Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Rozměr: px
Začít zobrazení ze stránky:

Download "Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/"

Transkript

1 Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/

2 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární patologie LF UP a Ústav klinické a molekulární patologie FN Olomouc

3 Obsah přednášky Teoretický úvod Principy metod využívajících hybridizaci Příklady využití těchto metod v praxi

4 Základní struktura DNA spojení (vazba) 2 navzájem komplementárních jednořetězcových molekul DNA vodíkovými vazbami, vzniká dvouřetězcová molekula DNA - dvoušroubovice DNA A-T a C-G RNA A-U a C-G

5 Pojem hybridizace Za vyšší teploty (specifická pro konkrétní složení DNA teplota tání Tm) probíhá denaturace DNA, zanikají vodíkové vazby ve dvoušroubovici a vznikají jednořetězcové DNA molekuly Při postupném ochlazování dochází k renaturaci DNA, tzn. znovuobnovení dvoušroubovice Hybridizace = proces spojování navzájem komplementárních jednořetězcových molekul DNA za vzniku hybridních dvouřetězcových molekul DNA podmínkou je úplná nebo částečná komplementarita bází nukleových kyselin

6 Pojem hybridizace DNA - A DNA - B Denaturace, zvýšená teplota Kombinování řetězců DNA Stupeň hybridizace Snižování teploty, renaturace Kompletní hybridizace Částečná hybridizace Nulová hybridizace

7 Využití hybridizace v diagnostice Detekce přítomnosti hledané DNA (RNA) ve vzorku (např. detekce DNA Mycobacteria tuberculosis), vyšetření genové exprese Detekce změn v DNA sekvenci (genetické mutace, strukturní a početní změny chromozomů) dsdna ssdna (doublestranded) dvouřetězcová DNA (singlestranded) jednořetězcová DNA

8 DNA (RNA) sonda Uměle připravená jednořetězcová DNA nebo RNA o délce bází (syntéza, klonování do bakteriálních vektorů) Označení sondy na jejím konci nebo po celé délce - radioaktivní - chemické - fluorescenční

9 Podmínky hybridizace Optimální teplota hybridizace Délka molekul DNA (RNA) použitých k hybridizaci, jejich koncentrace v reakční směsi Stupeň komplementarity bází Koncentrace solí a ph v reakční směsi, atd. přísné x méně přísné podmínky (potlačení nespecifických vazeb) Hybridizace A. s NK přenesenými na membrány B. s NK přímo v původních preparátech buněk a tkání - in vitro hybridizace C. s NK (nukleovou kyselinou) v roztoku

10 Hybridizace na membránách Testovaná NK je před hybridizací přenesena na membránu (nitrocelulóza, nylon) 1. Tečková hybridizace - přenáší se NK obsažená v roztoku

11 Hybridizace na membránách 2. Hybridizace kolonií a plak - přenáší se NK bezprostředně uvolněná z bakteriálních kolonií nebo plak bakteriofágů vyrostlých na živých médiích (agar) - mikrobiologie

12 Hybridizace na membránách membrána řetězce NK radioaktivně značená sonda navázaná sonda kolonie nebo plaky vyrostlé na plotně lýza buněk nebo fágů, denaturace NK v alkalickém prostředí hledaná genetická sekvence mem brán a odpovídající kolonie autoradiografie

13 Hybridizace na membránách 3. Southernův přenos (DNA) - štěpení DNA restriktázou na fragmenty - jejich rozdělení podle molekulární hmotnosti (velikosti) gelovou elektroforézou v el. poli (polyakrylamidový nebo agarózový gel) - přenos DNA z gelu na membránu (kapilární, elektroforetický nebo vakuový přenos) - hybridizace Nothernův přenos (RNA)

14 Hybridizace na membránách Southernův přenos restriktáza DNA gelová elektroforéza membrána sonda hybridizace autoradiografie

15 Hybridizace na membránách - DNA molekuly putují při gelové elektroforéze ke kladně nabité elektrodě DNA marker, určení velikosti DNA

16 Hybridizace na membránách - Získáme informaci nejen o přítomnosti, ale i o velikosti NK, která hybridizovala Southernův přenos ukázka autoradiogramu

