 ml zkumavky pro PCR nebo jamky na 96jamkové destičce údajem příslušného vzorku. 9. Označte 2,0 ml centrifugační zkumavku pro přípravu výchozí směsi. 10. Přidejte do 2,0 ml centrifugačních zkumavek s označením Výchozí směs požadovaný objem vody o jakosti pro molekulární biologii. 11. Přidejte do zkumavky s výchozí směsí požadované množství pufru DNA Polymerase 10X PCR Buffer. 12. Přidejte do zkumavky s výchozí směsí požadovaný objem 10 mm nukleotidů dntps. 13. Přidejte do zkumavky s výchozí směsí požadovaný objem primeru KRAS Forward Primer. 14. Přidejte do zkumavky s výchozí směsí požadovaný objem primeru KRAS Forward Primer. 15. Vyjměte enzym DNA Polymerase (PN ) z mrazáku. 16. Odstřeďte enzym DNA Polymerase přibližně 10 sek. 17. Zamíchejte enzym DNA Polymerase na vortexu přibližně 10 sek. 18. Přidejte požadovaný objem polymerázy DNA Polymerase do zkumavky s výchozí směsí. 19. Zavřete zkumavku s výchozí směsí víčkem. 20. Před použitím zkumavku s výchozí směsí zamíchejte na vortexu přibližně 30 sek. a poté odstřeďte přibližně 10 sek. 21. Až do použití uložte do ledu. 22. Odpipetujte 48,0 µl (viz poznámka v kroku 6 výše) výchozí směsi do příslušných jamek; používáte-li jednokanálovou pipetu, vyměňujte špičky pipety mezi jednotlivými jamkami. Používáte-li opakovací pipetu, nesmí mezi jamkami docházet k úniku nebo rozstřiku. Uložte destičku na led. 23. Do příslušných jamek přidejte 2,0 µl (viz poznámka výše v kroku 6) templátové DNA ze všech vzorků nebo vodu (kontrola bez templátu, NTC). Pro každý vzorek použijte novou pipetovou špičku; snažte se zabránit kontaminaci mezi vzorky v důsledku rozstřikování. Zakryjte jamky pásem s 8 kryty (používáte-li 96jamkovou destičku) nebo uzavřete 0,2ml zkumavky pro PCR. Zkontrolujte, že kryty jsou bezpečně utěsněny. 24. Až poté postupně otevřete kontroly s templátovou DNA ze soupravy (PN , ). Nakonec odpipetujte 2,0 µl z každé kontroly templátu, aby se zminimalizovala možnost kontaminace vzorků DNA. Znovu zakryjte každou jamku pásem s 8 kryty (používáte-li 96jamkovou desku) nebo uzavřete 0,2ml zkumavky pro PCR. Zkontrolujte, že kryty jsou bezpečně utěsněny. POZNÁMKA: Dobrou praxí je umístit kontroly bez templátu (NTC) do jamek, které nesousedí s kontrolou Positive Control ani se vzorky. POZNÁMKA:Návrh na uspořádání 96jamkových destiček pro všechny KRAS a NRAS exons 2-4 naleznete v Příloze A.1 Návrh uspořádání destičky pro soupravy SURVEYOR Scan. 25. Zamíchejte na vortexu 10 sek. (při přibližně poloviční rychlosti). 26. Odstřeďte 1-2 minuty, aby se všechny roztoky shromáždily na dně jamek a zkumavek. Přesvědčte se, že roztoky jsou na dně každé jamky a zkumavky. Pokud tomu tak není, odstřeďte znovu. Návod k použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC strana 14

16 12 Pokyny pro jednotlivé kroky 12.7 Program termocykleru pro amplifikační protokol 1. Pro amplifikaci PCR a tvorbu heteroduplexů použijte následující protokol pro termocykler: 15 cyklů 30 cyklů Počáteční denaturace 95 C 5 minut Touchdown amplifikace 95 C 30 sekund 62 C, -0,5 ºC/cyklus 30 sekund 72 C 25 sekund Amplifikace 95 C 30 sekund 55 C 30 sekund 72 C 25 sekund Konečné prodloužení 1 cyklus 72 C 2 minuty Tvorba heteroduplexů 95 ºC 2 minuty 12 C Ponechat 12.8 Kontrola kvality produktů PCR 1. Před digescí nukleázou SURVEYOR Nuclease se doporučuje zkontrolovat kvalitu a množství amplikonů gelovou elektroforézou (nebo jí ekvivalentním způsobem). 2. Proveďte analýzu alikvotního podílu produktu PCR spolu s různým množstvím hmotnostního žebříčku 100 bp DNA. 3. S použitím žebříčku proveďte odhad koncentrace amplifikované DNA. 4. Měl by být zřetelný pouze jediný proužek >20 ng/µl odpovídající hlavnímu produktu PCR. 5. Je-li přítomno více proužků, zkontrolujte, že byla dostačující kvalita vstupní templátové DNA (viz Příloha B Pokyny k řešení problémů). 6. Není-li přítomen žádný produkt, zkontrolujte, že byla dostačující kvalita vstupní templátové DNA (viz Příloha B Pokyny k řešení problémů).splňuje-li kvalita požadované specifikace, zvyšte objem templátu na 4,0 µl/50 µl reakci (snižte množství vody na reakci na 31,0 µl). 7. V kontrolním vzorku bez templátu by neměly být viditelné žádné produkty PCR. Jsou-li v této kontrole produkty DNA zřetelné, je pravděpodobná kontaminace; viz Příloha B Pokyny k řešení problémů. 8. Vyhodnoťte, zda PCR je robustní nebo slabá. a. Robustní PCR se projevuje jedním proužkem > 20 ng/µl. b. Slabá PCR se projevuje jedním proužkem < 20 ng/µl. c. Pro obě vyhodnocení, robustní i slabou PCR, přejděte k digesci nukleázou SURVEYOR Nuclease. RADA: v této fázi mohou být produkty PCR skladovány při teplotě < -20 ºC až 1 týden Digesce nukleázou SURVEYOR Nuclease 1. Je-li PCR vzorku o dostatečné kvalitě a množství, proveďte digestivní reakci s nukleázou SURVEYOR Nuclease podle níže uvedeného popisu. 2. Rozmrazte na ledu zkumavky obsahující roztok 0.15 M MgCl 2 Solution a SURVEYOR Enhancer Cofactor. 3. Do nové 0,2 ml zkumavky pro PCR nebo do jamky v 96jamkové destičce přidejte 10,0 µl z každého vzorku amplifikovaného pomocí PCR. Návod k použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC strana 15

17 12 Pokyny pro jednotlivé kroky 4. Připravte čerstvou směs z následujícího: 0.15 M MgCl 2 Solution, SURVEYOR Enhancer Cofactor, SURVEYOR Enhancer W2 a SURVEYOR Nuclease W (směs SURVEYOR Nuclease). Použijte následující tabulku jako vodítko pro přípravu výchozí směsi pro digesci nukleázou SURVEYOR Nuclease. Níže uvedený příklad představuje objem výchozí směsi pro 10 vzorků. Vezměte na vědomí, že bude zapotřebí mírně větší objem výchozí směsi než je tento výpočet, aby se tak kompenzovaly ztráty během pipetování. Počet digestivních reakcí s nukleázou SURVEYOR Nuclease: Výpočet objemu: 0.15 M MgCl 2 Solution (µl) 10,0 SURVEYOR Enhancer Cofactor (µl) 10,0 SURVEYOR Enhancer W2 (µl) 10,0 SURVEYOR Nuclease W (µl) 20,0 Celkový objem výchozí směsi: 50,0 Přidejte 5 µl výchozí směsi SURVEYOR Nuclease do každého vzorku amplifikovaného PCR (µl) 10,0 Celkový objem digestivní reakce s nukleázou SURVEYOR Nuclease: 15,0 a. Každou reagencii před použitím odstřeďte. b. Před pipetováním každou reagencii mírně promíchejte na vortexu; po každém promíchání krátce odstřeďte asi 10 sekund. c. Pro každou digesci přidejte do 0,2 ml (nebo větší) mikrocentrifugační zkumavky pro PCR následující komponenty. 1,0 µl 0.15 M MgCl 2 Solution (PN ) 1,0 µl SURVEYOR Enhancer Cofactor (PN ) 1,0 µl SURVEYOR Enhancer W2 (PN ) 2,0 µl SURVEYOR Nuclease W (PN ) Nebo přidejte 5 µl výchozí směsi připravené podle výše uvedené tabulky. 5. Mírně zamíchejte výchozí směs pro digesci se SURVEYOR Nuclease na vortexu po dobu 10 sek. při nízké rychlosti. 6. Mírně odstřeďte výchozí směs pro digesci se SURVEYOR Nuclease po dobu 10 sek. při nízké rychlosti. 7. Uložte výchozí směs pro digesci se SURVEYOR Nuclease do ledu, dokud ji nepoužijete. Poznámka: Výchozí směs pro digesci nukleázou SURVEYOR Nuclease připravená v kroku 7 musí být použita okamžitě, neboť u enzymu SURVEYOR Nuclease W dochází za přítomnosti ostatních složek této reakční směsi SURVEYOR Nuclease k jeho deaktivaci. 8. Odpipetujte 5,0 µl alikvotní podíly výchozí směsi pro digesci se SURVEYOR Nuclease do každé zkumavky nebo jamky obsahující 10,0 µl alikvotní podíl amplifikovaného produktu PCR (viz krok 3 výše). 9. Po dokončení pipetování odstřeďte 0,2 ml zkumavky PCR nebo 96jamkovou destičku po dobu 10 sek. 10. Mírně zamíchejte 0,2ml zkumavky PCR nebo 96jamkovou destičku po dobu 10 sek. 11. Odstřeďte po dobu 10 sekund při nízké rychlosti (tento krok je velmi důležitý, je-li digesce prováděna v přístroji bez zahřívaného krytu). 12. Inkubujte při teplotě 42 C po dobu 30 min. 13. Do každé zkumavky nebo jamky přidejte 1,0 µl roztoku SURVEYOR Stop Solution (PN ) a mírně zamíchejte na vortexu (celkový reakční objem s nukleázou SURVEYOR Nuclease je 16,0 µl). 10 Návod k použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC strana 16

