Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:




2 Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp Genetická výbava jedince, soubor všech alel jedince

3 Znak Z genetického hlediska každá definovatelná vlastnost organismu (např. krevní skupina, barva očí, výška, hmotnost atp.) Fenotyp Soubor všech znaků jedince; v užším smyslu - konkrétní forma znaku Určován genotypem a může být modifikován vnějším prostředím

4 Penetrance Pravděpodobnost, s jakou se varianta genu projeví ve fenotypu Expresivita Míra s jakou se určitý genotyp projevuje ve fenotypu (tentýž genotyp se u různých jedinců žijících v různých prostředích může do fenotypu promítnout různě silně)

5 ZÁKLADNÍ POJMY POČET CHROMOSOMŮ Somatické buňky - diploidní 2n dvě sady chromosomů maternální / paternální původ autosomy, heterochromosomy člověk 46 chromosomů: 46,XX nebo 46,XY Pohlavní buňky (gamety) - haploidní n obsahují jednu sadu chromosomů, náhodná segregace chromosomů (genů) do gamet

6 Monogenní dědičnost Znak je určován jedním genem (párem alel) Dědičnost odpovídá Mendelovým zákonům Vnější prostředí - jen malý nebo žádný vliv na expresi monogenně podmíněných znaků

7 Multifaktoriální dědičnost (polygenní dědičnost) Dědičnost je kontrolována mnoha geny Na expresi znaku se podílí jak genetická predisposice, tak faktory vnějšího prostředí Fenotypové projevy mají kontinuální charakter

8 Mendelovy pokusy 1865


10 Mendelovy závěry Každý znak je kontrolován dvěma faktory Faktory pro odlišné znaky se dědí nezávisle Faktory se nemísí, jsou buď dominantní nebo recesivní Distribuce faktorů v samčí a samičí pohlavní buňce se řídí základními statistickými zákony Výsledky křížení jsou stejné, když dominantní charakter náleží samčímu pohlaví a recesivní samičímu a naopak

11 Dominantní alela A Recesivní alela a Homozygot AA nebo aa Heterozygot Aa

12 Mendelovy zákony platí pro dědičnost monogenně podmíněných znaků

13 1. MENDELŮV ZÁKON Uniformita F1 generace Parentální generace (P) čisté linie První filiální generace (F1) uniformní Druhá filiální generace (F2) fenotyp 3 : 1 genotyp poměr 1 : 2 : 1 A a A a AA Aa Aa aa

14 Dihybridismus Parentální generace (genotyp) AB x aabb Gamety ab AAbb x aabb Ab ab F1 generace (genotyp) Gamety Fenotyp i genotyp uniformní AaBb, Ab, ab, ab F2 generace Fenotypový štěpný poměr 9 : 3 : 3 : 1 gamety Ab ab ab AB Ab AaBB AaBb Ab Ab AAbb AaBb Aabb ab AaBB AaBb aabb aabb ab AaBb Aabb aabb aabb

15 2. MENDELŮV ZÁKON Náhodná segregace genů do gamet Diploidní buňka (2n) Haploidní gamety (1n)

16 3. MENDELŮV ZÁKON Zpětné křížení ( F1 x recesivní homozygot parentální generace) fenotypový štěpný poměr 1:1 F1 Aa x aa P a a A Aa Aa Aa : aa gamety A a a a a aa aa 1 : 1

17 Zpětné křížení - křížení heterozygota s homozygotem Testovací zpětné křížení (backcross Bc) je křížení heterozygota s recesivním homozygotem.

18 Napište fenotypové a genotypové štěpné poměry - dihybridismus při úplné dominanci Typ křížení AB x aabb AaBb x AaBb AB x AaBb Fenotypové štěpné poměry uniformní Genotypové štěpné poměry uniformní 9:3:3:1 9 různých genotypů aabb x AaBb

19 Genotypový štěpný poměr křížení AaBb x AaBb gamety Ab ab ab AB Ab AaBB AaBb Ab Ab AAbb AaBb Aabb ab AaBB AaBb aabb aabb ab AaBb Aabb aabb aabb AB Ab AAbb AaBB AaBb Aabb aabb aabb aabb 1 : 2 : 1 : 2 : 4 : 2 : 1 : 2 : 1

20 Napište fenotypové a genotypové štěpné poměry - dihybridismus při úplné dominanci Typ křížení AB x aabb AaBb x AaBb AB x AaBb aabb x AaBb Fenotypové štěpné poměry uniformní Genotypové štěpné poměry uniformní 9:3:3:1 9 různých genotypů uniformní 1:1:1:1 1:1:1:1 1:1:1:1