17 In vitro hybridizace detekce sekvence DNA přímo v buňkách cytologických nebo histologických preparátů detekce přítomnosti sekvence DNA, její přesná lokalizace, možná kvantifikace signálu dnes převážně fluorescenční značení sond FISH - fluorescenční in situ hybridizace (základní metoda cytogenetiky) vizualizace pod fluorescenčním mikroskopem možnost použití několika sond vedle sebe

18 In vitro hybridizace

19 In vitro hybridizace Metoda FISH Chromozomy V jádře Testovaný preparát FISH sonda Fluorescenční signál Hybridizující FISH sonda

20 Příklad FISH vyšetření v naší laboratoři Prediktivní diagnostika u onkolog. pacientů Vyšetření onkogenu HER2 (transmembránový buněčný receptor) u pacientek s karcinomem prsu v případě zmnožení receptorů (pozitivita u 10-34% pacientů), pacientka dostává cílenou léčbu monoklonální protilátka Herceptin, výsledkem je inhibice růstu nádorových buněk

21 Příklad FISH vyšetření v naší laboratoři

22 Příklad FISH vyšetření v naší laboratoři - zelená sonda pro centromerickou oblast chromozomu - červená sonda pro gen HER2 Amplifikace HER2 genu

23 Příklad FISH vyšetření v naší laboratoři centr omer a gen HER2 centromera

24 Příklad FISH vyšetření v naší laboratoři Vyšetření onkogenu HER2 - v současné době se ve světě testuje a validuje možnost detekce HER2 pomocí RNA in situ hybridizace (detekce mrna HER2) - podmínkou je výborná kvalita vyšetřovaného materiálu, relativně nová metoda IHC x amplifikace DNA x m RNA

25 In vitro hybridizace Modifikováním FISH metody vznikly nové metodiky umožňující analyzovat celý genom v jednom hybridizačním pokusu Lze snadno hledat změny v počtu chromozomů, genů a DNA sekvencí (vrozené chromozomově podmíněné syndromy, nádorové buňky) - CGH metoda (komparativní genomická hybridizace) - SKY metoda (spektrální karyotypování)

26 In vitro hybridizace CGH (komparativní genomová hybridizace) - umožňuje detekovat relativní počet kopií jednotlivých sekvencí DNA mezi testovaným a tzv. normálním genomem - lze tak zjistit zmnožení DNA (amplifikace) nebo naopak ztrátu sekvencí (deleci), podmínkou je, aby byly tyto klonální změny zastoupeny alespoň v 50 % testovaných buněk

27 In vitro hybridizace Princip CGH metody testovaná DNA fluorescein rhodamid normální DNA metafázové chromozomy hybridizace oranžová-balancovaná DNA červená-ztráta DNA zelená-zisk DNA

28 Příklad CGH typizace In vitro hybridizace

29 In vitro hybridizace SKY metoda (spektrální karyotypování) - barevné rozlišení jednotlivých chromozomů založené na současné hybridizaci chromozomů (mitóza) s 24 celochromozomovými sondami značenými v různých kombinacích několika fluorescenčními barvami - screnningová metoda, identifikace komplexních chromozomových abnormalit, zejména translokací

30 In vitro hybridizace Příklad SKY karyotypizace

31 Hybridizace v roztoku PCR reakce polymerázová řetězová reakce (polymerase chain reaction) - zmnožování (amplifikace) vybrané sekvence dvouřetězcové DNA (stačí 1 molekula DNA) - sekvence DNA je vymezena tzv. primery (umělé nukleotidy bází) - používá se speciální termostabilní Taq polymeráza základní 3. kroky reakce, obvykle cca 30 cyklů 1. denaturace dsdna (94 C) 2. nasedání (hybridizace) primerů (30-65 C) 3. syntéza DNA (65-75 C)

32 Hybridizace v roztoku PCR reakce denaturace nasedání primerů syntéza DNA (Taq polymeráza, volné nukleotidy) namnožený úsek DNA

