1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním"


1 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám

2 Genetika - shrnutí TL2 1. Doplň: heterozygot, replikace, chromozom, recesivní, fenotyp, homozygot, DNA, dominantní, translace, genotyp, transkripce Gen je úsek. Soubor genů v organismu se nazývá.. Soubor znaků organismu se nazývá Převládající alela se nazývá.. Potlačená alela se nazývá. Stejné alely téhož genu v chromozomu má. Různé alely téhož genu v chromozomu má Zdvojení molekuly DNA se nazývá Přepis genetické informace z DNA do mrna se nazývá. Překlad genetické informace do primární struktury bílkovin (za spoluúčasti trna a rrna) se nazývá.. Útvar nesoucí genetickou informaci se nazývá 2. Urči správnou odpověď 1. Na objevu DNA se podílel : a) J.G. Mendel c) Lamarck 2. Homozygot je : a) jedinec s různými alelami daného genu b) jedinec se stejnými vlastnostmi daného genu c) jedinec se stejnými vlastnostmi daného genu 3. Základní vlastností DNA je schopnost : a) Sublimace b) Replikace c) Duplikace 4. Za zakladatele genetiky je považován : a) Mendel c) Darwin 5. Soubor všech pozorovatelných vlastností a znaků organismu se nazývá :

3 b) Genofond c) Fenotyp 6. Písmenem P se označuje : a) Generace prarodičů b) Generace rodičů c) Generace potomků 7. Soubor všech genů daného organismu se nazývá : b) Fenotyp c) Genofond 8. Kvalitativní znaky jsou podmíněny : a) Geny velkého účinku b) Geny malého účinku c) Faktory vnějšího prostředí 3. Přiřaď správně : a) DNA b) RNA c) Nukleosid d) Purinová báze e) Pyrimidinová báze

4 4. Urči, co platí: a) Replikace DNA je proces tvorby kopií molekuly deoxyribonukleové kyseliny. ANO/NE b) Soubor všech genů v gametách populace označujeme termínem genofond. ANO/NE c) Gen je úsek molekuly DNA, podle kterého se syntetizují pouze bílkoviny. ANO/NE d) Kodon je trojice nukleotidů v trna. ANO/NE e) Gamety jsou buňky, které u člověka nesou haploidní počet chromozomů. ANO/NE f) Kvantitativní znaky nejsou ve svém fenotypovém projevu ovlivněny prostředím. ANO/NE g) Mutace, které vedou ke změně počtu chromozomů se nazývají genomové. ANO/NE

5 Genetika - shrnutí - TL2 - řešení 1. Doplň: heterozygot, replikace, chromozom, recesivní, fenotyp, homozygot, DNA, dominantní, translace, genotyp, transkripce Gen je úsek DNA Soubor genů v organismu se nazývá genotyp Soubor znaků organismu se nazývá fenotyp Převládající alela se nazývá dominantní Potlačená alela se nazývá recesivní Stejné alely téhož genu v chromozomu má homozygot Různé alely téhož genu v chromozomu má heterozygot Zdvojení molekuly DNA se nazývá replikace Přepis genetické informace z DNA do mrna se nazývá transkripce Překlad genetické informace do primární struktury bílkovin (za spoluúčasti trna a rrna) se nazývá translace Útvar nesoucí genetickou informaci se nazývá chromozom 2. Urči správnou odpověď 1. Na objevu DNA se podílel : a) J.G. Mendel c) Lamarck 2. Homozygot je : a) jedinec s různými alelami daného genu b) jedinec se stejnými vlastnostmi daného genu c) jedinec se stejnými alelami daného genu 3. Základní vlastností DNA je schopnost : a) Sublimace b) Replikace c) Duplikace 4. Za zakladatele genetiky je považován : a) Mendel c) Darwin 5. Soubor všech pozorovatelných vlastností a znaků organismu se nazývá :

