THE ASSOCIATION OF SERUM BILIRUBIN AND PROMOTER VARIATIONS IN UGT1A1 WITH ATHEROSCLEROSIS

Transkript

1 THE ASSOCIATION OF SERUM BILIRUBIN AND PROMOTER VARIATIONS IN UGT1A1 WITH ATHEROSCLEROSIS Vítek L 1,2, Jiráskov sková A 1, Šmídová H 1, Dostálov lová G 3, Bělohlávek J 3, Kadlčkov ková L, Linhart,, A 3 1 Institute of Medical Biochemistry and Laboratory Diagnostics, 2 4 th Department of Internal Medicine, 3 2 nd Department of Internal Medicine 1 st Faculty of Medicine, Charles University in Prague Czech Republic

2 Disclosure The authors have nothing to disclose

3 Background Oxidative stress contributes importantly to atherogenesis Bilirubin, the major end-product of heme catabolism in the intravascular compartment, is believed to be one of the most powerful endogenous antioxidants

4 Bilirubin and atherosclerosis Negative relationship between occurrence of coronary stenoses and concentration of serum bilirubin (Clin Chem 1994, Ann Clin Lab Sci 1997, ATVB 1996, Athero 1997, Athero 2000, Athero 2001) Serum bilirubin below 7 μmol/l increases risk of CHD by 30% (Clin Chem 1995) Serum bilirubin has similar predictive value as the HDL cholesterol level (Athero 2000)

5 Introduction Bilirubin belongs to the most potent endogenous antoxidants and we have shown that mildly elevated serum bilirubin levels protect from both coronary (Novotný L. Exp Biol Med 2003) and carotid atherosclerosis. Relationship between IMT and age in normo- and hyperbilirubinemic men 1,30 1,20 1,10 non-gs GS IMT [mm] 1,00 0,90 0,80 0,70 y = 0,01x + 0,332 R 2 = 0,32 y = 0,0036x + 0,5508 R 2 = 0,0734 (Vítek L. Cerebrovasc Dis 2006) 0,60 0,50 0, age [years]

6 UGT1A1 gene UGT1A1 gene promoter is highly polymorphic, A[TA]7TAA responsible for increased serum bilirubin (Gilbert syndrome) Transkripce Transcription tgccatatatatatatataagtaggagagggcgaacctctggcaggagcaaaggcgccatggct TATA box Translation

7 Aim of the study to assess the relationship between serum bilirubin levels and promoter variations in UGT1A1, the gene regulating bilirubin homeostasis, in patients with various forms of atherosclerosis

8 Methods Study performed on: 79 pts with premature coronary atherosclerosis (myocardial infarction (MI) <45 (M) and <55 (F)), 2-4 years after MI 35 pts with chronic ischemic heart disease (IHD) 69 patients with periphereal artery disease (PAD) 226 matched healthy subjects Analyses: standard serum biochemistry (TA)n dinucleotide variations in UGT1A1 determined by fragment analysis on capillary DNA sequencer

9 Serum bilirubin levels in patients with atherosclerosis Group Premature MI (n=79) IHD (n=35) PAD controls (n=226) All 10.3* [ ] 9.8* [ ] 8.5* [ ] 12.2 [ ] Males 11.3* [ ] 9.1* [ ] 9.1* [ ] 12.8 [ ] Females 11.5 [ ] 10.6 [ ] 7.7* [ ] 10.6 [ ] Serum bilirubin expressed in μmol/l, data expressed as median [25-75%] Assessed by ANOVA on Ranks with post-hoc Dunn s testing *p <0.05, when compared to controls

10 Serum lipid levels Premature MI (n=79) IHD (n=35) PAD controls (n=228) LCL-C [mmol/l] 2.27* [ ] 2.37* [ ] 2.70 [ ] 2.87 [ ] HDL-C [mmol/l] 1.11* [ ] 1.36* [ ] 1.36* [ ] 1.64 [ ] Triglycerides [mmol/l] 1.67* [ ] 1.19 [ ] 1.23 [ ] 1.18 [ ] data expressed as median [25-75%] Assessed by ANOVA on Ranks with post-hoc Dunn s testing *p <0.05, when compared to controls All MI and majority of IHD/PAD patients treated with statins and platelet anti-aggregation Tx

11 ssed in umol/l, and 25-75% red to controls Serum bilirubin levels according to UGT1A1 genotype All 6/6 6/7 7/7 Males 6/6 6/7 7/7 Females 6/6 6/7 7/7 Premature MI (n=75) 8.2* [ ] 12.0 [ ] 18.8 [ ] (n=58) 8.3* [ ] 12.6 [ ] 18.8* [ ] (n=17) 7.9 [ ] 7.5 [ ] NA IHD (n=35) 8.2* [ ] 10.0 [ ] 25.3 [ ] (n=35) 8.2* [ ] 10.0 [ ] 25.3 [ ] (n=4+) 8.1 [ ] 10.0 [ ] 25.3 [ ] PAD 7.6* [ ] 8.2* [ ] 12.2* [ ] 7.6* [ ] 8.2* [ ] 12.2* [ ] 7.6* [ ] 8.2* [ ] 12.2* [ ] controls (n=190) 10.1 [ ] 12.7 [ ] 22.3 [ ] (n=103) 10.6 [ ] 14.2 [ ] 29.7 [ ] (n=87) 9.1 [ ] 10.4 [ ] 20.8 [ ]

12 Risk of atherosclerotic disease with each umol/l decrease of serum bilirubin Group All Males Females Premature MI (n=79) 0.98 [ ] 0.94 [ ] 0.97 [ ] IHD (n=35) 0.93 [ ] 0.82 [ ] 1.02 [ ] PAD 0.86 [ ] 0.86 [ ] 0.86 [ ] Data represent OR and 95% CI Risk of atherosclerotic tic disease according to UGT1A1 [TA] status 7 Group All Premature MI (n=79) 0.48 [ ] IHD (n=35) 0.49 [ ] PAD 0.56 [ ] Males Females 0.57 [ ] 0.39 [ ] 0.35 [ ] 0.83 [0.22-3,2] 0.35 [ ] 0.75 [ ] Data represent OR and 95% CI

13 Conclusions Manifestation of atherosclerotic diseases is associated with low serum bilirubin levels, especially in males Consumption of bilirubin due to increased oxidative stress accompanying diabetes, rather than (TA)n repeat variations in UGT1A1, is likely to account for this phenomenon