18 12 Pokyny pro jednotlivé kroky RADA: Produkty digesce SURVEYOR lze uchovávat po dobu až jednoho týdne při teplotě -20 ºC. 14. Umístěte digestované vzorky do systému DHPLC. Poznámka: Navrhované nastavení gradientu v systému DHPLC pro analýzu produktů digesce enzymem SURVEYOR Nuclease naleznete na 13 Kontrolní postupy 13.1 Kontrola kvality soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD Souprava obsahuje kontrolní plasmidovou DNA pro provádění kontroly kvality během specifických kroků testu. V Amplifikačním protokolu se pomocí těchto kontrol ověřuje, zda je výchozí směs správně připravena a zda amplifikace probíhá správně. Doporučuje se používat i kontroly bez templátu (s vodou místo templátové DNA), aby se tak mohla zjistit možná kontaminace složek souprav jakýmkoli cizorodým templátem DNA. Během kroku digesce nukleázou SURVEYOR Nuclease umožňuje amplikon z kontrolní plasmidové DNA účinnou kontrolu, zda podmínky při štěpící reakci (příprava výchozí směsi pro digesci enzymem SURVEYOR Nuclease a podmínky inkubace) byly uspokojivé. Ve fázi analýzy poskytují chromatogramy digestovaných kontrolních amplikonů nukleázou SURVEYOR Nuclease v systému DHPLC vodítko, zda se píky odpovídající této mutaci v úseku KRAS Exon 2 budou eluovat i při nízké hladině (viz Obrázek 4). Píky produktů štěpení odpovídající jiným mutacím v úseku KRAS Exon 2 se mohou eluovat v mírně odlišných pozicích. Pokud amplikony PCR neodpovídají výsledkům uvedeným v části Kontrola kvality produktů PCR, obraťte se na Přílohu B -Pokyny pro řešení problémů nebo kontaktujte technickou podporu společnosti Transgenomic, než přejdete k dalším krokům analýzy vzorků Použití kontrolních plasmidových DNA Součástí soupravy jsou dvě kontrolní DNA: KRAS Control Wild-Type; PN KRAS Positive Control Exon 2; PN Tyto kontrolní DNA jsou plasmidy s inzerty. Kontrola Positive Control obsahuje dva plasmidy: směs KRAS Control Wild-Type a mutační klon odlišující se od typu Wild-Type v jediném páru bází. Kontroly se dodávají v samostatných lahvičkách o koncentraci 10 5 kopií/µl. Primery KRAS Exon 2 Forward a Reverse pro amplifikaci pomocí PCR se dodávají v soupravě samostatně. Při používání těchto kontrol dodržujte pokyny uvedené v částech Amplifikační protokol, Digesce nukleázou SURVEYOR Nuclease a Analýza exonu KRAS Exon 2 pomocí nukleázy SURVEYOR Nuclease. PŘI PRVNÍM POUŽITÍ SOUPRAVY DŮRAZNĚ DOPORUČUJEME PROVÉST PŘED TESTOVÁNÍM GENOMICKÝCH VZORKŮ NEJPRVE EXPERIMENTY SE SAMOTNÝMI KONTROLAMI 14 Interpretace výsledků 14.1 Analýza exonu KRAS Exon 2 pomocí nukleázy SURVEYOR Nuclease Pro účely porovnání a kontroly VŽDY proveďte digesci enzymem SURVEYOR Nuclease u každé kontroly (typu Wild-Type a Positive Controls) a u kontroly bez templátu, u DNA vzorků a analyzujte je na stejné destičce pro vzorky v systému DHPLC. Během kroku digesce nukleázou SURVEYOR Nuclease umožňují amplikony z těchto kontrolních plasmidových DNA účinnou kontrolu, zda podmínky při štěpící reakci (příprava směsi SURVEYOR Nuclease a podmínky inkubace) byly uspokojivé. Ve fázi analýzy umožňují křivky digestovaných kontrolních amplikonů v systému DHPLC vodítko, kde dojde k eluci fragmentů DNA vzniklých Návod k použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC strana 17

19 14 Interpretace výsledků štěpením v místech specifických mutací v důsledku chybného párování, a to i při jejich nízké koncentraci (viz Obrázek 4). Pokud ani amplikony PCR ani fragmenty štěpení nukleázou SURVEYOR Nuclease odvozené z kontrolní DNA neodpovídají uvedeným výsledkům, obraťte se na Přílohu B - Pokyny pro řešení problémů nebo kontaktujte technickou podporu Transgenomic, než přejdete k dalším krokům analýzy vzorků. Níže uvedené ukázky jsou pouze pro účely ilustrace a NEJSOU určeny pro stanovení identity jakékoli konkrétní mutace. Potvrzení identity mutace je nutné, aby se jednoznačně stanovila přítomnost specifické záměny bází v exonu Exon 2 genu KRAS. Enzym SURVEYOR Nuclease štěpí ve všech místech chybného párování vzniklých v důsledku tvorby heteroduplexů mezi typem Wild-Type a mutovanou DNA, nikoli pouze v mutacích v úseku Exon 2. Enzym SURVEYOR Nuclease umožňuje potvrzení přítomnosti chybného párování. Identita změny bází specifická pro danou mutaci se požaduje ke stanovení KRAS aktivujícího stavu a musí být ověřena jiným způsobem, např. sekvenováním Kontrola výsledků SURVEYOR Scan Prohlédněte chromatogramy a porovnejte náležející kontrolám Wild-Type a Positive Controls s chromatogramem vzorku. Určete, zda chromatogram vzorku je svým charakterem podobný nebo odlišný od kontroly Wild-Type. Je-li odlišný, potom vzorek je Pozitivní SURVEYOR Scan a bude předán k analýze DNA sekvenováním. Příklady ukazuje Obrázek 4 a příklady takových vzorků ukazuje Příloha B Pokyny pro řešení problémů, 7 a 8. Každý vzorek s charakterem SURVEYOR Nuclease odlišným od Wild-Type by měl být předán k ověření sekvence, i když není identický s kontrolou. Viz příklad takového vzorku v Příloze B Pokyny pro řešení problémů, 7. Je-li třeba, zvětšete zkoumanou oblast a překryjte chromatogram vzorku chromatogramem kontroly Wild-Type pro daný amplikon. Pozorujte rozdíly mezi kontrolou Wild-Type a analyzovaným vzorkem. Důležité! Po důkladném prozkoumání každého vzorku vyhodnocující ověří, zda sousedící vzorky v analytické destičce mají identické pozitivní výsledky SURVEYOR Scan. Vyskytují-li se identické pozitivní výsledky, mohou být důsledkem příčné kontaminace mezi vzorky nebo kontrolami a analýza se musí zopakovat. Návod k použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC strana 18