6 b) Genofond c) Fenotyp 6. Jako P se označuje : a) Generace prarodičů b) Generace rodičů c) Generace potomků 7. Soubor všech genů daného organismu se nazývá : b) Fenotyp c) Genofond 8. Kvalitativní znaky jsou podmíněny : a) Geny velkého účinku b) Geny malého účinku c) Faktory vnějšího prostředí 3. Přiřaď správně : f) DNA g) RNA h) Nukleosid i) Purinová báze j) Pyrimidinová báze

7 a - 5, b) - 4, c) - 2, d) - 3, e) Urči, co platí: a) Replikace DNA je proces tvorby kopií molekuly deoxyribonukleové kyseliny. ANO b) Soubor všech genů v gametách populace označujeme termínem genofond. ANO c) gen je úsek molekuly DNA, podle kterého se syntetizují pouze bílkoviny. NE d) Kodon je trojice nukleotidů v trna. NE e) Gamety jsou buňky, které u člověka nesou haploidní počet chromozomů. ANO f) Kvantitativní znaky nejsou ve svém fenotypovém projevu ovlivněny prostředím. NE g) Mutace, které vedou ke změně počtu chromozomů se nazývají genomové. ANO Zdroje: Biologie pro gymnázia J.Jelínek, V. Zicháček

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010


ANOTACE vytvořených/inovovaných materiálů

ANOTACE vytvořených/inovovaných materiálů ANOTACE vytvořených/inovovaných materiálů Číslo projektu Číslo a název šablony klíčové aktivity Tematická oblast Formát Druh učebního materiálu Druh interaktivity CZ.1.07/1.5.00/34.0722 III/2 Inovace a


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků


Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00


Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny


Schéma průběhu transkripce

Schéma průběhu transkripce Molekulární základy genetiky PROTEOSYNTÉZA A GENETICKÝ KÓD Proteosyntéza je složitý proces tvorby bílkovin, který zahrnuje proces přepisu genetické informace z DNA do kratšího zápisu v informační mrna



ENZYMY A NUKLEOVÉ KYSELINY ENZYMY A NUKLEOVÉ KYSELINY Autor: Mgr. Stanislava Bubíková Datum (období) tvorby: 28. 3. 2013 Ročník: devátý Vzdělávací oblast: Člověk a příroda / Chemie / Organické sloučeniny 1 Anotace: Žáci se seznámí


Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti


Projekt SIPVZ č.0636p2006 Buňka interaktivní výuková aplikace

Projekt SIPVZ č.0636p2006 Buňka interaktivní výuková aplikace Nukleové kyseliny Úvod Makromolekulární látky, které uchovávají a přenášejí informaci. Jsou to makromolekulární látky uspořádané do dlouhých. Řadí se mezi tzv.. Jsou přítomny ve buňkách a virech. Poprvé


Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k


Základy molekulární a buněčné biologie. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy molekulární a buněčné biologie. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy molekulární a buněčné biologie Přípravný kurz Komb.forma studia oboru Všeobecná sestra Genetický aparát buňky DNA = nositelka genetické informace - dvouvláknová RNA: jednovláknová mrna = messenger


Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza

Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza Exprese genetického kódu Centrální dogma molekulární biologie - genetická informace v DNA -> RNA -> primárního řetězce proteinu 1) transkripce - přepis z DNA do mrna 2) translace - přeložení z kódu nukleových


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým


Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho


Centrální dogma molekulární biologie

Centrální dogma molekulární biologie řípravný kurz LF MU 2011/12 Centrální dogma molekulární biologie Nukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Mendel) 1869 objev nukleových kyselin (Miescher) 1944 genetická informace v nukleových



PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ 10 SEZNAM PŘÍLOH PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ PŘÍLOHA č. 2 MAPY Mapa 1 Lokalizace zájmového území (zdroj: Mapy.cz) Mapa 2 Místa odlovených nebo uhynulých kusů (zdroj:


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě Otázka: Genetika I Předmět: Biologie Přidal(a): Paris -věda, která se zabývá dědičností a proměnlivostí -zakladatelem je Johan Gregor Mendel (1822 1884), který se narodil v Hynčicích na Moravě 1. MOLEKULÁRNÍ