33 PCR reakce Hybridizace v roztoku cílový úsek Exponenciální amplifikace

34 Hybridizace v roztoku PCR reakce - zařízení hybridizér

35 PCR reakce Hybridizace v roztoku - detekce amplikonu gelovou elektroforézou, stanovením sekvence DNA nebo pomocí hybridizace se značenou sondou (Southernův přenos nebo real time PCR reakce) ko

36 Hybridizace v roztoku Real time PCR reakce (reakce PCR sledovaná v reálném čase) fluorescenční sonda nasedající na postupně přibývající amplikon možnost kvantifikace počtu hledané DNA sekvence ve vzorku

37 Hybridizace v roztoku PCR metoda má mnoho modifikací - In situ PCR reakce reakce probíhá přímo v buňkách preparátů, fluorescenční vizualizace amplikonu - Reverzní PCR reakce (RT-PCR) určená k amplifikaci molekul RNA; vyizolovaná RNA se nejprve přepíše za pomocí enzymu reverzní transkriptázy do cdna (copy DNA), pak probíhá standartní PCR reakce

38 Hybridizace v roztoku Využití PCR reakce - identifikace bakteriálních a virových patogenů (v naší laboratoři je zavedena metoda detekce mykobakterií tuberkolózy v DNA vyizolované z parafinových bločků neživé bakterie) - detekce mutací - určení typu nádorů (B nebo T lymfom) - detekce přítomnosti nádorových buněk ve vzorcích krve, kostní dřeně nebo v sentinelových uzlinách (hledají se typické znaky epiteliální tkáně na pozadí neepiteliální tkáně) minimální reziduální choroba

39 Shrnutí Hybridizační metody mají dnes už nezastupitelnou úlohu v získávání poznatků o vyšetřovaném materiálu pacienta Vždy je nutná kooperace lékař molekulární biolog Výhody vysoká citlivost a specifita Nevýhody dostatečně kvalitní materiál, speciální vybavení, časová náročnost, cena

40 Děkuju za pozornost

Hybridizace nukleových kyselin

Hybridizace nukleových kyselin Hybridizace nukleových kyselin Tvorba dvouřetězcových hybridů za dvou jednořetězcových a komplementárních molekul Založena na schopnosti denaturace a renaturace DNA. Denaturace DNA oddělení komplementárních

Více

Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka

Více

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA Cytogenetika telomera chromosom jádro centomera telomera buňka histony páry bazí dvoušroubovice DNA Typy chromosomů Karyotyp člověka 46 chromosomů 22 párů autosomů (1-22 od největšího po nejmenší) 1 pár

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby

Více

Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace

Více

Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi

Více

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Mgr. Klára Vilimovská Dědečková, Ph.D. Synlab genetics s.r.o. Molekulární

Více

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,

Více

NÁVAZNOST METOD KLASICKÉ A MOLEKULÁRNÍ CYTOGENETIKY. Vytvořilo Oddělení lékařské genetiky FN Brno

NÁVAZNOST METOD KLASICKÉ A MOLEKULÁRNÍ CYTOGENETIKY. Vytvořilo Oddělení lékařské genetiky FN Brno NÁVAZNOST METOD KLASICKÉ A MOLEKULÁRNÍ CYTOGENETIKY TYPY CHROMOSOMOVÝCH ABERACÍ, kterých se týká vyšetření metodami klasické i molekulární cytogenetiky - VYŠETŘENÍ VROZENÝCH CHROMOSOMOVÝCH ABERACÍ prenatální

Více

Pokročilé biofyzikální metody v experimentální biologii

Pokročilé biofyzikální metody v experimentální biologii Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 1/1 Proč biofyzikální metody? Biofyzikální metody využívají fyzikální principy ke studiu biologických systémů Poskytují kvantitativní

Více

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky.

