Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny"


1 Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum

2 OBSAH 1. Úvod Johan Gregor Mendel život a jeho práce 3 3. Pokusy na hrachu objev DNA Základní pojmy Pravidla dědičnosti Závěr Seznam literatury 11 2

3 Úvod: Vědeckému studiu mechanismu dědičnosti se říká genetika. Od počátku tohoto století zaznamenala tato vědecká disciplína velký rozkvět. Umožnila tak porozumět tomu, proč dědíme určité vlastnosti a také přesně určovat a léčit řadu vážných lidských onemocnění. Dovoluje dokonce byť je s tím stále ještě spojeno mnoho otazníků zasahovat do vzniku života samotného.genetika je vědou poměrně mladou. Za zakladatele genetiky je považován Johan Gregor Mendel ( ). Tento augustiniánský mnich z brněnského kláštera se v 2. polovině 19. století zabýval pokusy na rostlinách. Působil na zahrádce kláštera, kde zkoumal hrách. Při křížení u hrachu sledoval 7 dědičných znaků (tvar semen a lusků, zbarvení děloh, květů a nezralých lusků, délku stonku a postavení květů). Po zhodnocení výsledků zjistil, že se nedědí přímo znaky, ale "vlohy" pro ně. Mendel tak dal za vznik klasické genetice. Mendel vydal roku 1866 o svých pozorováních práci nazvanou Pokusy s rostlinnými kříženci. Ve své době však neměla jeho práce vůbec žádný ohlas a byla dokonce zapomenuta. Ke znovuobjevení Mendelovy práce a ke vzniku genetiky jako plnohodnotného vědního oboru tak dochází až na počátku 20. století. Johann Gregor Mendel Narodil se 20.července 1822 v rodině sedláka v obci Hynčice, nyní součástí obce Vražné (okres Nový Jičín) na Moravě. Mateřským jazykem Mendela byla němčina.po absolvování základní školy v Hynčicích a gymnázia v Opavě se v roce 1840 zapsal na Filozofický ústav Univerzity v Olomouci. V roce 1843 byl přijat jako novic do augustiniánského kláštera sv. Tomáše na Starém Brně. Tehdy obdržel řádové jméno Gregor. Brněnští augustiniáni byli vzdělanci, kteří se tehdy podíleli na univerzitní a gymnaziální výuce na území monarchie. V té době zaujímali významné postavení ve vědeckém a kulturním životě na Moravě. 3

4 V roce 1856 Mendel zahájil své experimenty s křížením rostlin (s hrachem).v roce 1863 ukončil pokusy s hrachem a dne 8. února 1865 přednesl na zasedání Přírodovědného spolku v Brně, devět let po Darwinově knize O původu druhů, první část své teorie přenosu dědičných jednotek a 8. března téhož roku druhou část o své klasické práci. V roce 1883 Mendel vážně onemocněl a dne 9. ledna 1884 zemřel v klášteře a byl pochován na brněnském ústředním hřbitově do hrobky augustiniánů. Rekviem v kostele dirigoval později světoznámý skladatel Leoš Janáček. Mendelova výzkumná činnost Mendel považoval proměnlivost rostlin za doloženou skutečnost. Jednotlivé znaky (např.tvar zralého semene), chápal protikladně, např. na jedné straně kulaté, na druhé hranaté jako dvě strany jedné mince. Hodnotil přenos jejich vloh. 4

5 Při genetickém křížení hrachu s kulatými semeny s hrachem s hranatými semeny má generace F1 fenotyp kulatých semen, protože znak pro kulatá semena je dominantní vůči znaku pro semena hranatá. Semena generace F2 jsou ze 3/4 kulatá a z 1/4 hranatá, protože alely těchto genů jsou přenášeny nezávisle haploidními gametami. Křížením rostlin hrachu s kulatými semeny s rostlinami se semeny hranatými poskytuje potomstvo F1, které má pouze kulatá semena. Křížením tohoto hrachu F1 vzniká potomstvo F2 mající ze tří čtvrtin RNA. Klíčovým okamžikem byl objev DNA, jako nositelky genetické informace. Watson a Crick roku 1953 předložili strukturní model dvojšroubovice DNA. Roku 1962 se dočkali Nobelovy ceny. 5