Struktura a funkce nukleových kyselin

Struktura a funkce nukleových kyselin Struktura a funkce nukleových kyselin ukleové kyseliny Deoxyribonukleová kyselina - DA - uchovává genetickou informaci Ribonukleová kyselina RA - genová exprese a biosyntéza proteinů Složení A stavební


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


NUKLEOVÉ KYSELINY. Složení nukleových kyselin. Typy nukleových kyselin:

NUKLEOVÉ KYSELINY. Složení nukleových kyselin. Typy nukleových kyselin: NUKLEOVÉ KYSELINY Deoxyribonukleová kyselina (DNA, odvozeno z anglického názvu deoxyribonucleic acid) Ribonukleová kyselina (RNA, odvozeno z anglického názvu ribonucleic acid) Definice a zařazení: Nukleové



TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865


Gymnázium, Brno, Elgartova 3

Gymnázium, Brno, Elgartova 3 Gymnázium, Brno, Elgartova 3 Šablona: III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Název projektu: GE Vyšší kvalita výuky Číslo projektu: CZ.1.07/1.5.00/34.0925 Autor: Mgr. Hana Křivánková Téma:


Vzdělávací materiál. vytvořený v projektu OP VK CZ.1.07/1.5.00/34.0211. Anotace. Biosyntéza nukleových kyselin. VY_32_INOVACE_Ch0219.

Vzdělávací materiál. vytvořený v projektu OP VK CZ.1.07/1.5.00/34.0211. Anotace. Biosyntéza nukleových kyselin. VY_32_INOVACE_Ch0219. Vzdělávací materiál vytvořený v projektu OP VK Název školy: Gymnázium, Zábřeh, náměstí Osvobození 20 Číslo projektu: Název projektu: Číslo a název klíčové aktivity: CZ.1.07/1.5.00/34.0211 Zlepšení podmínek


Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací Genetika Nauka o dědid dičnosti a proměnlivosti Genetika molekulárn rní buněk organismů populací Dědičnost na úrovni nukleových kyselin Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci


Nukleové kyseliny. DeoxyriboNucleic li Acid

Nukleové kyseliny. DeoxyriboNucleic li Acid Molekulární lární genetika Nukleové kyseliny DeoxyriboNucleic li Acid RiboNucleic N li Acid cukr (deoxyrobosa, ribosa) fosforečný zbytek dusíkatá báze Dusíkaté báze Dvouvláknová DNA Uchovává genetickou





2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné:

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné: Výběrové otázky: 1. Součástí všech prokaryotických buněk je: a) DNA, plazmidy b) plazmidy, mitochondrie c) plazmidy, ribozomy d) mitochondrie, endoplazmatické retikulum 2. Z následujících tvrzení, týkajících


1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


Deriváty karboxylových kyselin, aminokyseliny, estery

Deriváty karboxylových kyselin, aminokyseliny, estery Deriváty karboxylových kyselin, aminokyseliny, estery Zpracovala: Ing. Štěpánka Janstová 29.1.2012 Určeno pro 9. ročník ZŠ V/II,EU-OPVK,42/CH9/Ja Přehled a využití derivátů organických kyselin, jejich


VY_32_INOVACE_11.18 1/6 Genetika Genetika

VY_32_INOVACE_11.18 1/6 Genetika Genetika 1/6 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Buňky, tkáně, orgány, soustavy

Buňky, tkáně, orgány, soustavy Lidská buňka buněčné organely a struktury: Jádro Endoplazmatické retikulum Goldiho aparát Mitochondrie Lysozomy Centrioly Cytoskelet Cytoplazma Cytoplazmatická membrána Buněčné jádro Jadérko Karyoplazma



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Otázka: Genetika. Předmět: Biologie. Přidal(a): - GENETIKA

Otázka: Genetika. Předmět: Biologie. Přidal(a): - GENETIKA Otázka: Genetika Předmět: Biologie Přidal(a): - GENETIKA = nauka o dědičnosti a proměnlivosti organismů Dědičnost Schopnost organismů předávat určité znaky potomkům Zabezpečuje stálost druhu Způsobuje