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální

Více

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční

Více

Molekulární genetika

Molekulární genetika Molekulární genetika Genetické inženýrství Technologie rekombinantní DNA Vektor Genomová DNA Štěpení RE Rozštěpení stejnou RE, lepivé konce Ligace Transformace Bakteriální chromozóm Rekombinantní vektor

Více

Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin

Více

Metody studia exprese mrna. jádro a genová exprese 2007

Metody studia exprese mrna. jádro a genová exprese 2007 Metody studia exprese mrna Buněčné jádro a genová exprese 2007 Aktivita genu je primárn ě vyjád ř ena jeho transkripcí-prvním krokem vedoucím k syntéze kódovaného proteinu. Cíle metod Ur č ení mno ž ství

Více

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování

Více

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné:

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné: Výběrové otázky: 1. Součástí všech prokaryotických buněk je: a) DNA, plazmidy b) plazmidy, mitochondrie c) plazmidy, ribozomy d) mitochondrie, endoplazmatické retikulum 2. Z následujících tvrzení, týkajících

Více

Akreditovaný subjekt podle ČSN EN ISO 15189:2007: CGB laboratoř a.s Kořenského 10, Ostrava, Vítkovice

Akreditovaný subjekt podle ČSN EN ISO 15189:2007: CGB laboratoř a.s Kořenského 10, Ostrava, Vítkovice List 1 z 6 Pracoviště zdravotnické laboratoře: 1., Laboratoř klinické patologie a cytologie Kořenského 10, 70300 Ostrava Vítkovice Postupy vyšetření: 1 Histologická vyšetření tkání 2 Peroperační histologická

Více

Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní

Více

Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové beranek@lfhk.cuni.cz

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,

Více

Izolace nukleových kyselin

Izolace nukleových kyselin Izolace nukleových kyselin Požadavky na izolaci nukleových kyselin V nativním stavu z přirozeného materiálu v dostatečném množství požadované čistotě. Nukleové kyseliny je třeba zbavit všech látek, které

Více

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR)

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek

Více

Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2 http://www.paternityexperts.com/basicgenetics.html

Více

Buněčné kultury Primární kultury

Buněčné kultury Primární kultury Buněčné kultury Primární kultury - odvozené přímo z excise tkáně buněčné linie z různých organizmů, tkání explantované kultury jednobuněčné suspense lze je udržovat jen po omezenou dobu během kultivace

Více

Polymorfizmy detekované. polymorfizmů (Single Nucleotide

Polymorfizmy detekované. polymorfizmů (Single Nucleotide Polymorfizmy detekované speciálními metodami s vysokou rozlišovací schopností Stanovení jednonukleotidových polymorfizmů (Single Nucleotide Polymorphisms - SNPs) Příklad jednonukleotidových polymorfizmů

Více

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce

Více

ZÍSKANÉ CHROMOSOMOVÉ ABERACE. Vytvořilo Oddělení lékařské genetiky FN Brno

ZÍSKANÉ CHROMOSOMOVÉ ABERACE. Vytvořilo Oddělení lékařské genetiky FN Brno ZÍSKANÉ CHROMOSOMOVÉ ABERACE CHROMOSOMOVÉ ABERACE (CHA) Cílem cytogenetického vyšetření je zjištění přítomnosti / nepřítomnosti chromosomových aberací (patologických chromosomových změn) TYPY ZÍSKANÝCH

Více

Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014

Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014 Molekulárně biologické metody v mikrobiologii Mgr. Martina Sittová Jaro 2014 Harmonogram 1. den Izolace DNA 2. den Měření koncentrace DNA spektrofotometricky, real-time PCR 3. den Elektroforéza Molekulární

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

Metody detekce poškození DNA

Metody detekce poškození DNA STABILITA GENOMU II. Metody detekce poškození DNA Metody detekce poškození DNA Možnosti stanovení: 1. poškození DNA per se nebo 2. jeho následky mutace genů a mutace chromosomů 1. Detekce poškození DNA

Více

Příprava rekombinantních molekul pro diagnostické účely

Příprava rekombinantních molekul pro diagnostické účely 1 Příprava rekombinantních molekul pro diagnostické účely doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 2 Obsah přednášky 1) Pojem rekombinantní DNA 2) Historické milníky

Více

1.12.2009. Buněčné kultury. Kontinuální kultury

1.12.2009. Buněčné kultury. Kontinuální kultury Primární kultury - odvozené přímo z excise tkáně buněčné linie z různých organizmů, tkání explantované kultury jednobuněčné suspense lze je udržovat jen po omezenou dobu během kultivace ztrácejí diferenciační

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin

Více

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková Diagnostika retrovirů Lentiviry - HIV Vladislava Růžičková VI. Třída RNA-viry se zpětnou transkriptázou RT Čeleď: Retroviridae (hostitelé: Obratlovci) Rody: Alpharetrovirus Betaretrovirus Gammaretrovirus

Více

Izolace RNA. doc. RNDr. Jan Vondráček, PhD..