6 Model molekuly DNA představuje kroutící se spirálu zakódovaných chemických látek, jakousi nekonečnou šroubovici. Další důležitou vlastností této molekuly je, že dovede příslušné poselství dále přenášet z generace na generaci. Obě postranice kroutícího se,,provazového žebříku DNK tvoří střídající se skupiny cukru (dezoxyribózy) a fosforu, spojených dohromady vodíkovými můstky. model DNA 6

7 Základní pojmy Transkripce = přepis Citace: Transkripce představuje primární proces proteosyntézy (syntézy bílkovin). Jde o sestavení molekuly mrna podle záznamu v DNA. Vzniklá mrna slouží jako "posel" - přenese genetickou informaci od chromozómu k ribozómu. Ribozóm na ni nasedne a vytvoří vhodné podmínky pro translaci Translace = přenos Citace: Translace je sekundární proces syntézy bílkovin. Jde o sestavení primární struktury bílkoviny. DNA, RNA - Též známé jako DNK, RNK. Nukleové kyseliny, nositelky dědičné informace GEN - Jako gen je označován konkrétní úsek molekuly DNA nesoucí dědičnou informaci pro tvorbu bílkoviny. ALELA - Konkrétní forma genu. V rámci jednoho organismu jsou 2 alely pro 1 gen (kromě pohlavních buněk). LOKUS - Místo na chromozomu, kde je umístěn určitý gen. CHROMOZOM - z buňkách DNA a bílkovin GENOM - Soubor všech genů v 1 buňce, dělí se na jaderný a mimojaderný (např. v chloroplastech nebo mitochondriích). GENOTYP - Soubor všech genů v organismu. U jednobuněčných organismů je totožný s genomem GENOFOND - Soubor všech genů v populaci. FENOTYP - Soubor všech dědičných znaků organismu. Jakýsi praktický výsledek genotypu. Genotyp je však co do rozsahu širší, neboť na realizaci některých dědičných znaků se může podílet více genů a třeba i okolní vlivy. KARYOTYP - Soubor chromozomů, které jsou z hlediska jejich počtu a tvarového zastoupení charakteristický pro určitý organismus. 7

8 MUTACE - Změny genetické informace způsobené působením mutagenních faktorů (záření, chemikálie...). HOMOZYGOT - Organismus, jehož obě alely zkoumaného genu jsou stejné. HETEROZYGOT - Organismus, jehož alely zkoumaného genu jsou navzájem různé. P GENERACE - Rodičovská generace. F1, F2 GENERACE - první, druhá generace potomků. B1 GENERACE - První generace zpětného křížení. NUKLEOTID - základní stavební jednotka nukleových kyselin (Sacharid + N-báze + zbytek kyseliny fosforečné) Pravidla Dědičnosti: Proces dědičnosti je řízen a kontrolován geny. Polovička genů pochází od matky, druhá polovina od otce. V důsledku tohoto přenosu genů i toho, že,,podobné rodí podobné, se potomci téměř pravidelně podobají svým rodičům. Existují ovšem i výjimky. Třebaže základní genetické komponenty se v navzájem dědičnosti přenášejí stále stejně, přece jen se navzájem kombinují v téměř nekonečném počtu variant, a prakticky tak vylučují, aby genetická výbava dvou lidí ovšem s výjimkou jednovaječných dvojčat byla totožná. Velkou roli ve hře dědičnosti sehrává náhoda; jsou zde však i určitá pravidla a vzorce. Díky Mendelovým experimentům i všem později získaným poznatkům o buněčné struktuře dnes víme, že každý člověk vlastní dvě totožné kopie každého genu, z nichž jeden zdědil po otci, druhou po matce. Přecházejí-li geny z rodičů na potomky, může být zděděna buď mateřská či otcovská kopie. Z toho pak díky náhodnému výběru a mísením vzniká neobyčejně bohatý rejstřík kombinací. Ve složitém a fascinujícím příběhu lidského těla je nesporně ze všeho nejúchvatnější stránkou to, proč je každý z nás právě takový, jaký je. Při početí se spojují dvě pohlavní buňky mužská spermie a ženské vajíčko aby vzájemným oplozením vznikla jediná buňka nová. Uvnitř této buňky jsou obsaženy veškeré informace, které jsou nezbytné ke vzniku nové lidské bytosti a které také určují každou její vlastnost, od barvy vlasů a tělesné výšky až po schopnosti umělecké tvorby nebo úroveň intelektu. Tyto informace dědí potomek od rodičů, jsou uloženy v genech, jež jsou v počtu mnoha tisíců obsaženy v chromosomech uvnitř každé buňky. Každá lidská bytost je,,originál současně však tvoří i součet charakteristik a vlastností zděděných po rodičích. Děděné dispozice zahrnují prakticky vše, od na první pohled viditelných znaků jako je barva vlasů nebo tělesná stavba až po znaky méně zřejmé, jako jsou např. krevní skupina nebo metabolismus. 8