20 14 Interpretace výsledků 14.3 Příklady výsledků Ukázky výsledků získaných soupravou SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC jsou ukázány na Obrázku 4 níže. Tyto ukázky byly získány systémem WAVE 4500 Systems s použitím UV a fluorescenčních detektorů a s přesným dodržením pokynů v části Pokyny pro jednotlivé kroky. Pokyny pro navrhované nastavení gradientu v systému DHPLC pro analýzu produktů digesce enzymem SURVEYOR Nuclease naleznete na Obrázek 4A Průtok systémem DHPLC G12D fragmenty 74 a 116 bp KRAS Control Wild-Type KRAS Positive Control Neštěpený Vzorek 1, KRAS Exon 2 amplikon Vzorek 2, KRAS Exon bp Vzorek 3, KRAS Exon 2 Velikostní standard DNA Neštěpený amplikon 190-bp Promytí systému DHPLC Obrázek 4B G12D fragmenty 74 a 116 bp KRAS Control Wild-Type KRAS Positive Control Uncleaved Vzorek 1, KRAS Exon bp Vzorek 2, KRAS Exon 2 amplicon Vzorek 3, KRAS Exon 2 Velikostní standard DNA Neštěpený amplikon 190-bp Obrázek 4A a 4B Analýza v systému WAVE DHPLC s UV (Obrázek 4A) a fluorescenční (Obrázek 4B) detekcí produktů digesce enzymem SURVEYOR Nuclease kontroly KRAS Positive Control Exon 2 a kontroly KRAS Control Wild-Type a CRC DNA izolované z řezů FFPE. Při vizuálním prohlížení chromatogramů je třeba porovnávat vzorky po digesci s kontrolou Wild-Type Control (hnědá čára). Kontrola KRAS Positive Control Exon 2 (modrá čára) je směsí typu Wild-Type a mutantních plasmidů G12D dávající digesční píky 74 a 116 bp; tato kontrola ukazuje, že krok digesce enzymem SURVEYOR Nuclease proběhl správně a ukazuje oblast chromatogramu, kterou je třeba vizuálně prozkoumat a určit, zda by měl být vzorek předán k analýze sekvence DNA. Z porovnání charakteru digesce u vzorků 1-3 s elektroferogramem typu Wild-Type bez digesce je zřejmé, že vzorky 1 a 2 (červená a tyrkysová čára) obsahují pravděpodobné mutace a měly by být sekvenovány, aby se potvrdila přítomnost či absence mutace v příslušném kodonu. Vzorek 3 (zelená čára) má podobný chromatogram jako kontrola Wild-Type Control a není třeba jej předávat k sekvenční analýze DNA. Konečným výsledkem je Návod k použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC strana 19

21 14 Interpretace výsledků výsledek sekvenování, neboť se mohou vyskytovat i jiné nerelevantní mutace poskytující fragmenty o stejné velikosti. 15 Co je třeba dodržovat 15.1 Detekční hladina mutací získaných soupravou SURVEYOR Scan Validace souprav SURVEYOR Scan pro platformu DHPLC pomocí plasmidových klonů všech indikovaných mutací ukázala, že píky pro SURVEYOR Nuclease lze detekovat ve směsi 2-5% mutantu na pozadí Wild-Type. Automatické zjišťování sekvenováním přímého a zpětného řetězce často selhává v detekci mutací o koncentraci ve směsi s DNA typu Wild-Type nižší než 10%. Společně s výsledky získanými nukleázou SURVEYOR Nuclease lze důvěryhodněji interpretovat elektroferogramy sekvenování obsahující 5-10% mutantů. Ukáže-li analýza vzorku pro SURVEYOR Scan pozitivní výsledek, avšak sekvenování DNA neukáže žádnou detekovatelnou mutaci v KRAS nebo NRAS, doporučujeme takový výsledek vyhodnotit a zaznamenat jako Žádná varianta nezjištěna. Viz více podrobností v části Pracovní schéma Potvrzení sekvence U všech pozitivních výsledků ze SURVEYOR Scan přejděte k ověření sekvence, aby se určila identita sekvence mutací v KRAS Exon 2. Nepostupujte ověřování sekvence s negativními výsledky ze SURVEYOR Scan. Takový vzorek lze vyhodnotit jako Wild-Type nebo varianta nezjištěna. Primery Universal Sequencing Primers dodávané v soupravě jsou určeny k použití při ověřování sekvence. Přímý primer je PN F (Universal Sequencing Primer 1) a zpětný primer je PN R (Universal Sequencing Primer 2) Omezení testu Kontaminující látky přenesené ze vzorků zalitých v parafínu a fixovaných formalinem mohou narušovat amplifikaci metodou PCR a digesci nukleázou SURVEYOR Nuclease. Postupy kontroly kvality uvedenými v části Kontrola kvality produktů PCR se zajistí, že extrahovaná DNA bude vhodná pro použití s touto soupravou. Tato souprava byla validována pro analýzu vzorků získaných z nádoru kolorektálního karcinomu zalitých v parafínu a fixovaných formalinem. Není validována pro diagnostické použití s jinými druhy karcinomů ani pro čerstvé nebo zmrazené vzorky získané biopsií. Řešení problémů s nestandardními výsledky a podrobnosti k faktorům, které ovlivňují tento test, naleznete v části Příloha B - Pokyny pro řešení problémů v následujícím textu. Během práce se soupravou je nutné věnovat pozornost zabránění přenosu a křížové kontaminaci. Extrémní citlivost metody testování vyžaduje v následujících bodech preventivní opatření: Manipulaci se vzorky je nutné provádět tak, aby mezi vzorky nemohlo dojít ke křížové kontaminaci Pracujte na pracovišti pro PCR nebo na jiném vhodném místě, které lze před přípravou amplifikačních reakcí PCR vystavit UV záření. K otevření vzorků po amplifikaci pomocí PCR určených ke kontrole kvality gelovou elektroforézou použijte oddělené pracoviště pro PCR. Příprava k digesci enzymem SURVEYOR Nuclease má být provedena v oddělené místnosti nebo na jiném pracovišti pro PCR, než kde byla provedena původní PCR. Během všech kroků testu se s plasmidovými kontrolami v soupravě musí manipulovat odděleně od testovaných vzorků. o Všechny roztoky a jamky pro kontrolu bez templátu a pro DNA vzorků musí být před otevřením zkumavek s kontrolní plasmidovou DNA uzavřeny. Návod k použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC strana 20

22 15 Co je třeba dodržovat o o MANIPULACI S KONTROLAMI PROVÁDĚJTE JAKO POSLEDNÍ. Kontrolní plasmidovou DNA přidávejte do příslušných zkumavek pouze AŽ PO uzavření všech jamek s kontrolou bez templátu a se vzorky. Po uzavření zkumavek s kontrolní DNA otřete VŠECHNY zkumavky a víčka před přenesením na jiné pracoviště přípravkem destruujícím DNA (např. 10% chlornanem). Pipetování vzorků do 96jamkových desek nesmí umožnit kontaminaci sousedících jamek vzorkem, ke které by mohlo dojít vystříknutím během míchání nebo opomenutím vyměnit špičku pipety. Návod k použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC strana 21

23 Příloha A Příloha A A.1 Návrh uspořádání destičky pro soupravy SURVEYOR Scan Níže znázorněný návrh uspořádání destičky je určen pro analýzu SURVEYOR Scan všech sedmi exonů KRAS a NRAS Exons současně v deseti vzorcích. Legenda: Ex = Exon; WT = Wild-Type; Mut = mutace; NTC = kontrola bez templátu. A.2 Označení na kontrolní DNA Sekvence s označením jsou ukázány níže. Legenda: Úseky s nejčastější mutací jsou zvýrazněny růžově. Sekvenci ve velkém písmu tvoří kódující báze; malým písmem jsou nekódující báze. Kontroly obsahují genetické označení zvýrazněné růžově; tuto odchylku od sekvence KRAS Wild-Type v úseku, kde se mutace neočekávají, lze využít k řešení problémů s kontaminací vzorků s použitím kontrol Positive Controls. Viz Příloha B - Pokyny pro řešení problémů, 8, kde naleznete ukázku takové kontaminace na křivce SURVEYOR Scan. Označení v exonu KRAS Exon 2 Velikost amplikonu: 190 bp. V kontrolním plasmidu pro KRAS Exon 2 je genetické označení vytvořeno změnou TAT na ATA. Kodony 12 a 13 jsou zvýrazněny níže. GCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAAATAGAT A.3 Požadavky pro denaturaci v systému HPLC (DHPLC) A.3.1 Specifikace systému DHPLC pro aplikace v rámci SURVEYOR Scan Následující specifikace představují minimální požadavky pro specifikace systému DHPLC k provádění testů s použitím soupravy SURVEYOR Scan KRAS a NRAS. Systém dávkování gradientového rozpouštědla do HPLC Funkce binárního gradientu; vysoký tlak nebo nízký tlak Ovládání rychlosti průtoku, minimální rozsah: 0,7 1,6 ml/min Přesnost rychlosti průtoku: ± 2% (H 2 O při 20 ºC) Odplyňovač rozpouštědla Automatický vzorkovač Ovládání teploty k chlazení destiček, nastavitelné: 4 až 14 ºC Objem vstřiku: 5 50 µl Separační kolona Určena k separaci fragmentů dsdna různých velikostí, fragmenty od 50 bp do 250 bp Inkubátor s velmi přesným nastavením teploty Teplotní rozsah: 40 až 70 ºC