Izolace RNA. doc. RNDr. Jan Vondráček, PhD.. Izolace RNA doc. RNDr. Jan Vondráček, PhD.. Metodiky izolace RNA celková buněčná RNA ( total RNA) zahrnuje řadu typů RNA, které se mohou lišit svými fyzikálněchemickými vlastnostmi a tedy i nároky na jejich

Více

Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika

Více

VÝZNAM NĚKTERÝCH FAKTORŮ PREANALYTICKÉ FÁZE V MOLEKULÁRNÍ BIOLOGII

VÝZNAM NĚKTERÝCH FAKTORŮ PREANALYTICKÉ FÁZE V MOLEKULÁRNÍ BIOLOGII VÝZNAM NĚKTERÝCH FAKTORŮ PREANALYTICKÉ FÁZE V MOLEKULÁRNÍ BIOLOGII Plíšková L., Hrochová K., Kutová R. Ústav klinické biochemie a diagnostiky FN Hradec Králové PREANALYTICKÁ FÁZE V MOLEKULÁRNÍ BIOLOGII

Více

Microfluidic systems, advantages and applications Monika Kremplová, Mgr.

Microfluidic systems, advantages and applications Monika Kremplová, Mgr. Název: Školitel: Microfluidic systems, advantages and applications Monika Kremplová, Mgr. Datum: 21. 6. 2013 Reg.č.projektu: CZ.1.07/2.3.00/20.0148 Název projektu: Mezinárodní spolupráce v oblasti "in

Více

P ehled výsledk z Referen ní laborato e

P ehled výsledk z Referen ní laborato e P ehled výsledk z Referen ní laborato e 1,3 Hajdúch M, 1,3 Trojanec R, 2,3 Kolá Z, 1,3 Bouchalová K, 2,3 Sedláková E. 1 Laborato experimentální medicíny p i D tské klinice LF UP a FN Olomouc 2 Laborato

Více

Buněčné kultury. Kontinuální kultury

Buněčné kultury. Kontinuální kultury Buněčné kultury Primární kultury - odvozené přímo z excise tkáně buněčné linie z různých organizmů, tkání explantované kultury jednobuněčné suspense lze je udržovat jen po omezenou dobu během kultivace

Více

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace

Více

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Modifikace PCR, sekvenování Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Multiplex PCR Reakční směs obsahuje ne jeden, ale několik párů primerů rozpoznávajících různé cílové sekvence

Více

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Zavedení PCR v roce 1983 (Kary B. Mullis) Nobelova cena 1993 Metodika

Více

DY D NE N X Hana Vlastníková

DY D NE N X Hana Vlastníková DYNEX Hana Vlastníková Molekulární biologie: Vybavení laboratoře na klíč Přístrojová technika Kompatibilní diagnostické soupravy Profesionální přístup SOP Technická podpora Servis Přístrojové vybavení:

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Analýza transkriptomu Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s moderními metodami komplexní

Více

Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 4. Metody molekulární biologie I Izolace DNA a RNA Specifické postupy pro baktérie, kvasinky, rostlinné a živočišné tkáně U RNA nutno zabránit kontaminaci

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní

Více

Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová

Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Centrum nádorové cytogenetiky Ústav klinické biochemie a laboratorní diagnostiky VFN a 1. LF UK v Praze Klinický význam cytogenetických

Více

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:

Více

První testový úkol aminokyseliny a jejich vlastnosti

První testový úkol aminokyseliny a jejich vlastnosti První testový úkol aminokyseliny a jejich vlastnosti Vysvětlete co znamená pojem α-aminokyselina Jaký je rozdíl mezi D a L řadou aminokyselin Kolik je základních stavebních aminokyselin a z čeho jsou odvozeny