9 K předávání genetické informace z rodičů na dítě dochází při početí, kdy se dvě buňky spermie z otcova a vajíčko z matčina těla, z nichž každá obsahuje poloviční počet nezbytných chromosomů spojují a utvářejí jedinou buňku s úplnou chromosomální výbavou. Ne všechny páry genů jsou ovšem srovnatelné. Vědci rozlišují geny dominantní a recesivní. Pokud se tyto dva druhy setkají, pak samozřejmě dominantní potlačí recesivní. Naopak recesivní gen se může prosadit pouze tehdy, je-li i druhý gen v páru recesivního charakteru. Zdá se, že příkladem recesivní dědičnosti,,normálních rysů jsou zrzavé či velmi světlé vlasy. Jinak je ovšem taková recesivní dědičnost normálních znaků málo častá. Existují tři možné typy hlavních genů krevních skupin A, B, 0. Výjimečně ovšem může osoba krevní skupiny A zplodit ve spojení s partnerem skupiny B potomka s krevní skupinou 0 a to tehdy, mají-li oba,,tichý čili recesivní gen této skupiny. Právě tyto vlastnosti dovolují určovat v některých sporných případech otcovství. Bude to chlapec nebo děvče? Pohlaví dítěte je určováno již v okamžiku početí pohlavními chromosomy, děděnými po rodičích. Všechna vajíčka produkovaná ženinými vaječníky obsahují chromosom X, který vznikl rozštěpením páru chromosomů obsaženého v původní buňce. Normální mužské somatické buňky ovšem obsahují jeden chromosom X a jeden Y, takže při dělení buněk ve varlatech a formování spermií jich polovina vzniká chromosomem X, druhá pak s chromosomem Y. Při spojování vajíčka a spermie je tedy šance na vznik zygoty XX (ženské) nebo XY (mužské) rovnocenná. Polygenní dědičnost: V dědičnosti hraje velkou roli náhoda. Nelze např. nijak předpovědět, za bude vajíčka oplodněno spermií obsahující chromosom X, aby se mohl narodit chlapec. Možné je obojí. Je tomu tak proto, že chromosomy jsou do vajíček i spermií,, baleny na principu náhodného výběru. A zdá se, že tento princip platí pro všechny geny. Většinu lidských vlastností a rysů, jako je např. výška, určují skupiny genů působících současně čemuž se říká polygenní dědičnost. Právě proto je ovšem dědičnost v těchto případech velmi komplikovanou a prakticky nepředvídatelnou záležitostí. Výšku pravděpodobně kontrolují dva geny AA a BB. Znamená to, že průměrně velcí rodiče mohou mít dětí s tělesnou výškou i výrazně vzdálenou od průměru, třebaže v téměř padesáti procentech případů jsou průměrné i jejich děti. Ani to však ještě není konec možných variací. Velcí rodiče mají obvykle velké děti, avšak nikoli stejně velké, jako jsou oni sami. Podobně malým rodičům se často narodí děti, které je,,přerostou. O této skutečnosti se hovoří jako o tíhnutí nebo regresí k průměru, a lze ji vysledovat i u mnoha ostatních lidských vlastností včetně inteligence. Třebaže dědičnost je z velké části náhodným procesem, genetici užívají k výzkumu specifických vlastností a v genetickém poradenství zákonitostí statistické pravděpodobnosti. Gen buď odhaluje svou přítomnost, anebo zůstává skryt, v závislosti na tom, zda je dominantní či recesivní a zda se vyskytuje sám nebo v páru. 9