24 Příloha A Přesnost teploty: ± 0.2 ºC Reprodukovatelnost teploty: ± 0.2 ºC Linearita v celém rozsahu teplot: ± 2.0 ºC Alternativa detekce 1 UV/VIS detektor Rozsah vlnových délek: nm UV zdroj: Deuteriová lampa Alternativa detekce 2 Fluorescenční detektor Rozsah vlnových délek: buzení: nm; emise: nm Fluorescenční zdroj: 150 W xenonová lampa Pumpa pro fluorescenční barvivo Fixní rychlost průtoku 0,1 ml/min 20%/+50% Nízkopulzní průtok A.3.2 Obsluha systému Při nastavení a obsluze systému DHPLC dodržujte doporučení výrobce pro analýzu fragmentů dsdna o velikosti od 50 bp to 250 bp s dosaženým rozlišením velikosti 10 bp nebo vyšším. Takový je rozsah velikostí fragmentů po digesci enzymem SURVEYOR Nuclease s použitím této soupravy. Pokyny pro navrhované nastavení gradientu v systému DHPLC pro analýzu produktů digesce enzymem SURVEYOR Nuclease naleznete na A.3.3 Údržba kolon v systému DHPLC Při údržbě kolon v DHPLC dodržujte doporučení výrobce. Poznámka: analýza reakcí se SURVEYOR Nuclease vyžaduje dodržování častějších a přísnějších protokolů ve srovnání s analýzou standardních vzorků PCR. Další podrobnosti naleznete v pokynech pro systém DHPLC Návod k použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC strana 23

25 Příloha A A.4 Uspořádání laboratoře pro testy PCR V zájmu získání spolehlivých a nekontaminovaných výsledků PCR dodržujte při přípravě laboratoře pro PCR správnou laboratorní praxi. Při přípravě laboratorního uspořádání dbejte na prostorové oddělení činností během přípravy pro PCR od činností po amplifikaci. Je důležité oddělit (i) izolaci DNA; (ii) amplifikaci PCR; a (iii) činnosti následující po PCR, které zahrnují otevírání zkumavek obsahujících amplifikované vzorky při přípravě analýzy v gelu a při přípravě ostatních testů, jako je analýza produktů digesce enzymem SURVEYOR Nuclease a sekvenování DNA. Je rovněž důležité mít laboratorní potřeby a zařízení určené pro jednotlivé prostory a používat je pouze v těchto prostorech. Utírání ploch 10% (obj/obj) chlornanem, připravovaným jednou týdně, pomůže eliminovat fragmenty DNA 500 bp, jako jsou templáty pro PCR. Dále může být vhodné ošetřit plastové potřeby a roztoky expozicí krátkovlnnému UV záření s použitím UV síťovadla po dobu 7-10 minut. Poznámka: enzymy a DNA určená k amplifikaci nesmí být vystavovány UV záření. K minimalizaci kontaminace velmi pomůže nošení náležitého ochranného oděvu, častá výměna rukavic a utírání rukavic na rukou 10% (obj/obj) roztokem chlornanu před vstupem na pracoviště. Mělo by být dodrženo uspořádání alespoň o dvou místnostech znázorněné na schématu níže, které je určeno specificky pro PCR a pro analýzu s použitím enzymu SURVEYOR Nuclease.

26 Příloha A A.5 Odkazy na literaturu 1. Amgen News Release (2013) New analyses identify predictive biomarkers for Vectibix (panitumumab) in patients with metastatic colorectal cancer Peeters M et al (2013) Massively parallel tumor multigene sequencing to evaluate response to panitumumab in a randomized phase III study of metastatic colorectal cancer. Clin Cancer Res De Roock W et al (2010) Association of KRAS p.g13d mutation with outcome in patients with chemotherapy-refractory metastatic colorectal cancer treated with cetuximab. JAMA Peeters M et al (2013) Mutant KRAS codon 12 and 13 alleles in patients with metastatic colorectal cancer: assessment as prognostic and predictive biomarkers of response to panitumumab. J Clin Oncol Andre T et al (2013) Panitumumab combined with irinotecan for patients with KRAS wildtype metastatic colorectal cancer refractory to standard chemotherapy: a GERCOR efficacy, tolerance, and translational molecular study. Ann Oncol Loupakis F et al (2009) KRAS codon 61, 146 and BRAF mutations predict resistance to cetuximab plus irinotecan in KRAS codon 12 and 13 wild-type metastatic colorectal cancer. Br J Cancer De Roock W et al (2010) Effects of KRAS, BRAF, NRAS, and PIK3CA mutations on the efficacy of cetuximab plus chemotherapy in chemotherapy-refractory metastatic colorectal cancer: a retrospective consortium analysis. Lancet Oncol Qiu P et al (2004) Mutation detection using Surveyor nuclease. Biotechniques Kuang Y et al (2009) Noninvasive detection of EGFR T790M in gefitinib or erlotinib resistant non-small cell lung cancer.clin. Cancer Res Mitani N et al (2007) Surveyor nuclease-based detection of p53 gene mutations in haematological malignancy.ann. Clin. Biochem Engelman JA et al (2006) Allelic dilution obscures detection of a biologically significant resistance mutation in EGFR-amplified lung cancer.j. Clin. Invest Viz též odkazy na o nukleáze SURVEYOR Nuclease a jejím použití. Návod k použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC strana 25

27 Příloha B Příloha B Pokyny pro řešení problémů Efektivní použití souprav SURVEYOR Scan KRAS pro systém DHPLC závisí na úspěšném provedení celé řady kroků. Jedním z nejdůležitějších kroků je amplifikace metodou PCR, která musí vést k tvorbě specifické DNA o jednotné velikosti a v dostatečném množství, aby byla po hybridizaci a štěpení detekovatelná. To závisí na kvalitě původního vzorku. Provádění testu s DNA, která nesplňuje kritéria kvality a množství, se nedoporučuje. Poznámka: Používáte-li enzym SURVEYOR Nuclease poprvé, prostudujte si Pokyny pro jednotlivé kroky a proveďte experimenty v části Použití kontrolních plasmidových DNA.Před kontaktováním technické podpory společnosti Transgenomic mějte výsledky získané pomocí kontrolní plasmidové DNA připravené u sebe. Tyto pokyny po řešení problémů obsahují seznam problémů, se kterými se můžete setkat při používání souprav SURVEYOR Scan pro DHPLC a také návrhy jejich řešení. Podrobné informace k obsluze a údržbě přístroje naleznete v příručce pro systém DHPLC. Příručka obsahuje konkrétní pokyny pro kontrolu a udržování funkčnosti kolony a podrobnosti k řešení problémů. Problém 1 nízký výtěžek PCR nebo analýza na agarózovém gelu neukazuje žádný produkt PCR NÍZKÝ VÝTĚŽEK PCR Správný výtěžek PCR Nízký výtěžek PCR MOŽNÁ PŘÍČINA Špatná kvalita templátové DNA Velké množství RNA ve vzorku zvyšující odhadovanou koncentraci DNA Termocykler není zkalibrován Není dostatek templátu ŘEŠENÍ Opakujte purifikaci DNA; ověřte používanou purifikační metodu. Je-li DNA extrahovaná z FFPE příliš fragmentovaná, mohou být zapotřebí další bloky FFPE. Opakujte ošetření vzorku DNA RNázou a purifikaci DNA. Zkalibrujte termocykler. Zvyšte množství templátu. Proužek RNA Poznámka: Je třeba používat DNA vysoké kvality z FFPE. Podle měření absorbance při 260 nm musí mít DNA koncentraci 25 ng/µl, absorbanční poměr při 260/280 nm >1,8 a čistotu >90% DNA (tj. neobsahovat kontaminaci trna a rrna na základě pozorování agarózového gelu). Vzorky s DNA uchovávejte při teplotě od -20 C do -80 C. Analýza templátu DNA extrahované z tkání zalitých v parafínu vyžaduje některá preventivní opatření. Extrahovanou DNA lze ošetřit uracil DNA glykosylázou a tím zabránit amplifikaci fragmentů DNA obsahujících deaminovaná C residua. Často dochází k tomu, že vysoký podíl materiálu extrahovaného z tkání zalitých v parafinu a adsorbujícího při A 260 není během PCR správně amplifikován. Použití většího množství počáteční DNA často napomůže tvorbě správného produktu amplifikace. Další možností je vybrat nádorovou tkáň z FFPE s vyšším podílem nádorových buněk. Lze též použít mikrořez, avšak to je velmi časově náročný postup a nedoporučuje se pro běžnou laboratorní analýzu. Návod k použití soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro systém DHPLC strana 26