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží

Více

Klonování gen a genové inženýrství

Klonování gen a genové inženýrství Klonování gen a genové inženýrství Genové inženýrství užite né termíny Rekombinantní DNA = DNA, ve které se nachází geny nejmén ze dvou zdroj, asto ze dvou zných druh organism Biotechnologie = manipulace

Více

Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

MIKROBIOLOGIE V BIOTECHNOLOGII

MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Využití živých organismů pro uskutečňování definovaných chemických procesů pro průmyslové nebo komerční aplikace Organismus je geneticky upraven metodami genetického

Více

BUNĚČNÁ TRANSFORMACE A NÁDOROVÉ BUŇKY

BUNĚČNÁ TRANSFORMACE A NÁDOROVÉ BUŇKY BUNĚČNÁ TRANSFORMACE A NÁDOROVÉ BUŇKY 1 VÝZNAM BUNĚČNÉ TRANSFORMACE V MEDICÍNĚ Příklad: Buněčná transformace: postupná kumulace genetických změn Nádorové onemocnění: kolorektální karcinom 2 3 BUNĚČNÁ TRANSFORMACE

Více

J09 Průkaz nukleové kyseliny

J09 Průkaz nukleové kyseliny J09 Průkaz nukleové kyseliny VLLM0421c (jaro 2016) Osnova využití a metody průkazu NK PCR a její modifikace proces prokazování specifické sekvence NK 2/55 Přímé vs. nepřímé metody přímé hledáme mikroba,

Více

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI INDUKOVANÉ PŮSOBENÍM ORGANICKÝCH LÁTEK Z PRACHOVÝCH ČÁSTIC V OVZDUŠÍ Kateřina Hanzalová Oddělení genetické ekotoxikologie Ústav experimentální medicíny AV ČR v.v.i.

Více

Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie

Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie 1) Zadávání témat dle studovaného oboru 2) Přehled řešených témat v minulosti 3) 4) Přehled externích školících pracovišť Zaměření

Více

Mikrobiologické diagnostické metody. MUDr. Pavel Čermák, CSc.

Mikrobiologické diagnostické metody. MUDr. Pavel Čermák, CSc. Mikrobiologické diagnostické metody MUDr. Pavel Čermák, CSc. Princip identifikace soubor ZNAKŮ s rozdílnou separační hodnotou S HODNOTA S: S 1 S 2 S 3 Základní problémy Minimum morfologických znaků Podobná

Více

Nukleové kyseliny (NK)

Nukleové kyseliny (NK) Eva Roubalová B10 2007/2008 Předmět: - Obecná biologie - Biologie a genetika Zdroj velké části materiálů: učebnice Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava

Více

TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně

Více

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie.

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. 4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. Od genu k proteinu - centrální dogma biologie Geny jsou zakódovány v DNA - Jakým způsobem? - Jak se projevují? Již v roce 1902

Více

Metody testování humorální imunity

Metody testování humorální imunity Metody testování humorální imunity Co je to humorální imunita? Humorální = látková Buněčné produkty Nespecifická imunita příklady:» Lysozym v slinách, slzách» Sérové proteiny (proteiny akutní fáze)» Komplementový

Více

Aplikace molekulárně biologických postupů v časné detekci sepse

Aplikace molekulárně biologických postupů v časné detekci sepse Aplikace molekulárně biologických postupů v časné detekci sepse Mgr. Jana Ždychová, Ph.D. IKEM PLM - LLG Sepse je častou příčinou úmrtí během hospitalizace. Včasné nasazení odpovídající ATB terapie je

Více

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11.