A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům Karlova univerzita, Lékařská fakulta Hradec Králové Obor: všeobecné lékařství - test z biologie Vyberte tu z nabídnutých odpovědí (1-5), která je nejúplnější. Otázka Odpověď 1. Mezi organely membránového


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém


AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 I n v e s t i c e d o r o z v o j e v z d ě l á v á n í Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


a) Primární struktura NK NUKLEOTIDY Monomerem NK jsou nukleotidy

a) Primární struktura NK NUKLEOTIDY Monomerem NK jsou nukleotidy 1 Nukleové kyseliny Nukleové kyseliny (NK) sice tvoří malé procento hmotnosti buňky ale významem v kódování genetické informace a její expresí zcela nezbytným typem biopolymeru všech živých soustav a)


- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil


Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika


Molekulární genetika: Základní stavební jednotkou nukleových kyselin jsou nukleotidy, které jsou tvořeny

Molekulární genetika: Základní stavební jednotkou nukleových kyselin jsou nukleotidy, které jsou tvořeny Otázka: Molekulární genetika, genetika buněk Předmět: Biologie Přidal(a): jeti52 Molekulární genetika: Do roku 1953 nebylo přesně známa podstata genetické informace, genů, dědičnosti,.. V roce 1953 Watson


Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina

Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina Přehled GMH Seminář z biologie GENETIKA Molekulární genetika Základní dogma molekulární biologie Základním nosičem genetické informace je molekula DNA. Tato molekula se může replikovat (kopírovat). Informace


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat


Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou


Nukleové kyseliny příručka pro učitele. Obecné informace:

Nukleové kyseliny příručka pro učitele. Obecné informace: Obecné informace: Nukleové kyseliny příručka pro učitele Téma Nukleové kyseliny je završením základních kapitol z popisné chemie a je tedy zařazeno až na její závěr. Probírá se v rámci jedné, eventuálně


Základy metod forenzní genetiky. Hana Šumberová, DiS

Základy metod forenzní genetiky. Hana Šumberová, DiS Základy metod forenzní genetiky Hana Šumberová, DiS Bakalářská práce 2011 PROHLÁŠENÍ AUTORA BAKALÁŘSKÉ PRÁCE Beru na vědomí, že odevzdáním bakalářské práce souhlasím se zveřejněním své práce podle zákona


Úvod do studia biologie. Základy molekulární genetiky

Úvod do studia biologie. Základy molekulární genetiky Úvod do studia biologie Základy molekulární genetiky Katedra biologie PdF MU, 2011 - podobor genetiky (genetika je obecnější) Genetika: - nauka o dědičnosti a proměnlivosti - věda 20. století Johann Gregor


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)


-nukleové kyseliny jsou makromolekulární látky, jejichž základní stavební jednotkou je nukleotid každý nukleotid vzniká spojením:

-nukleové kyseliny jsou makromolekulární látky, jejichž základní stavební jednotkou je nukleotid každý nukleotid vzniká spojením: Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): Mulek NUKLEOVÉ KYSELINY -nositelkami genetické informace jsou molekuly nukleových kyselin tvořené řetězci vzájemně spojených nukleotidů,


6. Nukleové kyseliny

6. Nukleové kyseliny 6. ukleové kyseliny ukleové kyseliny jsou spolu s proteiny základní a nezbytnou složkou živé hmoty. lavní jejich funkce je uchování genetické informace a její přenos do dceřinné buňky. ukleové kyseliny


UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku)

UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) B I O L O G I E 1. Definice a obory biologie. Obecné vlastnosti organismů. Základní klasifikace organismů.


Masarykova univerzita v Brně, Fakulta lékařská

Masarykova univerzita v Brně, Fakulta lékařská Masarykova univerzita v Brně, Fakulta lékařská Obor: Všeobecné lékařství Biologie Testy předpokládají znalost středoškolské biologie. Hlavním podkladem při jejich přípravě byl "Přehled biologie" (Rosypal,


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci


Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.