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction

Více

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Filozofie validace. Je validace potřebná? Mezinárodní doporučení pro provádění validací ve forenzně genetických laboratořích

Filozofie validace. Je validace potřebná? Mezinárodní doporučení pro provádění validací ve forenzně genetických laboratořích INVESTICE DO ROZVOJE VZDĚLÁVÁNÍ Vzdělávání v oblasti forenzní genetiky reg. č. CZ.1.07/2.3.00/09.0080 Mezinárodní doporučení pro provádění validací ve forenzně genetických laboratořích INVESTICE DO ROZVOJE

Více

TheraScreen : souprava k detekci mutací K-RAS Pro detekci 7 typů mutací genu K-RAS

TheraScreen : souprava k detekci mutací K-RAS Pro detekci 7 typů mutací genu K-RAS TheraScreen : souprava k detekci mutací K-RAS Pro detekci 7 typů mutací genu K-RAS K použití se systémem Roche LightCycler 480 Real-Time PCR (Přístroj II) (katalogové číslo: 05015278001) a se systémem

Více

cobas 4800 BRAF V600 Mutation Test BRAF

cobas 4800 BRAF V600 Mutation Test BRAF cobas 4800 BRAF V600 Mutation Test PRO ÚČELY DIAGNOSTIKY IN VITRO. cobas DNA Sample Preparation Kit DNA SP 24 Tests P/N: 05985536190 cobas 4800 BRAF V600 Mutation Test BRAF 24 Tests P/N: 05985595190 POZNÁMKA:

Více

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MELAMINU A KYSELINY KYANUROVÉ METODOU LC-MS

Jednotné pracovní postupy zkoušení krmiv STANOVENÍ OBSAHU MELAMINU A KYSELINY KYANUROVÉ METODOU LC-MS Národní referenční laboratoř Strana 1 STANOVENÍ OBSAHU MELAMINU A KYSELINY KYANUROVÉ METODOU LC-MS 1 Rozsah a účel Postup je určen pro stanovení obsahu melaminu a kyseliny kyanurové v krmivech. 2 Princip

Více

Úloha č. 1 Odměřování objemů, ředění roztoků Strana 1. Úkol 1. Ředění roztoků. Teoretický úvod - viz návod

Úloha č. 1 Odměřování objemů, ředění roztoků Strana 1. Úkol 1. Ředění roztoků. Teoretický úvod - viz návod Úloha č. 1 Odměřování objemů, ředění roztoků Strana 1 Teoretický úvod Uveďte vzorec pro: výpočet směrodatné odchylky výpočet relativní chyby měření [%] Použitý materiál, pomůcky a přístroje Úkol 1. Ředění

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Charakteristika testu: Set AMPLICOR HPV vyráběný firmou Roche je určený pro detekci vysoko-rizikových typů lidských

Více

nastavení real-time PCR cykleru Rotor Gene 3000

nastavení real-time PCR cykleru Rotor Gene 3000 Verze: 1.4 Datum poslední revize: 25. 3. 2015 nastavení real-time PCR cykleru Rotor Gene 3000 (Corbett Research) generi biotech OBSAH: 1. Nastavení teplotního profilu a spuštění cykleru... 3 2. Zadání

Více

Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách

Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách Teorie Stanovení celkových proteinů Celkové množství proteinů lze stanovit pomocí několika metod; například: Hartree-Lowryho

Více

Příloha č. 3 Technická specifikace

Příloha č. 3 Technická specifikace Příloha č. 3 Technická specifikace PŘÍSTROJ Dva creepové stroje pro měření, jeden creepový zkušební stroj pracující v rozmezí teplot od +150 do +1200 C a jeden creepový zkušební stroj pracující v rozmezí

Více

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)

Více

C V C. Návod k použití pro Biofortuna SSPGo TM HLA Wipe Test BF-40-01. Revize 3. Červenec 2014

C V C. Návod k použití pro Biofortuna SSPGo TM HLA Wipe Test BF-40-01. Revize 3. Červenec 2014 Dot146v1 Instructions for Use for Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Strana 1 / 8 Návod k použití pro Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Revize 3 Červenec 2014 Dot146v1 Instructions for

Více

UŽIVATELSKÁ PŘÍRUČKA (překlad původního návodu k použití) SB 52 Tužkový měřič ph/orp/ C/ F

UŽIVATELSKÁ PŘÍRUČKA (překlad původního návodu k použití) SB 52 Tužkový měřič ph/orp/ C/ F UŽIVATELSKÁ PŘÍRUČKA (překlad původního návodu k použití) SB 52 Tužkový měřič ph/orp/ C/ F SUBOTA Indikátor automatické kompenzace teploty Indikátor nestability Měřící jednotka na hlavním LCD Hlavní LCD

Více

PŘÍBALOVÁ INFORMACE. www.geneproof.com. GeneProof PathogenFree DNA Isolation Kit IDNA050 IDNA250. In vitro diagnostický zdravotnický prostředek

PŘÍBALOVÁ INFORMACE. www.geneproof.com. GeneProof PathogenFree DNA Isolation Kit IDNA050 IDNA250. In vitro diagnostický zdravotnický prostředek PŘÍBALOVÁ INFORMACE GeneProof PathogenFree DNA Isolation Kit IDNA050 IDNA250 In vitro diagnostický zdravotnický prostředek Souprava je vyrobena v souladu s evropskou Směrnicí Rady 98/79/ES jako in vitro

Více

Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody

Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody Návod k použití souprav Wipe test Kontaminační kontrola Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody REF 7091 40 reakcí 1. Popis výrobku V posledních letech se

Více

ELEKTRONICKÝ DETEKTOR ÚNIKU CHLADIVA

ELEKTRONICKÝ DETEKTOR ÚNIKU CHLADIVA NÁVOD AC 5404Q 20.7.2010 ELEKTRONICKÝ DETEKTOR ÚNIKU CHLADIVA Vlastnosti produktu: elektronický detektor úniku chladiva TechnoTools D-440 (žhavený senzor) (splňuje normy SAE J2791, EN 14624) AC 5404Q obsahuje

Více

ZADÁVACÍ PODMÍNKY. Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT) Sídlo: U Nemocnice 2094/1, 128 20 Praha 2 IČ / DIČ

ZADÁVACÍ PODMÍNKY. Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT) Sídlo: U Nemocnice 2094/1, 128 20 Praha 2 IČ / DIČ VÝZVA K PODÁNÍ NABÍDEK DO VÝBĚROVÉHO ŘÍZENÍ NA ZADÁVACÍ PODMÍNKY Název zakázky: Systém Real-Time PCR 1. Identifikační údaje zadavatele Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT)

Více

LIDSKÁ CYTOGENETIKA Laboratorní diagnostika

LIDSKÁ CYTOGENETIKA Laboratorní diagnostika Pod Cihelnou 6 161 00 Praha 6 tel: 233 313 578, fax: 233 313 582 email: asco@ascomed.cz www.ascomed.cz 1. Kultivace lymfocytů LIDSKÁ CYTOGENETIKA Laboratorní diagnostika 1.1 Úvod Karyotypizace lidských

Více

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní

Více

Konfirmace HPLC systému

Konfirmace HPLC systému Mgr. Michal Douša, Ph.D. Obsah 1. Měření modulové... 2 1.1 Těsnost pístů tlakový test... 2 1.2 Teplota autosampleru (správnost a přesnost)... 2 1.3 Teplota kolonového termostatu... 2 1.3.1 Absolutní hodnota...

Více

Zkumavky Leucosep LTK.615 PŘÍBALOVÁ INFORMACE. Pro diagnostické použití in vitro PI-LT.615-CZ-V3

Zkumavky Leucosep LTK.615 PŘÍBALOVÁ INFORMACE. Pro diagnostické použití in vitro PI-LT.615-CZ-V3 Zkumavky Leucosep LTK.615 PŘÍBALOVÁ INFORMACE Pro diagnostické použití in vitro PI-LT.615-CZ-V3 Informace pro použití Použití Zkumavky Leucosep jsou určeny k odběru a separaci periferních mononukleárních

Více

Chyby spektrometrických metod

Chyby spektrometrických metod Chyby spektrometrických metod Náhodné Soustavné Hrubé Správnost výsledku Přesnost výsledku Reprodukovatelnost Opakovatelnost Charakteristiky stanovení 1. Citlivost metody - směrnice kalibrační křivky 2.

Více

IVD Bacterial Test Standard

IVD Bacterial Test Standard Návod k použití IVD Bacterial Test Standard Standard pro kalibraci hmotnostního spektrometru s typickým profilem peptidů a proteinů Escherichia coli DH5 alfa a dalšími proteiny. Pro použití při hmotnostní

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

Písemná zpráva zadavatele

Písemná zpráva zadavatele Písemná zpráva zadavatele veřejné zakázky zadávané dle zákona č. 137/2006 Sb., o veřejných zakázkách, ve znění účinném ke dni zahájení zadávacího řízení (dále jen ZVZ ). Veřejná zakázka Název: Ostatní

Více

SOUHRN ÚDAJŮ O PŘÍPRAVKU

SOUHRN ÚDAJŮ O PŘÍPRAVKU SOUHRN ÚDAJŮ O PŘÍPRAVKU 1 1. NÁZEV VETERINÁRNÍHO LÉČIVÉHO PŘÍPRAVKU APIGUARD gel (25% Thymolum) pro podání ve včelím úlu Vyhrazený veterinární léčivý přípravek 2. KVALITATIVNÍ A KVANTITATIVNÍ SLOŽENÍ

Více

ANTIBIOTICKÉ DISKY Antibiotické disky pro testování citlivosti

ANTIBIOTICKÉ DISKY Antibiotické disky pro testování citlivosti ANTIBIOTICKÉ DISKY Antibiotické disky pro testování citlivosti POPIS ANTIBIOTICKÉ DISKY jsou papírové disky se speciálními vlastnostmi, které jsou impregnované antibiotiky a používají se pro testy citlivosti

Více

PÍSEMNÁ ZPRÁVA ZADAVATELE

PÍSEMNÁ ZPRÁVA ZADAVATELE PÍSEMNÁ ZPRÁVA ZADAVATELE podle 85 zákona č. 137/2006 Sb., o veřejných zakázkách (dále jen zákon ) 1. IDENTIFIKAČNÍ ÚDAJE O VEŘEJNÉ ZAKÁZCE A ZADAVATELI 1.1. Název veřejné zakázky: Vybavení laboratoře

Více

Řasový test ekotoxicity na mikrotitračních destičkách

Řasový test ekotoxicity na mikrotitračních destičkách Řasový test ekotoxicity na mikrotitračních destičkách 1 Účel Řasové testy toxicity slouží k testování možných toxických účinků látek a vzorků na vodní producenty. Zelené řasy patří do skupiny necévnatých

Více

Použití v laboratorních podmínkách

Použití v laboratorních podmínkách Použití v laboratorních podmínkách Obsah Velcorin použití v laboratorních podmínkách Strana 3 5 Úvod Strana 3 Bezpečnostní opatření Strana 3 Pracovní postup (senzoricky) Strana 4 Pracovní postup (mikrobiologicky)

Více

Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Analýza kofeinu v kávě pomocí kapalinové chromatografie

Analýza kofeinu v kávě pomocí kapalinové chromatografie Analýza kofeinu v kávě pomocí kapalinové chromatografie Kofein (obr.1) se jako přírodní alkaloid vyskytuje v mnoha rostlinách (např. fazolích, kakaových bobech, černém čaji apod.) avšak nejvíce je spojován

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

VYHODNOCOVÁNÍ CHROMATOGRAFICKÝCH DAT

VYHODNOCOVÁNÍ CHROMATOGRAFICKÝCH DAT VYHDNCVÁNÍ CHRMATGRAFICKÝCH DAT umístění práce: laboratoř č. S31 vedoucí práce: Ing. J. Krupka 1. Cíl práce: Seznámení s možnostmi, které poskytuje GC chromatografie pro kvantitativní a kvalitativní analýzu.

Více

HM-843 Mixér Návod k obsluze

HM-843 Mixér Návod k obsluze HM-843 Mixér Návod k obsluze Přečtěte jsi tento návod důkladně před použitím a uložte si jej pro použití v budoucnosti. 1 Důležité bezpečnostní pokyny Pro zamezení poruch si tento Návod k použití pečlivě

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů

Více

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné

Více

Rapid-VIDITEST Crypto-Giardia

Rapid-VIDITEST Crypto-Giardia Rapid-VIDITEST Crypto-Giardia (Jednokrokový kazetový test pro in vitro diagnostiku Cryptosporidium parvum a Giardia lamblia) Návod k použití soupravy Výrobce: VIDIA spol. s r.o., Nad Safinou II 365, Vestec,

Více

P Ř Í L O H A K P R O D U K T U

P Ř Í L O H A K P R O D U K T U Immucor Transplant Diagnostics, Inc. 550 West Avenue, Stamford, Connecticut 06902 Spojené státy americké Tel: +1 (203) 328-9500 nebo volání bez poplatku ve Spojených státech amerických, Kanadě a Portoriku

Více

Písemná zpráva zadavatele

Písemná zpráva zadavatele Písemná zpráva zadavatele o veřejné zakázce zadávané dle zákona č. 137/2006 Sb., o veřejných zakázkách, ve znění účinném ke dni zahájení zadávacího řízení (dále jen ZVZ ). Veřejná zakázka Název: Spektrofotometry

Více

vzorek1 0.0033390 0.0047277 0.0062653 0.0077811 0.0090141... vzorek 30 0.0056775 0.0058778 0.0066916 0.0076192 0.0087291

vzorek1 0.0033390 0.0047277 0.0062653 0.0077811 0.0090141... vzorek 30 0.0056775 0.0058778 0.0066916 0.0076192 0.0087291 Vzorová úloha 4.16 Postup vícerozměrné kalibrace Postup vícerozměrné kalibrace ukážeme na úloze C4.10 Vícerozměrný kalibrační model kvality bezolovnatého benzinu. Dle následujících kroků na základě naměřených

Více

Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová. KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI

Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová. KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2009 Metodika byla vypracována pracovníky

Více

MUDr.M.Doleželová 23/10/2010 1

MUDr.M.Doleželová 23/10/2010 1 23/10/2010 1 Historie a představení společnosti Orion Diagnostica Oy je společností náležící k Orion Group, jedné z předních finských společností zabývajících se péčí o zdraví. Orion Diagnostica Oy byla

Více

Úvod. Postup praktického testování

Úvod. Postup praktického testování Testování vzorků kalů odebraných v rámci Doškolovacího semináře Manažerů vzorkování odpadů 21. 10. 2014 v ČOV Liberec, akciové společnosti Severočeské vodovody a kanalizace Úvod Společnost Forsapi, s.r.o.

Více

Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové beranek@lfhk.cuni.cz

Více

Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady

Více

Závěrečná zpráva. Zkoušení způsobilosti v lékařské mikrobiologii (Externí hodnocení kvality) PT#M/32/2010 (č. 677) Identifikace herpetických virů

Závěrečná zpráva. Zkoušení způsobilosti v lékařské mikrobiologii (Externí hodnocení kvality) PT#M/32/2010 (č. 677) Identifikace herpetických virů Státní zdravotní ústav Expertní skupina pro zkoušení způsobilosti Organizátor programů zkoušení způsobilosti akreditovaný ČIA, reg. č. 7001 Šrobárova 48, 100 42 Praha 10 Vinohrady Závěrečná zpráva Zkoušení

Více

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ

Více

Dodatečné informace k zadávacím podmínkám podlimitní veřejné zakázky

Dodatečné informace k zadávacím podmínkám podlimitní veřejné zakázky Krycí list Dodatečné informace k zadávacím podmínkám podlimitní veřejné zakázky Dodání automatického systému pro hemokultivaci bakterií včetně hemokultivačních nádobek VZ ev. č. 60024675 Zadavatel ÚSTAV

Více

METROLOGIE V CHEMII DAVID MILDE, 2013. Metrologie = věda o měření a jeho aplikaci

METROLOGIE V CHEMII DAVID MILDE, 2013. Metrologie = věda o měření a jeho aplikaci METROLOGIE V CHEMII DAVID MILDE, 2013 Metrologie = věda o měření a jeho aplikaci Měření - proces experimentálního získávání jedné nebo více hodnot veličiny (měření = porovnávání, zjišťování počtu entit).