21 VZTAHY MEZI ALELAMI Alely téhož genu mohou mít vůči sobě vztah: a) úplné dominance a recesivity - fenotyp jedince určuje dominantní alela již v jedné dávce. Fenotyp odpovídající recesivní alele - recesivní homozygoti U mužů u genů lokalizovaných na heterochromosomu X hemizygotní stav (pseudodominance) b) neúplné dominance - fenotyp heterozygota není shodný s fenotypem homozygotů c) kodominance - genový produkt obou alel se rovnocenně projeví ve fenotypu (např. krevní skupiny nebo MN, alely HLA komplexu)

22 Vztahy mezi alelami A A Aa aa úplná dominance neúplná dominance kodominance

23 Krevně skupinové antigeny: O systém alely A, B, 0 - mnohotná alelie Alelní vztahy: A k B kodominance A k 0 a B k 0 - dominance 0 - recesivní Krevní skupiny (fenotyp): A B 0 Genotypy: AA, A0; BB, B0; ; 00


25 DĚDIČNOST KREVNĚ SKUPINOVÝCH SYSTÉMŮ MN systém Vztah alel M a N kodominance Krevní skupiny (fenotyp): M MN N Genotypy: MM MN NN Rh systém Alela D dominantní, d recesivní Krevní skupiny (fenotyp): Rh+ Rh- Genotypy: DD, Dd; dd

26 O systém - příklady matka dítě možný otec vyloučený muž O O O O A B O A, B, O,A,B matka vyloučena O,B O,A -- A A A A A B O B B B B A B O A B O

27 O - výsledek matka dítě možný otec vyloučený muž O O O O A B O A, B, O,A,B matka vyloučena O,B O,A -- A A A A A B O A,B,,O B, A,B,O B, -- A,O O,A B B B B A B O A, A,B,,O A,B,O A, O,B -- B,O A B O A,B,,O A,B,,O matka vyloučena A,B, O

28 Příklad: Rh systém Matka má krevní skupinu RH+, otec RH- Zapište genotypy rodičů! Jakou krevní skupinu může mít jejich dítě? otec Rh-: genotyp dd, matka Rh+: DD nebo Dd Dítě: Rh+ (matka DD nebo Dd) Rh- (matka Dd)

29 Příklad: Barva očí Zjednodušený model dědičnosti barvy očí zahrnuje jeden gen s dvěma alelami řídícími se Mendelovými zákony. Hnědá barva je dominantní nad modrou. Hnědooký muž, jehož otec má modré oči, se oženil s modrookou ženou. Jaká je pravděpodobnost, že jejich dítě bude mít hnědé oči?

30 Barva očí muž Hh žena hh Gamety H h h h h h H Hh Hh h hh hh Pravděpodobnost, že dítě bude mít hnědé oči je ½.

31 Rříklad: Hledík Antirrhinum majus Křížením červenokvětých rostlin hledíku s bělokvětými získáme F1 generaci s růžovou barvou květu. P: AA aa F1: Aa Jaký je vztah mezi alelami A a a? Jaký bude fenotypový štěpný poměr v F2 generaci?

32 V lidské populaci se vyskytuje znak, kterým je schopnost srolování jazyka do tzv. korýtka. Tento znak je podmíněn dominantní alelou (označme jako B), naopak jedinci bb tuto schopnost nemají. Vyzkoušejte sami na sobě. Zjistěte co nejvíce o dědičnosti tohoto znaku v následujících rodinách. RNDr. Pavel Lízal, Ph.D. Ústav experimentální biologie, Přírodovědecká fakulta MU

33 Děti muže, který umí dát jazyk do korýtka a ženy, která tuto schopnost nemá, jsou všechny schopny jazyk srolovat. Jaké jsou genotypy všech členů rodiny? P: BB x bb F 1 : Bb

34 Muž se schopností srolovat svůj jazyk do korýtka, jehož oba rodiče to umějí také, se oženil s ženou, která také umí jazyk srolovat, avšak tuto schopnost má pouze její otec, matka to nedokáže. Měli jedno dítě, které neumí dát jazyk do korýtka. Jaké byly nejpravděpodobnější genotypy všech těchto jedinců? B- B- B- bb P: Bb x Bb F 1 : bb

35 Jaká je pravděpodobnost, že první dítě dvou heterozygotních rodičů se schopností srolování jazyka toto nebude umět? Umí-li první dítě dát jazyk do korýtka, jaká bude pravděpodobnost, že druhé dítě to nebude umět?

36 ODCHYLKY OD MENDELOVÝCH ZÁKONŮ Mitochondriální dědičnost matroklinní Vazba genů Genomický imprinting - ovlivnění transkripce - DNA methylace - modifikace DNA, která je děděna dceřinými buňkami bez změny sekvence DNA. Počet a uspořádání methylovaných cytosinů ovlivňuje funkci genů; nízká methylace vede k vysoké aktivitě a naopak. Enzymy skupiny DNAmethyltransferas udržují po replikace DNA identický typ methylace jaký byl před replikací. Zárodečný mosaicismus

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace Pojmy k zpmtování Gen -část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN Gen je různě dlouhá sekvence nukleotidů Gen je jednotk funkce


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 Mutace Mutace - náhodná změna v genomu organismu - spontánní


12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA


Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto


genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci


GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních


- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem


Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické


Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou


Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je


Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho


V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865


Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák MENDELISMUS Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák 1822-1884 In the ten years G. Mendel worked on his plants in the garden of the monastery, he made the greatest discovery in biology that


Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského


Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje


Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u


Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus


EPIGENETIKA reverzibilních změn funkce genů, Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická

EPIGENETIKA reverzibilních změn funkce genů, Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická EPIGENETIKA Epigenetika se zabývá studiem reverzibilních změn funkce genů, aniž by při tom došlo ke změnám v sekvenci jaderné DNA. Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická


DĚDIČNOST Monogenní dědičnost Multifaktoriální dědičnost Expresivita Penetrance Gen (strukturní gen

DĚDIČNOST Monogenní dědičnost Multifaktoriální dědičnost Expresivita Penetrance Gen (strukturní gen DĚDIČNOST Předtím než se začneme věnovat jednotlivým typům genetické determinace a přenosu genetické informace z rodičovské generace na potomky, objasníme si některé termíny. Monogenní dědičnost znamená


Stavba chromozomů Lidský karyotyp

Stavba chromozomů Lidský karyotyp Přípravný kurz z biologie 5 Stavba chromozomů Lidský karyotyp 3. 12. 2011 Mgr. Kateřina Caltová Stavba chromozomů Lidský karyotyp Chromozom buněčná struktura v jádře eukaryotních buněk řec. chroma = barva,


Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový


Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010


-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě Otázka: Genetika I Předmět: Biologie Přidal(a): Paris -věda, která se zabývá dědičností a proměnlivostí -zakladatelem je Johan Gregor Mendel (1822 1884), který se narodil v Hynčicích na Moravě 1. MOLEKULÁRNÍ


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém



GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou


Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským


1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická


Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by - Ned?le, B?ezen 01, 2015 Otázka: Genetika I P?edm?t: Biologie P?idal(a):


VY_32_INOVACE_11.18 1/6 Genetika Genetika

VY_32_INOVACE_11.18 1/6 Genetika Genetika 1/6 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost


13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Druhová a mezidruhová hybridizace

Druhová a mezidruhová hybridizace Druhová a mezidruhová hybridizace Obsah Druhová a mezidruhová hybridizace... 1 Obsah... 1 Monohybridní křížení... 1 Dihybridní křížení... 2 Polyhybridní křížení... 3 Souhrn Mendelismus v dědičnosti kvalitativních


Pojem plemeno je používán pro rasy, které vznikly záměrnou činností člověka, např. plemena hospodářských zvířat.

Pojem plemeno je používán pro rasy, které vznikly záměrnou činností člověka, např. plemena hospodářských zvířat. POPULAČNÍ GENETIKA Populační genetika se zabývá genetickými zákonitostmi v definovaných souborech jedinců téhož druhu. Genetické vztahy uvnitř populace jsou komplikované, a proto se v populační genetice


Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že


=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům

=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům Otázka: Genetika Předmět: Biologie Přidal(a): t.klodnerova REALIZACE GENETICKÉ INFORMACE, MUTACE, ZÁKLADNÍ GENETICKÉ POJMY: GEN, ZNAK, ALELA, GENOTYP, FENOTYP, HOMOZYGOT, HETEROZYGOT, HYBRIDIZACE, DOMINANCE,


Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením


Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto


Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika


Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním


Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií

Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Obecná genetika Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Ing. Roman Longauer, CSc. Ústav zakládání a pěstění lesů, LDF MENDELU Brno Tento projekt je spolufinancován Evropským


"Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT ". Základy Genetiky

Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT . Základy Genetiky "Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT ". Základy Genetiky ROSTLINNÁ BUŇKA aaaaaaaa jádro mitochondrie chromatin (DNA) aaaaaaaa aaaaaaa aaaaaaaa aaaaaaaa plastid



MENDELOVSKÁ DĚDIČNOST MENDELVSKÁ DĚDIČNST Mendelovská dědičnost - pojmy k zpmtování Gen část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN různě dlouhá sekvence


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI


Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální


ANOTACE vytvořených/inovovaných materiálů

ANOTACE vytvořených/inovovaných materiálů ANOTACE vytvořených/inovovaných materiálů Číslo projektu Číslo a název šablony klíčové aktivity Tematická oblast Formát Druh učebního materiálu Druh interaktivity CZ.1.07/1.5.00/34.0722 III/2 Inovace a



GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky



BIOLOGIE A GENETIKA VYPRACOVANÉ OTÁZKY KE ZKOUŠCE NA 1. LF UK 2015/2016 BIOLOGIE A GENETIKA VYPRACOVANÉ OTÁZKY KE ZKOUŠCE NA 1. LF UK 2015/2016 1 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba


Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů

Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů Imunogenetika Vědní odvětví zabývající se imunitním systémem obratlovců, který je výrazně odlišuje od nižších organizmů se nazývá imunologie. Její náplní je zejména studium imunity mechanizmů stálosti


GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D.

GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D. GENETIKA Mendelistická dědičnost 2014 Doc. MVDr. Eva Bártová, Ph.D. Nauka o DĚDIČNOSTI (HEREDITA) a PROMĚNLIVOSTI (VARIABILITA) termín genetika poprvé použil v r. 1905 W. BATESON název genetika odvozen


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)


Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). Orphanet - Volně přístupné webové stránky s informacemi


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání


Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21

Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21 Glosář - Cestina alely aneuploidie asistovaná reprodukce autozomálně dominantní autozomálně recesivní BRCA chromozom chromozomová aberace cytogenetický laborant de novo Různé formy genu, které se nacházejí


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


Využití algebraických hyperstruktur při určování dědičnosti krevních skupin

Využití algebraických hyperstruktur při určování dědičnosti krevních skupin PWSZ Nowy SĄcz Zeszyty Naukowe PWSZ NS, Nowy SĄcz 2013 Využití algebraických hyperstruktur při určování dědičnosti krevních skupin Eva Bártková 1, David Nocar 2, Květoslav Bártek 3 1 Katedra matematiky


Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti



PRAKTIKUM Z OBECNÉ GENETIKY RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin


Buňky, tkáně, orgány, soustavy

Buňky, tkáně, orgány, soustavy Lidská buňka buněčné organely a struktury: Jádro Endoplazmatické retikulum Goldiho aparát Mitochondrie Lysozomy Centrioly Cytoskelet Cytoplazma Cytoplazmatická membrána Buněčné jádro Jadérko Karyoplazma


GENETIKA. zkoumá dědičnost a proměnlivost organismů

GENETIKA. zkoumá dědičnost a proměnlivost organismů GENETIKA zkoumá dědičnost a proměnlivost organismů Dědičnost: schopnost organismů uchovávat informace o své struktuře a funkčních schopnostech a předávat je svým potomkům Proměnlivost (variabilita) je


Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací Genetika Nauka o dědid dičnosti a proměnlivosti Genetika molekulárn rní buněk organismů populací Dědičnost na úrovni nukleových kyselin Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci


Genetická determinace zbarvení vlasů u člověka. Genetická determinace zbarvení očí u člověka

Genetická determinace zbarvení vlasů u člověka. Genetická determinace zbarvení očí u člověka Genetická determinace zbarvení vlasů u člověka Genetická determinace zbarvení očí u člověka znaky polygenní, které však při studiu dědičnosti v rodinách vykazují zdánlivě jednoduchou dědičnost výzkumem


RURGenetika zápočtový program Programování II

RURGenetika zápočtový program Programování II RURGenetika zápočtový program Programování II Rudolf Rosa cvičící: Doc. RNDr. Pavel Töpfer, CSc. Obsah Specifikace...1 Původní specifikace...1 Upravená specifikace...2 Program...3 třída Populace...4 Datové


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Petr Lesný 1, Pavel Seeman 2, Daniel Groh 1 1 ORL klinika UK 2. LF a FN Motol Subkatedra dětské ORL IPVZ Přednosta doc. MUDr. Zdeněk Kabelka


Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00



TYPY DĚDIČNOSTI GONOSOMÁLNÍ DĚDIČNOST TYPY DĚDIČNOSTI GONOSOMÁLNÍ DĚDIČNOST DĚDIČNOST POHLAVNĚ VÁZANÁ geny lokalizované na pohlavních chromozomech X nebo Y řídí vznik nejen primárních pohlavních znaků přenos genů na potomky je vázán na přenos


QTL u koní. Kmen je skupina koní v rámci plemene, odlišných morfologických a užitkových vlastností (šlechtění na tažné a jezdecké využití).

QTL u koní. Kmen je skupina koní v rámci plemene, odlišných morfologických a užitkových vlastností (šlechtění na tažné a jezdecké využití). QTL u koní Dnešní plemena koní se odvozují od divokých předků, od: Equus przewalskii (kůň Převalského-kertaka) Equus gmelini (kůň západní) Equus gracilis (kůň severský) Pojmy plemenitby Plemeno je skupina