10 Proměnlivé geny: Všechny geny se mohou proměňovat čili prodělávat mutace, a to v důsledku působení různých faktorů prostředí, z nichž se dnes nejvíce hovoří o ionizujícím záření. Většina mutací je škodlivým, a postižené organismy proto obvykle umírají dokonce před narozením. Nicméně existují také určité mutace užitečné, jichž se užívá např. při šlechtění osiva nebo zvířecích chovů, aby se vyprodukovaly specifické druhy. Především však mutace tvoří základní spouštěcí faktor změn i v lidských populacích. U člověka jsou mutace a mutageny mimořádně důležité. Dojde-li k mutacím v pohlavních buňkách, u příslušné osoby se neprojeví vůbec nic může však dojít k dědičnému přenosu poruchy na příští generaci. Tak např. látka známá pod názvem Agent Orange, čili chemický defoliant užitý během války ve Vietnamu, pravděpodobně způsobil poškození pohlavních buněk vojáků i civilistů, kteří mu byli vystaveni. Proto se stále ověřuje podezření, zda se jim v důsledku toho nerodí poškozené děti. Tytéž obavy se objevují ve vztahu k potomků osob vystavených radioaktivnímu spadu po svržení atomových pum na Hirošimu a Nagasaki, nebo vojáků přítomných prvním pokusným nukleárním výbuchům. Závěr: Johann Gregor Mendel mě fascinoval, když se zapsal do Filosofického ústavu v Olomouci. Nejvíc mě překvapilo, že byl přijat do kláštera a tam dostal jméno Gregor. Jak Mendel začínal dělat pokusy s hrachem, tak je hodnotil jako přenos jejich vloh. Proces dědičnosti je řízen z poloviny od matky a druhá polovina je od otce. Já mám spíš všechno o otce. Potomci se podobají svým rodičům. V genech hraje velkou roli náhoda. U nás jsou důležité mutace a mutageny. 10

11 Seznam literatury: 1. Odmaturuj! Z biologie genetika, zpracovaly: Mgr. MUDr. Marie Benešová, Mgr. Hana Hamplová, Mgr. Kateřina Knotová, Ph.D., Mgr. Pavlína Lefnerová, Mgr. Ivana Sáčková, Mgr. Hana Satrapová 2. L.J.Dobroruka, B.Vacková : Přírodopis III pro 8.ročník, Scientia, Praha 2001 Internet: - Johann Gregor Mendel - genetika - DNA - Genetický kód - Přenos genetické informace - Replikace DNA - Translace - RNA - Geny - Genetika buňky - Přenos genetické informace při buněčném dělení - Genetika organismu - Mendelovy zákony - Vazby genů - Mutace - Genetika a lidské zdraví 11

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu


GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem


Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00



GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM



GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


ANOTACE vytvořených/inovovaných materiálů

ANOTACE vytvořených/inovovaných materiálů ANOTACE vytvořených/inovovaných materiálů Číslo projektu Číslo a název šablony klíčové aktivity Tematická oblast Formát Druh učebního materiálu Druh interaktivity CZ.1.07/1.5.00/34.0722 III/2 Inovace a