Více

Organizace transfuzní služby. I.Sulovská

Organizace transfuzní služby. I.Sulovská Organizace transfuzní služby I.Sulovská Transfuzní oddělení Výroba transfuzních přípravků (TP) řízena zákony, vyhláškami a metodickými pokyny 2 druhy TO: výrobci TP odběrová střediska Výrobci TP mají uděleno

Více

Analýzy v Sekci aplikovaného výzkumu zelenin a speciálních plodin VÚRV, v.v.i. Marie Nosálková Sandra Benická Přemysl Indrák

Analýzy v Sekci aplikovaného výzkumu zelenin a speciálních plodin VÚRV, v.v.i. Marie Nosálková Sandra Benická Přemysl Indrák Analýzy v Sekci aplikovaného výzkumu zelenin a speciálních plodin VÚRV, v.v.i. Marie Nosálková Sandra Benická Přemysl Indrák Představení Sekce aplikovaného výzkumu VÚRV v.v.i. : vznik v roce 1994 jako

Více

Návod k obsluze SEPREMIUM 10. Separátor kondenzátu 06/14

Návod k obsluze SEPREMIUM 10. Separátor kondenzátu 06/14 Návod k obsluze SEPREMIUM 10 Separátor kondenzátu 06/14 OBECNÁ FUNKCE Zařízení SEPREMIUM 10 slouží k odlučování oleje z kondenzátu, který je extrahován ze systémů na stlačený vzduch. Polypropylen má na

Více

QRM při skladování a distribuci. Září 2015

QRM při skladování a distribuci. Září 2015 QRM při skladování a distribuci Září 2015 Úvod Skladování Výchozích látek a materiálů Meziproduktů Hotových produktů Doprava spojená se skladováním Je součást výroby a podléhá pravidlům GMP Úvod Distribuce

Více

Základy laboratorní techniky

Základy laboratorní techniky Předmět: Biologie ŠVP: prokaryotní organismy, genetika Doporučený věk žáků: 16 18 let Doba trvání: 2 x 45 min. Specifické cíle: naučit studenty pracovat s laboratorními pomůckami a přístroji Seznam pomůcek:

Více

PRO VELMI RYCHLÉ OPRAVY - LZE BROUSIT A PŘETŘÍT VE STEJNÝ DEN

PRO VELMI RYCHLÉ OPRAVY - LZE BROUSIT A PŘETŘÍT VE STEJNÝ DEN PRO VELMI RYCHLÉ OPRAVY - LZE BROUSIT A PŘETŘÍT VE STEJNÝ DEN Vestavěný řídící systém na míchání Rychlá a snadná aplikace Lze použít na všechny druhy dřeva Testováno v extrémních teplotních podmínkách

Více

Validace a verifikace molekulárně biologických metod založených na analýze extrahumánního genomu

Validace a verifikace molekulárně biologických metod založených na analýze extrahumánního genomu Validace a verifikace molekulárně biologických metod založených na analýze extrahumánního genomu Doplněk k doporučení výboru České společnosti klinické biochemie o validaci a verifikaci analytických metod

Více

Molekulová spektroskopie 1. Chemická vazba, UV/VIS

Molekulová spektroskopie 1. Chemická vazba, UV/VIS Molekulová spektroskopie 1 Chemická vazba, UV/VIS 1 Chemická vazba Silová interakce mezi dvěma atomy. Chemické vazby jsou soudržné síly působící mezi jednotlivými atomy nebo ionty v molekulách. Chemická

Více

HISTO SPOT SSO soupravy

HISTO SPOT SSO soupravy Návod k použití HISTO SPOT SSO soupravy testovací soupravy pro tkáňovou typizaci HLA alel molekulárně biologickými metodami IVD katalogové číslo 726010: HISTO SPOT A 4D (96 testů) verze: 11 / 2013 katalogové

Více

Příbalový leták močových proužků DIRUI H-8,10,11. pro analyzátor DIRUI H-500

Příbalový leták močových proužků DIRUI H-8,10,11. pro analyzátor DIRUI H-500 Příbalový leták močových proužků DIRUI H-8,10,11 pro analyzátor DIRUI H-500 Rev: 01/2009 MEDESA s.r.o. Na Vyšehradě 1092, 572 01 POLIČKA Říčany u Prahy, 1.SčV Kolovratská 1476, 251 01 IČO: 64254577 DIČ:

Více

Neodolatelný SELECTAN ORAL SELECTAN ORAL. 23 mg/ml koncentrát k použití v pitné vodě. Vysoký příjem, nejlepší léčba.

Neodolatelný SELECTAN ORAL SELECTAN ORAL. 23 mg/ml koncentrát k použití v pitné vodě. Vysoký příjem, nejlepší léčba. SELECTAN ORAL 23 mg/ml koncentrát k použití v pitné vodě Neodolatelný Vysoký příjem, nejlepší léčba. SELECTAN ORAL představuje léčivý roztok v pitné vodě řešící opakující se infekce u prasat. : nová molekula

Více

Digitální tabule. Průvodce pro bezpečnost výrobku Včetně pokynů k montáži

Digitální tabule. Průvodce pro bezpečnost výrobku Včetně pokynů k montáži Digitální tabule Průvodce pro bezpečnost výrobku Včetně pokynů k montáži Logo 3M a značka 3M jsou obchodní známky 3M Company. Prosinec 2005 78-6970-9435-3 Copyright 2005, 3M Company. Všechna práva vyhrazena.

Více

Metodika detekce vnitřního genu hrachu setého lektinu pomocí PCR

Metodika detekce vnitřního genu hrachu setého lektinu pomocí PCR Aleš Vráblík, Jan Hodek, Jaroslava Ovesná Metodika detekce vnitřního genu hrachu setého lektinu pomocí PCR METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2012 Metodika byla vypracována pracovníky

Více

Biogenníaminy. pro HPLC. Dny kontroly kvality a speciálních metod HPLC Bio-Rad Lednice 8.-9. Listopadu, 2012

Biogenníaminy. pro HPLC. Dny kontroly kvality a speciálních metod HPLC Bio-Rad Lednice 8.-9. Listopadu, 2012 Bio-Rad Laboratories Munich Manufacturing Biogenníaminy pro HPLC Dny kontroly kvality a speciálních metod HPLC Bio-Rad Lednice 8.-9. Listopadu, 2012 Bio-Rad Laboratories München, Germany Biogenníaminy

Více

Médium MarrowGrow. Informace o produktu. Médium MarrowGrow MGM-100 100 ml. Při práci dodržujte zásady práce s biohazardním materiálem

Médium MarrowGrow. Informace o produktu. Médium MarrowGrow MGM-100 100 ml. Při práci dodržujte zásady práce s biohazardním materiálem Médium MarrowGrow Informace o produktu Médium MarrowGrow MGM-100 100 ml UPOZORNĚNÍ: Při práci dodržujte zásady práce s biohazardním materiálem CytoGen GmbH, produktová informace verze 1.2 www.cytogen.info

Více

Nejistota měř. ěření, návaznost a kontrola kvality. Miroslav Janošík

Nejistota měř. ěření, návaznost a kontrola kvality. Miroslav Janošík Nejistota měř ěření, návaznost a kontrola kvality Miroslav Janošík Obsah Referenční materiály Návaznost referenčních materiálů Nejistota Kontrola kvality Westgardova pravidla Unity Referenční materiál

Více

Instalace. Bezdrátový přístupový bod NETGEAR 802.11ac WAC120. Obsah balení. NETGEAR, Inc. 350 East Plumeria Drive San Jose, CA 95134 USA.

Instalace. Bezdrátový přístupový bod NETGEAR 802.11ac WAC120. Obsah balení. NETGEAR, Inc. 350 East Plumeria Drive San Jose, CA 95134 USA. Ochranné známky NETGEAR, logo NETGEAR a Connect with Innovation jsou obchodní známky nebo registrované obchodní známky společnosti NETGEAR, Inc. v USA a jiných zemích. Informace zde uvedené podléhají změnám

Více

Využití technologie Ink-jet printing pro přípravu mikro a nanostruktur II.

Využití technologie Ink-jet printing pro přípravu mikro a nanostruktur II. Ústav fyziky a měřicí techniky Vysoká škola chemicko-technologická v Praze Využití technologie Ink-jet printing pro přípravu mikro a nanostruktur II. Výrobci, specializované technologie a aplikace Obsah

Více

Derivační spektrofotometrie a rozklad absorpčního spektra

Derivační spektrofotometrie a rozklad absorpčního spektra Derivační spektrofotometrie a rozklad absorpčního spektra Teorie: Derivační spektrofotometrie, využívající derivace absorpční křivky, je obecně používanou metodou pro zvýraznění detailů průběhu záznamu,

Více

Detektor hořlavých plynů GS 120

Detektor hořlavých plynů GS 120 Detektor hořlavých plynů GS 120 - Instalační příručka - verze 1.0 adresa: ADDAT s.r.o. Májová 1126 463 11 Liberec 30 telefon: fax: http: e-mail: 485 102 271 485 114 761 www.addat.cz addat@addat.cz Obsah:

Více

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR Mikrobiologický ústav AV ČR Příloha 6 Havarijní plán 1/5 Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR a) Adresa pracoviště Mikrobiologický ústav AV ČR