=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům

=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům Otázka: Genetika Předmět: Biologie Přidal(a): t.klodnerova REALIZACE GENETICKÉ INFORMACE, MUTACE, ZÁKLADNÍ GENETICKÉ POJMY: GEN, ZNAK, ALELA, GENOTYP, FENOTYP, HOMOZYGOT, HETEROZYGOT, HYBRIDIZACE, DOMINANCE,



21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka


Studijní materiály pro bioinformatickou část ViBuChu. úloha II. Jan Komárek, Gabriel Demo

Studijní materiály pro bioinformatickou část ViBuChu. úloha II. Jan Komárek, Gabriel Demo Studijní materiály pro bioinformatickou část ViBuChu úloha II Jan Komárek, Gabriel Demo Adenin Struktura DNA Thymin 5 konec 3 konec DNA tvořena dvěmi řetězci orientovanými antiparalelně (liší se orientací


Nukleové kyseliny Replikace Transkripce translace

Nukleové kyseliny Replikace Transkripce translace Nukleové kyseliny Replikace Transkripce translace Figure 4-3 Molecular Biology of the Cell ( Garland Science 2008) Figure 4-4 Molecular Biology of the Cell ( Garland Science 2008) Figure 4-5 Molecular



GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky


Biosyntéza a metabolismus bílkovin

Biosyntéza a metabolismus bílkovin Bílkoviny Biosyntéza a metabolismus bílkovin lavní stavební materiál buněk a tkání Prakticky jediný zdroj dusíku pro heterotrofní organismy eexistují zásobní bílkoviny nutný dostatečný přísun v potravě


7. Regulace genové exprese, diferenciace buněk a epigenetika

7. Regulace genové exprese, diferenciace buněk a epigenetika 7. Regulace genové exprese, diferenciace buněk a epigenetika Aby mohl mnohobuněčný organismus efektivně fungovat, je třeba, aby se jednotlivé buňky specializovaly na určité funkce. Nový jedinec přitom


Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA


Slovníček genetických pojmů

Slovníček genetických pojmů Slovníček genetických pojmů A Adenin 6-aminopurin; purinová báze, přítomná v DNA i RNA AIDS Acquired immunodeficiency syndrome syndrom získané imunodeficience, způsobený virem HIV (Human immunodeficiency


Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u


Vzdělávací materiál. vytvořený v projektu OP VK. Anotace. Název školy: Gymnázium, Zábřeh, náměstí Osvobození 20. Číslo projektu:

Vzdělávací materiál. vytvořený v projektu OP VK. Anotace. Název školy: Gymnázium, Zábřeh, náměstí Osvobození 20. Číslo projektu: Vzdělávací materiál vytvořený v projektu VK ázev školy: Gymnázium, Zábřeh, náměstí svobození 20 Číslo projektu: ázev projektu: Číslo a název klíčové aktivity: CZ.1.07/1.5.00/34.0211 Zlepšení podmínek pro


Výukový materiál zpracovaný v rámci projektu Výuka modern

Výukový materiál zpracovaný v rámci projektu Výuka modern St ední pr myslová škola strojnická Olomouc, t. 17. listopadu 49 Výukový materiál zpracovaný v rámci projektu Výuka modern Registrační číslo projektu: CZ.1.07/1.5.00/34.0205 Šablona: III/2 P írodov dné


Struktura nukleových kyselin Vlastnosti genetického materiálu

Struktura nukleových kyselin Vlastnosti genetického materiálu Struktura nukleových kyselin Vlastnosti genetického materiálu V předcházejících kapitolách bylo konstatováno, že geny jsou uloženy na chromozomech a kontrolují fenotypové vlastnosti a že chromozomy se


genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace


Příbuznost a inbreeding

Příbuznost a inbreeding Příbuznost a inbreeding Příbuznost Přímá (z předka na potomka). Souběžná (mezi libovolnými jedinci). Inbreeding Inbrední koeficient je pravděpodobnost, že dva geny přítomné v lokuse daného jedince jsou


13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu