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků


V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865


Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým


Deriváty karboxylových kyselin, aminokyseliny, estery

Deriváty karboxylových kyselin, aminokyseliny, estery Deriváty karboxylových kyselin, aminokyseliny, estery Zpracovala: Ing. Štěpánka Janstová 29.1.2012 Určeno pro 9. ročník ZŠ V/II,EU-OPVK,42/CH9/Ja Přehled a využití derivátů organických kyselin, jejich



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):


1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická


Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika


Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


VY_32_INOVACE_11.18 1/6 Genetika Genetika

VY_32_INOVACE_11.18 1/6 Genetika Genetika 1/6 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku)

UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) B I O L O G I E 1. Definice a obory biologie. Obecné vlastnosti organismů. Základní klasifikace organismů.


Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Tradice šlechtění šlechtění zlepšování pěstitelsky, technologicky a spotřebitelsky významných vlastností


Genetika člověka - reprodukce

Genetika člověka - reprodukce Gymnázium Václava Hraběte Školní rok 2015/2016 Genetika člověka - reprodukce Seminární práce z biologie autor práce: Andrea Jirásková; 8.A vedoucí práce: RNDr. Roman Slušný Prohlášení Prohlašuji tímto,


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA





Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální


Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti


Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina

Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina Přehled GMH Seminář z biologie GENETIKA Molekulární genetika Základní dogma molekulární biologie Základním nosičem genetické informace je molekula DNA. Tato molekula se může replikovat (kopírovat). Informace


Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho


Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Výukový materiál zpracovaný v rámci projektu Výuka modern

Výukový materiál zpracovaný v rámci projektu Výuka modern St ední pr myslová škola strojnická Olomouc, t. 17. listopadu 49 Výukový materiál zpracovaný v rámci projektu Výuka modern Registrační číslo projektu: CZ.1.07/1.5.00/34.0205 Šablona: III/2 P írodov dné


Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u


12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat


REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce?

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce? REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince Co bylo dřív? Slepice nebo vejce? Rozmnožování Rozmnožování (reprodukce) může být nepohlavní (vegetativní, asexuální) pohlavní (sexuální;


1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


Gymnázium, Brno, Elgartova 3

Gymnázium, Brno, Elgartova 3 Gymnázium, Brno, Elgartova 3 Šablona: III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Název projektu: GE Vyšší kvalita výuky Číslo projektu: CZ.1.07/1.5.00/34.0925 Autor: Mgr. Hana Křivánková Téma:


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi


S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef


Gymnázium Jana Nerudy. Závěrečná práce studentského projektu. Forenzní genetika

Gymnázium Jana Nerudy. Závěrečná práce studentského projektu. Forenzní genetika Gymnázium Jana Nerudy Závěrečná práce studentského projektu Forenzní genetika Rok odevzdání práce: 2015 Braunová Johana Jelínková Kristýna Petrův Alžběta Svobodová Eliška 1/19 Obsah: 1. Genetika obecně...


GENETIKA. zkoumá dědičnost a proměnlivost organismů

GENETIKA. zkoumá dědičnost a proměnlivost organismů GENETIKA zkoumá dědičnost a proměnlivost organismů Dědičnost: schopnost organismů uchovávat informace o své struktuře a funkčních schopnostech a předávat je svým potomkům Proměnlivost (variabilita) je


Škola: Střední škola obchodní, České Budějovice, Husova 9. Inovace a zkvalitnění výuky prostřednictvím ICT

Škola: Střední škola obchodní, České Budějovice, Husova 9. Inovace a zkvalitnění výuky prostřednictvím ICT Škola: Střední škola obchodní, České Budějovice, Husova 9 Projekt MŠMT ČR: EU PENÍZE ŠKOLÁM Číslo projektu: CZ.1.07/1.5.00/34.0536 Název projektu školy: Výuka s ICT na SŠ obchodní České Budějovice Šablona


Molekulární základy dědičnosti. Ústřední dogma molekulární biologie Struktura DNA a RNA

Molekulární základy dědičnosti. Ústřední dogma molekulární biologie Struktura DNA a RNA Molekulární základy dědičnosti Ústřední dogma molekulární biologie Struktura DNA a RNA Ústřední dogma molekulární genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace DNA RNA


Velká rodina života. mlha se zvedá

Velká rodina života. mlha se zvedá Úvod Jen málo národů a lidských pospolitostí na Zemi nemá svůj mýtus o stvoření. Američtí Irokézové věřili, že svět a všechno v něm stvořili nebeští lidé, podle starověkých Japonců byl svět výtvorem bohů,


Zvyšování kvality výuky technických oborů

Zvyšování kvality výuky technických oborů Zvyšování kvality výuky technických oborů Klíčová aktivita V.2 Inovace a zkvalitnění výuky směřující k rozvoji odborných kompetencí žáků středních škol Téma V.2.18 Dřeviny Kapitola 2 Rozmnožování rostlin


orientuje se v přehledu vývoje organismů a rozliší základní projevy a podmínky života

orientuje se v přehledu vývoje organismů a rozliší základní projevy a podmínky života Přírodopis ZŠ Heřmánek vnímá ztrátu zájmu o přírodopis na úkor pragmatického rozhodování o budoucí profesi. Náš názor je, že přírodopis je nedílnou součástí všeobecného vzdělání, především protože vytváří



ŠKOLNÍ VZDĚLÁVACÍ PROGRAM Vyučovací předmět : Období ročník : Učební texty : Přírodopis 3. období 9. ročník Danuše Kvasničková, Ekologický přírodopis pro 9. ročník ZŠ a nižší ročníky víceletých gymnázií, nakl. Fortuna Praha 1998


Obecná biologie a genetika B53 volitelný předmět pro 4. ročník

Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Charakteristika vyučovacího předmětu Vyučovací předmět vychází ze vzdělávací oblasti Člověk a příroda, vzdělávacího oboru Biologie. Mezipředmětové


6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649



TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tématická Odborná biologie, část biologie Společná pro


Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě Otázka: Genetika I Předmět: Biologie Přidal(a): Paris -věda, která se zabývá dědičností a proměnlivostí -zakladatelem je Johan Gregor Mendel (1822 1884), který se narodil v Hynčicích na Moravě 1. MOLEKULÁRNÍ


PARLAMENT ČESKÉ REPUBLIKY Poslanecká sněmovna 2008 V. volební období. Vládní návrh. na vydání. zákona zákona o specifických zdravotních službách

PARLAMENT ČESKÉ REPUBLIKY Poslanecká sněmovna 2008 V. volební období. Vládní návrh. na vydání. zákona zákona o specifických zdravotních službách PARLAMENT ČESKÉ REPUBLIKY Poslanecká sněmovna 2008 V. volební období 689 Vládní návrh na vydání zákona zákona o specifických zdravotních službách - 2 - ZÁKON ze dne 2009 o specifických zdravotních službách


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 I n v e s t i c e d o r o z v o j e v z d ě l á v á n í Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


1. Úvod do genetických algoritmů (GA)

1. Úvod do genetických algoritmů (GA) Obsah 1. Úvod do genetických algoritmů (GA)... 2 1.1 Základní informace... 2 1.2 Výstupy z učení... 2 1.3 Základní pomy genetických algoritmů... 2 1.3.1 Úvod... 2 1.3.2 Základní pomy... 2 1.3.3 Operátor


Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je


Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


1) Je vydána na základě a v mezích zákona, do něhož již byly příslušné směrnice Evropských společenství promítnuty.

1) Je vydána na základě a v mezích zákona, do něhož již byly příslušné směrnice Evropských společenství promítnuty. 448/2006 Sb. VYHLÁŠKA Ministerstva zemědělství ze dne 1. září 2006 o provedení některých ustanovení plemenářského zákona ve znění vyhlášky č. 57/2011 Sb. Ministerstvo zemědělství stanoví podle 33 zákona



PRAKTIKUM Z OBECNÉ GENETIKY RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie lizal@sci.muni.cz 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin


Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.