Více

Příloha č. 2 k rozhodnutí o prodloužení registrace sp.zn.:sukls119389/2009

Příloha č. 2 k rozhodnutí o prodloužení registrace sp.zn.:sukls119389/2009 Příloha č. 2 k rozhodnutí o prodloužení registrace sp.zn.:sukls119389/2009 PŘÍBALOVÁ INFORMACE: INFORMACE PRO UŽIVATELE LEUCO-SCINTkit Kit pro přípravu radiofarmaka. Léčivá látka: Exametazimum (HM-PAO)

Více

MONO - Rychlý test na mononukleózu (plná krev/sérum/plazma) Příbalová informace

MONO - Rychlý test na mononukleózu (plná krev/sérum/plazma) Příbalová informace C 35 MONO - Rychlý test na mononukleózu (plná krev/sérum/plazma) Příbalová informace Rychlý test pro diagnostiku infekční mononukleózy (IM), kvalitativní detekce heterofilních protilátek IM v plné krvi,

Více

ORGANICKÁ CHEMIE Laboratorní práce č. 9

ORGANICKÁ CHEMIE Laboratorní práce č. 9 Téma: Bílkoviny, enzymy ORGANICKÁ CHEMIE Laboratorní práce č. 9 Úkol 1: Dokažte, že mléko obsahuje bílkovinu kasein. Kasein je hlavní bílkovinou obsaženou v savčím mléce. Výroba řady mléčných výrobků je

Více

P Ř Í L O H A K P R O D U K T U

P Ř Í L O H A K P R O D U K T U Immucor Transplant Diagnostics, Inc. 550 West Avenue, Stamford, Connecticut 06902 Spojené státy americké Tel: +1 (203) 328-9500 nebo volání bez poplatku ve Spojených státech amerických, Kanadě a Portoriku

Více

Experiment C-16 DESTILACE 2

Experiment C-16 DESTILACE 2 Experiment C-16 DESTILACE 2 CÍL EXPERIMENTU Získání informací o třech klasických skupenstvích látek, změnách skupenství (jedné z fázových změn), křivkách ohřevu a ochlazování a destilační křivce. Prozkoumání

Více

FLUORESCENČNÍ MIKROSKOP

FLUORESCENČNÍ MIKROSKOP FLUORESCENČNÍ MIKROSKOP na gymnáziu Pierra de Coubertina v Táboře Pavla Trčková, kabinet Biologie, GPdC Tábor Co je fluorescence Fluorescence je jev spočívající v tom, že některé látky (fluorofory) po

Více

Thermo Scientific TCAutomation Řešení laboratorní automatizace. Adaptabilní automatizace. ke zrychlení laboratorních procesů

Thermo Scientific TCAutomation Řešení laboratorní automatizace. Adaptabilní automatizace. ke zrychlení laboratorních procesů Thermo Scientific TCAutomation Řešení laboratorní automatizace Adaptabilní automatizace ke zrychlení laboratorních procesů Efektivita a konzistence při manipulaci se vzorky Zvýšení efektivity a bezpečnosti

Více

BEZPEČNOSTNÍ LIST NYCOCARD D-DIMER WASHING SOLUTION. 1. POPIS PRODUKTU A VÝROBCE Název produktu: NycoCard D-Dimer Washing Solution Aplikace:

BEZPEČNOSTNÍ LIST NYCOCARD D-DIMER WASHING SOLUTION. 1. POPIS PRODUKTU A VÝROBCE Název produktu: NycoCard D-Dimer Washing Solution Aplikace: BEZPEČNOSTNÍ LIST NYCOCARD D-DIMER WASHING SOLUTION 1. POPIS PRODUKTU A VÝROBCE Název produktu: NycoCard D-Dimer Washing Solution Aplikace: Určeno k užití s sety NycoCard D-Dimer. NycoCard D-Dimer Single

Více

Měření koncentrace roztoku absorpčním spektrofotometrem

Měření koncentrace roztoku absorpčním spektrofotometrem Měření koncentrace roztoku absorpčním spektrofotometrem Teoretický úvod Absorpční spektrofotometrie je metoda stanovení koncentrace disperzního podílu analytické disperze, založená na měření absorpce světla.

Více

Návod k obsluze a údržbě

Návod k obsluze a údržbě ZÁRUČNÍ LIST Záruční a pozáruční servis zajišťuje: ATV Moravia s. r. o. Kšírova 45, 619 00 Brno, Česká republika tel/fax.: 541 249 327 email: opravy@atv-servis.cz www.atv-servis.cz Záruku lze uplatnit

Více

Analyzátory moči a močového sedimentu

Analyzátory moči a močového sedimentu KATALOG 2013 Dirui Industrial Co., Ltd Analyzátory moči a močového sedimentu Katalog produktů firmy DIRUI Analyzátory moči a močového sedimentu Analyzátory přístrojové vybavení Název Popis H-100 - analyzátor

Více

TOP PRODUKTY PRO LABORATOŘ

TOP PRODUKTY PRO LABORATOŘ NO VÉ P RODUK TY TOP PRODUKTY PRO LABORATOŘ LABORATORNÍ PŘÍSTROJE SPOTŘEBNÍ LABORATORNÍ MATERIÁL Dialab spol.s r.o. je členem asociace CZEDMA ČESKÁ SPOLEČNOST KLINICKÉ BIOCHEMIE Česká lékařská společnost

Více

P ehled výsledk z Referen ní laborato e

P ehled výsledk z Referen ní laborato e P ehled výsledk z Referen ní laborato e 1,3 Hajdúch M, 1,3 Trojanec R, 2,3 Kolá Z, 1,3 Bouchalová K, 2,3 Sedláková E. 1 Laborato experimentální medicíny p i D tské klinice LF UP a FN Olomouc 2 Laborato

Více

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Brno, 17.5.2011 Izidor (Easy Door) Osnova přednášky 1. Proč nás rakovina tolik zajímá?

Více

Standardizace imunohistologického stanovení steroidních receptorů mezi pracovišti - studie proveditelnosti.

Standardizace imunohistologického stanovení steroidních receptorů mezi pracovišti - studie proveditelnosti. Standardizace imunohistologického stanovení steroidních receptorů mezi pracovišti - studie proveditelnosti. Fabian P., Nenutil R., Benčík V., Bobot L., Jandáková E., Kolář Z., Pavlovský Z., Ryška A., Veselý

Více

XB-523 Odšťavovač citrusových plodů Návod k obsluze

XB-523 Odšťavovač citrusových plodů Návod k obsluze XB-523 Odšťavovač citrusových plodů Návod k obsluze Přečtěte jsi tento návod důkladně před použitím a uložte si jej pro použití v budoucnosti. 1 Důležité bezpečnostní pokyny - Pro zamezení poruch si tento

Více

PROTOKOL WESTERN BLOT

PROTOKOL WESTERN BLOT WESTERN BLOT 1. PŘÍPRAVA ELEKTROFORETICKÉ APARATURY Saponátem a vodou se důkladně umyjí skla, plastové vložky a hřebínek, poté se důkladně opláchnou deionizovanou/destilovanou vodou a etanolem a nechají

Více

Rapid-VIDITEST Lactoferrin

Rapid-VIDITEST Lactoferrin Rapid-VIDITEST Lactoferrin Jednokrokový kazetový test pro detekci laktoferinu ve stolici Návod k použití soupravy Výrobce: VIDIA spol. s r.o., Nad Safinou II 365, Vestec, 252 42 Jesenice u Prahy, Tel:

Více

FLUORIMETRICKÉ STANOVENÍ FLUORESCEINU

FLUORIMETRICKÉ STANOVENÍ FLUORESCEINU FLUORIMETRICKÉ STANOVENÍ FLUORESCEINU návod vznikl jako součást bakalářské práce Martiny Vidrmanové Fluorimetrie s využitím spektrofotometru SpectroVis Plus firmy Vernier (http://is.muni.cz/th/268973/prif_b/bakalarska_prace.pdf)

Více

Bezdrátová termostatická hlavice

Bezdrátová termostatická hlavice Bezdrátová termostatická hlavice Model: TRV10RF INSTALAČNÍ MANUÁL Obsah krabice Obsah balení Ikony použité v tomto návodě: Bezpečnostní pokyny Důležitá informace Tip Obsah : Obsah balení Úvod Shoda výrobku

Více

Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty

Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty J.Berkovcová, M.Dziechciarková, M.Staňková, A.Janošťáková, D.Dvořáková, M.Hajdúch Laboratoř

Více

Pouze vyškolený a kvalifikovaný laboratorní personál. Před použitím testu si pozorně přečtěte tyto instrukce.

Pouze vyškolený a kvalifikovaný laboratorní personál. Před použitím testu si pozorně přečtěte tyto instrukce. Návod k použití digene HC2 CT-ID DNA Test Stanovení nukleové kyseliny in vitro hybridizačním testem s amplifikací signálu na mikrodestičce s použitím chemiluminiscence pro kvalitativní detekci DNA Chlamydia

Více