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. Personalizovaná medicína Roche v oblasti onkologie Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. listopadu 2013 Personalizovaná vs standardní péče Cílená léčba Spojení diagnostiky

Více

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou

Více

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést

Více

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Inovace laboratorních úloh genetických předmětů metodikami pracujícími s ribonukleovými kyselinami pšenice Metodické návody pro laboratorní

Více

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ

Více

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Dle čl. 7 odst. 2 Směrnice děkana pro realizaci bakalářských

Více

Mikročipy v mikrobiologii

Mikročipy v mikrobiologii Mikročipy v mikrobiologii doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 Obsah přednášky 1) Charakteristika biočipů, DNA microarrays a DNA chip 2) Výroba čipů, charakteristika

Více

Environmentální aplikace molekulární biologie

Environmentální aplikace molekulární biologie Environmentální aplikace molekulární biologie Petra Jančová, Kristýna Maršálková, Jana Šerá, Hana Pištěková Ústav Inženýrství Ochrany Životního Prostředí, Fakulta Technologická, Univerzita Tomáše Bati

Více

Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR. Mgr. Silvie Dudová

Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR. Mgr. Silvie Dudová Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR Mgr. Silvie Dudová Centrum základního výzkumu pro monoklonální gamapatie a mnohočetný myelom, ILBIT LF MU Brno Laboratoř experimentální

Více

Proč je dobré studovat genetické procesy na úrovni buňky? Například proto, že odchylky počtu nebo struktury chromozomů mohou způsobit:

Proč je dobré studovat genetické procesy na úrovni buňky? Například proto, že odchylky počtu nebo struktury chromozomů mohou způsobit: Cytogenetika Proč je dobré studovat genetické procesy na úrovni buňky? Například proto, že odchylky počtu nebo struktury chromozomů mohou způsobit: mentální nebo psychomotorickou retardaci, poruchy vývoje

Více

VÝSLEDKY FISH ANALÝZY U NEMOCNÝCH S MM ZAŘAZENÝCH VE STUDII CMG 2002 VÝZKUMNÝ GRANT NR/8183-4 CMG CZECH GROUP M Y E L O M A Č ESKÁ MYELOMOVÁ SKUPINA

VÝSLEDKY FISH ANALÝZY U NEMOCNÝCH S MM ZAŘAZENÝCH VE STUDII CMG 2002 VÝZKUMNÝ GRANT NR/8183-4 CMG CZECH GROUP M Y E L O M A Č ESKÁ MYELOMOVÁ SKUPINA VÝSLEDKY FISH ANALÝZY U NEMOCNÝCH S MM ZAŘAZENÝCH VE STUDII CMG 2002 VÝZKUMNÝ GRANT NR/8183-4 CZECH CMG M Y E L O M A GROUP Č ESKÁ MYELOMOVÁ SKUPINA Zhodnocení spolupráce Přehled molekulárně cytogenetických

Více

Základy klinické cytogenetiky chromosomy

Základy klinické cytogenetiky chromosomy Základy klinické cytogenetiky chromosomy Hanáková M. SHRNUTÍ PŘEDNÁŠKY chromosomy metody přípravy chromosomových preparátů, hodnocení chromosomů, metody molekulární cytogenetiky vrozené chromosomové aberace

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

Tekuté biopsie u mnohočetného myelomu

Tekuté biopsie u mnohočetného myelomu Tekuté biopsie u mnohočetného myelomu Mgr. Veronika Kubaczková Babákova myelomová skupina ÚPF LF MU Pacientský seminář 11. května 2016, Brno Co jsou tekuté biopsie? Představují méně zatěžující vyšetření

Více

Nové technologie v mikrobiologické diagnostice a jejich přínos pro pacienty v intenzivní péči

Nové technologie v mikrobiologické diagnostice a jejich přínos pro pacienty v intenzivní péči B I O M E D I C AL Nové technologie v mikrobiologické diagnostice a jejich přínos pro pacienty v intenzivní péči Jaroslav Hrabák CHARLES UNIVERSITY IN PRAGUE Obsah prezentace ČSIM 2016 Mikrobiologická

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

MIKROBIOLOGIE V BIOTECHNOLOGII

MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Termín biotechnologie byl poprvé použit v roce 1917 Procesy, při kterých se na tvorbě výsledného produktu podílejí živé organismy Širší definice: biotechnologie

Více

VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ

VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ Lucie Vištejnová 2, Jan Hodek 1, Patrik Sekerka 2, Jaroslava Ovesná 1, Kateřina Demnerová 2 1. Výzkumný ústav rostlinné výroby, Drnovská 507,

Více

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Charakteristika testu: Set AMPLICOR HPV vyráběný firmou Roche je určený pro detekci vysoko-rizikových typů lidských

Více