VODA S ENERGIÍ Univerzita odhalila tajemství vody Objev hexagonální vody

VODA S ENERGIÍ Univerzita odhalila tajemství vody Objev hexagonální vody VODA S ENERGIÍ Univerzita odhalila tajemství vody Objev hexagonální vody Čtvrté skupenství vody: Hexagonální voda: Na univerzitě ve Washingtonu bylo objeveno čtvrté skupenství vody, což může vysvětlit


Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace


BAKTERIÁLNÍ GENETIKA. Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc.

BAKTERIÁLNÍ GENETIKA. Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. BAKTERIÁLNÍ GENETIKA Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. -dědičnost u baktérií principiálně stejná jako u komplexnějších organismů -genom haploidní a značně menší Bakteriální genom


Projekt Genetika a příjmení a zapojení Klusáčků do něj

Projekt Genetika a příjmení a zapojení Klusáčků do něj Projekt Genetika a příjmení a zapojení Klusáčků do něj Písemnosti odeslané jmenovcům ze dne 10. září 2008: Vážený pane Klusáčku obracíme se na Vás touto cestou s nabídkou účasti v unikátním vědeckém projektu


Molekulární genetika: Základní stavební jednotkou nukleových kyselin jsou nukleotidy, které jsou tvořeny

Molekulární genetika: Základní stavební jednotkou nukleových kyselin jsou nukleotidy, které jsou tvořeny Otázka: Molekulární genetika, genetika buněk Předmět: Biologie Přidal(a): jeti52 Molekulární genetika: Do roku 1953 nebylo přesně známa podstata genetické informace, genů, dědičnosti,.. V roce 1953 Watson


Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny



PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ 10 SEZNAM PŘÍLOH PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ PŘÍLOHA č. 2 MAPY Mapa 1 Lokalizace zájmového území (zdroj: Mapy.cz) Mapa 2 Místa odlovených nebo uhynulých kusů (zdroj:


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI


Schéma průběhu transkripce

Schéma průběhu transkripce Molekulární základy genetiky PROTEOSYNTÉZA A GENETICKÝ KÓD Proteosyntéza je složitý proces tvorby bílkovin, který zahrnuje proces přepisu genetické informace z DNA do kratšího zápisu v informační mrna


13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu


Populační genetika II

Populační genetika II Populační genetika II 4. Mechanismy měnící frekvence alel v populaci Genetický draft (genetické svezení se) Genetický draft = zvýšení frekvence alely díky genetické vazbě s výhodnou mutací. Selekční vymetení


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela


Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací Genetika Nauka o dědid dičnosti a proměnlivosti Genetika molekulárn rní buněk organismů populací Dědičnost na úrovni nukleových kyselin Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci


- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil


Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Dle čl. 7 odst. 2 Směrnice děkana pro realizaci bakalářských



ZÁPISNÍ ŘÁD KLUBU PŘÁTEL PSŮ PRAŽSKÝCH KRYSAŘÍKŮ, Z. S. ZÁPISNÍ ŘÁD KLUBU PŘÁTEL PSŮ PRAŽSKÝCH KRYSAŘÍKŮ, Z. S. PREAMBULE 1. Cílem spolku s názvem Klub přátel psů pražských krysaříků (dále jen KPPPK) je chov čistokrevného plemene psů PRAŽSKÝ KRYSAŘÍK s průkazem


Vznik a vývoj života na Zemi

Vznik a vývoj života na Zemi Vznik a vývoj života na Zemi Vznik a vývoj života na Zemi VY_32_INOVACE_02_03_01 Vytvořeno 11/2012 Tento materiál je určen k doplnění výuky předmětu. Zaměřuje se na vznik života na Zemi. Cílem je uvědomit
